agg Player: SunshineJesse Game: DCSS trunk Server: crawl.dcss.io Filename: 2024-12-22.00:47:54.ttyrec Time: (1734828474) Sun Dec 22 00:47:54 2024 agg- [?1051l[?1052l[?1060l[?1061hagg. V)0[?7h[?25l[?1cagg4 agg6 agg? Welcome, SunshineJesse. Please select your species. SimpleIntermediateAdvanced a - Mountain Dwarfj - Humans - Coglin b - Minotaurk - Koboldt - Vine Stalker c - Merfolkl - Demonspawnu - Vampire d - Gargoylem - Djinniv - Demigod e - Draconiann - Sprigganw - Formicid f - Trollo - Ghoulx - Naga g - Deep Elfp - Tengu y - Octopode h - Armataurq - Oniz - Felid i - Gnollr - BarachiA - Mummy Tengu are bird-people who love to fight, both with weapons and spells. They are fragile but agile, and eventually learn to fly. + - Recommended species * - Random species # - Recommended character ! - Random character % - List aptitudesSpace - Pick background first ? - Help Tab - Tengu Conjureraggagg]agg.#Welcome, SunshineJesse the Coglin. Please select your background. WarriorAdventurerMage a - Fighteri - Artificerq - Hedge Wizard b - Gladiatorj - Shapeshifteraggu#7r - Conjurer c - Monkk - Wanderers - Summoner d - Hunterl - Delvert - Necromancer e - BrigandWarrior-mageu - Forgewright Zealotagg#m - Warperv - Fire Elementalist f - Berserkern - Hexslingeragg#Iw - Ice Elementalist g - Cinder Acolyteo - Enchanteragg#x - Air Elementalist h - Chaos Knightp - Reavery - Earth Elementalistz - Alchemist agg$Conjurers confront problems with damaging spells. + - Recommended background * - Random background # - Recommended characteragg$8 ! - Random character % - List aptitudesagg6$XSpace - Change species ? - Help Tab - Tengu Conjureraggagg:agg(JSunshineJesse the ShooterCoglinHealth: 16/16 ========================Magic: 1/1========================AC: 3Str: 11EV: 11Int: 8SH: 0Dex: 17XL:  1 Next:  0% Place: Dungeon:1Noise: ---------  Time: 0.0 (0.0)a) +2 sling {Septima d) +0 sling {Arun} aggJbFire: a) +2 sling {Septima} aggQ#. ..#. .###.. ..#... ..####.##.##......##......##...@##......##.!....##.#.#####...#..##aggYaggB\Welcome, SunshineJesse the Coglin Hunter.It is said that the Orb of Zot exists deep within this dungeon.agg`aggPress ? for a list of commands and other information.  Found an emerald potion.aggtaggˮ[ _Found a staircase leading out of the dungeon.aggagg% agg, Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting2.0   3.0   0   g - Spellcasting   0.0   1.4  -2      aggg8     b - Unarmed Combat   0.0   1.2  -1  agg        aggS    agg7c + Ranged Weapons 3.6   4.8  -1      agg         d - Armour   0.0   1.2  -1  agg,{    e + DodgingaggJ*1.7   2.4  -1      f + Stealthagg0.7   1.2  -1              agg        agg        agg:        aggh        agg            agg            aggThe relative cost of raising each skill is in cyan.  The species aptitude is in white.  [?] Helpagg?G[=] set a skill target  aggh[/] auto|manual mode [*] useful|all skills [!] training|cost|targetsagg| c * Ranged Weapons   3.6aggŦ TargetTarget--  --  --  --  --  --  --  a-z] set[-] clear selected targetcost|targetsagg.<[?25h[?0c0 agg" agg [?25l[?1cagg#716.0  -1  current training targets, if any.=] set aall targetsagg/ f * Stealth   0.7agg p f - Stealth   0.7agg}aggaggUSunshineJesse the Shooter#. ..Coglin#. .##Health: 16/16 ========================#.. ..#Magic: 1/1========================... ..#AC: 3agg.Str: 11###.##.#EV: 11Int: 8#......#SH: 0Dex: 17#......#XL:  1 Next:  0% Place: Dungeon:1#...@#Noise: ---------  Time: 0.0 (0.0)#......#a) +2 sling {Septima d) +0 sling {Arun} #.!....#Fire: a) +2 sling {Septima} #.#.#####...#..agg##Welcome, SunshineJesse the Coglin Hunter.It is said that the Orb of Zot exists deep within this dungeon.Press ? for a list of commands and other information.  Found an emerald potion. _Found a staircase leading out of the dungeon.aggaggaggȘaggagg8u _aggBagg$#.#. .## #......# ......# ###.##.# #......# #......# ###...<# #......# #.@....# #.#.#### #..... #....?.# ##..##.# .... .# #.... #agg-M##..#agg+4.0 (4agg+5.0 (5aggFaggM _e - an emerald potionagg agg+ agg agg5 aggV agg agg ,agg ,aggV nagg ###.##.# #......# #......# ###...<# #......# #......# #.#.#### #......# agg `#....@.# ##..##.# #.... .# #.... .###..# ##....agg! 8###. agg- +8.0 (3agg +9.0 (4agg agg b _f - a scroll labelled UCOCURHIDDIMagg agg^ agg agg aggv aggr agg aggC aggo agg agg aggG BaggO agg ,aggs agg agg? aggk agg; agg agg aggI agg agg agg agg aggbaggDnagg Xagg[Baggagg=agggagg.aggagg#......# #......# agg%##..##.# ##......# ).#......# ...aggG##..#### ....#......# .....###..####......aggji#......@.......21.0 (12.0)aggt#..............##.............#............##.........##..#.........# .#...aggn........#.........##agg(B2.0 (13agg+agg-% _Found a dagger.aggagg$aggyaggoaggxaggX,agg'aggagg,aggaggaggv,aggaggagg,aggnaggagg=aggfaggagg& agg( aggM agg aggiagg,agg!aggagg ,aggaggaggagg/aggaggagg#aggKaggagg+ agg!agg"agg$"agg#agg$,agg%agg(agg)agg;)agg)agg*agg,agg4,agg,aggJ.agg/,agg0agg2agg4agg4aggc5agg6agg8,aggU9agg:aggK=,agg>agg?aggcAaggAagg\BaggaDagg-F,aggHaggMaggX....# ....# .. .#### ### #.. ....##......# #.. ....##..###..##.# .##.##.....#..... ....##....)..#..###### ....##............ .#####.......##.@...# ....##...........##K.# ..####.......##.## .# .............##.# .............##.#####.. ............###........ K   kobold (asleep) ...........###...#####. ........##..#...##.. ........###..agg}Y*[40m........agge-42.0 (20aggye,3.0 (21agglaggpz _A kobold comes into view. It is wielding a +0 short sword.aggפ4aggagg%] _A kobold is nearby!agg| ((K  You shoot a sling bullet.agg- ((The sling bullet hits the kobold but does no damage.  You shoot a sling bullet.agg agg agg~ '.Kagg ..agg9 agg ===agg 4.3 (1.3agg, )aggj Rev agg agg agg  agg agg <_The sling bullet barely misses the kobold.agg agg" y (You shoot a sling bullet.agg֪ ((The sling bullet hits the kobold but does no damage.  You shoot a sling bullet.agg,agg8K..5.6Rev+ aggN:agg=  You shoot a sling bullet. _The sling bullet barely misses the kobold.  You shoot a sling bullet.  The sling bullet hits the kobold but does no damage.  You shoot a sling bulletaggC=\. _The sling bullet barely misses the kobold.aggo{ (((You shoot a sling bullet.agg}  The sling bullet closely misses the kobold.You shoot a sling bullet.agg\ K..  The sling bullet hits the kobold but does no damage.2------6.9Rev* aggagg@ _The kobold hits you with a +0 short sword.aggCn`  You shoot a sling bullet. The sling bullet hits the kobold!agg{sC)agg (((You kill the kobold!aggQ)..------18.3 (1.4agg+agg/ _You shoot a sling bullet.aggagg[aggaggH _No target in view!agg  _agg 3=Rev+ agg agg ,agga aggF aggo aggv aggd agg :=agg agg agg f4==Rev agg agg agg agg? Xagg ,agg agg aggj r5===aggD agg agg agg agg agg agg agg agg agg4 aggx agg 9=agg| aggo agg L6==agg agg 1 _HP restored.aggm 3agg" aggk$ aggL& agg& agg}' agg0) agg+ ,agg- agg0 aggj: #.##.#.# .#....# .# #...<# .# #.# ##$###>....# ...... #.#### #### #...# .##......# #...# ....##..###..##@########---67.3 (19.0)##.##.....#...........#...##....)..#..######...##..................agg: k#####.......##..)..#####...........##..# #..####.......##.## ..#......##.# .#......##.#####..aggB aggdB e==---8.3 (20aggEH aggJ ; _Found a stone staircase leading down.agg@3aggagg agg!agg%Bagg*(,agg(aggj*agg-,aggq.agg0agg70 ..  .## ...J.# ... ....# ... ##.# ... # #.# ....# #.# agg7i<# #.# #### #####>... ..# ............# #### #######...#....# ##......# #...# ##....##..###..##.##### .##.##.....#...........#J   endoplasm (asleep) ....##....)..#..######..agg8##.................. .#######..)..###aggC271.3 (3.0)aggD+2.3 (4aggJaggS _An endoplasm comes into view. _You see here 8 gold pieces.agg  .. .## ...J. ... ... ... #.# #.#<# #.# ### aggĭ7 #@###>...  ............#  #######...#....#  #...# ##.. #.######## .. )..#.. ... )..### aggE .. .## ...J. ... ... ... #.# #.#<# #.# ###  #@###>... aggF ............#  #######...#....#  #...# ##..#.###.. )..#.....)aggNaggNOaggjUaggbYa _An endoplasm is nearby!aggSI .. .## ...J. ... ... ... #.# #.#<# #.# ###  #@###>...  ............# aggS #######...#....#  #...# ##.. #.######## .. )..#.. ... )..### agg .. .## ...J. ... ... ... #.# #.#<# #.# ###  #@###>...  ............#  #######...#....#  #...# ##..aggT#.###.. )..#.....)agg4aggLagga _An endoplasm is nearby!agg b (((((agg` (J    You shoot a sling bullet. The sling bullet hits the endoplasm.  The endoplasm quivers.agg  The endoplasm is severely wounded.You shoot a sling bullet. The sling bullet hits the endoplasm.agg2 C.agg& K.......aggr* k3===3.5 (1.2Rev agg/ agg2 M _You kill the endoplasm!aggr aggs agg3y aggy{ H _No target in view!agg4aggEaggaggaggagg@ _You now have 8 gold pieces.aggs##..... ...# . # ... ##.# ... ..# #.# # agg#.# <# #.# ###.# #######.###>....# ........@...# --- #### #######...#....#agg ..##......# #...# ##..b##..###..##.######### agg+##.##.....#...........#..##....)..#..######.. b   bat (asleep)##.................. #####.......##..)..###..##....##..agg"#agg,40aggaggagg @b...baggG---5.5 (2aggaggV _A bat comes into view.agg3 G .## ..... ... ... ... #.# #.#<# #.# ###.  #######.###>....  ........@...#  #######...#..b.#  #...# ##... #.######### .. )..#.. .. .##..)..###  aggw .## ..... ... ... ... #.# #.#<# #.# ###.  #######.###>....  ........@...#  #######...#..b.#  #...# ##... #.######### ..)..#.. ...##..)agg4agg4aggcZ _A bat is nearby!aggM(((((((agg~K  You shoot a sling bullet. The sling bullet barely misses the bat.You shoot a sling bullet. The sling bullet hits the bat.agg~P )agg 6.......agg ?4===6.7 (1.2agg aggP G _You kill the bat!aggca aggb aggr ^ _No target in view!aggQaggRaggSaggWaggYagg\; _agg+]aggS_agg_aggP`agg'baggcaggdagg eaggcfagg8hagghagghagg/mR  There is a stone staircase leading down here.aggnaggo _aggpaggqaggsaggSsaggsagg7vagg|  ..... ... ... .. ... .. ... .agg[}a #.# r# #.# #.#  #.# #####..#  #######.###>..@.# ---  ............#####  #######...#....# ..# #...####..... .###..##.###########agg}Z.#...........# r   rat (asleep))..#..######.. ..............##..)..###agg.82.7 (6.0agg#---aggޅ$3.7 (7aggaggҏV _A rat comes into view.agg=1M ..... ...  agg2... ..  ... ..  ... .  #.# r#  #.# #.#  #.# #####..#  #>..@.#  .....#####  ..#....#   agg2T))..###agg%= ..... ...  ... ..  ... ..  ... .  agg#.# r#  #.# #.#  #.# #####..#  #>..@.#  .....#####  ..#....# ))aggF aggaggVaggaggZ _A rat is nearby!agg(]  You shoot a sling bullet. The sling bullet hits the rat.agg!#n†((agg (((((You kill the rat!aggg2 p....†..agg7 k5===5.0 (1.3Rev aggp< agg*? / _You shoot a sling bullet.aggO Jagg H _No target in view!agg/JaggK4aggXMaggMNaggN% _aggSaggS0agg>Vagg#] ....=..g.. .............. .......... ......... ..... ... ... #.# #†# agg] #.# ##@# --- #.# #####..# #.###>....##.......##### ######...#....## #...####.....g   goblin (asleep) ##..##.#######agg]C)..#..######..aggb 8.0 (3.0  A goblin comes into view. It is wielding a +0 dagger.Found a notched iron ring.aggg5.ggagg)h aggh1==-aggh$9.0 (4aggoaggr( _The goblin shouts!agg ....=........  ......g....  ..... .........  ... .......  ... .....aggl ... ... #.# #†# #.# ##@# #.# #####..#>....#######  .)agge~ ....=........  ......g....  ..... .........  ... .......  ... ..... ... ... #.# #†# #.# ##@# #.# #####..#aggL >....####### )agg'aggagg)aggH] _A goblin is nearby!agg`  You shoot a sling bullet. The sling bullet hits the goblin.agg~)(((((aggb ((You kill the goblin!agg'.)....†aggj7=90.2 (1.2Rev aggagg/ _You shoot a sling bullet.agg agg1 agg agg H _No target in view!aggTaggaggTagguaggaggeSM...K........=......... ........)...............................#........agg... #.....#  ## #.# #####.. #######.###>....##Rev agg׿#####K   kobold (missile, wandering)agg(0.0agg75---1.2 (1aggaggd _A kobold comes into view. It is wielding a +0 short sword. aggEj_You see here a rat corpse.aggH ...K...........  .....=.........  ........)......  ...................  ................  aggo... #........  ... #.....# #.# #@# #.# ##.# #.# #####..#>....###### agg B ...K...........  .....=.........  ........)......  ...................  ................  ... #........  ... #.....# #.# #@# agg C#.# ##.# #.# #####..#>....###### agg3LagghM3---aggmYaggZ aggZO_A kobold is nearby!aggV Y ((((aggcW ((K  )  You shoot a sling bullet.  The kobold shouts!  The sling bullet hits the kobold.agg  The kobold is severely wounded.You shoot a sling bullet. The sling bullet hits the kobold.agg5 C)aggj ~ ......  You kill the kobold!aggm v9===2.5 (1.3Rev+ aggs aggjs aggz /  --more--aggK( _You hear a shout!agg0.)..=... )......... ......... ......... ... #..@..# #.# ####†## #.# ##.# #.# #####..#  #######.###>....##  ............##### #######...#....# ....# #...####..... ###..##.###########aggT8agg9e---30Rev agg=agg?aggK 5Mg#>. )..=... )..agg *....#...@.......... ##.....##...####†###.# ##.#Rev g   gnoll (wandering)agg cA gnoll comes into view. It is wielding a +0 club.agg a.gaggN B---4agg- agg 3 _Found a stone staircase leading down.agg^agg`?.##.....##...agg.#agg$>agg(*g..aggc agg()..agg1*=...agg agga)agg.agg.aggU.......#........... ##.....##...####†## # ## agg*#.# #####..  #######.###>....##  ............##### #######...#....#aggz.g5aggagg^ _Found a scroll labelled USECRI LOMESE.agg=## ####### ###?.##.....##...#>.. g)..=... )......#........... ##.....##...####†## ## ## #.# #####..  #######.###>....##  ............#####aggaggT.gagg&6aggaggaggG (( You shoot a sling bullet. The sling bullet hits the gnoll.agg7  The gnoll is moderately wounded.You shoot a sling bullet. The sling bullet hits the gnoll.agg׺ agg V.g.agg 7===7.8 (1.3agg agg ^ _The gnoll is severely wounded.agg (You shoot a sling bullet. The sling bullet hits the gnoll.aggQ  The gnoll is severely wounded.You shoot a sling bullet. The sling bullet hits the gnoll.aggc agg ..gThe gnoll is almost dead.agg 3-----9.0 (1.2Rev+ agg aggt 8 _The gnoll hits you with a +0 club.aggD_  You shoot a sling bullet. The sling bullet hits the gnoll.aggI1)agg1 (((((((You kill the gnoll!agg[,......)agg^aggzi^SunshineJesse the Shooter## ####### ###Coglin.?.##.....##...Health: 14/16 =====================---...#..........>Magic: 1/1========================...............AC: 3Str: 11aggjn....)...........EV: 11Int: 8......=.........SH: 0Dex: 17.........)......XL:  1 Next: 230% Place: Dungeon:1.........)@........Noise: ===------  Time: 100.2 (1.2).................a) +2 sling {Septima d) +0 sling {Arun} .....#...........Fire: a) +2 sling {Septima} ... ##.....##...Rev+ #.# ####†## ###.# ##.##.# #####..########.###>....##............#####You shoot a sling bullet. The sling bullet hits the gnoll.  The gnoll is almost dead. _The gnoll hits you with a +0 club.  aggkYou shoot a sling bullet. The sling bullet hits the gnoll.  You kill the gnoll! _You shoot a sling bullet.aggjl _The gnoll hits you with a +0 club.  You shoot a sling bullet. The sling bullet hits the gnoll. aggl You kill the gnoll! _You shoot a sling bullet.  Your Dodging skill increases to level 2!You have reached level 2!aggsv/  --more--agg {9/22=-2/22aggc 54% agg agg 4 _aggL9### ####### ###?.##.....##...#>.)..=... .@..)......).. ...... ...........agg'M .... ##.....##... #.# ####†## ## #.# ##.# #.# #####..# #######.###>....##aggMagguWaggX----1aggY0 _aggaaggdaggaM### ####### ###?.##.....##...#>. )..... ...)agg .).......#............#.#aggagg4B---2aggɖagg̛w _You see here a ring of willpower.agg4aggOagg:agg; _aggC agg _20=Rev agg aggaggagggaggyaggaggagg,aggaggaggq1==aggaggcaggagg0 aggC"agg"agg<%agg',agg)aggU,agg,i2===agg3.aggx2agg4agg4agg,6aggt8agg=,agg?aggBaggD,aggEaggHaggKagg!L:==aggjNaggQaggTaggUaggWaggr`################# ###agg`##.....##...##.#..........> #................... #)........... #...=....... .aggaG ...............)...... agg2ae.## ##..........)......... aggJad..# #................... agg`a\..# #.......#...........aggh0175.0)agg"i,8.2 (16aggnaggqc _g - a scroll labelled USECRI LOMESEaggaggVaggaggaggagg agg$agg(aggO+agg+agg-agg0agg_2agg2agg3agg6agg8agg8agg9agg;agg=agg=agg;?agg@aggBaggBaggCagg6IaggFJ,aggJaggLaggNaggOaggOaggQaggSaggYSaggTaggUagg1WaggiWagg&XaggYaggb[agg[aggb\agg]agg^agg'_agg_aggbagg daggXdaggdaggfagg{gagggagghagglaggm,aggnaggoaggLqaggqaggraggDsaggt,agguaggvaggMw,aggwaggxaggWyaggyaggyagg:{agg{agg7|agg|aggɂaggAaggaggagg&aggl,aggaggaggaggaggAaggaggagg֎aggTaggagg-aggkaggؒagg+aggaggagg7agg(aggvaggagg.aggaggUaggaggaggNaggaggߡaggwagg8aggaggԥaggaggaggraggaggTaggaggR,agg+aggvaggںagg%aggagg/aggaggaggZagg\aggaggaggaggaggaggaggaggagg(aggWaggaggaggL,agg&aggagg@aggaggagg>agg,aggYaggqaggaggaggaggdagg ,aggagg5aggaggaggagghagg$,aggaggagg,aggaggaggBagg aggaggaggeaggagg0aggdagg"aggbaggagg2aggaggaggaggaggdagg aggaggagg~agg!agg agg agg agg aggR #......##..###..##.###..##.##.....#.....#......##....)..#..##......##...........##..#####.......##..#......##...........###..####.......##.# #...............##.# #..@............##.#70.2 (52 ##.............###.. #............###... #.........##..#...# #...###...... #......#.#  #...#######.#  #>######## #.#  #.. aggrB1.2 (53agg!agg&9 _Found an escape hatch in the floor.aggbdaggdaggeagg1jaggkaggJlaggspaggRraggsaggsaggmtaggwBaggxagg{Bagg},agg~agg~aggHaggagg,aggaggZaggp,agg#aggP  There is an escape hatch in the floor here.agg4 _agg*Baggaggfagg,aggd,aggpnaggݱnagg|,aggaggxaggA,agg1aggaggaggaggpaggagg#>######### #.# #.# #.. ##.# ... #..# # #.## #.. #.### ... aggi#...##### r.# ###.....###$..# #####..@....# ###.?.#  ..#  .#agg .. ## r   rat (asleep) aggagg,94.2 (2agg,5.2 (24agg/agg]V _A rat comes into view.agg  #> #.#  #.# #..  ##.# ...  #..# #  #.## #.. agg  #.### ...  #...##### r.#  ###.....###$..#  #####..@....#  #####.?.#  ..#  agg޶ a.#  ..  ## agg aggL> #>aggPL #.#  #.# #..  aggL##.# ...  #..# #  aggL#.## #..  #.### ...  #...##### r.#  aggL###.....###$..#  aggMy#####..@....#  agg:M#####.?.#  ..# aggfMB .# ..aggM> ## aggMagg|TaggTagg[agg^Z _A rat is nearby!agg  ((r  You shoot a sling bullet. The sling bullet hits the rat.  The rat squeaks loudly.aggN (((((The rat is severely wounded.You shoot a sling bullet.aggagg.....r.aggwP====6.5 (1.3)agg,Rev aggagg;^ _The sling bullet closely misses the rat.agg (You shoot a sling bullet.  The sling bullet hits the rat but does no damage.aggj _The sling bullet closely misses the rat.You shoot a sling bullet.  The sling bullet hits the rat but does no damage.  The rat is severely wounded.aggaggyS$ragg ===-7.8Rev+ aggagg agg'N_The rat is severely wounded.agg]  You shoot a sling bullet. The sling bullet hits the rat!aggE†agg{X ((((You kill the rat!agg" †...8-9.1 _You shoot a sling bullet.agg9 agg agg aggܭ agg ,aggQ u  You see here a rat corpse.agg agg _agg agg5 aggZ agg :Rev agg aggK agg agg agg[ M _You now have 23 gold pieces (gained 15).aggr agg aggT agg agg agg !agg agg0 #.# #.. ##.# ... #..# ##.. #.## #####.... #.### #.....# #...##### #...# ###.....###...# #####...†...#  #####.@.# --- #...# agg ###.# ...#### agg /205.1 (6.0agg% G---6.1 (7agg agg' a _h - a scroll labelled PESAOSIMMEEagg|agg|aggs}agg~aggaggagg-aggh|#.## #####.... #.##agg#.....# #...##### #...# agg###.....###...#  #####...†...# agg܎v #####...# agg #...# [ agg###.###.... #@.....#agg>_8.1 (2 ######## aggɏaggagg+9.1 (3agg|agg- _Found a leather armour.aggԚ3aggaggVaggL,aggVaggagg#.## #####....  #.### #.....#  #...##### #...# .  ###.....###...# ..#####...†...# [..#####...# ∩...#...# [.[.####.###.....##..@...# 10.1 (1## aggA1.1 (2agg*aggN _Found a helmet and a buckler. Found Gugic's Armour Shop.aggso 4aggnt aggv H _No target in view!agg agg agg agg agg) #.## #####.... #.### #.....# .# ... agg #...##### #...# #.##.. ###.....###...# ...g.#####...†...# .[b[.#####...# ..∩.aggߟ #...# .[.[.# ###.###.....# #...@..# # g   hobgoblin (asleep)agg Xb   bat (asleep)agg } 0  A bat and a hobgoblin come into view.aggP agg agg̷ ?.bbagg +2.1 (1agg agg ( _Found a ring mail.agg">  You shoot a sling bullet.aggd (((((((The sling bullet hits the bat but does no damage.agg4  You shoot a sling bullet. The sling bullet barely misses the bat.The hobgoblin shouts!agg....g[∩[bgaggc===3.3 (1.2Rev aggiagg^ _The bat misses you. The bat barely misses you.aggK]  You shoot a sling bullet. The sling bullet hits the bat.aggRA. agg\ (((((((You kill the bat!agg[aggd....[g[.aggPj 624.5Rev+ _You shoot a sling bullet.aggsagguo _Your Ranged Weapons skill increases to level 4!aggN (((((((You shoot a sling bullet.agg /  The sling bullet closely misses the hobgoblin.You shoot a sling bullet.agg۲ agg ...[∩g.aggT l5.8 (1.3Rev* agg+ agg d _The sling bullet closely misses the hobgoblin.agg7P P ((aggP $(((((aggP /You shoot a sling bullet.agg  The sling bullet closely misses the hobgoblin.You shoot a sling bullet. The sling bullet hits the hobgoblin.agg^ agg"i ; ...aggri [∩[gThe hobgoblin is heavily wounded.aggj -7.0 (1.2aggs aggpv W _The hobgoblin closely misses you.aggU  You shoot a sling bullet. The sling bullet hits the hobgoblin.aggf  The hobgoblin is almost dead.You shoot a sling bullet. The sling bullet hits the hobgoblin.aggC† agg708.2 _You kill the hobgoblin!aggƓaggaggaggH _No target in view!aggj4aggǗaggoH _No target in view!agg5 ..#  ##.. .## #####....# .### #.....# .# . ...##### #...# ##.## ##.....###...# #.....  #####...†...# #.[.[#####...# #..∩.....#...# #.[.[.# ###.###@....##......############agg: agg,< =---90 _aggC aggF v _You see here a hobgoblin corpse.aggiagg1# agga .agg agg"^ ##..# #### agg## #####....# ...# agg(### #.....##.# ....# agg..##### #...# ##.## agg҇g#.....###...# #........# agg%#####...†...# #.[.[....#aggm#####...# #..∩......agg#...# #.@.[.# aggb###.###†....# agg6=#......####aggr"########aggagg^agg\agg---agg20 agg5 _aggqaggU aggުagg'A_You see here a -1 helmet.aggagg Equip which item?  - - Unarmed Inventory Items Hand Weapons (go to first with )) agg a - a +2 sling (weapon) {Septima}  d - a +0 sling (offhand) {Arun} Armour (go to first with [)  b - a +0 leather armour (worn) Floor Items ([,] to select) Armoura -1 helmetaggF[?] describe selected [!] equip|wield|wear[tab] equip|unequip agg> aggqx.#...SunshineJesse the Shooter aggȎ.###..# ####Coglin #######....# ...#Health: 22/22 ======================== ### #.....##.# ....#aggMagic: 2/2======================== ..##### #...# ##.##.....agg3AC: 3Str: 11 #.....###...# #........#EV: 11Int: 8 aggY#####...†...# #.[.[....#SH: 0aggDex: 17#####...# #..∩......agg&XL:  2 Next: 70% Place: Dungeon:1#...# #.@.[.#aggя9Noise: ---------  Time: 220.2 (0.0)###.###†....#a) +2 sling {Septima d) +0 sling {Arun} agg #......####Fire: a) +2 sling {Septima} ########Rev* agg7You shoot a sling bullet. The sling bullet hits the hobgoblin. _You kill the hobgoblin! _No target in view! agg\_No target in view! _You see here a hobgoblin corpse. _You see here a -1 helmet.agg%P  Okay, then.aggagg aggl. _agg# #.. # #...   ##..# ####  #####....# ....# aggq## #.....##.# ....## .##### #...# ##.##...... .....###...# #........# ####...†...# #.[.[....#######...# #..@.......#...# #.[.[.########.###†....# #......############aggaggi1.2 (1Rev+ _aggagg=g _There is an entrance to Gugic's Armour Shop here.aggVhagghoWelcome to Gugic's Armour Shop! What would you like to do?  a -  115 gold the +0 pair of boots "Nydag" {Harm rPois Will-}  b -  240 gold the +3 leather armour of Liphagg {Rampage}  c -  230 gold a +0 bardingaggod -  45 gold a +0 buckler  e -  20 gold a +0 leather armour  f -  20 gold a +0 leather armour  g -  20 gold a +0 leather armour  h -  40 gold a +0 ring mail  aggoi -  7 gold a +0 robe  j -  40 gold a +0 scale mail  k -  160 gold a +1 scale mail of cold resistance agg pYou have 23 gold pieces. [Esc] exitaggKp[!] buy|examine items[a-k] mark item for purchase aggxp[/] sort (type)[A-K] put item on shopping listagg~9agg?agg F##..SunshineJesse the Shooter ##...Coglin ###..# ####Health: 22/22 ======================== ######....# ....#Magic: 2/2======================== ## #.....##.# ....##AC: 3Str: 11 .##### #...# ##.##......EV: 11Int: 8 .....###...# #........#SH: 0Dex: 17 ####...†...# #.[.[....##XL:  2 Next: 70% Place: Dungeon:1#####...# #..@.......aggFNoise: ---------  Time: 221.2 (0.0)#...# #.[.[.#####a) +2 sling {Septima d) +0 sling {Arun} ###.###†....#Fire: a) +2 sling {Septima} #......####Rev+ ######## _No target in view! _No target in view! _You see here a hobgoblin corpse. _You see here a -1 helmet. _Okay, then. _There is an entrance to Gugic's Armour Shop here.aggMagg`NaggrSaggTaggWaggaggaggQF _Unknown command.aggcO `agg^W Q _agg'_ ?  You see here a -2 buckler.agg` agg=a _aggb aggdd aggf aggZf aggGh aggl agg`n aggn :Rev aggo aggq aggYs aggs aggt aggv aggy ,aggy agg@} agg aggF agg> agg agga agg !aggg agg̉ aggӌ agg agg3 agg" aggG agg] ,agg aggo ,agg agg* ,agg{ aggU  agg~ w_f - 2 scrolls labelled UCOCURHIDDIM (gained 1)aggc agg agg agg agg̟ agg aggT agg~ aggǥ agg_ $ agg )_You now have 33 gold pieces (gained 10).agg 3agg agg4 aggƫ agg agg agg' aggݯ agg" agg aggL agg agg aggM agg߷ aggE ,agg agg{ agg' agg agg agg agg; agg agg~ aggA agg agg agg agg agg- aggJ agg agg_ agg agg agg agg@ aggq agg agg agg agg@ agge agg agg{ agg agg aggI agg{ agg. aggY agg agg; agg agg agg agg agg7 ,agg agg agg / ..#agg m ###.. ... .....#aggD  .l .....# .. agg |..... ##.  ... ..  #.# .# .#### ##.# agg #.....# #@.# ......# #.## ......# ####.# agg m#.....#######....# agg a..............#### #.....#########aggF l   frilled lizard (asleep) #.....# #.....# aggl %#######aggo 053.2 (32.0)agg! ,4.2 (33agg agg  agg S_A frilled lizard comes into view.agge ..#... .l  ..  ##. agge ... ..  #.# .#.#### ##.#....# #@.# ......# #.## ......# ####.#.....#.........####agg f6agg+ ..#... .l  ..  ##.  ... ..  #.# .#.#### ##.#agg=u....# #@.#.....# #.## ......# ####.#.....#.........####aggagg7agg)agg/ e _A frilled lizard is nearby!aggS o  You shoot a sling bullet.  The sling bullet hits the frilled lizard.agg=Z †(((((agg0 ((You kill the frilled lizard!agg9d p.†.....aggg C5===5.5 (1.3)aggGh ,Rev aggk aggOn / _You shoot a sling bullet.agg{ aggo| aggz aggq H _No target in view!agg>MaggMaggP,agg'RQ _aggUaggVaggWaggW,aggXagg Z,aggSZagg[agg]agg]]agg]agg9aaggyf #.#  aggf#.#  #.#  ..# #.###### #.. .######......# ..# ...K.....†...# aggfh..# .............# .. ###@# --- #...# # #.##agg2g### ##.## #..# ...# #.##K   kobold (missile, asleep) ...# ####.# ..aggQg@.#######....# ...........####aggk& aggkm61.5 (6.0  A kobold comes into view. It is wielding a +0 whip.aggq\.KK)aggr5===2.5 (7aggzagg|( _The kobold shouts!agg (( You shoot a sling bullet. The sling bullet hits the kobold.agg3{  The kobold is moderately wounded.You shoot a sling bullet. The sling bullet hits the kobold.agg  C)agg- ..3/23833.7 (1.2Rev aggZ agg J _You kill the kobold!aggagg1agg#agg|aggaggagg$,aggagg'!aggaggagg aggRaggaggvaggaggaggaggaggEaggaggaggaggӻagg aggaggaggؾagg aggaggaggaggaggaggVagg{aggaggaaggdagg{,aggaggagg}aggaggaggaggaggaggaggagg ## #. . #######.#  .......#  ........#  ....S...#  aggV--- # #. #.#agg| #.# #.#aggS   ball python (constriction, asleep) #.#agg #.# #.#agg075.7 (12.0)agg\.SS)aggH---6.7 (13aggagg^ _A ball python comes into view.agg ( You shoot a sling bullet. The sling bullet hits the ball python.agg(  The ball python is severely wounded.You shoot a sling bullet. The sling bullet hits the ball python.agg. E†agg8 .7===8.0 (1.3)Rev agg0 agg O _You kill the ball python!aggBaggOaggagg;H _No target in view!aggҔaggYaggޕaggaggagg,% _aggBaggaggagg'agg]agg!agg\aggagg1\aggaggdaggHaggaggagg۳aggѴaggKagg׷aggaggٸagg{aggaggEaggaggaggagg`aggagg,aggagg}M _You now have 44 gold pieces (gained 11).aggaggkaggagg9agg1aggsaggaggaggaggaggagg[,aggagg$L _You now have 53 gold pieces (gained 9).aggaggaggaggagg,aggaggaggaggagg^aggaggLaggaggQaggaggxy.......##### #....# ### #agg...#....##### ###.... ..# #...####......##....########.# #.###########....#...........# .......................# ..######...........†..# .................###########.# aggP#..)..########..####.# ...##..# ##.@.#agg#.#--- #.## ..# #.#.....# #.# agg#.# .# #.........l #.# #.#####.. ......###### #.# #........ ####.#.#aggN\#.# ...#####. #.#..#.#l   frilled lizard (asleep) ..##....####.# agguO.........# agg#.#### #.##.## #####.. .######.....aggagg096.0 (18.0)aggH---7.0 (19agg:agg a _A frilled lizard comes into view.aggo  You shoot a sling bullet.  The sling bullet hits the frilled lizard.aggd)(aggH(((((.aggagg{ K (aggm{ DYou kill the frilled lizard!agg} 6.......agg/ p91===8.2 (1.2)Rev aggL agg / _You shoot a sling bullet.aggvaggJwaggwaggXzagg:|aggBaggz,aggaggaggagg6!aggagg8aggaggagg@aggraggԎ,aggagg aggagg+aggaggaggaggCagg@aggkaggaggjaggagguaggaggΞagg+aggagg,aggaggagg,aggjaggagg˥aggaggagg$aggiaggaggTagg7aggaggagggaggaggagg/aggͳagg@aggaggTaggͶaggaggagg>aggaggagg ,aggaggagg,aggaggagg,aggaggagg,aggaggaggagg,aggaggagg,aggaggaggaggaggagguagg,aggQagg/aggagg>aggagg*agg,aggPaggaggaggaggbaggaggOaggaggagg XaggXaggW,aggaggvaggAagguaggaggmaggaggaggQagg/aggaggaggaggaggE,aggaggaggagg,aggagg,aggaggaggy,aggagg aggv agg agg/ aggjaggaggaggaggVagg,aggagg'agg Bagg"agg#agg#agg$agg'agg~)agg)agg+aggz.agg0agg0agg2agg5agg)8aggX8agg9agg <aggh>,agg?agg'Bagg7D,aggEaggGaggH,aggIaggJaggK,aggrLagg&TaggV,aggfXaggZagg\agg]aggp^agg`aggwb,aggdaggeaggg,agg~hagg...## .....................# ......)..............# ........=............# ..).........### ......).......# ...........^... .....#.................. ..##.....##..@....... ---379.2 (81.agg*0)######÷#######......  ##.#   #####..# ....###>....## ####.#># agg+......##### #....# . ### ...#....#########.... ..# ...####......##....########.# agg?+R.###########....#...........#agg39---agg84&80.2 (82aggD9agg;; _Found a stone staircase leading down.agg4agg6aggiH _No target in view!agg! 3agg-# agg( agg* aggc+ $ _agg/ Xagg1 agg6 aggr8 ,aggk9 agg; agg@= agg= agg6> agg^@ aggA ,aggB aggC aggD ,aggD aggF R  There is a stone staircase leading down here.aggfH aggH  _aggI aggP aggdR aggR aggS aggT aggU agg+V aggV aggpX aggZ ,agg\ ,agg^ ,agg_ agge` agga agg$b aggb agg1e aggf aggf aggHg agg!j aggr ....# # ...# ...### S..# ...######...# ^....... ...# ......# ...# ##............###...# agg!s ######........##....#  #........#.@...#  #........#.#####  ####.#>##...#  #....#....#######...........# aggs .##....########.# S   ball python (constriction, asleep) ....#...........# ##..............# .............†..#aggvy } 93.2 (13  A ball python comes into view.agg~ a.SS)agge ,4.2 (14aggZ agg؈ 5 _The ball python hisses angrily.agg{jT ...#  ...# ..# ^ ...#  ...# ...##...# .##....#  #........#.@...#  #........#.#####  aggk>##...#  ....###.......#######.#†..#aggvE ...#  ...# ..# ^ ...#  ...# ...##...# .##....#  agg>#........#.@...#  #........#.#####  >##...#  ....##.....######.#agg:†..#agg? agg aggVaggOb _A ball python is nearby!agge  You shoot a sling bullet. The sling bullet hits the ball python.aggQx.((((agg? (((You kill the ball python!agguP.......aggw.........#SunshineJesse the Shooter .........#...#Coglin .........### ...#Health: 23/23 ======================== ...........######...#Magic: 2/2======================== ........^....... ...#AC: 3Str: 11 ..............# ...#EV: 11Int: 8 ##............###...#SH: 0Dex: 17 ######........##....#XL:  2 Next: 100% Place: Dungeon:1#........#.@...#Noise: ===------  Time: 395.4 (1.2)#........#.#####a) +2 sling {Septima d) +0 sling {Arun} ####.#>##...#Fire: a) +2 sling {Septima} aggy)#....#....###Rev #####...........# .##....########.# ....#...........# ##..............# .............†..# _There is a stone staircase leading down here.  A ball python comes into view. _The ball python hisses angrily. _A ball python is nearby!agg{You shoot a sling bullet. The sling bullet hits the ball python.  You kill the ball python! _You shoot a sling bullet.  You have reached level 3!aggN/  --more--aggl  Your experience leads to an increase in your attributes!Increase (S)trength, (I)ntelligence, or (D)exterity? aggQ 8/283/393 0%  You feel agile. x2agg aggx  Your brain swirls with designs for a bismuth ipsilaterosorter. You just need _some more time...aggX4aggaggRaggagg Q _agga!,agg1"agg#agg$agg"%!agg%agg7'agg"(0agg(aggu.agg/agg/aggG0agg2agg3,aggA4aggo6aggz7,agg7agg9agg:,aggr;agg&=agg_>,agg-?aggAaggBaggBaggCaggEaggFaggYGaggHagg'JaggYKaggKagghLaggaaggiaggj,agglaggpaggq,aggnraggvagg x,agg5yagg|agg~,agg0aggN;  There is a shaft here.agg>5 _agg%aggagg|,aggaggGagg!,aggaggagg,agg՛agg agg,agg_aggXagg;agg*,aggaggagga,aggaggaggƴ,aggaggagg,aggaggagg,aggaggaggaggagghaggnaggx,agg6agg aggaggTaggaggagg,aggaggagg,aggagg'agg1,aggaggaaggg,aggagg]agg,aggagg>agg,aggaggDagg,aggaggagg,aggaggagg,aggaggagg,aggaggXaggSaggRaggaggaggagg,,aggaggagg,aggagg aggaggaggQaggaggaggaggHaggaaggHagg,agg+agg agg7aggaggagg aggF agg agg aggN ,agg aggagg,agg]agg#agg,aggaggagg,aggJagg!agg7#,agg$agg+agg.,agg'1agg3agg6,agg8agg!V #..##..#...##.....#####..  #..###..................#  #........#.##.########...  ##.##.# #.....##  #>######### #.#..# #.....#  #.# ##...## #.....#aggV# #...## #....## #..# ###..#########.## #.## #####.@..##....###.####---454.4 (59.0) #.### #.....##.##....##.....# #...##### #...####.##...........# ###.....###...# #........#......# aggVO #####...÷...aggW# #.[.[....##.....# #####...# #..∩.............agg/W  #...# #.[.[.#####.....#aggWW  ###.###†....# #.....# agg|W #......#### #.....# agg=X:---agg`aggrbE _Done exploring.aggaggaggܸagg'............aggp......0.0)aggaggaggqE _Done exploring.aggH7agg 9ZWhere to? (? - help) aggT96 D - Dungeon agg xagg%[?25h[?0c #.........##..#...##.....#####.. SunshineJesse the ShooteraggЍ#.........###..................# Coglin#...............#.##.########... Health: 28/28 ========================#.........#######.##.# #.....## Magic: 3/3========================#>######### #.#..# #.....# AC: 3Str: 11  #.###...## #.....# EV: 11Int: 8 ##.##...## #....## SH: 0Dex: 19 #..####..#########.##XL:  3 Next:  0% Place: Dungeon:1 #.#######.@..##....###.#### Noise: ---------  Time: 454.4 (0.0) aggbk#.### #.....##.##....##.....# a) +2 sling {Septima d) +0 sling {Arun} #...##### #...####.##...........# Fire: a) +2 sling {Septima} ###.....###...# #........#......######...÷...# #.[.[....##.....#agg#####...# #..∩............. #...# #.[.[.#####.....# ###.###†....# #.....# #......#### #.....# Your brain swirls with designs for a bismuth ipsilaterosorter. You just need _some more time... _There is a shaft here. _Done exploring. aggR_Done exploring.  What level of the Dungeon? (default 1, ? - help) aggd [?25l[?1cagg:l 42agg'n aggy agg| agg E _agg agg" aggq agg agg agg ,agg? agg aggڔ agg agg aggY aggr agg ,agg? aggs aggȠ aggw agg agg agg agg agg' aggѭ ,agg aggݲ aggm ,aggZ agg agg ,agg agg agg ,agg\ agg agg ,agg agg agg agg agg aggX agg ,agg aggg agg ,aggN agg agg ,agg agg agg% ,agg aggC agg ,agg> agg| agg ,agg agg agg ,agg agg agg ,agg aggc agg ,agg agg agg ,agg agg agg' ,agg1 aggB _some more time... _There is a shaft here. _Done exploring.  There is a stone staircase leading down here.aggY aggc agg $ _agg agg7?2agg?aggBaggBaggACaggL                ######  aggIM #..@.#  80.2 (25.8) #..###   .....   ....##.   aggM... #.   .. #.  ? #.   ..    _You climb downwards.  Found a scroll labelled HIDAXE ALEOH.aggfNaggRaggKUa _There is a stone staircase leading up here.agg?aggz@aggdAaggCaggFagguKP _aggN,agg OaggFQagguT,aggyUaggWagg,`     # ########## ... ...#..<.# ###..#.#..### .......@....# 3.2 (3.0)##.....##.#.# agg`k##.#.#  #..... #.# #  #.?... #.# ..... ... .....#) .# ..:..#. ##  agg0iagggd4.2 (4 _Found a whip.agg 3agg agg9 agg agg ,agg[ agg e    ##############  .......#..<.# #####..#.#..### ..............# aggc  ###...@.##.#.#  #.....##.#.#  #.....##.# #  #.?...##.  ...........  #)...# r   rat (asleep):..#.####  agg ..r.. .?     agg0 s 5.2 (1  A rat comes into view.agg +6.2 (2agg aggI d _Found a scroll labelled PESAOSIMMEE.aggq (((((((You shoot a sling bullet.aggl rThe sling bullet completely misses the rat.You shoot a sling bullet.  The sling bullet hits the rat but does no damage.agg$agg......:r.aggq0c===7.4 (1.2Rev agg7agg;- _The rat squeaks loudly.agg&l(((((((agg  You shoot a sling bullet. The sling bullet barely misses the rat.You shoot a sling bullet.aggx aggآ j....r.agg 6.8.7 (1.3agg/ 7Rev+ aggU agg ^ _The sling bullet closely misses the rat.agg 8(((agg 4((((agg  You shoot a sling bullet. The sling bullet barely misses the rat.agg  ....r.:.9.9 (1.2agg" w _You shoot a sling bullet. The sling bullet barely misses the rat.agg׵ (((You shoot a sling bullet.aggA  The sling bullet hits the rat but does no damage.  You shoot a sling bullet. The sling bullet hits the rat.agg4aggagg].r..aggCm91.2 (1.3Rev* agg]agg^ _The rat is moderately wounded.agg5 ((((You shoot a sling bullet.agg/  The sling bullet closely misses the rat.You shoot a sling bullet. The sling bullet hits the rat.aggSaggN^.†..aggR022.5aggXZaggh]G _You kill the rat!agg4agggaggeH _No target in view!agg: agg; agg= agg6A aggD aggL    ##############  .......#..<.# #####..#.#..###  ..............#  ###.....##.#.# aggM E #..@..##.#.#  #...†.##.# #  #.?...##.# ........... #)...# .....:..#.#### K   kobold (wandering)....#.?   K...####   aggN . aggoX (0.0agg!Y 5---3.5 (1agga aggi u _A kobold comes into view. It is wielding a +0 dagger.aggC ##############  .......#..<.#  #####..#.#..###  ..............#  ###.....##.#.#  #..@..##.#.#  #...†.##.# #  #.?...##.#  ...........  ......#)...#  .....:..#.####  ........#.?  ....K...####  aggVgl ##############  .......#..<.#  #####..#.#..###  ..............#  ###.....##.#.#  #..@..##.#.# agg7h1 #...†.##.# #  #.?...##.#  ...........  ......#)...#  .....:..#.####  ........#.?  ....K...#### agg>qaggq:---agg{agg~] _A kobold is nearby!agg*N (((((K  (You shoot a sling bullet.  The kobold shouts!  The sling bullet hits the kobold.agg (The kobold is moderately wounded.You shoot a sling bullet.aggt8aggC.?..:.K.aggC7===4.7 (1.2aggPaggSa _The sling bullet closely misses the kobold.agg<~Q ((agg~U(((((You shoot a sling bullet.agg)   The sling bullet closely misses the kobold.You shoot a sling bullet. The sling bullet hits the kobold.aggSagg.?..:).agg045.9aggLaggJ _You kill the kobold!aggfaggaggaggH _No target in view!agg 4aggl agg H _No target in view!agg _agg5 ############## .......#..<.# ..#.#..### .......#  ###.....##.#.#  #.....##.#.#  #...†.##.# #  #.@...##.# ---............... .........#)...# ......:..#.#### ......)..#.?  ....####  .....     7.9 (2.0---8.9 (3Rev+  _i - a scroll labelled HIDAXE ALEOHaggg/4agg1agg5agg9agg>,agg8?aggxC,aggEaggoHaggLaggMaggIOagg9[ #####..#.#..### ..............# ###.....##.#.#  #.....##.#.#  #...†.##.# # #######.....##.# ................ ..........#)...# .......@..#.#### )..#.?  .####  ......  ###  # . #######+##  aggX\ You pick up a book of Dangerous Friends and begin reading...aggd(501aggeZ2.9 (4Rev agglaggo  agg#osYou add the spells Forge Blazeheart Golem, Orb of Destruction and Spellspark _Servitor to your library.agg._ agg_ aggWa aggf aggj aggj aggCp ,aggs ,aggt aggv aggVz ,agg{ agg~ agg aggP aggv agg <  You see here a +0 whip.agg agg  _agg@ agg aggҒ ,aggѓ aggo ,agg' agg | _h - 2 scrolls labelled PESAOSIMMEE (gained 1)agg 3aggx agg agg$ ,aggŢ agg agg ,agg٦ agg ~agg agg aggU agg agg0 ,aggr aggc aggf ,agg agg agg Bagg` agg agg agg& agg agg ,agg agg agg agg- ,aggk agg agg ,agg agg8 agg ,agg agg aggS ,agg agg+ agg,aggyaggagg,aggagg<agg,aggi agg agg1 aggd agg agg"aggaggDaggaggkaggR,aggaggaggagg&aggaggagg0,aggagg!aggm$agg$aggC%agg'agg. #.# #.### #.#  #######.#######  aggC/>........   #@################431.0) #................. agg/#..############### .................#..<.# #############..#.#..### ..............# ###.....##.#.# #.....##.#.##...†.##.#.#agg8agg~9,4.9 (42agg4?aggA; _Found a stone staircase leading down.agg}aggaggagg|aggaggJBagg%aggTaggaggaggx,aggagg>agg+,aggaggaggaggaggWaggagg! ,agg agg+ aggagg9aggaggagg,aggNaggaggagg,aggaggragg agg:aggaggagg,aggaggagg&Bagg'agg0Q#.##. #.##. #.###.#######.#######..>..............##..######.######### ...# #..........#######.######..########.......@................56.9 (1#######.#############..##... ........ #..## ###.... #.$< #........ #...†.#..# #######....?#..# ........... .........aggN8agg8,7.9 (13aggY>agg@9 _Found a stone staircase leading up.agglE aggE aggyF aggG aggI ,aggqN ,aggR #.##.#######.#######..>..............##..##...# #...#######.######..aggS ...............#######.#######.. #.@....... 8aggDS X.0) #. ###....aggxS #.$< #..... #...†aggS ;.#..### ######.?#..# ...........[. aggS R..........#... #aggS ))agg[ agg\ +9.9 (2aggib agge - _Found a leather armour.aggڍ3aggMaggܐagg|aggaggZ,aggaggEaggagg6aggwagg͡aggSM _You now have 64 gold pieces (gained 11).agg7aggpaggagg׬agg) ##..######.####### ...# #........#######.######..######......................#######.############# #......... ...... #..####### ###########..<.....# #.........@..# #.......#..############b.....?#..# .........[..#..# .........$......#..# .....########..# ). b   bat (asleep) #..# . #..# . aggu.[40m.........aggt 63.9 (4  A bat comes into view.agg+4.9 (5aggaggE* _Found 9 gold pieces.aggM ((((((b  You shoot a sling bullet. The sling bullet hits the bat.agg (The bat is moderately wounded.You shoot a sling bullet.aggWaggUXaggZagg[agge<....b..aggec===6.2 (1.3Rev agg`maggp^ _The sling bullet closely misses the bat.agg< (((((((You shoot a sling bullet.agg  The sling bullet closely misses the bat.You shoot a sling bullet.  The sling bullet hits the bat but does no damage.aggGagg$IaggbU b......  The bat is moderately wounded.7aggUo-7.4 (1.2Rev+ agg_aggc' _The bat hits you.aggw ]  You shoot a sling bullet. The sling bullet hits the bat.agg)% k†aggi (((((((You kill the bat!agg8 .......†agg< O-88.7 (1.3aggC aggF / _You shoot a sling bullet.agg,4aggIaggagg b8=agg1 _HP restored.aggm4agg agg%agg~agg:Rev agg3aggR$,agg%agg)} _f - 3 scrolls labelled UCOCURHIDDIM (gained 1)agg,agg,:=agg-aggN0agg3agg3agg4agg57agg87agg9agg:agg<agg<agg=agg?aggBaggBaggCaggEagg&H,aggHaggK,aggrLaggPPL _You now have 73 gold pieces (gained 9).aggRagg!Sagg#Tagg;Vagg$X,aggYaggYagg[agg[agg\agg>_agga,aggcaggdaggBg,agggagg}iaggkagg>kaggkaggsm7 _You open the door.aggnaggnagguoaggpaggIraggtraggraggv@  There is an open door here.aggxagg_x _aggOzagg5{agg|,aggx}agg(~aggaggaggaggaggÂ,aggaggagg),aggoagg)agg~,aggɈaggagg,aggaggaggɌ,aggagg͍aggh,aggaggagg#.# #.# #.# # #.  #.#h# #. ##.#.### ##.####...... ..>..#####.#.##### ##..###.@. ...# ---######.#.### #.# .. .. aggT#.# #########.### #.# # agg2#.# #..### h   hound (asleep)#.###########..<#..........†.########.........#..###aggQz 96.7 (28.0)  A hound comes into view.aggaggʣk.hhagg6===7.7 (29aggagg& _The hound barks!agg-R #.# #.# #.# # #.  #.#.# #.  ##.#.###  ..h... ..> #.#####.#.#####  .......@....... ...#  .######.#.##### #.# ..  #.# ## #.#  #.#  #.#<aggRM #..†. ..agg<% #.# #.# #.# # #.  #.#.# #.  ##.#.###  ..h... ..> agg#.#####.#.#####  .......@....... ...#  .######.#.##### #.# ..  #.# ## #.#  #.#  #.#< #..†. agg#...aggagg_aggagg\ _A hound is nearby!aggW ((You shoot a sling bullet.agg  The sling bullet closely misses the hound.You shoot a sling bullet.agg_ aggIh .hThe sling bullet barely misses the hound.aggh ]9.0 (1.3)Rev aggXl aggm = _The hound bites you but does no damage.aggX, (((((((You shoot a sling bullet.agg  The sling bullet closely misses the hound.You shoot a sling bullet.agg@, .agg@....agg@.aggAehThe sling bullet hits the hound but does no damage.aggxB7-600.2 (1.2Rev+ aggIaggWk  _The hound bites you.  aggW:You shoot a sling bullet. The sling bullet hits the hound.agg (((((((The hound is heavily wounded.aggn2 ..aggo4....haggmorYou shoot a sling bullet. The sling bullet misses the hound.aggo(1.4agguagg|9  aggw|_The hound bites you but does no damage. The hound barely misses you.You shoot a sling bullet. The sling bullet hits the hound!aggZ  The hound is almost dead.agg4PYou shoot a sling bullet. The sling bullet hits the hound!agg' q†aggagg-912.7 (1.3Rev* aggGaggF_ _You kill the hound!aggaggagg^ _No target in view!aggagg agg^ _No target in view!agg?aggagg^ _No target in view!agg#aggagg^ _No target in view!aggfaggagg| _No target in view!aggaggC _No target in view!aggOaggXPaggTagg>Wagg1agg,aggLaggagg2< agg< aggA aggC agg agg0 agg agg agg( agg( agg- agg'0 agg agg agg agg aggxM aggN agg9S aggU agg$ agg> aggO aggI8 agg8 aggB> agg@ agg aggD agg agg. agg$ aggB% agg* agg, agg agg| agg aggR agg4agglaggAUnknown command.aggaggԭagg|agg(agg48= agga_agg9:Rev+ aggaggջa  You see here a hound corpse.aggs .# #.# #.#   #.#   #.# # #.  #.#.# #. .#.#####.#.##### ##). ..>..---4.7 (2.0.#####†#.##### ##................. ...# .######.#.###. #.#... ..... #.# ##########. #.# #.. #.# #..## #.###########..<.agg_aggG---5.7 (3agg*agg*$ _Found a spear.agg* Jagg{- agg/ agg4 Bagg6 agg6 :=agg8 aggc9 agg; agg; :Rev agg< agg= agg? agg@ agg@ aggtC aggE aggF aggF aggvH aggJ ,aggJ aggCL aggN aggO aggiO aggP aggR 0agg2S aggS aggT aggT aggU ,aggW aggDW aggiX agg=d agge ,aggnf aggg aggvj ,aggj agg&l aggn aggn aggo aggp agg v aggv aggvx agg<| Baggv} agg ,agg agg agg ,agge aggօ agg, ,agg agg agg ,agga aggs agg ,aggn agg agg ,aggS agg agg ,aggJ agge aggΝ agg agg agg agg ,aggV agg& aggȩ ,agg agg" agg ,aggn aggг agg ,agg agg agg> ,aggm aggv agg ,aggl agg agg ,agg, agg9 agg ,agg agg aggb agg agg aggH agg ,agga aggj agg agg agg aggv agg agg3 agg agg agg ,aggK agg agg ,agg agg agg ,agg agg agg* ,agg; agg aggV ,agg agg aggX agg aggh agg6 agg aggN agg{ agg agg ,agg agg; agg+ ,agg! agg" agg$ ,aggJ% agg}& agg{( ,aggx) agg+ agg. ,agg. agg0 agg2 ,agg/3 agg/6 ,aggz6 agg+7 agg8 agg]: ,aggn; agg= aggJ? ,agg? aggSA aggC ,aggAD aggF aggH aggH aggI aggK 7 _You open the door.aggN 3agg1O aggS @  There is an open door here.aggU aggFV  _aggW aggX aggZ ,agg9[ agg%] agg_ ,agg3` agga aggd ,aggre aggf aggh ,agg}i aggj agg m ,aggm aggCo aggq ,agg(r aggs aggv ,agglv agg x agg2 #......##......# ###+#'## #.## #..# ##.#  agg #.###   #...## ###@.#71.7 (66.0) #.......########.#  agg .# .# .#agg .# ># agg agg ,2.7 (67agg agg J _Found a stone staircase leading down.aggg ,3.7 (68agg5 agg = _You now have 82 gold pieces (gained 9).aggagg3aggagg!#......# ###+#'##  #.## #..# ##.# #.####...#g####..# #......@# #######.#  #.# #agg).##.##.# g   goblin (asleep).>####agg\,0.0)agg+4.7 (1agg2aggis _A goblin comes into view. It is wielding a +0 club.agg> (((((g  You shoot a sling bullet. The sling bullet hits the goblin.  The goblin shouts!aggQ( (The goblin is heavily wounded.You shoot a sling bullet.agg}aggO/.g....aggc===5.9 (1.2Rev aggIaggYa _The sling bullet closely misses the goblin.aggHh~ ((((((You shoot a sling bullet.agg  The sling bullet closely misses the goblin.You shoot a sling bullet. The sling bullet hits the goblin.agg5pagg raggv+...g..aggw-7.2 (1.3agg5w7Rev+ agg |agg _The goblin is almost dead.You shoot a sling bullet. The sling bullet hits the goblin.aggra)((aggA ((((You kill the goblin!aggK...)..aggo058.5aggaggE _You shoot a sling bullet.aggHagg9agg^ _No target in view!aggAaggֵaggֻ^ _No target in view!aggaggaggo^ _No target in view!aggaggaggH _No target in view!aggu0 agg=1 agg4 agg7 H _No target in view!agg aggx agg agg C _No target in view!agg agg agg9! agg# agg agg agg} agg* agg aggo agg agg, agg agg aggw aggԈ agg agg aggK agg agg= agg aggr agg aggF agg  Q _agg_ agg agg agg agg! agg! 7Rev agg&" agg# agg$ agg% agg% agg' agg) agg * agg* aggm, agg. ,agg7/ agg{1 Q _ There is a stone staircase leading down here.aggQ4 agg4 0 _agg6 agg8 aggA; agg; aggi< agg> aggA ,aggB aggxD aggG ,aggG aggI aggL aggVL agg3M aggAO aggR ,aggR aggT aggW ,aggX aggY agg[ ,agg] agg$_ aggla agga aggHb agg,d aggf ,aggg aggi aggIl aggl aggEm aggo aggWq aggq aggr aggTt aggv agg=w aggx aggy agg{ ,agg| agg} aggy agg agg agg agg ,agg. agg agg͇ agg aggf agg agg ,aggA agg agg ,agg aggя agg ,agg agg$ agg ,agg agg agg͚ agge ,aggY agg֝ ,agg aggɟ agg  #......# #......# #......# #......#. agg ###+#'##..# #.###...##+ #..#.....##### ##.#...@...##.###---......###.##...##aggA #.....g #.# #.####..#....... #.# #...)...######## #.# #######.#agg  #.###### #.# g   goblin (asleep) #......## #.# ######..### #.#agg P##...###.#agg& 707.5 (29.0)  A goblin comes into view. It is wielding a +0 club.agg= bg.gagg &====agg %8.5 (30aggr aggg ( _The goblin shouts!aggI         .   ..##.##  #...##+ #..#  #......##### ##.#  #......@...# #.###  #.....g###.#  #...... #.#  ....... #.# #...)... ####### #.# . #. #. #......## #. ..### #. ##...###.agg         .   ..##.##  #...##+ #..#  #......##### ##.#  #......@...# #.###  #.....g###.#  #...... #.#  ....... #.# #...)... ####### #.# . #. #. #......## #. ..### #. ##...###. _A goblin is nearby!aggg>  You shoot a sling bullet.aggT  The sling bullet hits the goblin but does no damage.  You shoot a sling bullet. The sling bullet hits the goblin.agg=m  The goblin is heavily wounded.agg7-===-9.6 (1.1)Rev aggLagg79 _The goblin hits you with a +0 club.aggw (((You shoot a sling bullet.agg:8o  The sling bullet barely misses the goblin.agg" g..  You shoot a sling bullet. The sling bullet misses the goblin.5----10.8 (1.2agg _The goblin hits you with a +0 club.  You shoot a sling bullet. The sling bullet hits the goblin!agg-j)agg^  (((You kill the goblin!agg;)..agg#......#SunshineJesse the Shooter#......#Coglin#......#Health: 26/28 ======================--#......#Magic: 3/3========================.agg###+#'##AC: 3Str: 11..##.##EV: 11Int: 8#...##+#..#SH: 0Dex: 19#......##### ##.#XL:  3 Next: 100% Place: Dungeon:2#......@...##.### Noise: ===------  Time: 711.9 (1.1)agg#.....)###.##...## a) +2 sling {Septima d) +0 sling {Arun} #...... #.# #.####..# Fire: a) +2 sling {Septima} ....... #.# #...)...# Rev+ aggR,####### #.# #######.##.###### #.# #......## #.# ######..### #.# agg4##...###.# You shoot a sling bullet.  The sling bullet barely misses the goblin.You shoot a sling bullet. The sling bullet misses the goblin. aggǴ_The goblin hits you with a +0 club.  You shoot a sling bullet. The sling bullet hits the goblin!  You kill the goblin!aggp _You shoot a sling bullet.  You have reached level 4!aggjagg/  --more--aggI s31/34-4/494 0% agg aggu f _You feel clever.agg agg agg H _No target in view!agg'aggaggaggAagg2= _aggaggB:Rev aggaggY ,agg agg agg3 i3==agg agg agg aggagg;aggaggaggaggaggaggagg h4==aggagg;agg*,agg!aggagg"agg#agg#agg'%  aggI'You see here a +0 club.agg=)agg) _agg*agg,agg/agg/9=agg0agg2agg5agg5agg7agg}9agg;agg;agg<agg>aggAaggAaggCaggmEaggGaggGaggHaggKaggN,aggkOaggQaggTaggTagg|VaggZaggd#.# #.#+# ###..### #......# #...###..## #...aggd..... #... ##...... #... #.... #... #....... #...--- #....#.####J.. ###+ #... #..###  #)# ##...##+aggd# # #......####aggd##..........# J   endoplasm (asleep)agg+eq#.....)###.##......# #.# #..........# #.# #.agg{ 30.9 (19.0)  An endoplasm comes into view.---1.9 (20aggj|T _Found a runed sling.aggG #.#  #+#  .### ...# ###..##  .......  ##.... ..  aggQHu#.....####....  #.....@.......  #....#.####J..  #... #..###  #)# ##...##+#  # #....  #..........#  #.....)###.#  #......# #.#   #.# agg #.#  #+#  .### ...# ###..##  .......  ##.... ..  #.....####....  #.....@.......  #....#.####J..  #... #..###  #)# ##.. # #.... #..........#  #.....) #......# #.#   #.# aggaggagga _An endoplasm is nearby!agg ((((J  You shoot a sling bullet. The sling bullet hits the endoplasm.agg (((The endoplasm is severely wounded.agg@/You shoot a sling bullet.aggm0r  The sling bullet barely misses the endoplasm.agg:1...J...aggw;/===3.1 (1.2agg;8)Rev aggDagg F aggFP_The endoplasm jiggles.agge (((((((You shoot a sling bullet.agg/  The sling bullet barely misses the endoplasm.You shoot a sling bullet. The sling bullet hits the endoplasm.aggSagg,.......agg<l24.4 (1.3Rev+ aggZ!agg#M _You kill the endoplasm!agg #.# # #+# ### .### # ...# # ###..### # ........ # ##....# .. #agg  #.....####.... # #. # #....#.####... ### #....#..### #)#####...##+# # #......##### #..........# #.....)###.# #......# #.# # .# #.# #aggagg6---50aggaggagg #.# ..##+#  .### .. # ...# .. # ###..###.agg # .. # ##....# .. # #.....####.... # #. # #....#.####...  #....#..### #)#####...##+# #. #......#####agge# #....# #.....)###.# #......# #.# .# #.#agg agg q---6Rev aggaggaggpw..##+# #.### ..  ...## ####..### # ....... # ##....# .. # #.....####.... # #............. # #..@.#.####... # #....#..###  #)#####...##+# #. #......##### # #..........# #.....)###.# #......# #.#...# #.# ########## #.#agg {agg{&7agg~aggDaggz 9.### ..  ...## ###..###  .......  ##....# ..  #.....####.... agg  #.............  #....#.####...  #.@..#..###  #)#####...##+# #. #......##### #. #..........# #. #.....)###.##. #......# #.# .. ...# #.# #. ########## #.#  #.## agg aggq &8agg agg agg  ...#####..### ....... ##....# .. #.....####.... #............. #....#.####... #....#..###  #@#####...##+# #.# #......##### #.# #..........#agg?  #.# #.....)###.# #.# #......# #.# ... ...# #.# #.# ########## #.# #.# #.# #..agg. D9agg agg  agg q_You see here a +0 sling of electrocution.aggaggyEquip which item?  - - Unarmed aggInventory Items Hand Weapons (go to first with )) agg" a - a +2 sling (weapon) {Septima}  d - a +0 sling (offhand) {Arun} Armour (go to first with [)  b - a +0 leather armour (worn) Floor Items ([,] to select) Hand Weapons aggVa +0 sling of electrocution[?] describe selected agg[!] equip|wield|wear[tab] equip|unequip aggagg~agg...## ..SunshineJesse the Shooter###..###.Coglin........Health: 34/34 ========================##....# ..Magic: 4/4========================#.....####....agg\AC: 3Str: 11#.............EV: 11Int: 9#....#.####...SH: 0Dex: 19#....#..###XL:  4 Next:  2% Place: Dungeon:2#@#####...##+#Noise: ---------  Time: 739.4 (0.0)#.# #......##### a) +2 sling {Septima d) +0 sling {Arun} aggV#.# #..........# Fire: a) +2 sling {Septima} #.# #.....)###.#agg#.# #......# #.#... .........# #.# #.# ########## #.# aggt#.##.# #..agg&  _The endoplasm jiggles.You shoot a sling bullet.  aggMThe sling bullet barely misses the endoplasm.You shoot a sling bullet. The sling bullet hits the endoplasm. agg~(_You kill the endoplasm! aggj_You see here a +0 sling of electrocution.aggJw  You're wielding all the weapons you can. Replace which one?(? for menu, Esc to cancel)< or a - a +2 sling {Septima}; > or d - a +0 sling {Arun}agg9 agg 340.4 (1 _agg aggS h  You start parting from your weapon.aggU +1.4 (2aggA agg agg= +2.4 (3agg= aggN agg +3.4 (4agg m4.4 (5agg- H } aggz _You continue parting from your +0 sling {Arun}. x4  You whisper farewell to Arun.agg7 agg agg  You finish parting from your +0 sling {Arun}.  You start attuning to your weapon.5.4 (6agg agg. +6.4 (7agg agg agg= +7.4 (8agg agg agg +8.4 (9agg$ agg* agg+ /9.4 (10.0)aggf/ agg1  j) +0 sling (elec) _You continue attuning to your +0 sling of electrocution. x5agg< /  --more--aggxKc {You finish attuning to your +0 sling of electrocution.  You hear the crackle of electricity. _You welcome your +0 sling of electrocution "Malena" into your grasp.aggIagg aggaggP _aggXBaggaggaggΞaggbaggaggV#.....####.... #............. #....#.####.......#..### .#####...##+#agg֩7.# ######.# #..........#.# #.....)###.# #......# #.##B.............# #.###.############ #agg )  #..#.# ### B   giant cockroach (asleep)agg-* agg agg52.4 (3.0).BB3.4 (4aggp _A giant cockroach comes into view.aggV   #..  #..  #..  #.#  #.#  #.#  #.# ) #@#   #.B............#  ###.############ agg0 #.#  #.#  #.#  #.# #.#aggM    #..  #..  #..  #.#agg M  #.#  #.#  #.# ) #@#   agg #.B............#  ###.############  agg \#.#  agg* #.#  #.# agg  agg #.# #.# agg' agg' agg8 t _A giant cockroach is nearby!agg Y(You shoot a sling bullet.agg g _A giant cockroach is nearby!shoot a sling bullet.  The sling bullet barely misses the giant cockroach.  You shoot a sling bullet.  The sling bullet hits the giant cockroach.  Lightning courses through the giant cockroach!aggO )agg+ l .  You kill the giant cockroach!agg/ k4===4.7 (1.3Rev agg6 3agg1B /  --more--agg . _You hear an angry hiss.bgg}vbgg~I ....bggO`#.####.### #####...##+#.# #......#####.....# #.)####l#.#####......# #..@.......##.###########bgg? #.# .l   frilled lizard (wandering)#.#bggS0.0bgg!5---5.7 (1bggLbggY _A frilled lizard comes into view.bgg%   #..  #..  #.#  #.#  #.#  # #.# ) #l#.#####......#  #..@...........#  ###.############  #.#  #.#  #.#  #.# #.# #.#bgg#   #..  #..  #.#  #.#  #.#  # #.# )bgg( #l#.#####......#  #..@...........#  ###.############  #.#  #.#  bggظ#.#  #.#bgg] #.# #.# bggbbgg :---bggbggQ] _A frilled lizard is nearby!bgg7' fYou shoot a sling bullet.  The sling bullet hits the frilled lizard.bgg, d.(bggճ o(You kill the frilled lizard!bgg< +..bgg@ ?6===6.9 (1.2bggE bggfH / _You shoot a sling bullet.bggObgg']bgg?_bgga7bggXbbggcbggXf0bgggbggjbggfl,bggymbggHobgg`q,bggqbggTvbggwbgg0xbggz,bgg},bgg~bggObgg,bggbgg{bggbggbggbggbggbggɍbggKbggbggbggMbggmbggڝbggbggƣXbggBbgg.bggbggBbgg>bggFBbgg=Xbgg5bggBbgg1bggXbggZ####...' #......# +......+ #......##......# ###..r...# ...#......# ## #@#--- #.#. .# #####.######...#.....##...#r   rat (asleep)####.##...# ##..#...##.......#bgg`094.9 (38.0)bggH---5.9 (39bggD bggpV _A rat comes into view.bggS ((r  You shoot a sling bullet. The sling bullet hits the rat.  The rat squeaks loudly.bgg (((The rat is heavily wounded.You shoot a sling bullet.bggf  The sling bullet closely misses the rat.bggmZ'....rbggasN  You hear a shout! You hear an angry hiss.bggs|====7.2 (1.3)Rev bggVybggybggJ/  --more--bggî7 _Something unseen opens the door.bggcnYou shoot a sling bullet.  The sling bullet hits the rat but does no damage.bggz(((((The rat is heavily wounded.bggtYou shoot a sling bullet. The sling bullet barely misses the rat.bggAzf r......gbggz...rr   quokka (wandering)g   goblinbggzr   ratA quokka comes into view.A goblin comes into view. It is wielding a +0 club.bgg{===-8.4 (1.2Rev+ bgg(bgg4-bgg)/  --more--bggoO _The rat closely misses you.bgg9UYou shoot a sling bullet. The sling bullet hits the rat.bgg?.rbgg2(((bgg5F((You kill the rat!bggKbgg'Nbgg0U}'r......'....g.bggpU..bgg5Yo79.6Rev* bgg_bgg{c' _You shoot a sling bullet.bgg+bggbggbggw> _Unknown command.bgg_XYou shoot a sling bullet. The sling bullet hits the goblin.bggq)(((bggC ((((You kill the goblin!You shoot a sling bullet.bggbggbgg |...r...bgg%79800.9 (1.3bgg,bgg.` _The sling bullet barely misses the quokka.bgg]bgg^bggebgg2jF _Unknown command.bggw (((You shoot a sling bullet. The sling bullet hits the quokka.bgg   The quokka is lightly wounded.  You shoot a sling bullet. The sling bullet hits the quokka.bgg)C)bggbgge l...l   frilled lizardYou kill the quokka!bggͪ1122.2bggbgg޴a _A frilled lizard comes into view.bgg (((((((You shoot a sling bullet.bggݖ  The sling bullet barely misses the frilled lizard.You shoot a sling bullet.  The sling bullet hits the frilled lizard!bggDbgg՞!bggp' bgg4( †bggs( .bgg( .bgg( )bggV) .bgg) .bgg) .bgg. bggQ/ 3bgg/ 3.4 (1.2bgg5 bgg09  bgg9 bgg9 ._You kill the frilled lizard!bgg : bggZ bggf` bgg` bggi bggEm  bggm bggm "_Unknown command.bgg$n bggϚ bgg bgg' bggb H _No target in view!bgg7 bgg bgg bgga bgg  bgg bgg "_Unknown command.bgg, bggV| bgg| bggǂ bggs H _No target in view!bgg bgg bgg bgg F _Unknown command.bggc4bggahbggk _Unknown command.No target in view!Unknown command.No target in view!Unknown command.No target in view!bgg^ Jbgg bgg=bggQ _bggbggbggbggVbgghbggbggbgg"bgg$bgg$:Rev+ bggr&bggv(bgg}+bgg+bgg,bgg1 _ Things that are here:  a +0 club; a quokka corpse; a goblin corpsebgg4bggB5 _bgg[6bgg_8bggT;bgg;bgg<bgg?@  There is an open door here.bgg CbggCFRev  _bggDbggGbggN #. >..#.# #.#..)... #.#.#.#.#.# #.#.......bgg_O ###.#.#.#####. . .....#.......  #.#.#.....## ####.@.†.....'.---11.4 (8.0#......#.....##bggJPL+......'.....'.#.....)#.....## #......#.....# ###......#.....# ..#......####### ########.##.#bggv[]---2.4 (9bgg ^bgga; _Found a stone staircase leading down.bgg#bggj$bgg*,bgg -bgg0,bggB2bggh5bgg5!bggV7bgg9bgg =bggQ=bgg>bggBbggEbggUEbggRFbggKBbgg&LbggNbggPbggQbggWRbggkTbgg]WbggWbggXbggZbgg]bgg]bggM^bggcbggdbggdbggebgggbggj,bggkbggmbggXpbggpbggqbggsbgg?v,bggvbggxbggzbgg0{bgg{bggbggbggփbggbggbgg          #    #.  #.########  bgg1`.:.=...#   #.@# #.# 26.4 (14.0)  #..# #.# ##  #..# #.#>. ...  #..# #.#.....  #..# #.#.#.#  #..# #.#....  #..#####.#.#.#####.   #..........#.......  ##.#####.#.#.....## bggڕbgg+bggO%7.4 (15bggbgg͞Q _Found a large granite ring.bggF 3bggH bgg[M Bbgg=Q ,bggSS ,bggT bgg\         ##  #.  #.######## bgg]  #..@.=...#  #..#####.#  #..# #.# ##  #..# #.#>.  #..# #.#..... #..# #.#.#.# #..# #.#.... #..#####.#.#.#####.  #..........#.......You pick up a book of Necromancy and begin reading...bggcd 19.4 (2.0)bgg(e ,30.4 (3bgg k bggk  bggk j You add the spells Soul Splinter, Grave Claw and Vampiric Draining to your _library.bgg&/       ##  #.  #.#  #...@=...#  #..#####.#  #..# #.# ##  #.. #.. #.. #.. #.. 1.4 (1bgg'5 bgg       ##  #.  #.#  #....@...#  #..#####.#  #..# #.# ##  # bgg% bggb& &2bgg* bggZ/ _You see here a ring of protection from fire.bgg3bggHbggbggUbggP _bgg!bggY!bggS"bgg#bgge&,bgg7'bgg(bggz+,bgg,bgg-bgg0,bggz3bggn9bggHbggIbggJ bggPJ bggJ bggJ bgg'K&  bggsK0  bggK0  bggK###bgg9L  #.@......SbggLZ  #.########bggL}  #....=...# bgg$M  #..#####.#bggN  #..# #.# ##bggO  #..# #.#>. ...bggOzS   ball python (constriction, asleep)bggOh  #..# bggP#.#.....bggPPy  #..# #.#.#.#bggP bggP_  #..# #.#bggQ%....bggT^bgg_$7.4 (5bggv`bgg`$8.4 (6bgggbggm bgg_nbggn:_A ball python comes into view.bggnbggS ##########  #.@......S  #.########  #....=...#  #.  #..# #.# ##  #..# #.#>. ...  #..#   #..#   #..#  bgg  ##########  #.@......S  #.########  #....=...#  #. #..# #.#  #..# #.#>. ...  #..#  #..#  #..# bgg b _A ball python is nearby!bgg h ##########  bgg #.@......S  #.########  #....=...#  #.  #..# #.# ## bgg @ #..# #.#>. ...  #..#  bggI / #..#   #..# bggq " bgg P ##########  #.@......S  #.########  #....=...#  #. #..# #.#  #..# #.#>. ...  #..#  #..#  #..# bgg bggt bgg bggż b _A ball python is nearby!bggue  You shoot a sling bullet. The sling bullet hits the ball python!bggg((((((†bgg9 (You kill the ball python!bggWN......†bggS[k4===9.7 (1.3Rev bggabgg;d/ _You shoot a sling bullet.bggnbgg%obgg0ubggwH _No target in view!bggp4bggqbggUtH _No target in view!bgg-4bggmbgg-bggbgg; _bggbggV,bggbggfbggbggbggbggbggbgg!bggbggubggbggbggbggbgg],bggzbggbgg,bggAbgg g  You see here a ball python corpse.bggbgg< _bggnbggbgg,bgg(bggbggubggbggbgg. bgg",bgg$bgg%bgg),bggd*bgg,bgg/,bgg00bgg"2bgg4,bgg5bggv7bgg29,bgg9bgg<=bggwIbggJbggJbggKbggJMbggO,bggPbggZTbggV,bggXbggYbggW\bgg\bgg]bggT_bggabggbbggcbggdbggf,bgghbggkbgg(n,bgg>obggPqbggBs,bgggtbggxbggG....†..######## #.#.##### #####.......... .# #.#.# =...#.^##########.# #.#.# ###.#...........#.# # #.#.#  #.#.#.#######.#.#.# #.#.# bgg #.#>........#.#.#.#####.#.#####  #.#............)...............  #.#.#.#####.#.#.#.#####†#.#####  #.#....................---64.7 (25.0) ###.#.#.#####.#.#..######.#.##### bgg......#.......#.#..# #.#...... ###.#.#.....###.#.[# #.####### ###...†.....'...#.$# #.# ......#.....#####..# #.# ......'.....'. ..# #.#######bggO  .....)#.....## #.# #........  bgg|......#.....# ########...... bggbggEH---5.7 (26bggbgg) _Found a scale mail.bggj 3bgg!l bggp bggu ,bggx ,bgg{ bgg3| bgg} bgg bgg bgg[ bgg bgg B  You see here a +0 scale mail.bggޑ bgg[  _bgg bgg ,bgg% bgg L _You now have 89 gold pieces (gained 7).bgg 3bgg bgg2 bgg bgg B  You see here a +0 scale mail.bgg' bggd  _bggj bggǼ bgg bggſ bggj bgg bgg: ,bgg bggS bgg >##### #.#......... .†..######## #g# #.#.######## ##.......... .#.# #.#.# .#.^##########.#.# #.#.# bgg ..#...........#.#.# #.#.# .#.#.#######.#.#.# #.#.# .#>........#.#.#.#####.#.######## .#............).................. .#.#.#####.#.#.#@#####÷#.######## bgg .#............................... .#.#.#####.#.#..######.#.######## ...#.......#.#..# #.#......... bggL .#.#.....###.#.[# #.##########†.....'...#..# #.# g   goblin (asleep)#.....#####..# #.#'.....'......# #.##########bgg v)#.....######.# #..........†bgg/ 76.7 (11  A goblin comes into view. It is wielding a +0 dagger.bgg\ `.ggbgg 5==7.7 (12bgg bggx ( _The goblin shouts!bgg;`  You shoot a sling bullet. The sling bullet hits the goblin.bgg})(((((bgg$F ((You kill the goblin!bggj.).....bgg-6=bgg@8.9 (1.2)Rev bggQbgg / _You shoot a sling bullet.bgg > 4bgg? bggD bggG bggL Bbggdt bggTy Bbgg{} bgg]~ bgg~ bgg bgg bggņ bgg bggˆ bgg bggߍ ,bgg bgg bgg ,bgg bgg bggї bgg bgg bgg{ bggz ,bggC bgga ~  Things that are here:  a +0 dagger; a goblin corpsebgg bgg?  _bgg bggX bgg ,bgg bgg bgg ,bgg bgg bggg ,bggF bgg0 bgg bgg: bgg bgg bggd ,bgg bgg ~  Things that are here:  a +0 dagger; a goblin corpsebgg8 bgg  _bgg bgg bgg ,bgg bgg bgg ,bggR bgg bgg$ z #.#######.#  #......### #.#####.#......... .†..##.####### #..#)^###.#......#.#.# #.#.# bgg #.#######.#.#.# #.#.# >........#.#..---.).......r.#.#####÷ .#............................... .#.#.#####.#.#..######.#.#########.#..r   quokka (wandering)#.#.[.#..bgg 1901.9 (23.0)bgg3 R.rbgg H---2.9 (24bgg bgg1 Y _A quokka comes into view. bggY   #.. #.# .†#.# #)# #.#.# ^.#.# #.#.# .#.# #.#.# .#.# #.#.# >.#@#.....)........#.#.#.#.#####÷#......#.#..###.#..# #.#.[# †#..# #.#  #.#  bggVa   #.. #.#†#.# #)# #.#.#  bgg^.#.# #.#.# .#.# #.#.# .#.# #.#.# >.#@#.....)........#.#.#.#.#####÷#......#.#..###.#..# #.#.[# †#..#  bggS  bgg bgg bgg  bggm] _A quokka is nearby! bggU ((((((r  You shoot a sling bullet. The sling bullet hits the quokka. bgg  The quokka is moderately wounded.You shoot a sling bullet. The sling bullet hits the quokka.  Lightning courses through the quokka!! bggP† bgg w,...... bgg xo9===4.1 (1.2)Rev  bgg bggJ _You kill the quokka! bgg4 bgg  bggb) bggn, bgg, bgg/ bgg1 bgg4 bgg4 bgg_6 bgg8 bgg; bgg=<! bggu= bgg@ bgg\C0 bggD bggG bgg\I bggI bgg(K bggL bggO bggLO bggbQ bggUc  You see here a hound skeleton. bggX bgg4Y _ bggZ bgg.] bgg_ bgg_ bgg` bggc bgge bggf bggf bggh bggj bggSk bggl bgg*n bggp bgg`p bggYq bgg"s bgg v, bggw bggx bgg!{ bggu{ bgg| bgg~ bgg bggn###.#.#.#.#####÷#.###..#### .............................# .#.#..######.#.##########.#### ....#.#..# #.#................ ..###.#.[# #.############.#### ..'...#..# #.# #...... ..#####..# #.# #..#### . bgg.'......# #.###########..<... ..######.# #.@........†.......---.# #.########...#..#### ..# #........'g........#..# ### ##########......[..#..# #.........#..# #.#########..# g   hobgoblin (wandering) #.# #..#  ##### #.# #..# ##...# #.# #..# bgg017.1 (13.0) bggH---8.1 (14 bgg  bggΡ\ _A hobgoblin comes into view. bgg (gYou shoot a sling bullet.  The hobgoblin shouts! bgg1}  The sling bullet hits the hobgoblin but does no damage.  You shoot a sling bullet. bgg bgg g.  The sling bullet hits the hobgoblin but does no damage. bgg0---====9.3 (1.2)Rev  bgg bgga- _The hobgoblin hits you. bgg >  You shoot a sling bullet. bgg`! ((((The sling bullet hits the hobgoblin but does no damage.  You shoot a sling bullet. bgg8 g...  The sling bullet completely misses the hobgoblin. bgg ===-20.6 (1.3Rev+  bggl  bggx V _The hobgoblin barely misses you. bggt%c  You shoot a sling bullet. The sling bullet hits the hobgoblin. bgg  The hobgoblin is lightly wounded.  You shoot a sling bullet. The sling bullet hits the hobgoblin. bggD$ bggE bggJ1---21-1.7 (1.1 bggR bggTM _You kill the hobgoblin! bggk bggk bgg|s bgg8vH _No target in view! bgg; 4 bgg<  bgg>  bggB ; _ bggC , bgg E  bggG  bgg,H  bgg6I  bggsK  bggK  bggK ^2=Rev  bggM  bggO  bggPO  bggkP  bggR , bgg T  bggV , bggW  bggY  bggDZ q3== bgg[  bggt]  bgg]  bgg^  bgg a , bggGb  bggd , bgg-g  bggh 94 bggi E== bggRi  bgg0k  bggm  bgg`m  bgg~n  bgg  You now have 101 gold pieces (gained 12).  Things that are here: bgg  bgg^ j _a +0 plate armour; a hobgoblin corpse bgg 3 bggy  bgg  bgg  bgg 9= bgg  bgg>  bgg , bgg  bgg  bgg= , bggC  bgg  bggl , bgg  bgg_  bgg , bgg״  bgg  bgg޷ , bggN  bgg  bgg% , bggƺ  bgg  bggo , bgg  bgg  bgg  bgg  bggS  bgg  bgg , bgg  bgg% 7 _You open the door. bgg 3 bgg]  bgg @  There is an open door here. bggl  bgg  _ bgg  bgg#  bgg , bgg  bgg  bgg  bgg  bgg  bgg  bggZ , bgg;  bgg  bgg , bggj  bggG  bgg  bgg*  bgg  bgg  bgg , bgg  bgg  bgg , bgg  bgg  bgg , bgg  bgg  bgg , bgg  bgg  bgg , bgg  bgg  bggd , bgg  bgg  bgg  bgg:  bgg  bgg  bgg , bggb  bgg  bgg , bggI  bgg  bgg  bgg.  bgg  bgg  bggE , bgg  bgg  bgg! , bggS"  bggs#  bggC%  bgg%  bgg!&  bgg'  bgg\)  bgg)  bgg)  bgg +  bgg, , bgg.-  bgg.  bggU0 , bgg0  bgg_2  bgg9  #.........#.#####...##+##  #.#.# ###### #.........#.# #.......... #########.#.# #.....)###.# #.#.#####......# #. bggz: [#..............# #.# ###.############ #. #.# #.# #@# #---69.7 (48.0) #.#  #.#  #.##.##.##.# #<#  bgg:  bgg?  bggq@ I---70.7 (49 bggC  bggF 9 _Found a stone staircase leading up. bgg] 3 bgg^  bggA`  bgg:e B bgg=g  bggh  bggh  bggi  bggj  bggk , bggok  bggl  bggm , bggn  bgg0o  bggp , bgg_p  bgglq  bggr  bgg9r  bggfr  bggs  bgg4t , bggt  bggv  bggw  bggMw  bggw  bggx  bgg z , bggz  bgg|  bgg~ , bgg~  bgg%  bgg' , bgg  bggl  bggˆ , bgg  bgg"  bgg , bgg_  bgg  bgg/ , bggđ  bggƒ  bgg%  bgg  bgg"  bggQ  bgg  bggm  bgg  bgg  bgg  bggH  bgg  bgg  bggş , bgg  bgg  bgg , bgg  bgg  bgg]  bgg  bggߤ  bgg  bgg}  bgg  bgg  bgg  bgg  bgg! , bgg  bgg1  bgg  bgg  bgg  bggt , bggޭ  bgg׮  bgg , bggF  bgg*  bgg  bggI  bgg  bggd  bgg_ , bgg´  bgg  bgg[ , bgg϶  bggz  bggc , bgg׸  bgg  bgg! , bgg  bggh  bgg  bggŽ  bgg  bggǾ  bgg  bgg  bgg"  bgg  bgg , bggd  bgg  bgg  bgg  bgg&  bgg  bgg  bgg2  bgg  bggs  bgg , bgg , bgg} , bgg  bggz  bggF  bgg  bgg1  bgg  bggI  bgg}  bggm  bggH  bgg , bgg  bggJ  bggW  bgg  bgg  bgg  bgg5 B bggv ~  Things that are here:  a +0 club; a goblin skeleton bgg bgg _ bgg bggz bgg bgg bgg bgg  bgg , bgg  bgg bgg, bgg bgg^ bgg bgg bgg|  bgg/% bgg& bgg' bgg( bgg* bgg+, bgg2, bgg/ bgg1 bgg2 bgg2 bgg7 bgg8 bgg9 bggm: bggoB#...#...# #......# #...#...# #......# #...#...# #......# ........# #......# ####....#.....# ####....#.....# ........# #......#  bggC.####...# ###+#'## ..###...#.## #...##+##.#..# #......##### #.##.# #..........# #.##.### #.....)###.# #.##...## #......# #.# #.####..# .......# #.# #...)...# ######## #.# #######.##.###### #.# bggH#......##......##......##..............'1021.7 (51.0) bggvN bggOM======2.7 (52 bggX bggZ= _As you open the door, it creaks loudly! bggQ 3 bgg  bgg bgg) bgg bggy  bgg!@  There is an open door here. bgg # bgg#5 _ bgg% bgg&, bgg?' bgg ) bgg*B bgg, bgg,, bgg=- bgg/ bgg/, bgg80 bgg2 bgg?4, bgg4 bgg6 bgg7 bgg7 bgg8 bgg9 bgg:, bgg: bgg< bggx=, bgg= bgg? bggA, bggB bggC bggD, bggPE bggF bggG, bggpH bggJ bgg2K, bggK bgg4M bggN, bggN bggO bgg,Q bggaQ bggQ bgg*S bggT, bggT bggV bggW, bggX bggZ bgg\ bgg8] bgg6^ bgg` bgg9c, bggd bggf bgg>i bggvi bggj bggl bggo, bggVp bggr bggt, bggv bggw bgg\z, bggT| bgg~ bgg , bggX bggƃ bgg, bgg@ bgg bgg] bgg bgg bgg bgg, bggb bgg bgg  bggF bgg bggؑ bgg@ bggv bggԓ bgg bgg` bgg bgg  bgg- bgg, bggɚ bgg bgg bgg, bgg bgg' bggj bgg bgg bggA######## ..... #.# ###### #.#  # #.#  # #.#  # bgg[d #.#  bggQ # #.# #######.#######.########......>.......@......g------######..######.################# ...# #.................. ########.######..###############. ..........................#..<.#. ########.#############..#.#..###. g   hobgoblin (asleep) #........................#. bgg#..############.....##.#.#. #######..<.....# #.....##.#.#. bgg bgg}&56.7 (34 bgg bgg------ bggJ%7.7 (35 bgg bgg\ _A hobgoblin comes into view. bgg+\ 4 #.# #.# #.# #.# #.# #.# #.# #.# #.# #.#######.######## >.......@......g ######.######## bgg] #.#........<.####### #.. #...<  bgg P #.# #.# #.# #.# #.# #.# #.# #.# #.# #.#######.######## >.......@......g ######.######## #.#........<.####### #.. #...<  bgg`  bgg  bgg  bgg ` _A hobgoblin is nearby! bgg ((((((gYou shoot a sling bullet.  The sling bullet hits the hobgoblin but does no damage. bgg5 (The hobgoblin shouts!  You shoot a sling bullet. bggJ  bgg  bgg .....ggg   goblin (wandering)The sling bullet closely misses the hobgoblin. bggW g===8.8 (1.1)Rev  bgg  bgg u _A goblin comes into view. It is wielding a +0 dagger. bgg  bggy! bgg)((((( bgg#  bggbg bgg bgg6You shoot a sling bullet.  bggSThe goblin shouts!  bgg$The sling bullet hits the hobgoblin. bgg$  The hobgoblin is almost dead.You shoot a sling bullet.  The sling bullet barely misses the hobgoblin. bgg?+/  --more-- bgg$  The sling bullet hits the goblin. Lightning courses through the goblin!() bggܫ ZYou kill the goblin!You hear a shout!....g.gg   goblinA goblin comes into view. It is wielding a +0 dagger. bggI W460.0 (1.2Rev+  bgg  bgg  bgg  _You hear a shout! bgg (((((( You shoot a sling bullet.  bgg6 uThe sling bullet barely misses the hobgoblin.The sling bullet hits the goblin. bgg  The goblin is severely wounded.You shoot a sling bullet. The sling bullet hits the hobgoblin. bgg͘ yg    bgg4 ....g.)61.3 (1.3 bgg:  bgg= M _You kill the hobgoblin! bggs `  You shoot a sling bullet. The sling bullet hits the goblin. bgg (((() bggT (((You kill the goblin! bggl....).) bgg5o82.6Rev*  bgg bggw/ _You shoot a sling bullet.bgg\jbggjbggbqbggjsH _No target in view!bgg74bgg<bggh?H _No target in view!bgg'>bgg>bgg@bgg`DbggGbggKWRev+ _bggVLbggNbggU # #.# .# #.# #.# #.# #.# #.# #.# #.# bggV#.# #.# .#######.##g>.........@..).).#---bgg2V..######.### #...#.######..##bggTVV.##.......#..<.#.#bggxV.#############..#.#..###.# g   goblin (wandering)#....#.#bggVD#..##.....##.bggVy..<.....# #.....##.bggV!bgg^,30bgg{^G---4.6 (2bggdbggis _A goblin comes into view. It is wielding a +0 club.bgg ((((((You shoot a sling bullet.bgg p  The sling bullet closely misses the goblin.bgg# bgg ...).ggbgg v===5.8 (1.2Rev* bgg bgg!" s _You shoot a sling bullet. The sling bullet misses the goblin.bggS  You shoot a sling bullet. The sling bullet hits the goblin.  Lightning courses through the goblin!bgg c(((()bggC ((You kill the goblin!bggbggR g..).).g   Robin (wandering)You shoot a sling bullet.bgg6317.1 (1.3bggbggo _Robin of the Strong Arm comes into view. They are wielding a +0 club.bgg (((((gYou shoot a sling bullet.  Robin shouts!bgg3  The sling bullet hits Robin but does no damage.  You shoot a sling bullet. The sling bullet hits Robin.  Lightning courses through Robin!!bggj9C)bggϼT  You kill Robin!bggbgg!/  --more--bgg g..).)bgg\ g   hobgoblin (wandering)hear a shout!bgg3 6538.2 (1.1bgg bgg T _A hobgoblin comes into view.bgg (((((g  You shoot a sling bullet.  The hobgoblin shouts!  The sling bullet hits the hobgoblin.bggH@ (The hobgoblin is moderately wounded.You shoot a sling bullet.bggC r  The sling bullet barely misses the hobgoblin.bgg )..).gbgg -9.4 (1.2bgg? bggQ bgg /  --more--bggJ( _You hear a shout!bgg [((((((You shoot a sling bullet.bgg The sling bullet closely misses the hobgoblin.You shoot a sling bullet.  The sling bullet hits the hobgoblin but does no damage.bgg bgg _..)g).bgg@ )70.6bggW bgg \ _The hobgoblin is moderately wounded.bgg  You shoot a sling bullet. The sling bullet hits the hobgoblin.  Lightning courses through the hobgoblin!bggd b(((.bgg1 (((You kill the hobgoblin!bggo k..).).bgg7 051.8bggu bgg / _You shoot a sling bullet.bgg0v4bgg}bgg.H _No target in view!bgg4bggbgg#"H _No target in view!bggbggbggJbggbggBbggD; _bggbggtbggbggubggHbggPRev+ bgg¹bgg~  Things that are here:  a +0 dagger; a goblin corpsebggKbgg _bgg<bggWbggg  .# #.#  .# #.#  .# #.#  .# #.# ## .# #.# .# .# #.# g# .#######.########)#  .bggJ>............).@.#  --- ..######.###################  # #.....#  #.######..#####.##  #..<.#.#  #.#####bgg..#.#..###.#   g   goblin (wandering) .....#.#  ..#####bgg;.....##.#.#.#  ..<.....# #.....##.#.#.#  bgg-5.8 (4.0bggL.gbggG---6.8 (5bggkbgg _A goblin comes into view. It is wielding a +0 club. _Items here: )) ††.bgg]  You shoot a sling bullet.  The goblin shouts!  The sling bullet hits the goblin.bggb e)bggr (You kill the goblin!bggll bggAw g)g   goblin  You shoot a sling bullet.bggH{ j7====8.0 (1.2bgg{ ?Rev* bggȂ bgg s _A goblin comes into view. It is wielding a +0 club.bgg  ((You shoot a sling bullet.bggv  The sling bullet closely misses the goblin.You shoot a sling bullet. The sling bullet hits the goblin.bgg1bgg3bgg9m  The goblin is heavily wounded.bgg_Cg)gg 2 goblinsbggD<===-bgg6D!9.2bggJbggWP _A goblin comes into view. It is wielding a +0 dagger of draining.bgg`  You shoot a sling bullet. The sling bullet hits the goblin.bgg|)   goblinbggU (You kill the goblin!bggbggUd.g)bggy_60-80.5 (1.3bggAbgg/ _You shoot a sling bullet.bgg0  You shoot a sling bullet. The sling bullet hits the goblin!  Lightning courses through the goblin!!bgge)bgg (You kill the goblin!bggm)21.7 (1.2bggbggx/ _You shoot a sling bullet.bgg_bgg_bgg#fbgghH _No target in view!bggN bggN bggS bgguV H _No target in view!bggu`YEquip which item?  - - Unarmed Inventory Items Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} Armour (go to first with [)  b - a +0 leather armour (worn) Floor Items ([,] to select) Hand Weaponsa +0 cluba +0 dagger[?] describe selected [!] equip|wield|wear[tab] equip|unequip bggbggbggƮM##  SunshineJesse the Shooter .# #.#  Coglin .# #.#bggX/  Health: 34/34 ======================== .# #.#  Magic: 4/4======================== .# #.###  AC: 3Str: 11 .# #.#.#  EV: 11Int: 9 .# #.#bgg.#  SH: 0Dex: 19 .#######.########)#bgg>  XL:  4 Next: 62% Place: Dungeon:2 .>............).@)#bggί  Noise: ===------  Time: 1081.7 (0.0) ..######.###################   a) +2 sling {Septima j) +0 sling (elec) { bgg..# #...................#   Fire: a) +2 sling {Septima} bggB#.######..###############.##   Rev* ...................#..<.#.#  #.#############..#.#..###.#  bgg2  ........................#.#    bggV..############.....##.#.#.#    ..<.....# #.....##.#.#.#  bggw You shoot a sling bullet. The sling bullet hits the goblin!  bggLightning courses through the goblin!!  You kill the goblin! _You shoot a sling bullet. bggl_No target in view! _No target in view!bggDn  Okay, then.bggbgg . _bggz (# .# #.# #.# #.# #.# #.#bgg  #.# #.# ## #.# #.# .# #.# #.# .# #.bgg} #.#)# .>....)@))# #..######.## .# #.# #.######..bgg #.## .#..<.#.# #.#..#.#..###.# #bgg .#.# #..#.....##.#.#.# #..<.....# #.....##.#.#.# bgg bgg] <---2.7 (1 _bgg3 bgg` bgg,  .# #.#  .# #.#  .# #.#  .# #.# ##  .# #.# .# bgg3 .# #.# .#  .#.#)#  .>.).@)#  ..######.##bggh  # #.#  #.######..#bgg.##  #..<.#.#  #.#bggw..#.#..###.#  .#.#  ..#bggۗ.....##.#.#.#  ..<.....# #.....##.#.#.#  bgg%bggB---3bggbggޫl _Items here: )) ††.bgg"T  # #.#  # #.#  # #.#  # #.# ###  # #.# ..#  # #.# #.#  #.#)#  >.bgg#).)@#  .######.##  .# #.#  .######..#.##  #..<.#.#  .#..#.#..###.#  #.#  .#.....##.#.#.#  .<.....# #.....##.#.#.#  bgg/(bgg(d4Rev+ _bgg -bgg1  Things that are here: _a +0 club; a goblin corpsebggŀM  ###.. #.# #. #######.######## >............).))# #####.################## .# #...................#   Rev+ bggPHbgg]bgg-5 _bggbgg _Items here: ))) [[ †††.bgg bgg˧ FEquip which item?  - - Unarmed Inventory Items Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} Armour (go to first with [)  b - a +0 leather armour (worn) bggm Floor Items ([,] to select) Hand Weaponsa +0 cluba +0 club a +0 dagger of draining Armoura +0 animal skina +0 helmet[?] describe selected [!] equip|wield|wear[tab] equip|unequip bgg  bgg  bggj e  SunshineJesse the Shooter #  Coglin # #.#  Health: 34/34 ======================== # #.#  Magic: 4/4======================== bgg S# #.#  AC: 3Str: 11 # #.# ####  EV: 11Int: 9 # #.#..#  SH: 0bgg |Dex: 19 # #.##.#  XL:  4 Next: 62% Place: Dungeon:2 #######.########@#bgg= 8  Noise: ---------  Time: 1085.7 (0.0) >............).))#bgge   a) +2 sling {Septima j) +0 sling (elec) { bgg w.######.###################   Fire: a) +2 sling {Septima} .# #...................#   Rev+ bgg .######..###############.##  ..................#..<.#.#    .#############..#.#..###.#  bgg   .......................#.#    bgg .############.....##.#.#.#    _No target in view! bgg ._Okay, then. _Items here: )) ††.  Things that are here: _a +0 club; a goblin corpse _Items here: ))) [[ †††.bgg) bgg* 26.7 (1 _bgg2 bgg; bgg-@ +7.7 (2bggA bgg H bggfH Z8.7 (3Rev bggM bggU bggV +9.7 (4bgg~^ bggf bggxf ,90.7 (5bggk bggm 4 _You start putting on your armour. You continue putting on your +0 helmet. x4bggn bggls bggu [ _You finish putting on your +0 helmet.bgg.bggӛbggןbggF _Unknown command.bgg bggz bgg bgg bgg bgg ; _bgg- bggc bgg !bggb bgg^ bgg 0bgg# bgg bgg. bggw bgg@ bggU bgg^ bgg bggN bgg bgg ,bgg bgg) bgg ,bggy ,bgg" bgg1# bgg % bggS' bgg>) bggw) bgg* bgg, bgg. ,bggl/ bgg8 bgg: bgg: bgg`; bggK> bgg? bgg@ bgg@ bggG XbggI bggJ ,bggES ,bgg4T ,bggT bgg[ Xbgg\ bgg^ bgg4_ bgg_ bggb bggd ,bgge bggqg bggm Xbggn ,bggUo bggJr bggs bggs bggt bggw bggx ,bgg!z bgg| bggj~ ,bgg bgg7 XbggE bgg1 ,bggD bgg bggw ,bgg bgg bggg bgg bggK bgg bgg bgg bgg] bgg bggl ,bgg bgg bgg ,bgga bggB bgg bggL bgg bgg bgg0 ,bgg2 bgg bggy ,bggc bgg bgg ,bgg bgg bggg ,bgg bgg bgg ,bggE bgg bgg ,bgg bgg bgg& bgg` bgg bggI bgg ,bgg bgg bggl ,bgg bgg Xbgg! bggF ,bgg bgg bggx ,bgg6 bgg bgg ,bggx bgg bgg ,bgg bgg bgg ,bgg@ bgg  bggV ,bggY bgg " bgg# ,bgg% bgg& bggF) ,bgg/* bggV+ bggx- ,bggZ. bgg/ bgg1 ,bgg 3 bgg5 bgge7 bgg7 bgg8 bgg: bgg+< bggd< bgg= bggA? bgg@ ,bggkA bggB bggE BbggUF bggF ,bggsH ,bggI ,bggI bggJ bggK ,bgg)L bggM bggN ,bggDO bggJP bgg{Q ,bggQ bgg(S bggT ,bggU bgguV bggX ,bggX bgg$Z bggl[ ,bgg[\ bgg] bgg^ ,bgg_ bgg` bggb ,bggb bgge ,bggf bggh M _You now have 106 gold pieces (gained 5).bgg j 3bggj bggl bggm ,bgg`n bggwo bggp bggp bgg#q bggr bggrt bggt bggu bggv bggUx ,bggx bggz bgg8| ,bgg~| bgg~ bgg ,bgg bgg bgg‚ ,bgg bggI bgg ,bgg bggȇ bggH ,bggЉ bgg6 bgg ,bgg bgg- bgg bgg1 bgg bggI bgg #..# #######+###.# #..####b##.# ......# #.##.# ......# #.##.# ......# #.#bggÝ @#.# ......# #.#.# ......# ##.# ......# .#.# ......# #.# bggE ##'#'## #.##########.##  #.#.## #.............#  #.#..# ###############  #.##.#  #.##.###  b   bat (wandering)  #.##...##  bgg #.####..#   #...)...# bgg֭ ]168.7 (78.0)9.7 (79bgg bgg V _A bat comes into view.bgg¶4 #..#  #.#  #b# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #@# #.#  #.#.##   #.............#   ####          #...)...#bggN #..#  #.#  #b# #.#  #.# #.#  #.# #.#  #.# #.# bggNO #.# #.#  #.# #.#  #.# #.#  #@# #.#  #.#.##   #.............#   ####  bggN<      bggNU  #...)...#bgg,V4bggg\bgg_Z _A bat is nearby!bgg #..#  #.#  #b# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #@# #.#  #.#.##   #.............#   #### bggVx         #...)...#bgg: #..#  #.#  #b# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #.# #.#  #@# #.#  #.#.##   #.............#   ####          #...)...#bggAbggPBbggGbggJZ _A bat is nearby!bggK (((((((You shoot a sling bullet.bgg9m  The sling bullet closely misses the bat.bggûXbgg{....b..bbggh===70.9 (1.2)Rev bggbggFw _You shoot a sling bullet. The sling bullet barely misses the bat.bggW ]  You shoot a sling bullet. The sling bullet hits the bat.bgg .((bggM (((((You kill the bat!bgg J.......bgg l52.0 (1.1Rev+ bgg bgg / _You shoot a sling bullet.bgg bgg bgg bgg bgg6 Xbgg Rev bgg bgg, bgg4 bgg bgg bgg bgg bgg bggn bgg bgg bggr !bgg bgg bgg^ bgg bgg> bgg bgga bgg bgg bgg%! 7 _You open the door.bgg" bgg># bgg.$ bgg( @  There is an open door here.bgg3* bgg*  _bgg, bgg/ bgg0 bgg0 bgg1 bggG ...#..#####.....##.#.#.# ...#..# #...................# [..##..........#)...#.### ##..........#.####.# #####.......)..#......#  ##..........##########  ##...................#  ##.........#########.#  ##.....@...# #.# ---83.0 (11.0)  #..# #.........# #.#  #..# ########'## #.# ##..### #.# #.#.....##.##.#.....#.##.#.....# #.##.#.....#[bggH 40m #.##.#...# #.##.#---bggSL bgg-N E _Done exploring.bggDB3bggCbgg%e0.0).'......bggjbggkE _Done exploring.bgg bggE Where to? (Tab - D:2, ? - help)  D - Dungeon bggbggM#[?25h[?0cbggÓ...#..############.....##.#.#.#SunshineJesse the Shooter ...#..# #...................#Coglin [..#..# #..........#)...#.###Health: 34/34 ======================== bgg...#..# #..........#.####.#Magic: 4/4======================== ####..# #.......)..#......#AC: 4bggIStr: 11#..# #..........##########EV: 11Int: 9bgg#..# #...................#SH: 0Dex: 19#..# #.........#########.#XL:  4 Next: 65% Place: Dungeon:2bgg#..# #.....@...##.#Noise: ---------  Time: 1183.0 (0.0)bgg#..# #.........##.#a) +2 sling {Septima j) +0 sling (elec) {bgg #..# ########'###.#Fire: a) +2 sling {Septima} ###..###bgg0#.##.##......##.##.##......##.#bggWJ#.##......##.##.##......##.#bgg#.##......##.##.# _You shoot a sling bullet. _You open the door. _There is an open door here. bggؕ_Done exploring. _Done exploring.  What level of the Dungeon? (default 2, ? - help) bggv [?25l[?1cbgg43bggbggabggbggAE _bggbgg,bggbggbgg5,bggbggbgg,bggbggbgg,bggkbggTbgge,bgg&bggbgg,bggbgg2bgg,bgg}bggbgg$,bggbggvbgg,bggLbggo bgg' ,bggt bgg bgg ,bggR bggG bggO ,bggr bgg2 bggE! ,bgg# bggi' bggR) bgg) bgg{* bgg, bgg3. bggy. bgg+0 bgg1 bggt3 ,bgg4 bgg9 bgg: ,bggl; bgg< bggz> bgg> bgg? bggGA bggB bggB bggC bgg+E bggF ,bggYG bggEH bggI ,bggI bggeJ bggJ bggJ bgg'K bggDL bggM ,bggN bggyO bgghP bggP bggQ bggkR bggS ,bggwT bggU bgg_V ,bggV bggW bggSX ,bggX bggLZ }_You open the door. _There is an open door here. bggZ k_Done exploring.  There is a stone staircase leading down here.bgg[ bgg[ bgg[ $ _bgg1\ bgg[ 3bggA bgg bgg bgg bgg C  #.#  #.#  #.# bgg~ s #.#  #.#  #.#  #.###  bgg x#@..#  212.8 (29.8) bgg ###.#   .  ..bgg3 P ## bggX _You climb downwards.bgg bgg- bgg a _There is a stone staircase leading up here.bggIbggJ3bggKbggKbgg.P _bgg|PbggqQbggSbggBSbggSbggUbggVbggQWbggWbggYbggr[bgg[bggg\bgg]bgg _bggG_bgg_bgg~abggcbggTcbggcbgg1ebggfbggfbgggbgghbgg jbggj,bggslbggmbggmbggynbggobgg qbgg?qbggqbggsbgg.tbgghtbggtbggAvbgg7wbggwbggwbggmybggzbgg{bgg{bgg|bgg(~bggn~bgg~bggɀbgg%,bgg7#<..# #.# ###.###.# ####...##.# #.........# ##.##...####. ..####...##.##...............#.....####...####S......@...##.....#######... # S   adder (asleep)bggJ/34.8 (22.0bgg,5.8 (23bggcbggY _An adder comes into view.bggh #<..# #.#  ###.###.#  ####...##.#  ....#  ##.##...####  . .##.##  ........#  .....####...####  S......@...##  .....#######  ... #bgg3bgg6&Q #<..# #.#  ###.###.#  ####...##.#  ....#  ##.##...####  . .##.##  ........#  .....####...####  S......@...##  .....#######  ... #  bggI*bgg*bgg.bgg1] _An adder is nearby!bgg1 ((((((S  You shoot a sling bullet.  The sling bullet hits the adder but does no damage.bgg  The adder hisses angrily.  You shoot a sling bullet. The sling bullet hits the adder.bgg: bgg4< bggB V..S....bggC g===7.0 (1.2)Rev bggH bggK 3 _The adder is lightly wounded.bgg (((( You shoot a sling bullet. The sling bullet hits the adder.bgg  The adder is heavily wounded.You shoot a sling bullet. The sling bullet hits the adder.bggQ bgg{ P.S...bgg (8.2bgg 7Rev+ bgg bgg ^ _The adder is severely wounded.bggл_  You shoot a sling bullet. The sling bullet hits the adder.bgg,`.((( bgg ((((You kill the adder!bggYL.......bggp819.4Rev* bggbgg7/ _You shoot a sling bullet.bgg bggP!bgg%bgg6(H _No target in view!bggcbgg4bgg!bgg#bgg)Rev+ _bgg*bgg?,,bgg-bggW/bgg0,bgg1bgg2bgg%: #.# #. #.### #. #<..# #. ###.###. ####...##. ######### #......... #.$.....# ##.##...### #.......####...##.## ##....@............#---J.........####...#######.............## #.......#######.........############J   endoplasm (asleep)bggA.43.4 (4.0bggBv---4.4 (5Rev bggEbggI] _An endoplasm comes into view.bgg c  You shoot a sling bullet. The sling bullet hits the endoplasm!bggH (((.(((bgg? (You kill the endoplasm!bgg 4.......bgg v4===5.6 (1.2Rev+ bgg bgg& / _You shoot a sling bullet.bgg(4bggW/^ _No target in view! bgg bgg bgg bggnH _No target in view! bgg`  bgg  bgg7 bgg bggW bggQ _ bgg bgg:Rev  bgg bggo bgg bgg bgg bgg , bgg_! bggR$M _You now have 108 gold pieces (gained 2). bgg% bgg9&& bgg& bggv( bggD* bgg* bggx+ bgg- bgg., bggt/ bgg0 bgg82, bggR3 bgg4 bgg6, bggD7 bgg8 bgg: bgg: bgg[; bgg= bgg> bgg/? bgg? bggA bggB bggB bggGC bggD bggKF bggF bgg*G bgg I bggJ bggK bggzK bggL bggN bggN bgg,O bggNP bggtQ bggQ bgg[ bgg\ bgg:^, bgg^ bgg_ bggZ`, bgg` bgga bggXc, bggd bggze bgg%g bggdg bggg bggi bggNj bggOk, bggk bggp #.......#########.......#..............#...######.......##########.......# #..........# #.############# #.#  #@# --- ##  ########  bggq bgg^u069.6 (24.0) bgguI---70.6 (25 bggcy bgg~] _l - a bubbling coppery potion bgg%4 bgg) bgg -H _No target in view! bgg  bgg  bgg܃  bgg  bgg  bgg- _ bggΌ  bggJ , bgg  bgg"  bgg , bggю  bggǏ  bggM , bgg  bgg  bgg  bgg  bgg  bgg  bgg , bggQ  bgg  bggk  bgg  bgg  bggo  bggn  bgg  bgg  bgg  bggP  bggl  bgg  bgg7  bggʚ , bgg  bgg  bgg7  bggP  bgg  bgg0  bgg , bgg  bgg  bggO , bgg  bgg  bgg~  bgg  bgg  bggv  bggޣ  bgg!  bgg  bgg  bgg , bgg  bgg  bgg# , bggf  bgg"  bgg  bggĪ  bgg  bgg  bgg$  bggN  bggv  bgg  bgg , bgg  bgg  bggN , bgg  bgg  bgg , bgg  bgg  bgg1 , bggy  bgg  bgg B bggv  bggҵ , bgg~  bgg  bgg" , bggi  bgg  bgg¹ , bgg  bgg  bgg_ , bgg  bgg  bggӽ  bgg  bgg3  bgg۾  bggz , bggο  bggO  bgg  bggE  bggt  bgg  bgg  bgg  bggL  bgg  bgg0  bggZ  bgg  bgg  bgg  bgg4  bgg  bgg  bgg  bgg  bgg]  bgg  bgg , bgg\  bggK  bgg}  bgg  bgg  bgg  bgg  bgg  bggs  bggH  bgg*  bgg[  bgg  bggg  bgg  bgg  bgg  bgg  bgg , bgg  bgg  bgg , bggn  bgg b...#####..##...#... ##..#.# .##....##.##.#.#..... #######.#.#.###. #####.......#...# #....#.#########.###.##....#.##.@...#########.... bgg6 y#.# ###.####...........#.# ......######....#.#############....#.##.............#.########### #.#############...........# #.############.####.##......# bgg .314.6 (44 bggR ,5.6 (45 bggN  bgg b _m - a scroll labelled ANUYPIZXOPSU bgg? bggt@ bggA!bgg7!bgg!bggX!bggC!bgg!bggo !bgg !bgg !bgg- !bgg!bgg,!bggL!bgg7!bgg,!bgg>!bgg!bggB!bggD!bgg!bgg!bggM!bggG!bggQ)## ### ###. ..... r....#####..# .##...#... # >##..#.##.# .#  #....##.### .#   #.#.#.....# .# ######.#.#.###.##.# ######### .......#...# #..@.# #.......# .#########.###.#### ### .# #.....#########..... .# ###.####..............## .# #......###### .# #######.......r   quokka (asleep) .# #................# .### #.################ ...........# #.#!bgg,} 22.6 (7.0)  A quokka comes into view.!bgg^2.rr!bggL3+3.6 (8!bgg7!bgg;; _Found a stone staircase leading down.!bggX_ ## ###  ###. ..... ..   r#   # ># #.# .# #.### .# ...# .##.##.#   #..@.#  #.#### !bggY #..... ###. #      #.#!bgg ## ###  ###. ..... ..   r#   # ># #.# .# #.### .# ...# .##.##.#   #..@.#  #.####  #..... ###. #   !bgg/ #.#!bgg!bgg!bgg!bgg] _A quokka is nearby!!bggR% (((((You shoot a sling bullet.!bgg ((The sling bullet hits the quokka but does no damage.  You shoot a sling bullet.!bgg. !bgg/ !bggQ6 }..>r...!bgg7 c===4.8 (1.2Rev !bgg; !bgg= a _The sling bullet closely misses the quokka.!bgg ((((You shoot a sling bullet.!bggP  The sling bullet closely misses the quokka.You shoot a sling bullet. The sling bullet hits the quokka.!bggX !bggW j.r..!bgg d6.1 (1.3Rev+ !bgg !bgg ^ _The quokka is heavily wounded.!bgg `  You shoot a sling bullet. The sling bullet hits the quokka.!bggH k.((!bgg\ (You kill the quokka!!bggS2...!bgg567.2 (1.1!bgg!bgg/ _You shoot a sling bullet."bgg#"bgg.$"bggd("bgg*H _No target in view!"bgg?-"bgg-4"bgg."bgg/"bgg"0% _"bgg3"bgg4"bggh5PRev "bgg6"bgg6,"bgg7"bgg7"bgg?8"bggY8"bgg8"bgg&9"bggG:"bgg:!"bgg4;"bgg=R  There is a stone staircase leading down here."bggw?"bgg? _"bgg@"bggA"bggC"bgg;D"bgg"E"bggF"bggbH,"bggH"bggJ"bggK"bgg/L"bggL"bgg_N"bggO,"bgg$P"bggaQ"bggR"bggR"bggUS"bggzU"bggW"bggW"bggX"bgg,Z"bgg\,"bgg_"bgga"bggkc"bgg,d"bgg{d"bgg\f"bggg"bggDh"bggh"bggo  .# .  #.. ##.  ...## #.. "bgg/p9 ...# #.#  #..# #.# #.# #..# #.# #.# #..# #@# #.#"bggbp---  ..#####.# #. "bggp ..............# #.# "bggp####..####.####### #.... # #>#"bggp#.#.##.# #.##<."bggq}  ...##.####.####"bgg/q  #.#.....##.#####."bggWq  #.#.###.##.# ######### #...."bggqE "bggv043.2 (16.0)"bggwH---4.2 (17"bgg"bgg$ "bggֈ"bgg-_n - a blue potion"bggT"bggS I"bggHT "bgg0V "bggV "bgg<[ n"bgg\ "bgg] "bgg] "bggN^ "bgg_ "bgg` "bgga "bgga "bggb "bggd "bgg@d "bggd "bggxf "bggg "bgg,h "bggh "bgg#j "bggk ,"bggl "bgg6m "bggn ,"bgg&o "bgg:q "bggx xw.# #.# #.# #.## ...# "bggx #..######  #........      "bggx #  #.. ##."bggx  ...## #..# "bggy ...# #.## w   dart slug (asleep)"bgg>y X #..# #.##.#"bggfy  #..# #.# #.#"bggy  #..# #.# #.#"bgg 252.2 (8.0)"bgg= _.ww"bgg +3.2 (9"bggV "bgg \ _A dart slug comes into view."bggj ..# #w# #.# #.## ...# #..######  #........  #@# #.# #.# #.. ##.# ...## #..# ...# #.##"bgg #..# #.# #.#  #..# #.# #.#  #..# #.# #.# #bggKM ..# #w# #.# #.###bgg ...# #..######  #........  #@# #.# #.# #.. ##.# ...## #..# ...# #.## #bggu#..# #.#  #..# #.#  #..# #.# #bgg#bgg#bgg#bgg` _A dart slug is nearby!#bggc (((((#bggn You shoot a sling bullet. The sling bullet hits the dart slug.#bgg># ((The dart slug is moderately wounded.You shoot a sling bullet.#bgg(#bgg^j..w....#bgg٪7===4.3 (1.1#bgg,Rev #bgg>#bggg _The sling bullet completely misses the dart slug.#bggΑ (((( You shoot a sling bullet. The sling bullet hits the dart slug.#bgg  The dart slug is almost dead.You shoot a sling bullet. The sling bullet hits the dart slug.#bggM....5.6 (1.3Rev+ #bgg" #bgg#bggq9_The dart slug is almost dead.#bggų#bggS  You shoot a sling bullet. The sling bullet hits the dart slug.†((((#bggY (((You kill the dart slug!#bgg]l..†....#bgga6916.8 (1.2#bgge#bggf/ _You shoot a sling bullet.#bggP 4#bggo #bgg! H _No target in view!#bggk v#bggr _#bggs #bggt #bggt :Rev #bggdu #bggv #bggx #bgg"y #bggy #bggz #bgg{ #bgg<| #bgg| #bggN~ #bggc ,#bgg #bgg4 #bgg܂ #bgg1 !#bggN #bgg e  You see here a dart slug corpse.#bgg@ #bgg  _#bgg] #bggr #bgg #bgg, #bgg #bgg" #bggq #bgg #bgg- #bggЏ #bgg #bgg #bggc #bggē #bggd #bgg #bggG #bggɗ #bggM #bgg #bgg# #bgg #bggߜ #bgg+ #bgg #bgg #bgg ,#bgg #bgg #bgg #bggݣ #bgg: #bggĥ #bgg #bgg #bgg N _You now have 127 gold pieces (gained 19).#bgg #bgg #bggz #bgg #bgg ,#bgg #bgg˱ #bgg #bgg #bgg #bgg #bgg` ,#bgg #bgg #bgg ### #.# ####.. ....## ###..## . #.....## .. #####.#.##@#.##bgg 1---.........##.##................#####...#####.. ##.## #.. #.# KK   kobold (asleep) #.### #...# ###.##bgg 77.8 (21.0)  A kobold comes into view. It is wielding a +0 club.#bgg }K.K#bgg& V==-8.8 (22#bgg #bgg ( _The kobold shouts!$bgg\" ### #.# ####.. ....## ###..## .  #.....## ..  .##@#.#  ..##.##.  ........  ..#####..  ##.## #K.  #.# .  #.### #...# ###.#$bggx ### #.# ####.. ....## ###..## .  #.....## ..  .##@#.#  ..##.##.  ........  ..#####.. ##.## #K. $bggx+#.# .  #.### #...# ###.#$bgg~$bgg2$bgg$bgg] _A kobold is nearby!$bgg? (((((((You shoot a sling bullet.$bgg  The sling bullet barely misses the kobold.You shoot a sling bullet.$bggG$bggPa....K..$bggVQf=80.1 (1.3)Rev $bggV$bggYJ _The sling bullet hits the kobold but does no damage.$bgg; (((( You shoot a sling bullet. The sling bullet hits the kobold.$bggׄ (((The kobold is severely wounded.You shoot a sling bullet.$bgg $bgg D.......$bgg~ _1.4Rev+ $bgg $bgg a _The sling bullet closely misses the kobold.$bgge 4$bggl $bgg H _No target in view!%bggaa%bggb%bggf%bggfhH _No target in view!%bgg4%bgg%bgg####.# #####.. .#....## #.#####..##.....###.. #####.#.##.#.# .........##@##...............K...#######...#####..$.# ##.## #..##.# .##.### K   kobold#...####.# #†#0.0%bgg:K.%bgg5---2.4 (1%bgg%bgg+ _Found 16 gold pieces.%bggi ### #.# #  ####.. .#  ....## #.#  ###..## #..#  #.....###..  %bggi(#.#.# #@##.  .............K....#  ######...#####..$.#  ##.## #..#  #.# .#  #.### #...# %bggi>###.# #†#%bggq ### #.# #  ####.. .#  ....## #.#  ###..## #..#  #.....###..  #.#.# #@##.  .............K....#  ######...#####..$.#  ##.## #..#  %bggK#.# .# #.### #...# ###.# #†#%bgg' %bgg :---%bggG%bgg|] _A kobold is nearby!%bgg`  You shoot a sling bullet. The sling bullet hits the kobold.%bggEa()%bgg] (((((You kill the kobold!%bggѡ V.)....%bggڥ ~2===3.6 (1.2Rev* %bggr %bggʮ / _You shoot a sling bullet.%bgg{c %bggc %bggOi %bgg l H _No target in view!%bgg 4%bgg( %bgg %bgg= %bgg mRev+ _%bgg ,%bgg %bgg |  Things that are here:  a +0 club; a kobold corpse%bgg@ %bgg _%bgg& %bgg %bgg\ %bgg %bgg %bggn %bgg/ %bgg :Rev %bgg %bgg#  _You now have 143 gold pieces (gained 16).%bgg| %bggH ,%bgg %bgg %bgg_M%bgg"%bgg%bgg%bgg%bgg%bgg,%bggQ%bgg\%bgg%bgg%bgg%bggW%bgg"X%bgg#%bgg$%bgg$%bggJ&%bgg(,%bgg)%bgg+%bgg0n%bggO1%bgg1%bgg6,%bgg|7%bgg9N _You now have 160 gold pieces (gained 17).%bgg.A #. .####  ##...##### ##........ ###.......# #.........######## #..........<.  #.# .##...@.# ---401.6 (18.0) %bggA(##.. .#.....## ...## ##.#.##### ##..## ##..#. .....###..##. .#.##.#.#.##.# ....##.##.##.%bggA# ........)....# #...#####....#%bggaG%bggGH---2.6 (19%bggK%bggRN9 _Found a stone staircase leading up.&bgghGI&bggG&bgg8J&bggK,&bggQX&bggQ&bggVS,&bggT&bggU&bggmW&bggW&bgg7X&bggY&bggE[&bggp[&bgg\&bgg]&bgg^&bgg_&bgg_&bggZb&bggc,&bggLd&bgge&bggg&bggIg&bggg&bgg i&bggj&bggj&bgg-k&bggl&bggm&bggn&bggn&bggSp&bggq&bgg0r&bggr&bggs&bggu,&bggv&bgghw&bggx,&bggy&bggz&bgg8|,&bgg|&bgg)~&bgg&bgg&bgg\&bgg&bgg&bgg&bggT&bgg&bgg&bgg+&bgg&bgg&bggB&bgg&bgg&bgg&bgg2,&bgg&bgg<&bgg &bggL&bgg&bggJ&bggԓ,&bggL&bgg&bgg,&bgg&bggi&bgg&bgg &bggQ&bgg &bgg&bgg,&bgg$&bgg]&bgg&bgg&bgg;&bggs,&bgg&bgg8&bgg&bggŧ&bgg&bgg&bgg,&bggL&bgg&bgg&bggP&bgg&bgg&bgg(&bggo&bgg&bgg6&bggH,&bggܴ&bggԵ&bgg3B&bggNX&bggb&bgg&bgg&bgg&bgg&bgg&bgg&bgg3&bggo&bgg&bgg&bgg&bgg&bgg&bggU&bgg&bggy&bgg&bgg&bggM&bgg&bgg&bggA&bgg&bgg&bggv&bgg&bgg&bgg8&bggr&bgg&bgg&bgg&bgg&bggV&bgg&bgg:&bgg,&bggH&bgg&bgg,&bggm&bgg&bgg\,&bgg&bgg&bggG&bgg&bgg&bgg&bgg&bgg(&bgg&bgg&bgg{,&bgg &bggn&bgg,&bgg&bgg&bgg&bgg&bgg.&bgg&bgg&bgg%&bgg^&bgg&bgg7&bgg&bgg&bgg}&bgg:,&bgg&bggT&bgg,&bgg&bgg|&bgg]##.##.##.##.###### ....)....# ..... w #.# #####....# ##.#.#.####.# # #.#..# ...........##.#..# .#.#.###..# &bgg## #.#..#.####...####..# .# #...........# .# #..#.........#####..# †# ##...... #.@.......# .## ## .#.## #..#####.### #+#. #.# ..######. #. #.#.... &bgg .# #.######## . ..#w   dart slug (asleep)# ###.# .# .# .#&bgg-57.6 (55&bgg,8.6 (56&bgg!&bgg %\ _A dart slug comes into view.&bgg ((((((w  You shoot a sling bullet. The sling bullet hits the dart slug.&bgg  The dart slug is lightly wounded.  You shoot a sling bullet.  The sling bullet hits the dart slug but does no damage.&bgg _w......&bgg˒ g===9.9 (1.3)Rev &bggj &bggJ 7 _The dart slug is lightly wounded.&bgg' (((((( You shoot a sling bullet. The sling bullet hits the dart slug.&bggCThe sling bullet hits the dart slug but does no damage. _The sling bullet hits the dart slug.  The dart slug is heavily wounded.  You shoot a sling bullet.  The sling bullet hits the dart slug but does no damage.&bgg9 ......  The dart slug is heavily wounded.&bgg? ```````The dart slug launches a dart at you.'bgg܄l......@'bggυe61.1 (1.2Rev+ 'bggnj'bgg'bgg /  --more--'bggD0 P _The slug dart misses you.(bggÐ(((((( You shoot a sling bullet. The sling bullet hits the dart slug.(bggThe dart slug is almost dead.You shoot a sling bullet. The sling bullet hits the dart slug.(bgg"E†(bggF......(bgg072.3(bgg,(bggE _You kill the dart slug!(bggei(bggj(bggn(bggr@ _No target in view!(bgg=J(bgg(bggx(bgg<Q _(bgg(bgg(bgg|(bggN(bgg(bgg:Rev (bgg9(bgg(bggh(bgg(bgg(bgg(bgg#(bggf(bgg(bggy(bgg(bgg(bgg(bgg(bggS(bggi,(bgg(bgg.(bggG(bgg(bgg(bgg1(bggs(bgg(bgg(bggm(bggm(bgg(bgg(bgg(bgg(bgg(bgg$(bgg(bgg\(bgg(bgg%(bgg>(bgg(bgg(bgg;(bgg (bgg (bggU (bgg (bgg (bgg|(bgg(bgg$(bggO(bggP(bgg(bggL(bgg(bgg,(bgg(bgg(bgg,(bgg0(bgg(bgg^ ,(bgg (bgg<"(bggB$(bgg$(bgg<%(bgg&(bgg((bgg((bgg)(bggr/ ##.## #.#..# ...........#  #.# #.#..#.# .#.#.###..#  #.### #.#..#.####...####..# (bgg/ #...# #...................####.# #..#.........#####..# #†# ##...... #.........# ######.## ###.#.## #..#####.## ........# #.#.# #+#..# #.# ######..######.#@# ##.# #.#--- #.........#.### ##.###.# #.########....# ##......#(bggG0Y #.# #..#####.#####.# #.# #..###...#####.# (bgg0 ##.# #..............# # #..##.####.#####.### # #.###............. # #.#######.#####.#(bgg1(bgg5085.3 (23.0)(bgg6H---6.3 (24(bgg:(bggk=U _o - 2 silvery potions(bgg I(bgg$ (bggt (bgg (bggY n(bgg" (bgg' ,(bggI (bgg" (bgg ,(bggD (bgg (bgg ,(bgg0 (bgg (bgg ,(bgg (bggP (bgg ,(bgg (bgg7 (bgg (bgg* (bgg (bgg (bgg  #.# .##.....######.# ####.. .#.....## #.#  (bgg/ ....## ##.#.##### #.#  ###..## ##..#.# #.#  #.....###..##.# #.###### ##.#.##.#.#.##.# #. #.... ......##.##.##.#######.. #.###..)....#..(..... † #.#...#####....#@###.#.#.####.#94.3 (8.0)##.## #.#..#..............#(bgge #.# #.#..#.###.#.#.###..##.### #.#..#.####...####..#(bgg #...# #...................###..#.........####(bgg #..# #†# ##......###.........# #(bgg #####.## ###.#.## #..#####.## ........# #.#.# #+#..(bgg C# #.#(bgg+ (bgg +5.3 (9(bgg (bgg8 % _Found 5 stones.)bgg3)bggb)bgg)bgg ,)bgg,)bgg,)bgg )bgg;  You see here 5 stones.)bggj)bgg _)bgg )bgg#)bgg)bgg)bgg)bgg)bgg2,)bgg")bgg)bgg)bgg )bgg)bgg)bgg.)bggl)bggC)bgg)bgg)bgg)bgg)bgg)bgg)bgg)bgg)bgg)bggF )bggz )bgg )bggi )bgg)bgg7)bgg)bgg)bgg>)bggo)bgg>)bgg=)bgg,)bgg)bgg)bgg)bgg)bggM)bgg!)bgg#,)bgg%)bgg81 .....)....#..(......†.##.# .#####....#.###.#.#.####.# ## #.#..#..............# # #.#..#.###.#.#.###..# ### #.#..#.####...####..# ..# #...................# )bgg1#.# #..#.........#####..# #†# ##......###.........# .## ###.#.## #@.#####.## 510.3 (15.0) ...# #.#.# #'#..# #.# #..######.#.# !(##.# #.# #.........#.###)(##.###.# #.########....#### #.# #..#####.#####)bgg2.# #.# #..###...#####.#.# #..............#)bggF2{# #.####.#####.### _You open the door.)bgg4_ _Found 3 stones, 2 boomerangs and a spear.)bgg )bgg )bggʤ )bgg! H _No target in view!)bggNd )bggd )bgg$i )bggk H _No target in view!*bgg-*bgg.*bggi0*bgg4*bgg 8*bgg<: _*bgg>@  There is an open door here.*bgguE*bggE _*bggG*bggL;  You see here 3 stones.*bggN*bgg^O _*bggQ*bggx## #.#..#..............# #.#..#.###.#.#.###..# .### #.#..#.####...####..# ...# #...................#.# #..#.........#####..#  #†# #####.........# ##.## ###.#.## #..#####.## ....# #.#.# ##'#..# # ##..######.#.# #@(##.# #.  #.........#.###)(##.###.#  ###....####......#  #.# #..#####.#####.#  #.# #..###...#####.# ##.# #..............#.# #.####.#####.#### # # ######.#####.#3.3 (3.0)4.3 (4 _p - a glowing orange potion*bgg*bggD*bgg*bgg*bgg,*bggX*bgg@  There is an open door here.*bgg*bggl _*bgg*bggg*bgg*bggG*bgg*bggD*bggP*bgg*bgg*bgg*bgg*bgg*bgg]*bggx*bgg4,*bggO*bgg*bgg3*bgg*bgg$*bgg*bgg,*bgg*bgg*bgg,*bgg*bggh*bgg,*bgg*bgg(*bgg,*bggo*bgg#*bgg`,*bgg*bggA *bggO ,*bgg *bggF*bgg*bgg*bgg`*bggy*bgg,*bgg*bgg*bggM,*bgg *bgg#*bgg$*bgg%*bgg&*bgg;**bggz,,*bgg-*bgg1*bggO3,*bgg4*bgg6*bgg <*bggY=*bgg>*bgg>*bggY?*bgg)A*bgg}B*bggB*bggD*bggH*bgg@J,*bggK*bggaM*bggQ,*bggQ*bggT*bggV*bgg[W*bgg"Y*bgg[*bgg],*bggf_*bgga*bgg c,*bgg*d*bgg+f*bgg i*bggfi*bggj*bggo*bggwB*bggx*bgg*bgg,*bgg?*bgg}*bgg*bggm*bgg*bggq*bgg܉,*bgg'*bgg+*bgg,*bgg,*bgg(*bggŗ,*bgg*bgg*bggɜ*bgg*bgg*bggҟ*bgg,*bgg*bgg>*bggc,*bgg*bgg*bgg,*bgg*bgg*bgg,*bggׯ*bgg*bgg,*bgg*bgg*bgg*bggS*bgg*bgg*bgg,*bggc*bgg*bgg׿,*bgg*bgg*bggc,*bgg *bgg*bgg,*bgg*bgg*bggg,*bgg*bgg*bgg5*bgg*bgg *bgg*bgg*bggB*bgg*bgg&*bgg,*bgg*bggs*bgg,*bgg*bgg*bgg,*bgg]*bggq*bgg*bgg!*bgg*bgg_*bggg,*bggl*bgg]*bgg'*bggo*bgga*bgg,*bgg2*bggz*bggs*bgg*bgg>,*bgg*bgg*bgg,*bgg=*bgg[*bgg],*bgg*bgg*bgg4,*bggm*bgg *bgg,*bgg*bgg *bggL ,*bgg*bgg*bgg,*bgg *bgg*bgg*bgg2*bgg*bgg*bgg,*bgga*bggx$n*bggn%,*bggz&*bgg'*bgg),*bgg**bgg+*bgg.-,*bgg-*bgg.*bgg0,*bggj0*bgg1*bgg3*bggn3*bgg3*bgg4*bgg5*bgg56*bggv6*bggx7*bgg8*bgg8*bgg9*bgg;*bgg{<*bgg<*bgg$=*bgg$>*bgg?,*bgg?*bggR@*bgg8A,*bggA*bggB*bggC*bggC*bggD*bggE*bgg6G,*bggH*bggI*bggeK,*bggL*bggN*bggP,*bgg Q*bggR*bggT,*bgg\U*bggV*bgg X,*bggX*bggY*bggZ*bggZ*bggV[*bgg\*bgg ^*bgg[^*bgg^*bggE`*bgga*bggb*bggb*bggd*bggKf*bggf*bggug*bgg1h*bggGi*bggi*bggi*bgg~l*bggdv ### ##### ### #.# #.#.# #.# #.#####..## ##. #.......## ## #######..## ##. #.....###.. #########.#.##.#.#. #............##.##.*bggmw #.@..............). #.########...#####. #. ##.## #. #. #.# #. #S #.### #. #g #...# #. S   adder (asleep) #. ###.# #. g   goblin (asleep) !. #†# ## ########.## #*bgg 603.3 (89.0)  An adder and a goblin come into view.*bggֆ,4.3 (90*bgg*bggX _Found an emerald potion.*bgg8  ### #####  #.# #.#.# #. .## ##. #.......##  ..## ##. #.....###.. #########.#.##.#.#. #............##.##. #.@.......). #.######## #. ##.##  #. #.#  #S #.###  *bggW9 #g #...#  #. ###.#  !. #†#   *bgg ' ### #####  #.# #.#.# #. .## ##. #.......##  ..## ##. #.....###.. #########.#.##.#.#. #............##.##. #.@.......). #.######## #. ##.##  #. #.#  #S #.###  #g #...#  #. ###.#  !. #†#   *bgg *bggh *bgg *bgg}  *bgg V_There are monsters nearby!*bggB Q ### #####  #.# #.#.# #. .## ##. #.......##  ..## ##. #.....###.. #########.#.##.#.#. #............##.##. #.@.......). #.######## #. ##.##  #. #.#  #S #.###  #g #...#  #. ###.#  !. #†#   *bggp4 ### #####  #.# #.#.# #. .## ##. #.......##  ..## ##. #.....###.. #########.#.##.#.#. #............##.##. #.@.......*bgg5). #.######## #. ##.##  #. #.#  #S #.###  #g #...#  #. ###.#  !. #†#   *bgg>*bgg>*bggbF*bggId _There are monsters nearby!+bgg1 (((S    You shoot a sling bullet. The sling bullet hits the adder.  The adder hisses angrily.+bgg  The adder is heavily wounded.You shoot a sling bullet. The sling bullet hits the adder.+bgg(?h  The adder is almost dead.+bgg?+bgg@+bggRI.S.g.g+bggJg===5.6 (1.3)Rev +bggQ+bggX( _The goblin shouts!+bgg[,D((+bgg>  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet. The sling bullet hits the adder!+bgg~g   goblin+bggA+bggC+bggK5.g.+bggM+bggV### ##### ### SunshineJesse the Shooter#.# #.#.# #.# Coglin#.#####..## ##. Health: 35/35 ========================#.......## ## Magic: 4/4========================#######..## ##. AC: 4Str: 11#.....###.. EV: 11Int: 9#########.#.##.#.#. SH: 0Dex: 19#............##.##. XL:  4 Next: 113% Place: Dungeon:3#.@..............). Noise: ===------  Time: 1606.8 (1.2)#+bgg[W.########...#####. a) +2 sling {Septima j) +0 sling (elec) {#g##.## #. Fire: a) +2 sling {Septima} #.#.# #. Rev+ #.#.### #.#.#...# #. g   goblin#.###.# #.!.#†# ##########.## #You shoot a sling bullet. The sling bullet hits the adder.  The adder is almost dead. _The goblin shouts!  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet. The sling bullet hits the adder! _You kill the adder!+bggY\ _The goblin shouts!The sling bullet misses the adder.  You shoot a sling bullet. The sling bullet hits the adder! _You kill the adder!Your Fighting skill increases to level 3!You have reached level 5!+bggb/  --more--+bgg| E41/415/55 7% +bgg +bgg~ 4 _+bgggR ((+bgg/You shoot a sling bullet.+bgg  The sling bullet closely misses the goblin.You shoot a sling bullet.,bggX,bggbg†7.9 (1.1,bggl,bggna _The sling bullet closely misses the goblin.,bgg  You shoot a sling bullet. The sling bullet hits the goblin.,bggQ  The goblin is moderately wounded.You shoot a sling bullet. The sling bullet hits the goblin.,bgglWf),bggS,bggt89.1 (1.2Rev* ,bgg[,bggJ _You kill the goblin!,bggn,bggMo,bggu,bggxH _No target in view!,bggJ4,bgg,bgg,bgg,bggARev+ _,bgg7,,bgg #.# #.#.# #. #.#####..## # #.......## # #######..## #.....###.#########.#.##.#.# #............##.## #................) #@########...#####---,bggp #†# ##.## # #.# #.# # #.# #.### # #.# #...# # #.# ###.# # K   kobold (wandering),bgg !.# #†# # K.# ########.## ..........#,bggx -100,bggeKK.,bgglG---1.1 (2,bgg,bgg# _A kobold comes into view. It is wielding a +0 dagger.Things that are here: _a +0 club; a goblin corpse,bgg.  #.# #.#.#        ######### #........ #........) #@#,bgg  #†# ##.##  #.# #.#  #.# #.###  #.# #...#  #.# ###.#  K.# #†#  ..#    ,bgg(4 ^ #.# #.#.#        ######### #........ #........) #@# #†# ##.##  ,bgg5 #.# #.#  #.# #.###  #.# #...#  #.# ###.#  K.# #†#  ..#  ,bgg< ,bgg= ,bggE ,bgg H ] _A kobold is nearby!,bgg #.# #.#.#        ######### #........ #........) #@# ,bgg#†# ##.##  #.# #.#  #.# #.###  #.# #...#  #.# ###.#  K.# #†#  ..#    -bggr #.# #.#.#       -bgg7s ######### #........ #........) #@# #†# ##.##  -bggs#.# #.#  #.# #.###  #.# #...#  #.# ###.#  K.# #†#  -bggsO..#  -bgg3|-bgg|-bggd-bgg܆] _A kobold is nearby!-bgg' -bgg~(((((((You shoot a sling bullet.-bgg#  The sling bullet barely misses the kobold.You shoot a sling bullet. The sling bullet hits the kobold.-bgg()-bgg I†..-bggױ?..).-bggK~9===2.2 (1.1Rev* -bgg_-bgg,J _You kill the kobold!-bggZ)4-bgg.-bgg 0H _No target in view!-bgg1/4-bgg6-bggq9H _No target in view!-bggH`-bgg#a-bggb-bggDf-bggh-bggRi% _-bggnx  You see here an adder corpse.-bggq\Rev+ _-bggs-bgg&u-bggv-bggXw-bgg[x-bggAz-bgg{-bggI|-bggY}-bgg-bgg*-bgg:Rev -bggw-bgg'-bgg},-bgg-bggb-bggr-bgg-bgg-bgg  e - 2 emerald potions (gained 1)  Things that are here:-bgg-bggԙ-bgga _a +0 dagger; a kobold corpse-bggT-bgg&-bgg-bggȣ-bggϥ-bgg3-bgg2-bggũ-bggӫ,-bgg-bggp-bgg-bgg-bgg-bggB-bgg#.# #.# #.# #.### #.#.# #...# #.####.# ###.# #.###..).# #†# ####......###########.## #..###...............# #......############..#####..#....@# #......----bgg# #.###. #.#####. . #.# ## .... #.##.###..#.#.. ...## #..# g   goblin (wandering)g.. ...# #.##.## #..# #.##..# #.#-bggw 24.2 (12.0)  A goblin comes into view. It is wielding a +0 club.-bgg -bgg gr   quokkarg   goblinThe goblin shouts!==-5.2 (13-bgg-bggY _A quokka comes into view.-bgg g #.# #.#  #.# #.###  #.# #...#  ####.# ###.#  ###..).# #†#  .  #..###..  #......### #..#....@#  # #.###.#  #. ..# #.#  ## .... #.#  #.###.. ##.#  g. ...## #..#  r.. ...# #.##  .## #..# #.#  -bgg] ,#..# #.# -bggg P #.# #.#  #.# #.###  #.# #...#  ####.# ###.#  ###..).# #†#  .  #..###..  #......### #..#....@#  # #.###.#  #. ..# #.#  ## ....  #.###..  g. ...## #..#  r.. ...# #.##  .## #..#  #..# -bggD -bggΜ -bgg -bggd  -bgg V_There are monsters nearby!-bggZ (((-bgg(r You shoot a sling bullet. The sling bullet hits the goblin..bgg^; ( The goblin is heavily wounded.You shoot a sling bullet. The sling bullet misses the goblin.The sling bullet hits the quokka..bgg.bggn  The quokka is severely wounded..bgg.bgg:.bgg...grr 2 quokkas (1 wandering).bggO=6.4 (1.2)Rev .bgg.bggU.bggY _A quokka comes into view..bgg (((rYou shoot a sling bullet.  The sling bullet hits the goblin but does no damage..bgg=i (((The goblin is heavily wounded.You shoot a sling bullet..bggR.bggI.bgg.bgg..g.r...bggN(7.6.bgg7Rev+ .bgg.bgg^a _The sling bullet closely misses the goblin..bgg`  You shoot a sling bullet. The sling bullet hits the goblin..bggo(().bgg:&  .bgg;vYou kill the goblin!You shoot a sling bullet. The sling bullet hits the quokka..bggB((†   quokka.bgg7.bggM..)r..bgg1118.8.bggK.bggJ _You kill the quokka!.bgg_e((((((.bgg  You shoot a sling bullet. The sling bullet misses the quokka.You shoot a sling bullet. The sling bullet hits the quokka..bggk .bggl .bggu ..r).†..bggu V9.9 (1.1Rev* .bggu .bgg} .bggu a _The quokka is moderately wounded..bgg' ( You shoot a sling bullet. The sling bullet hits the quokka..bggy  The quokka is severely wounded.You shoot a sling bullet. The sling bullet hits the quokka..bggM= `r..bgg> .31.2 (1.3.bggD .bggG Z _The quokka is almost dead..bggqM (((You shoot a sling bullet..bgg  The sling bullet barely misses the quokka.You shoot a sling bullet. The sling bullet hits the quokka..bggj)/bgg$S†../bgg(522.4 (1.2/bgg//bggB2J _You kill the quokka!/bgg/bgg  You see here a quokka corpse. _/bgg/bggx/bgg /bgg $Rev+ /bgg&!/bgg?"/bgg&/bgg:(/bgg(/bgg)/bgg.|  Things that are here:  a +0 club; a goblin corpse/bggE0/bgg0 _/bgg1/bgg2/bgg64,/bgg85/bggp8/bgg :/bggR::Rev /bgg$;/bgg&>b  You see here a quokka corpse./bgg?/bgg6@ _/bggA/bggB/bggC/bggAD/bggD/bggE/bggH/bggI/bgg}J/bggL/bggdN/bggN!/bggO/bggR/bgg)U0/bggTV/bggXX/bggnZ,/bggl[/bgg\/bgg^,/bgg_/bggb/bggXd,/bgge/bggf/bggg,/bggh/bggj/bgg/l,/bggl/bggn/bggo,/bgg`p/bgg$r/bggs,/bggt/bggv/bggvx,/bgg8y/bggY|/bgg}/bgg ~/bgg~/bgg/bggn,/bgg/bggU/bgg/bgg,/bgg /bggX,/bggۈ/bgg&/bgg/bggߋ/bggA/bgg&/bgge/bggʏ/bgg/bggL/bgg/bggɒ/bggY/bggO/bgg[,/bgg/bgg/bgg;,/bgg/bgg/bggy,/bgg/bgg/bgg),/bggq/bggB/bgg͠,/bgg/bgg|/bgg,/bggc/bggߣ/bggl/bggפ,/bggT/bggȥ/bgg/bgg2/bgg/bgg/bggȧ/bgg/bgg/bgg ,/bggr/bggT/bgg,/bggߪ/bgg/bgg-/bggc/bgg/bgg/bgg,/bgg0/bgg/bggD/bgg,/bgg/bggű/bgg%/bggn/bggس/bgg,/bggV/bgg*/bgg/bgg/bgg_/bgg\/bggmW #... .# #... .# #)### # .# #†#  #.##.## #.# /bgg >#...###.# #.#  ........ #.# ####...# ####.#  #..###..).# ---/bgg76.4 (44.0) #.###.# ##...... #.# ## #..###..... #.# #...../bgg.#####.# #..#.....##.# ##.#.###†# #.# #.#.....##  #.# #.###.)... ##.## #.###.###. /bgg/bgg/bggOH---7.4 (45/bgg/bgg; _Found a stone staircase leading down./bggv I/bggw /bggy /bgg} /bgg* /bgg! ,/bgg /bgg' /bgg ,/bggU /bgg /bgg ,/bgg /bgg /bgg, ,/bgg6 /bgg n/bgg ,/bgg /bgg /bggC /bgg /bgg /bgg /bgg< ,/bgg /bgg /bgg= ,/bgg /bgg\ /bggD /bgg /bgg /bggF /bgg׭ /bgg$ /bggЮ /bgg /bgg ,/bgg\ /bggz /bgg ,/bgg /bggt /bgg /bgg /bggj /bgg /bgg  ## #.### #......######## #####/bgg5 >......@..# #93.4 (16..#######.####.######.............#......####.######.........# #.# #)#####/bggo j### #.# #.# #†##.##.## #.# #.#/bgg #>#...###.# #.##.........# #.#/bgg !/bgg} /bgg ,4.4 (17/bgg /bgg ; _Found a stone staircase leading down.0bgg0bgg30bgg0bgg0bgg[0bggX0bgg=0bgg0bgg0bggC0bgg|0bgg0bggR0bgg0bgg0bgg0bgg`0bgg0bgg0bgg0bggO0bgg0bgg 0bgg+ 0bgg ,0bgg 0bgg<R  There is a stone staircase leading down here.0bggK0bgg _0bgg0bggo0bgg0bgg 0bgg`0bgg0bgg70bgg0bgg0bggi0bgg0bggP0bgg0bgg0bgg0bgg*0bggy0bgg&!0bgg"0bgg #0bgg#0bgg$0bggA&0bgg&0bgg&0bgg\(0bgg)0bgg)0bggY*0bgg+0bgg,0bgg>-0bgg}-0bgg/0bggR00bgg00bgg00bgg_20bggc30bgg30bgg30bgg@50bgg60bgg60bgg070bgg80bgg90bgg90bggH:0bgg;0bgg<0bggQ<0bgg<0bgg8=0bgg=0bgg>,0bgg?0bgg@0bggA0bggxA0bggB0bggC0bgg/D0bggD0bggGF0bggjG0bggG0bggH0bggI0bgg2K,0bggK0bgg#L0bgg|M0bggM0bgg7N0bgg\O0bggP0bggP0bgg2Q0bggR0bggS0bggET0bggT0bggU0bgg!W0bggpW0bggW0bgg;Y0bggZ,0bggZ0bgg[0bgg\0bgg ]0bgg]0bgg^0bggJ_,0bgg_0bgg#a0bggra0bgga0bggb0bgg#d0bgge0bgge0bggf0bgg(i,0bggi0bgg.ko _e - 4 emerald potions (gained 2)0bgglI0bggl0bgg]m,0bggm0bgg6n0bggto,0bggp0bggq0bggotB0bggw0bggy0bgguy0bggBz0bgg|0bgg ~0bggC~0bgg$0bggށ0bggt##### ####..######### ####..###....###...#.ß.###@~!...######...###..#.....#...#.._s.# ##...... ###..#######..##.~....#### .....# #### ###..###. 0bgg####.# ### #########.#.......#.# #.# #.#.# #.#.##.....# s   scorpion (asleep)#.####..## ##..#.....###.# #.......## ##.#.##### # #.# #######..## ##..#.#0bggI 736.4 (42  A scorpion comes into view.Found the Hermit's Pendant {Faith Invo=14 Evo=0 MP+5}.0bggē,7.4 (430bgg20bgg>< _Found a faded altar of an unknown god.0bggH )0bggI  #   ####..##  ###...#.ß.###@~!...# 0bgg#I M ##..#.....#...#.._s.# ..0bggQI F#..##.~....# .....# #### ###..## ### ####### 0bggI #.# #.# #.#.#  #.#   #.#   # #.#   0bgg  #   ####..##  ###...#.ß.###@~!...#  ##..#.....#...#.._s.# ..#..##.~....# .....# #### ###..##0bgg  ### #######  #.# #.# #.#.#  #.#   #.#   #.#  0bgg 8_0bgg 0bgg 9_0bgg _ _A scorpion is nearby!0bggyA (((sYou shoot a sling bullet.0bggC  The sling bullet hits the scorpion but does no damage.  You shoot a sling bullet. The sling bullet hits the scorpion.0bggM ,0bggQ f~s_.0bggR g===8.6 (1.2)Rev 0bggX 0bgg [ 6 _The scorpion is lightly wounded.0bggK, (_ You shoot a sling bullet. The sling bullet hits the scorpion.0bggM_  You shoot a sling bullet. The sling bullet hits the scorpion. _The scorpion is lightly wounded.  You shoot a sling bullet. The sling bullet hits the scorpion.  The scorpion is moderately wounded.  You shoot a sling bullet.  The sling bullet hits the scorpion but does no damage.0bgg40bggY<]s!_0bgg=_9.8Rev+ 1bgg9_1bggc _The scorpion is moderately wounded.1bggf} (((((You shoot a sling bullet.1bggx  The sling bullet closely misses the scorpion.You shoot a sling bullet. The sling bullet hits the scorpion.1bgg s!...  The scorpion is heavily wounded.1bgg_37---40.9 (1.11bgg 1bgg . _The scorpion stings you.1bgg |  You shoot a sling bullet.  The sling bullet hits the scorpion but does no damage.1bggc  The scorpion is heavily wounded.You shoot a sling bullet. The sling bullet hits the scorpion.1bgg _The scorpion is almost dead.1bgg7g2.0Rev* 1bgg9_1bgg@ _The scorpion splashes around in the water.1bgg} (((((You shoot a sling bullet.1bggb< _The sling bullet barely misses the scorpion.You shoot a sling bullet.1bgga s!..._The sling bullet closely misses the scorpion.The scorpion splashes around in the water.1bggT b8=--3.11bgg 1bggk U _The scorpion barely misses you.1bgg  You shoot a sling bullet. The sling bullet hits the scorpion.  Lightning courses through the scorpion!1bgg X†_1bggk (((((_You kill the scorpion!1bggk {†!..._1bggi =2641bgg04.4 (1.3 _You shoot a sling bullet.1bgg1bggo _Your Ranged Weapons skill increases to level 5!2bggiV_2bggo2bgg?rH _No target in view!2bgg### ####.# ####..###....#2bgg}###...#.ß.###.@!...######...###..#.....#...#.._..# ##...#######..##.~....####.# ....# ########..###.#.# ### #########.#.#.# #.# #.#.# #.#.##.....# 2bgg2k _You enter the shallow water.2bgg---50Water Rev* 2bggś2bgg  _Moving in this stuff is going to be slow. _You see here a scorpion corpse.2bggY.#### ####.# ####..###....####...#.ß.###.†@...######...# ##..#.....#...#.._..# ##. #..#######..##.~....####.#2bgg/# ########..###.#.# ### #########.#.#.# #.# #.#.# #.#.##.....# 2bgg62bgg7_9---7.0 (1.62bggw7IRev*  _2bggv<2bggC2bgg>Db8.0 (2Rev+ 2bggJ9_2bggL` _e - 5 emerald potions (gained 1)2bggI ##### ####.# ####..###....# ###...#.ß.###.†.@..######...# #..#.....#...#.._..# ##. ..#..##.~....####.#2bgghJ # ########..###.# #.# ### #########.#. #.# #.# #.#.# #.#.##.....# 2bggQ 2bggPR -9.0 (1.02bggW 2bggjY 2bgg L ############## ####.........######### ####..###....######## ###...#.ß.###.†....######... #..#.....#...#..@..# ##......... ..#######..##.~....####.### ########..###..Rev+ #.##.....###..##.#2bgg =502bgg 2bgg  There is a faded altar of an unknown god here. _You see here the Hermit's Pendant {Faith Invo=14 Evo=0 MP+5}.3bggk  There is a faded altar of an unknown god here. _You see here the Hermit's Pendant {Faith Invo=14 Evo=0 MP+5}.  This altar belongs to (a) Elyvilon, (b) Vehumet or (c) Trog, but you can't tell which.  Press the corresponding letter to learn more about a god, or press enter to  convert or escape to cancel.3bggVn  Okay, then.3bgg3bgg(. _4bgg+4bgg4bgg4bggb4bgg$404bgg= _Rev 4bgg4bgg4bgg4bgg4bgg4bgg*4bgg%4bggC4bgg#14bggN==4bgg 4bgg1 _HP restored.4bgg4bgg4bgg4bgg=4bgg4bgg"4bgg4bgg4bgg,4bgg4bggz!4bgg%#4bggH#9=4bggN$4bggc&4bgg',4bgg)4bgg+4bgg-,4bgg.4bggN04bgg1,4bgg24bgg34bgg4,4bggL54bgg64bggL74bggl74bgg74bgg:4bgg{;4bgg;4bgg<4bggw=4bggL>4bggx>4bgg>4bggP@4bggTA,4bggA4bggVC4bggC4bggD4bggjD4bggE4bggF,4bggG4bggH4bggI,4bggOJ4bggK4bggnL4bggL4bgg+M4bggRN4bgg O4bggFO4bggO4bggP4bggQ,4bgg8R4bgg,S4bgg.T,4bggT4bggV4bggV4bggV4bggzW4bgg}X4bggcY4bggY4bggY4bggZ4bgg[4bgg[4bggG\4bgg8]4bgg^,4bgg^4bggl_4bgg`4bgg?`4bgg`4bgga4bggb,4bgg7c4bggd4bggd4bgg e4bgge4bggCf4bggLg4bggzg4bggg4bggi4bggj4bgg*j4bggj4bggk4bggl,4bgg(m4bggTn4bggdo4bggo4bgg|p4bgg~q4bggr,4bggr4bggs4bggst4bggt4bgg u4bggv4bgg.........  #. #..#######.   ## #..........  ##....####.  #.##.# #. 4bggH4bgg,1.0 (414bggǐ4bgg% _Found 5 stones.4bgg 34bgg 4bggS 4bgg 4bggM 4bgg ,4bgg ,4bgg6 4bgg 4bgg 4bgg. 4bgg 4bgg ;  You see here 5 stones.4bgg5 4bgg  _4bgg| 4bgg 4bgg 4bgg 4bggu 4bggM 4bgg 4bgg 4bggڧ 4bgg B4bgg 4bggM 4bggް 4bgg 4bgg 4bggY 4bggK ,4bgg 4bgg 4bggx  ############# #............ ##########.########### #..........# #.#######..# #(# #..# 4bgg h #.# #..#########  #.#######>.........#  #....@.##..#######.###4bgg  ######.##.............  $###....####.###4bgg   .# #.##.# #.#4bgg~ 5  .# #.##.# #.#  K# #.##.## #.# K   kobold (missile, asleep)  <# #>#...###.# 4bgg .# #.........# ####...##### #4bgg 800.0 (9.0)  A kobold comes into view. It is wielding a +0 short sword.4bgg /1.0 (10.0)4bgg 4bgg N _Found 7 gold pieces. Found a stone staircase leading up.4bgg  #..  #.  #(# #..#  #.#   #.#######> 4bgg  #....@.# ######.# $# .#  #.#  .#  #.#  4bgg K#  #.#  <# #>  .#    4bggLe  #..  #.  #(# #..#  #.#   #.#######>  #....@.# ######.# $# .#   .#   K# 4bgge #.#  <# #> .#  4bggj4bggpk4bggr4bggt] _A kobold is nearby!5bgg #..  #.  #(# #..#  #.#   #.#######>  #....@.# ######.# $# .#  #.#  .#  #.#  K#  #.#  <# #>  .#    5bgg3\  #..  #.  #(# #..#  #.#   #.#######>  #....@.# ######.# $# .#   .#   K#  #.#  <# #> .#  5bggsc45bgg9j5bgg{u ((((K) _A kobold is nearby!You shoot a sling bullet.5bgg  The sling bullet hits the kobold but does no damage.  You shoot a sling bullet. The sling bullet hits the kobold.5bggef)5bggZf.$..5bggŎo5===2.2 (1.2)Rev 5bgg5bggJ _You kill the kobold!5bggO5bggS5bgg5bgg)H _No target in view!5bgg5bggr5bgg~5bggH _No target in view!5bgg 5bgg 5bgg`" 5bgg% 5bgg' 5bgg, Q _5bggH/ ,5bgg0 5bgg_2 5bgg-4 ,5bgg=5 5bgg}8 5bgg8 !5bgg9 5bgg< M _You now have 167 gold pieces (gained 7).5bgg> 5bgg> 5bgg? 5bggA 5bggxC ,5bggzD 5bggE 5bgg:G ,5bggJ 5bggN  5bggN V Things that are here:  a +0 short sword; 5 stones5bgg\P 5bggP  _5bggQ 5bggS P  There is a stone staircase leading up here.5bggLU 5bggU  _5bggqV 5bggW 5bgg)Y ,5bggY 5bggZ 5bgg"\ 5bggb\ 5bgg] 5bgg_ 5bgg` ,5bggxa 5bggb 5bggSd ,5bggd 5bgg@f 5bggg 5bggg 5bggPh 5bggKi 5bgg j 5bggHj 5bggj 5bggk 5bggXl 5bggl 5bggm 5bggm 5bggn ,5bgggo 5bgg[p 5bggq ,5bggq 5bggs 5bggt 5bggt 5bgg1u 5bgg;v 5bggw 5bgg%w 5bgg_w 5bggWy 5bggj  #.#####... #.##....#.# #  #.##.###.##   #.##.# ### #.5bgg !  #.##.##.  #.##.##.  #.##.# ##5bggՁ *  #####.##.# #  #.@...##.# ---22.2 (20.0)5bgg   #.######.## # #. ##...###### 5bggj #. #.#........... #[ ##.#.########. #. ##.## #. #( ### #. #.5bgg j##.  ###..5bgg= 5bgg< H---3.2 (215bgg0 5bgg % _Found 6 stones.5bgg| 5bgg| 5bgg} 5bgg4 5bgg 5bgg ,5bgg6 5bggN 5bgg 5bgg߉ 5bgg 5bgg 0  #.##.###.##   #.##.# ##  #.##.#  5bgg  #.##.# #  #.##.# # #####.##.#  #.....##.#   #.######.##   #@# ##...#######  #.# #.#.......... 5bggP  #[# ##.#.  #.# ##.## #  #(# ### #  #.# 5bgg # S   ball python (constriction, asleep)  #.# ###.  #.S...5bgg y  ###.5bggٚ 15.0)5bggT +6.2 (35bggW 5bggz ^ _A ball python comes into view.6bgg\    ###        ####  #..  #.#  #@#  #.#  #[#  #.# ##.##  #(# ###  #.#  #.#  #.S 6bggQ?    ###        ####  #..  #.#  #@#  #.#  #[#  #.# ##.##  #(# ###  #.#  #.#  #.S  _A ball python is nearby!6bgg N ###  #### .....######.##.# ##...########.#..........[# ##.#.########.# ##.## (# ### .# ####.S ..##### ##6bgg 6bgg 27.2 (1 _6bgg 6bggn 6bgg  #### ....######.## ##...########.#..........#.#.########.# ##.## (# ### 6bgg .# ####.S ..#####  ## 6bgg <86bggy 6bgg _You see here a +1 robe of cold resistance.7bgg(e  You shoot a sling bullet. The sling bullet hits the ball python.7bgg%-~((((†7bggn-!7bgg& (You kill the ball python!7bgg^<.(..†7bgg@k6===9.4 (1.2Rev 7bggD7bggF 7bggMG!_You shoot a sling bullet.7bgg/7bgg7bggU7bggeH _No target in view!7bggx 7bggx 7bggU} 7bgg H _No target in view!7bgg 7bgg 7bgg 7bgg 7bggo g _7bggo 7bgg 7bgg 7bggY ;  You see here 6 stones.7bggj 7bgg 0 _7bgg 7bgg# 7bgg 07bggu 7bgg 7bgg 7bgg 7bgg 7bgg> 7bgg# ,7bggQ 7bgg g  You see here a ball python corpse.7bgg 7bgg  _7bggJ 7bgg 7bgg 7bgg 7bggq" 7bggq$ 7bgge& 7bgg& 7bgg' 7bgg) 7bgg0+ 7bgg^+ 7bgg, 7bggv. 7bgg0 7bgg0 7bgg1 7bgg7 7bgg>9 7bggn9 7bgg: 7bgg< 7bggu> ,7bgg> 7bgg@ 7bggA 7bggA 7bggB 7bggC 7bggD 7bggD 7bggEE 7bggF 7bgg+H ,7bggH 7bgg)J 7bggJ 7bgg.K 7bggqK 7bgg.M 7bggM 7bggN 7bggwN 7bggO 7bggP ,7bgghQ 7bggS 7bggT 7bggJT 7bggT 7bgg5V 7bggW 7bggZW 7bggW 7bgg2[ 7bgg=` ,7bgg` 7bggb 7bggc 7bggd 7bggd 7bggXf 7bggg 7bggg 7bggnh 7bggi 7bggk 7bgg2k 7bggJl 7bggm 7bggn 7bggo 7bggo 7bggdq 7bggr 7bggr 7bggs 7bggu 7bggQv 7bgg{v 7bgg8w 7bggz d  You see here a quokka skeleton.7bgg| 7bggy|  _7bggP} 7bgg& .###.## ##......###########.## .# ### #..###...............# .# #......############..## .# #..#.....# #..... .# ##.#.###÷# #.#### .# #.#.....### #.# .# #.###.)...## #.# .## #.###.###..# ##.# ..#########....÷@....## #..# ---58.4 (29.0) 7bgg ...........#..........# #.## #.########.#.#######..# #.# .## #.#.## #..# #.# ## #....# #..# #.# 7bgg ##..#.######..#####.# #########...#...............# ..........#####..####.####### 7bggГ #########...#....# #>#7bgg :---7bgg 7bggU E _Done exploring.8bgg8bggf8bgg8bggY/.÷0.0)...... .........8bggp38bgg58bgg7E _Done exploring.8bgg 8bgg Where to? (Tab - D:3, ? - help)  D - Dungeon 9bgg9bgg [?25h[?0c9bggOu.###.## ##......###########.##SunshineJesse the Shooter .# ### #..###...............#Coglin .#9bgg{#......############..### Health: 41/41 ======================== .##..#.....##..... Magic: 5/5======================== .###.#.###÷#9bgg#.#### AC: 4Str: 11 .#9bgg#.#.....####.#EV: 12Int: 9 .#9bggH #.###.)...## #.#SH: 0Dex: 19 .###.###.###..# ##.#XL:  5 Next: 66% Place: Dungeon:3 9bgg..#########....÷@....## #..#Noise: ---------  Time: 1858.4 (0.0) ...........#..........# #.##9bgga) +2 sling {Septima j) +0 sling (elec) { #.########.#.#######..# #.#Fire: a) +2 sling {Septima} .###.#.## #..# #.# ###....# #..# #.###..#.######..#####.# #########...#...............# ..........#####..####.####### 9bggm#########...#....# #># _You see here 6 stones. _You see here a ball python corpse. _You see here a quokka skeleton. _Done exploring. _Done exploring.  What level of the Dungeon? (default 3, ? - help) 9bggE [?25l[?1c9bgg 449bgg 9bgg 9bgg 9bgg [ _9bgg} ,9bgg 9bgga 9bgg3 ,9bgg 9bgg 9bgg! ,9bggޭ 9bgg 9bgg' ,9bgg 9bgg 9bgg̳ ,9bggԴ 9bgg; 9bggz ,9bggl 9bgg 9bggú ,9bggc 9bggh 9bgg ,9bgg8 9bgg) 9bgg ,9bgg 9bgg ,ball python corpse. _You see here a quokka skeleton. _Done exploring.  There is a stone staircase leading down here.9bggK 9bgg: 9bgg $ _9bgg% 9bgg8 49bgg=9 9bggI; 9bgg; 9bggJ= 9bggJ   #.[........  #.........#  #..........  #..........  #..........  9bggK ~#..........  #.........#  #@....... 70.1 (11.7) ####....#  ..# 9bggHK ? # 9bggoK 4_You climb downwards.  9bggK Found a scale mail.9bggHL 9bggQ 9bggDT a _There is a stone staircase leading up here.:bggSF:bggII}Read which item? Scrolls  c - a scroll of butterflies  f - 3 scrolls labelled UCOCURHIDDIM  g - a scroll labelled USECRI LOMESE  h - 2 scrolls labelled PESAOSIMMEE  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSU :bggI[!] read|quaff[?] describe selectedT bggw>bggo>bggvSunshineJesse the Shooter#§§§§§§§§§§Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Str: 11#§§§§§§§§§§EV: 12Int: 9#§§§§§§§§§§SH: 0Dex: 19#§§§§§§§§§#XL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Noise: ---------  Time: 1871.1 (0.0)####§§§§#a) +2 sling {Septima j) +0 sling (elec) {§§#Fire: a) +2 sling {Septima} # >bggP &_You climb downwards.  Found a scale mail. _There is a stone staircase leading up here.  The air fills with toxic fumes!  As you read the scroll labelled PESAOSIMMEE, it crumbles to dust. _It was a scroll of poison.>bgg   As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  It is a scroll of identify.>bgg/  --more-->bgg Identify which item? (\ to view known items) Scrolls (select first with ?)  g - a scroll labelled USECRI LOMESE  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSU Potions (select first with !)  e - 5 emerald potions  l - a bubbling coppery potion  n - a blue potion  o - 2 silvery potions  p - a glowing orange potion[?] describe selected@bgg!@bgg@bggfASunshineJesse the Shooter#§§§§§§§§§§Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Str: 11#§§§§§§§§§§EV: 12Int: 9#§§§§§§§§§§SH: 0Dex: 19#§§§§§§§§§#@bggXL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Noise: ---------  Time: 1871.1 (0.0)####§§§§#@bgg:a) +2 sling {Septima j) +0 sling (elec) {§§#Fire: a) +2 sling {Septima} # _There is a stone staircase leading up here.  The air fills with toxic fumes!  As you read the scroll labelled PESAOSIMMEE, it crumbles to dust. _It was a scroll of poison.  As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  It is a scroll of identify.@bgg@bgg+2.1 (1@bgg@bggW _e - 5 potions of curing@bggφ@bggRead which item? Scrolls  c - a scroll of butterflies@bggf - 2 scrolls of identify  g - a scroll labelled USECRI LOMESE  h - a scroll of poison  i - a scroll labelled HIDAXE ALEOH @bgg) m - a scroll labelled ANUYPIZXOPSU @bgg-[!] read|quaff[?] describe selectedAbgg Abgg Abgg SunshineJesse the Shooter#§§§§§§§§§§Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Str: 11#§§§§§§§§§§EV: 12Int: 9#§§§§§§§§§§SH: 0Abgg߶ JDex: 19#§§§§§§§§§#XL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Noise: ---------  Time: 1872.1 (0.0)####§§§§#a) +2 sling {Septima j) +0 sling (elec) {§§#Fire: a) +2 sling {Septima} #The air fills with toxic fumes!  As you read the scroll labelled PESAOSIMMEE, it crumbles to dust. _It was a scroll of poison.  As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  It is a scroll of identify. _e - 5 potions of curingAbggU AbggE (Identify which item? (\ to view known items) Scrolls (select first with ?)  g - a scroll labelled USECRI LOMESE  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSU Potions (select first with !)  l - a bubbling coppery potion  n - a blue potion Abgg o - 2 silvery potions  p - a glowing orange potion[?] describe selectedBbgg Bbgg6 Bbgg| fSunshineJesse the Shooter#§§§§§§§§§§Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Str: 11#§§§§§§§§§§EV: 12Int: 9#§§§§§§§§§§SH: 0Dex: 19#§§§§§§§§§#XL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Noise: ---------  Time: 1872.1 (0.0)####§§§§#a) +2 sling {Septima j) +0 sling (elec) {§§#Fire: a) +2 sling {Septima} #The air fills with toxic fumes!  As you read the scroll labelled PESAOSIMMEE, it crumbles to dust. _It was a scroll of poison.  Bbgg\ As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  It is a scroll of identify. _e - 5 potions of curingBbgg=& ]  As you read the scroll of identify, it crumbles to dust.Bbgg' +3.1 (1Bbgg+ Bbgg. / _o - 2 potions of ambrosiaBbggIj Bbggp sRead which item? Scrolls Bbggq  c - a scroll of butterfliesf - a scroll of identify  g - a scroll labelled USECRI LOMESE  h - a scroll of poison  i - a scroll labelled HIDAXE ALEOH Bbggr  m - a scroll labelled ANUYPIZXOPSU [!] read|quaff[?] describe selectedDbgg DbgguYSunshineJesse the Shooter#§§§§§§§§§§Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Str: 11#§§§§§§§§§§EV: 12Int: 9Dbgg5#§§§§§§§§§§SH: 0Dex: 19#§§§§§§§§§#XL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Noise: ---------  Time: 1873.1 (0.0)####§§§§#a) +2 sling {Septima j) +0 sling (elec) {§§#Fire: a) +2 sling {Septima} # _It was a scroll of poison.  As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  DbggzIt is a scroll of identify. _e - 5 potions of curingAs you read the scroll of identify, it crumbles to dust. _o - 2 potions of ambrosiaDbgg7DbggțIdentify which item? (\ to view known items) Scrolls (select first with ?) DbggN g - a scroll labelled USECRI LOMESE  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSU Potions (select first with !)  l - a bubbling coppery potion  n - a blue potion DbggT p - a glowing orange potion[?] describe selectedEbgguEbgguEbgg}SunshineJesse the Shooter#§§§§§§§§§§Ebgg#~Coglin#§§§§§§§§§#Health: 41/41 ========================#§§§§§§§§§§Magic: 5/5========================#§§§§§§§§§§AC: 4Ebgg~pStr: 11#§§§§§§§§§§EV: 12Int: 9#§§§§§§§§§§SH: 0Dex: 19#§§§§§§§§§#XL:  5 Next: 66% Place: Dungeon:4#@§§§§§§§Ebgg~fNoise: ---------  Time: 1873.1 (0.0)####§§§§#a) +2 sling {Septima j) +0 sling (elec) {§§#Ebgg~[Fire: a) +2 sling {Septima} # Ebgg'_It was a scroll of poison.  As you read the scroll labelled UCOCURHIDDIM, it crumbles to dust.  It is a scroll of identify. _e - 5 potions of curingEbggWnAs you read the scroll of identify, it crumbles to dust. _o - 2 potions of ambrosiaEbgg]  As you read the scroll of identify, it crumbles to dust.Ebgg|+4.1 (1EbggEbgg][ _l - a potion of heal woundsEbgg5 EbggӉ Ebggۊ Ebgg ,Ebgg Ebgg_ ,EbggՓ Ebgg ,Ebgg Ebgg Ebggߗ Ebggޚ Ebggv ,Ebgg Ebggȟ Ebgg EbggB Ebgg ,Ebgg Ebgg Ebgg Ebgg Ebgg ,Ebgg Ebgg ,Ebgg| Ebgg ,EbggҰ Ebgg Ebgg> Ebgge Ebgg Ebgg3 Ebgg5 EbggI Ebggt Ebggl Ebgg Ebgg@ Ebgg BEbggA Ebgg ,Ebgg! Ebgg ,Ebgg Ebgg Ebgg Ebgg Ebgg EbggV Ebgg Ebgg Ebgg ,Ebgg Ebgg Ebgg Ebggu Ebgg Ebgg EbggV Ebgg Ebgg Ebgg? Ebgg: Ebggc Ebgg Ebgg$ EbggW Ebgg Ebggf ,Ebggn Ebggv ,Ebgg Ebgg ,Ebgg Ebgg ,EbggN Ebggq ,Ebgg Ebgg, ,Ebgg Ebgg ,EbggV Ebgg Ebgg Ebgg8 EbggH ,Ebgg Ebgg ,Ebgg Ebgg ,Ebggo Ebggu Ebgg Ebgg Ebgg ,EbggN Ebgg" ,Ebgg Ebgg% ,Ebgg Ebggg Ebgg Ebgg Ebgg5 Ebggv Ebgg Ebgg EbggS Ebgg( Ebgg3 Ebggy Ebgg Ebgg Ebgg Ebgg Ebgg ,Ebgg, Ebgg9 ,Ebgg Ebgg Ebgg? Ebgg Ebgg ,Ebggf Ebgg ,Ebgg Ebgg ,EbggV EbggH Ebgg| Ebgg Ebgg Ebgg Ebgg) Ebgg ,Ebgg EbggQ" ,Ebgg# Ebgg$ ,Ebgg$ Ebgg& ,Ebgg& Ebgg/) ,Ebgg;* EbggH, Ebgg, Ebgg- Ebggj0 Ebgg0 Ebgg1 Ebgg3 Ebgg4 Ebgg4 Ebgg>7 Ebggk7 Ebgga8 Ebgg: Ebgg: Ebgg; Ebggj> Ebgg> Ebgg? Ebgg@ Ebgg&A EbggA EbggB EbggC EbggC EbggD EbggD EbggjE Ebgg G ,EbggJ EbggL ,EbggM EbggcP ,EbggP EbggQ EbggGbggBGbggTEGbggMI,GbggMGbgg ]...:......... ...(. ## ......#. #. .. ..(?.#.###.##.. ..  #........#.#####.  #.[ #..@....#8.1 (1  #.........###.##.##.#Gbgg]w#................#  #.............#....#  #.....#.##.#  #....#.# .#.........#.#.# .####<..........# #####....###.#GbggugA9.1 (2GbggpGbggq% _Found 7 stones.Gbgg3 IGbgg Gbgg GbggG Gbgg  GbggC Gbggv ,Gbgg Gbgg Gbgg ,Gbgg Gbgg Gbgg1 ,Gbgg Gbgg& GbggE' Gbgg6) Gbgg2. ~ _g - 2 scrolls labelled USECRI LOMESE (gained 1)Gbgg1 3Gbgg3 Gbgg8 Gbgg; ,Gbgg= GbggA ;  You see here 7 stones.GbggK E............# ............# J..........#  ..........#  #........#  # #....$...#  .. #?#...:....#  ..##.#... ........(...  ## ###..#........# . #. .....#..(.....# .###.##..............# ......#.#####........#J   endoplasm (asleep) .. #.......##### .......###.##.##.# ..............##..#GbggS W96.1 (77.1 (8GbggZ GbggM_ ] _An endoplasm comes into view.Hbgg  ............#  ............#  J..........#  ..........#  #........#  # #....$...#  Hbgg_.. #?#...:....#  ..##.#...@....#  ........(....#  ## ###..#........# . #. .....#..(.....# ..........# ###........#  #.......##### ##.##.##HbggԵe ............#  ............#  J..........#  ..........#  #........#  # #....$...#  Hbgg!.. #?#...:....#  ..##.#...@....#  ........(....#  ## ###..#........#  #. .....#..(.....#..........####........#  #.......#######.##.#HbggֿHbggHbggHbggma _An endoplasm is nearby!Hbgg> (((((J  You shoot a sling bullet. The sling bullet hits the endoplasm.  The endoplasm quivers.Hbgg  The endoplasm is severely wounded.You shoot a sling bullet. The sling bullet hits the endoplasm..Hbgg;......HbggH 7===8.3 (1.2HbggVjRev _You kill the endoplasm!Hbggh$Hbgg&h _Your Dodging skill increases to level 3!HbggHbggHbgg=HbggH _No target in view!Hbggm 4Hbgg Hbggk H _No target in view!Hbgg) Hbgg Hbgg Hbggz Hbgg DM(..#########..... . # #....$ #?Hbgg2 u0.0..##.#.... ........(## ###..#........#Rev ..#..(........###....##.##.#Hbggx Hbgg" 5---9.3 (1Hbgg% Hbgg1 p _Found 6 stones.  You pick up a Treatise on Traps and begin reading...Hbgg^2 #---Hbgg2 /2000.3 (2Hbgg?9 Hbgg<  You add the spells Construct Spike Launcher, Sigil of Binding and Diamond _Sawblades to your library.IbggȐ3Ibgg!Ibgg?Ibgg>Ibggq,IbggkIbggIbggIbgg3$ Ibggb*_You now have 177 gold pieces (gained 10).Ibgg3IbggIbggiIbggүIbgg!IbggIbggIbgg~IbggIbggyIbgg߻Ibgg,IbgghIbggIbggIbgg>IbggfIbgg Ibgg,IbggvIbggIbggQ,IbggIbgg,IbggIbggHg _h - 2 scrolls of poison (gained 1)Ibgg3IbggIbggIbggIbggIbggsIbggIbggIbgg%IbggIbggIbgg,IbggIbgg3Ibgg,IbggFIbggSIbgg,IbggIbggIbgglIbggIbggIbggIbgg Ibgg Ibgg, Ibgg? Ibgg,Ibgg8IbggAIbggAIbggwIbgguIbggvIbggIbggIbggvIbggIbggIbggIbggIbgg IbggH"Ibgg|"Ibgg"Ibgg'%,Ibgg%Ibggg)N _You now have 190 gold pieces (gained 13).Ibgg*IbggH+Ibgg+Ibgg@-Ibgg.Ibgg /Ibggt/Ibgg3Ibgg<5Ibggo5Ibgg5Ibgg7Ibgge8Ibgg8Ibgg9Ibgg9IbggX;Ibgg;Ibgg;Ibgg=Ibgg?Ibgg?Ibgg@IbggBIbggD,IbggEIbggGIbggxIIbggTJ,Ibgg1LIbgg N,IbggOIbgg;PIbggQIbggQIbggFRIbggUIbggWIbggKWIbgg-XIbggYIbgg[Ibgg[Ibgg\Ibgg^Ibgga,IbggbIbggrdIbggyf,IbggdgIbgghIbgg:pk............(....########..#........#  #. ......#..(.....# Ibggp##.##..............# ....#.#####........# ...... #.......##### .....###.##.##.## Ibggp............##..### .........#....#.@.# 38.3 (38.0) Ibggp.........#.##.###.# .......#.#..#.# .# Ibgg6q.....#.#.#..#.# ..........#..#.# #.# #....###.##.#.# > #....# #....#.# .#Ibgg[q}# #....# ######.. .. Ibggqn#<...# #..IbggtxIbgg'yIbgg@y%9.3 (39IbggIbgg Ibggڂ-_Found a stone staircase leading down.Ibgg:g IIbggq Ibggew XIbgg y Ibggy Ibggz IbggO| Ibgg| Ibgg} Ibgg~ Ibgg~ Ibgg Ibggr Ibgg Ibgg Ibgg\ IbggB _.... #.......##### ...###.##.##.## ..........##..### .......#....#...# ...#.##.###.# #.#..#.# #.## ##.#.#..#.# #..# .##..#.# ##.#.(####.##.#.# #@..## #....#.# #.#### ######.. ... # #.. ...# #......... ...# ........#5   Grinder (asleep)### 5..##### .... Ibgg ; 45.3 (6.0)  Ibgg `Grinder comes into view.Found 2 poisoned darts.Ibggn 55.==6.3 (7Ibgg Ibgg z _Grinder shouts! _There is a stone staircase leading down here.Ibgg ###..##.# #.## #  #..# .#  ##.#.(#  #@..#   #.###   ... #.. ..... #.........  5.......#  ...#######  ....Jbggk| ###..##.# #.## #  #..# .#  ##.#.(#  #@..#   #.###   ... #.. ..... #......... 5.......#  ...####### .... Jbggp4Jbgg)tJbggv\ _Grinder is nearby!Jbgg (((((((You shoot a sling bullet.JbggT q  The sling bullet completely misses Grinder.  You shoot a sling bullet.Jbgg+ Jbgg83 c.......Jbgg3 a=7.6 (1.3Rev Jbgg9 Jbgg; G _The sling bullet hits Grinder but does no damage.Jbgg3h Jbggh JbggXn Jbggp H _No target in view!Jbgg,4Jbgg3Jbgg5H _No target in view!KbggKbggVKbggKbggKbgg #.##### ###.##.##.## ####..### .##....#...# ..#.##.###.# .#.#..#.# #.## .# #.#.#..#.# #..##.# Kbgg#..#.# ##.#.(# ###.##.#.# #>@.# # #....#.# #.### # ######.. .... # #........ # #.5.......# ..........# 5   Grinder ....####### Kbgg1(0.0Kbgg8*Kbggg  Grinder gestures at you.KbggL8@KbggUMe39-----8.6 (1KbggTKbgg9Z4 _Pain shoots through your body!Kbgg, ((((You shoot a sling bullet. The sling bullet hits Grinder.Kbggд  Grinder is lightly wounded.  You shoot a sling bullet. The sling bullet hits Grinder.Kbgg8Kbgg5@b...5.Kbgg An===9.7 (1.1Rev+ KbggFKbggI1 _Grinder is lightly wounded.Kbggf(((((((Kbgg?j  You shoot a sling bullet. The sling bullet barely misses Grinder.  You shoot a sling bullet. The sling bullet hits Grinder.Kbgg @  Grinder is lightly wounded.Kbggj ...§....5.Kbgg h40=-51.0 (1.3Kbgg Kbgg % _Grinder blinks!Kbgg ((( You shoot a sling bullet. The sling bullet hits Grinder.Kbgg  Grinder is moderately wounded.You shoot a sling bullet. The sling bullet hits Grinder.Kbgg Kbgg ...5.  Grinder is heavily wounded.Kbggש g  Grinder gestures at you.Kbgg3 2.2 (1.2Rev* Kbgg; Kbgg> 2 _You resist with some effort.KbggJH ((You shoot a sling bullet. The sling bullet hits Grinder.Kbgg=  Grinder is heavily wounded.You shoot a sling bullet. The sling bullet hits Grinder!LbggLbggE......Lbgg-3.3 (1.1Lbgg!$ Lbgg!N_Grinder is severely wounded.Lbgg4LbggȹLbgg.H _No target in view!LbggJLbgg*H _No target in view!Lbgg*LbggLbggLbgg_LbggLbgg; _LbggLbgg^Lbggd>---4055   GrinderLbgge:---Lbgg2lLbgg/s ((((( _Grinder is nearby!You shoot a sling bullet.Lbgg  The sling bullet closely misses Grinder.  You shoot a sling bullet. The sling bullet hits Grinder.Lbgg ..5..  Grinder is severely wounded.Lbgg g  Grinder gestures at you.Lbgg` Lbgg 1=====5.5 (1.2LbggQ Lbgg< - _You struggle to resist.Lbggu [(((((>Lbgg`  You shoot a sling bullet. The sling bullet barely misses Grinder.  You shoot a sling bullet. The sling bullet hits Grinder.Lbgg Lbgg t.....6.7Lbgg^ Lbgg, \ _Grinder is severely wounded.Lbgg Lbgg Lbgg Lbgg H _No target in view!MbggUMbggMbggvMbggKH _No target in view!MbggRs4MbggtMbggzMbgg{MbggzMbgg`; _MbggMbggMbgg#.#####........#  #.......##### .# ###.##.##.## .### ..##..### ...##....#...# $..#.##.###.# .. Mbgg .#.#..#.# #.## .# #.#.#..#.# #..##.# ...#..#.# ##.#@(---70###.##.#.# #>..# #....#.# #5#### ######.. .... # #..# #......... 5   Grinder .# ..........# Mbgg n##....#######....Mbgg ":---Mbgg0)Mbggq,\ _Grinder is nearby!Mbgg ( You shoot a sling bullet. The sling bullet hits Grinder.MbggL  Grinder is almost dead.You shoot a sling bullet. The sling bullet hits Grinder.MbggMbggLA5.Mbgg7===8.9 (1.2MbggMbggxW _Grinder is almost dead.Mbgg5]  You shoot a sling bullet. The sling bullet hits Grinder.MbggD3 MYou shoot a sling bullet. The sling bullet hits Grinder. _almost dead.  The sling bullet hits Grinder but does no damage.Mbgg<  Grinder is almost dead.=60.1Mbgg Mbgg _Grinder misses you. Grinder barely misses you.Mbggë ]  You shoot a sling bullet. The sling bullet hits Grinder.Mbgg D.Mbgg6 (((((((You kill Grinder!Mbgg i.......Mbgg Mbgg S#.#####........#SunshineJesse the Shooter .. #.......##### .#Coglin .###.##.##.## .###Health: 42/42 ======================== ........##..### ...#Magic: 5/5======================== Mbgg ".....#....#...# $..AC: 4Str: 11 .....#.##.###.# ..EV: 12Int: 9 ...#.#..#.# #.## .#SH: 0Dex: 19 .#.#.#..#.# #..##.#XL:  5 Next: 250% Place: Dungeon:4 .....#..#.# ##.#@(#Noise: ===------  Time: 2061.3 (1.2) .###.##.#.# #>..##a) +2 sling {Septima j) +0 sling (elec) { .# #....#.# #.###Fire: a) +2 sling {Septima} .# ######.. ....Rev* .##........ .##......... .#..........# Mbggv M##....#######....Mbgg You shoot a sling bullet.  The sling bullet hits Grinder but does no damage.  Grinder is almost dead. _Grinder misses you. Grinder barely misses you.You shoot a sling bullet. The sling bullet hits Grinder.  You kill Grinder!Mbgg % MbggW a_You shoot a sling bullet.  You have reached level 6!Mbgg /  --more--NbggLD8/486/6677% NbggQNbggzT4 _NbggPT NbggT Nbgg V Nbgg] Nbgg_ Nbggrc ; _Nbggf C  You see here 2 poisoned darts.Nbggh Nbggji _Nbggj Nbggl Nbggn Nbggo :Rev+ Nbggp Nbggr Nbggs ,Nbggt Nbggv Nbggix Nbggx Nbggy Nbgg| ,Nbgg} Nbgg N _You now have 209 gold pieces (gained 19).NbggJ URev NbggU Nbgg' Nbggq Nbggf Nbgg Nbgg Nbggގ Nbgg Nbgg8 Nbggԑ Nbgg Nbgg Nbgg Nbgg Nbgg Nbgg* !Nbgg Nbgg Nbgg Nbgg Nbgg Nbgg Nbgg q ...........#  #..# <####  #.#........# .....  #.#........# ...... ##.#........# ........(....# #...... #..#........# .........#..(.....#####.......Nbgg .......##..@.......---73.3 (12.0) ####........##.######### #.......######.# #.##.##.## ###.### .....##..###.....# .Nbgg .#....#...#.....# ..#.##.###.#.....#.#..#.# #.###.Nbgg/ ,### NbggQ l#.#..#.# #..##.#Nbgg Nbggo H---4.3 (13Nbgg Nbggu 9 _Found a stone staircase leading up.ObggRE_ObggGJBObggyMBObggMObgg.QObggRObggRObggqSObggVObggJX,ObggXObggZObggg\Obgg\Obgg&]Obgg~^Obgg_,Obgg_Obgg`Obgga,ObggNbObggTcObggd,ObggudObggeObggfObgg(gObgggObgghObgg~iObggiObggiObggjObgglk,ObggkObgglObggm,ObggnObggoObggqObgg-qObggqObggrObggsObggsObggtObggOvObggx,Obgg)yObggzObgg{Obgg{ObggK|Obgg}Obgg~Obgg-ObggObggĀObggObggObggObggObgg # # ##.#  .#$#.#  .....  ...  .. ####.#.# (..########## 92.3 (18 .....### .Obgg....##.# [# ............##.# ..  ...........##.######  #.#........##.....<######  #.#........######.......#  #.#........# #.......# ##.#........# #........ObggObggx,3.3 (19Obgg'Obgg# _Found a robe.Obgg3ObggObggjObggObggObggObggcObgg,ObggObggObgg{,ObggObggObgg;,ObggVObggObggObggObggObgg,ObggObggN _You now have 229 gold pieces (gained 20).Obgg3Obgg>ObggMObggObgg~####.. #.# #.# .. #.#####.### Obgg###.#.......# ######.#.#.###  ...........$..>100  #####...#.#.#.#!###. ####.#.#.#.#. ######......#.#.#.# ....##.##.###.#.#. Obggt....##.##[# #.#...# ....##.##.. ..##### ....##.######## ....##.....<######ObggB4.3 (11Obgg*"Obgg#; _Found a stone staircase leading down.Obgg@Obgg9ObggObggObgg,Obggj,ObggG,ObggQObgg[Obgg5ObgghObgg9Obgg### #..  #.# ### Obgg:#.# ...  #.#####.### Obgg ###.#.......#  ######.#.#.###.#.##### .................$..>#  #####...#.#.#.#@###.#  ####.#.#.#.#.#.#  ###......#.#.#.#.#  .##.##.###.#.#.#..  .##.##[# #.#...###  .##.##.. ..#####    .##.########    .##.....<   .######.......#   Obgg17.3 (3.0)Obgg5+8.3 (4ObggObggZ _q - a fuming orange potionObgg6 Obgg ObggE Obggw Obgg Obgg ,Obgg BObgg N _You now have 239 gold pieces (gained 10).Obgg Obgg  Obgg Obgg Obgg ,Obgg ObggP ObggP ,Obgg Obggc R  There is a stone staircase leading down here.ObggH ObggG  _Obgg Obgg Obgg Obgg Obgg Obgg Obgg ObggI Obgg v _l - 2 potions of heal wounds (gained 1)Obgg Obgg Obgg_! Obggw( Obgg) Obgg* Obgg, ,Obgg, Obgg^. Obgg/ ,ObggK0 Obgg1 Obgg.3 ,Obgg3 Obgg 5 Obgg56 Obggl6 Obgg6 ObggJ8 Obgg9 ,Obgg3: ObggZ; Obgg< ,Obggp= ObggO> ObggI? Obgg? Obgg? ObggA ObggC ObggC ObggC ObggE ObggF ObggF ObggKG ObggK ObggZM ,ObggM Obgg9O ObggKP ObggP ObggP Obgg4R ObggzS ,Obgg T ObggU ObggV ,ObggpW ObggX ObggY Obgg%Z ObggZ Obgg[ Obgg-] ,Obgg] Obgg@_ ObggR` Obgg` Obgg` Obgg{a Obggb ,ObggHb Obggc Obggc Obggc Obggd Obggd Obggie ,Obgge Obggnf Obggf Obgg g Obggg ObggXi Obggj ,Obggk Obggl Obggm ,Obggm Obggn Obgg3o Obggo Obggo Obggp ObggCq ,Obggq Obggbr Obggr Obggs ObggRs Obggt Obggt Obggt Obggt Obggv Obggzw Obggw Obggx ,ObggDy ,Obggy ObggObgg@,Obgg BObggCObggFObgg]FObggGObggJObgg]M,ObggNObggNQObggV,ObggiYObgg[Obggc ###  ..#  ## #.#  #< #.#  #. #.#  ### #.###.#   .....#.....#############ObggpdH ......|@................90.3 (82.0) ..##.###.############### #... ..  #....(..######### #................ ObggdW#................ $................ ................. #.#........ObggjObggk,1.3 (83ObggpObggr9 _Found a stone staircase leading up.PbggPbgg)PbggPbggM].................Pbgg  ### ..# ### #.# #<# #.# #.# #.#PbggsD## #.###.#.#......@..##.###.# #... .. #....(.. #... #....Pbgg $..... ....... #.#Pbgg,0.0)PbggA2.3 (1Pbgg#t _You see here a staff of death.Pbgg43PbggPbggPbggQPbgg: _PbggSPbgg,PbggcPbggPbgg,PbggPbggPbgg},Pbgg Pbgg Pbgg2#<# #.##.# #.# ##### #.###.# ......#.....##############.......|.....................##.###.################Pbgg # #.......# #....(.. #@.#6.3 (4 #................ $................#.................."....####.#Pbgg[####.... #.####.... #.###....##.##............(....#PbggPbgg+7.3 (5Pbggj!Pbgg#Q _Found a runed brass amulet.PbggZ Pbgg[ Pbgg] PbggY` Pbggf Pbgg~k ,Pbggk Pbggo ,Pbggq Pbggs PbggHw ,Pbggy Pbggs| Pbgg| Pbgg~ Pbgg N _You now have 259 gold pieces (gained 20).Pbgg Pbgg Pbgga Pbgg. Pbgg Pbgg BPbgg͞ Pbgg, Pbgg ,Pbggz Pbgg Pbggy Pbgg Pbgg$ Pbgg Pbgg8 ,Pbgg Pbgg Pbgg  ### ### #.. ..# #.### #.#  #.#<# #.# Pbgg  #.#.# #.# #######.#.###$.......#..........@.|.Pbggϻ 209.3 (12.0).....##.###.###########.%. #.# #.......# . #.# #....(..#####Pbggb  #.# #..... #.###..... #................#."....####.#.....Pbgg Pbgg -10.3 (13Pbgg? 6%Pbgg9 + _Found a maw talisman.Pbgg8_3Pbgg `Pbgg4iPbggr ### ### #.. ..# #.### #.# #.#<# #.# #.#.# #.#########.#.###.# $Pbggsk#.....#########.....|..................##.###.###########.%... #.# #.......#?..B. #.# #....(..#####..... #.# #B   giant cockroach (asleep)PbggEs.... #.###.... #.. #...........PbggS 0.0)%A giant cockroach comes into view.Pbgg%+1.3 (1PbggKPbgg71 _Found a scroll of identify.Qbgg  ### ###  #.. ..#  #.### #.#  #.#<# #.#  #.#.# #.#  ########.#  .$.....@.# Qbgg..........|.... ......##.###.## ..%... #.#   ?..B. #.# #....( ..... #.#  .... #.# .... #..QbggO|b ### ###  #.. ..#  #.### #.#  #.#<# #.#  #.#.# #.#  ########.#  .$.....@.# ..........|.... ......##.###.## ..%... #.#  ?..B. #.# #....( ..... #.#  .... #.# .... #..QbggQbggoQbgg#9%Qbgg%f _A giant cockroach is nearby!Qbgg}) ((%.(BYou shoot a sling bullet.Rbggl  The sling bullet hits the giant cockroach but does no damage.  You shoot a sling bullet.  The sling bullet hits the giant cockroach.Rbgg RbggRbggbl.B%...Rbgg.M===2.4 (1.1Rev Rbgg`RbggRbggeg _The giant cockroach is heavily wounded.Rbgg"  You shoot a sling bullet.  The sling bullet hits the giant cockroach but does no damage.  Lightning courses through the giant cockroach!!Rbgg(.Rbgg (%.(((((You kill the giant cockroach!Rbgg{.......83.6 (1.2Rev+ RbggB9%RbggŦ/ _You shoot a sling bullet.Rbggb8%Rbgg.cRbgggRbgghH _No target in view!Rbggl _No target in view!Rbggy 4Rbgg Rbgg+ Rbgg9 Rbgg WRev  _Rbgg Rbgg Rbgg Rbggl Rbggg Rbggz Rbgg RbggB Rbgg Rbggf Rbgg Rbgg Rbgg Rbgg Rbgg2 !Rbgg Rbgg Rbgg RbggV Rbgg Rbggh Rbgg Rbgg Rbgg% N _You now have 271 gold pieces (gained 12).Rbggn ### ### #.. ..# #.### #.# Rbgg l#.#<# #.# #.#.# #.#.##############.#.###.#>...............#.....##.Rbgg ........|......---20.6 (7.0####........##.###.####Rbgg > #....%...##.# #..... #..?.....##.# #....(Rbgg?  #........##.# #..... #........##.###Rbgg  #........## #........## #."....###Rbgg Rbggm G---1.6 (8Rbgg1 Rbgg ; _Found a stone staircase leading down.Sbgg$Sbgg SbggSbggSbggSbggSbgg\SbggSbgg)SbggSbggcSbggSbggSbggSbggSbgg #.### #.#.#<# #.#.# #.##############.#.##>...............#.....##.................|.......####........##.###.#### #....%...##.# #..... ###.# #....( #.# #.....Sbgg2 ?.#............"....###.###.....#. ##....# #....Sbgg!E%4.6 (3Sbgg+5.6 (4Sbgg"D _r - a scroll of identifySbggr Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls labelled USECRI LOMESE  h - 2 scrolls of poison  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSUr - a scroll of identify [!] read|quaff[?] describe selectedUbggUbggUUbgg7#.### #.# SunshineJesse the Shooter#.#<# #.# Coglin#.#.# #.# Health: 48/48 ========================.##############.#.###.# Magic: 6/6========================Ubgg>...............#.....## AC: 4Str: 11.................|...... EV: 12Int: 9.####........##.###.#### SH: 0Dex: 19Ubggk#....%...##.# #..... XL:  6 Next: 78% Place: Dungeon:4#..@.....##.# #....( Noise: ---------  Time: 2225.6 (0.0)#........##.# #..... a) +2 sling {Septima j) +0 sling (elec) {#........##.###..... Fire: a) +2 sling {Septima} #........##.........#........##.........#........##."....### .........#####.....#Ubgg .#........# ##....# Ubggոi#....#  _You shoot a sling bullet. Ubgg_No target in view! _No target in view! _You now have 271 gold pieces (gained 12). _Found a stone staircase leading down. Ubgg-_r - a scroll of identifyUbggUbggUIdentify which item? (\ to view known items) Scrolls (select first with ?) Ubggx f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls labelled USECRI LOMESE  i - a scroll labelled HIDAXE ALEOH  m - a scroll labelled ANUYPIZXOPSU Potions (select first with !)  n - a blue potion  p - a glowing orange potion Ubgg q - a fuming orange potion[?] describe selectedVbggVbggxVbggV#.### #.# SunshineJesse the Shooter#.#<# #.# Coglin#.#.# #.# Health: 48/48 ========================.##############.#.###.# Magic: 6/6========================>...............#.....## AC: 4VbggStr: 11.................|...... EV: 12Int: 9.####........##.###.#### SH: 0Dex: 19#....%...##.# #..... XL:  6 Next: 78% Place: Dungeon:4#..@.....##.# #....( Noise: ---------  Time: 2225.6 (0.0)#........##.# #..... a) +2 sling {Septima j) +0 sling (elec) {#........##.###..... Fire: a) +2 sling {Septima} #........##.........#........##.........#........##."....### .........#####.....# .#......VbggD..# ##....# #....#  _You shoot a sling bullet. _No target in view! _No target in view! _You now have 271 gold pieces (gained 12). _Found a stone staircase leading down. _r - a scroll of identifyVbggx %As you read the scroll of identify, it crumbles to dust.Vbgg+6.6 (1Vbgg8%Vbgg 2 _i - a scroll of brand weaponVbgge3VbggeVbgglVbggoVbgg.....#..# #########..# # #.....##.  ####### ## #. #. .. .#.###.##.#........#.Vbgg8%VbggR+1.6 (5Vbgg8%Vbgg9 _Found an escape hatch in the floor.Vbgg Vbgg VbggP Vbgg Vbgg  ######.###.## #....% #.....### #..#...g #......B.. #..^...."....#.......###....>.....#Vbgg  ######## g   Ijyb (wand, asleep)B   giant cockroach (asleep)#.[........Vbgga 0  Ijyb and a giant cockroach come into view.VbggP +2.6 (1Vbgg Vbgg | _Ijyb is wielding a +0 club and carrying a wand of polymorph.Vbgg, #....%...##.#  #........##.#  #........##.#  ### #........ ...g #........ ..B.. #........ .^....#........ .......@....... >.....#........#  #######........#  #.....##. Vbggf #######  #. #.  #.[Wbgg4] #....%...##.#  #........##.#  #........##.#  ### #........Wbgg]' ...g #........ ..B.. #........ .^....#........ Wbgg].......@....... >.....#........#  Wbgg]u#######........#  Wbgg]#.....##.  ####### Wbgg ^^ #. #. Wbgg*^ WbggL^C #.[Wbggh7%WbggOiWbggtWbggwd _There are monsters nearby!Wbgg# (((g  )You shoot a sling bullet. The sling bullet hits Ijyb.  Lightning courses through Ijyb!Wbgg %((Ijyb is severely wounded.WbggSWbggkX  You shoot a sling bullet. The sling bullet closely misses Ijyb.....gB.o.o   orc wizardB   giant cockroach===3.8 (1.2Rev Wbggl8%Wbgg`z _An orc wizard comes into view. It is wielding a +0 dagger.Wbgg$ ( You shoot a sling bullet. The sling bullet hits the orc wizard.WbggIJ %((((((The orc wizard is moderately wounded.You shoot a sling bullet.Wbgg=nWbggI .......Bo The sling bullet barely misses the orc wizard.WbggId5.1 (1.3Rev+ Wbgg T8%Wbgg>WA _The orc wizard hits you but does no damage.Wbgg  You shoot a sling bullet. The sling bullet hits the orc wizard.Wbggs The sling bullet barely misses the orc wizard. _The orc wizard hits you but does no damage.  The sling bullet hits the orc wizard but does no damage.WbggE WbggR .gThe orc wizard is moderately wounded.Wbgg -6.3 (1.2Wbgg 8%Wbggp P _The orc wizard misses you.Wbggy  You shoot a sling bullet.  The sling bullet hits the orc wizard but does no damage.  Lightning courses through the orc wizard!WbggS )B   giant cockroachWbgg2 (You kill the orc wizard!You shoot a sling bullet.WbggȞ ,Wbgg %.gBThe sling bullet hits the giant cockroach but does no damage.Wbgg p897.5Rev* Wbgg Wbggw Wbgg /  --more--XbgglHS _The giant cockroach misses you.XbggbYou shoot a sling bullet.  The sling bullet barely misses the giant cockroach.The sling bullet hits Ijyb.Xbggi%)(B   giant cockroachXbgg((((((You kill Ijyb!You shoot a sling bullet.Xbgg}  Xbggc~ Xbgg~ ".....)BXbgg~ =The sling bullet barely misses the giant cockroach.Xbgg Xbgg XbggJ +Xbgg s.####........##.###.## SunshineJesse the ShooterXbggV #....%...##.# #... CoglinXbgg #........##.# #... Health: 48/48 ========================Xbgg #........##.# #... Magic: 6/6Xbgg+ 3========================Xbgg ### #........##.###... AC: 4Xbgg .Str: 11Xbgg- .... #........##....... EV: 12Xbggi -Int: 9Xbgg ..... #........##....... SH: 0Xbggڏ .Dex: 19Xbgg# .^....#........##."....# XL:  6 Next: 102% Place: Dungeon:4Xbggo .....)B@.......#####.... Noise: ===------  Time: 2238.6 (1.1)XbggÐ >.....#........# ##... a) +2 sling {Septima j) +0 sling (elec) {Xbgg #######........# #... Fire: a) +2 sling {Septima} XbggZ #.....##. .... Rev* Xbgg #######Xbggݑ #####Xbgg #. #. .. B   giant cockroachXbggT .#.###.##.Xbgg #........#.Xbgg̒ 8#.[........Xbgg 6You shoot a sling bullet.  XbggC DThe sling bullet barely misses the giant cockroach.Xbgg 8The sling bullet hits Ijyb.  Xbgg You kill Ijyb!Xbgg7 6You shoot a sling bullet.  Xbggp =The sling bullet barely misses the giant cockroach.Xbgg XbggY Xbgg Xbgg% /  --more--XbggV _The giant cockroach barely misses you.You have reached level 7!Xbgg /  --more--Xbgg E53/537/77 1% Xbgg Xbgg  Your brain swirls with designs for a pilot doodad. You just need some more _time...Xbgg gYou shoot a sling bullet.  The sling bullet hits the giant cockroach.Xbgg) e)XbggvT %(((((((You kill the giant cockroach!Xbggp%.....))Xbgg-9.8 (1.2Xbgg8%XbggN/ _You shoot a sling bullet.Xbgg7%XbggoXbgg8%Xbgg* F _Unknown command.Ybgg`YbggmaYbgghYbgg@jH _No target in view!YbggYbggYbgg8%YbggxF _Unknown command.Ybgg4YbggYbggYbggQ .####.##.###. #....%...##.# #### #.##.# #oo #.##.# ###.##.##.###...#.##..#.##.^....#.##.".....)@..#####.>.....#.# #####.# # #.....##.  ####### Ybgg #. #. . oo 2 orcs (asleep) .#.###.## #.# #.[Ybggl*(0.0Ybgg.6---40.8 (1Ybgg3Ybgg< _2 orcs come into view.Things that are here: _a +0 dagger; a +0 robe; a giant cockroach corpseZbggW %((((o1 asleep)You shoot a sling bullet. The sling bullet hits the orc.  The orc shouts!Zbgg=  You shoot a sling bullet. The sling bullet hits the orc.  The orc shouts!  The orc is almost dead.  You shoot a sling bullet.  The sling bullet hits the orc but does no damage.  Lightning courses through the orc!Zbgg])   orc (Zbggco5---Zbggjv/  --more--Zbgg h   You kill the orc!.o...oZbgg k 7===1.9 (1.1Zbggv 8%Zbggx  _The orc shouts!Zbgg| ((( You shoot a sling bullet. The sling bullet hits the orc.Zbgg The orc is heavily wounded.You shoot a sling bullet. The sling bullet hits the orc.ZbggR V%)Zbgg !Zbgg K%...ZbggP 023.0Zbgg 8%Zbgg ? _You kill the orc!Zbgg 7%Zbgg ZbggD 8%Zbgg F _Unknown command.Zbggw 7%Zbggox Zbgg ZbggM H _No target in view![bgg4[bggJ[bggyF _Unknown command.[bgg_U%[bgg38%[bggH _No target in view![bggH4[bgg{J[bggN[bggQ[bggW; _[bggHaH .####.##.###. #....%...##.# # ### #........##.# # ). #........##.# #.#####)##........##.###.#........##.#..##.^....#.##.".@).#####---.>.....#.# ####..# # #.....##.  ####### [bgga #. #.  .#.###. #. #.[ _Unknown command. _No target in view! _ r - a wand of polymorph (6)  Things that are here:[bggm,40[bggmG---5.0 (2[bggGv8%[bggxo _a +0 club; a +0 leather armour; the goblin corpse of Ijyb\bgg5\bggH\bggM,\bggRN:Rev+ \bgg R\bggS\bggV\bggV\bggqX\bgg[\bgg$^,\bggH`\bgghz  Things that are here:  a +0 whip; an orc corpse\bgg0l\bggl _\bggn\bggu  Things that are here:  a +0 flail; a +0 ring mail; an orc corpse\bggiy\bggzFRev  _\bgg{\bgg,~\bgg\bgg\bgg]\bggƄ\bgg\bggj\bgg\bgg\bggӎ\bgg\bggZ\bgg\bgg\bggɘ\bgg\bgg͜\bgg\bgg\bggg\bgg\bgg/,\bggݩ\bgg-\bgg.,\bgg@\bgg)\bgg,\bgg\bgg\bgg|,\bgg\bggR  There is a stone staircase leading down here.\bgg\bgg^ _\bgg\bgg/\bgg,\bgg\bgg\bggH,\bgg\bgg\bgg,\bgg?\bgg\bgg,\bggr\bgg\bgg~,\bgg:\bgg\bgg\bgg/\bggw\bgg?\bgg ,\bggt \bgg \bgg ,\bgg \bgg \bgg ,\bgg \bggA \bgg ,\bgg! \bggM$ \bgg' ,\bgg( \bgg3 \bgg7 ,\bggJ9 \bggA< \bgg> ,\bgg@ \bggC \bggF ,\bggH \bggJ \bggM ,\bggN \bggP \bgg%S ,\bggm\ B\bgg\ \bgg] \bgg_ \bgga \bgga \bgg,c \bgge \bggg \bggh \bggi \bggm \bgg^p \bggp \bgger \bggVt \bggv ,\bggbx \bggy \bgg{ ,\bgg3} \bgg \bgg B\bggm \bggS \bggy \bgg \bgg \bgg4 ,\bggI \bgg \bgg ,\bggB \bgg \bgg ,\bgg \bgg \bgg ,\bgg3 \bgg \bgg ..))........#####.....##.#...... ...#........# ##....##.#...... ####........######....##.#......#.....##.#................(..########.#.#########..#...... #.#.# #........#..( #.#.###.##........ #........#.#####....\bgg(  #.[...@....##.......### #.........###.##.##.##  #.........##..###.............#....#.#.............#.##.###.#...........#o#..#.# #. o   orc (wandering)\bggf #.........#.#.#..#.# #.###<..........#..#.# ######....###.##.#.# #\bgg 89.0 (44.0)  An orc comes into view. It is wielding a +0 war axe.\bgg o.o\bgg, 6==90.0 (45\bggj \bggr % _The orc shouts!\bgg*y k))..# .  .#.(  .#.######\bggy  #.#.# #..( #.#.###.## #........#.# #.[...@....# #.........##  #............. \bggy \#............. #...........o. \bggz 3#...........#.  #.........#.#\bgg@z )  ###<......... \bggcz ,  \bgg %))..# .  .#.(  .#.###### #.#.# #..( #.#.###.## #........#.# \bgg2 #.[...@....# #.........##  #............. #............. #...........o. #...........#.  #.........#.#  ###<.........   \bgg \bggY \bgg>* \bgg- [ _An orc is nearby!\bgg:  ))..# .  .#.(  .#.###### #.#.# #..( #.#.###.## #........#.# #.[...@....# #.........##  #............. #............. #...........o. #...........#.  #.........#.#  ###<.........   ]bgg ]m))..# .  .#.(  .#.###### #.#.# #..( #.#.###.## ]bgg]t#........#.# #.[...@....# #.........##  #............. #............. #...........o. #...........#.  #.........#.# ]bgg]J ###<......... ]bgg^  ]bggph4]bggq]bggt[ _An orc is nearby!]bggr (((((You shoot a sling bullet.]bggrw  The sling bullet hits the orc but does no damage.  You shoot a sling bullet.]bggw]bgg]bggi.....o..]bgge=1.1 (1.1)Rev ]bgg*]bggG _The sling bullet hits the orc but does no damage.]bgg4 (((You shoot a sling bullet.]bgg ((The sling bullet hits the orc but does no damage.]bgg$]bggm.i..o..]bggv/_2.2Rev+ ]bgg}9]bgg6>w _You shoot a sling bullet. The sling bullet barely misses the orc.]bgg  (( You shoot a sling bullet. The sling bullet hits the orc.]bgg7p  The orc is moderately wounded.You shoot a sling bullet.  The sling bullet hits the orc but does no damage.]bggm ]bggg .o.3.4 (1.2]bggI ]bgg ^ _The orc is moderately wounded.]bggЗ ( You shoot a sling bullet. The sling bullet hits the orc.]bgg ((((The orc is severely wounded.You shoot a sling bullet.]bgg ]bgg- eo....]bggϬ (4.6]bgg) ]bggո H _The sling bullet closely misses the orc.]bgg ]bgge (((((You shoot a sling bullet.]bgg5  You shoot a sling bullet. _The sling bullet closely misses the orc.  ]bggYou shoot a sling bullet.  The sling bullet closely misses the orc.  You shoot a sling bullet. The sling bullet hits the orc.  Lightning courses through the orc!]bggS^bggO[)....^bggSTg5.8Rev* ^bgg\^bgg^G _You kill the orc!^bgg^bgg^bggX^bggH _No target in view!^bgg^bgg^bgg^bgg|H _No target in view!^bgg\^bgg^bgg^bggQ _^bgg^bgg   Things that are here:  a +0 war axe; a +0 ring mail; an orc corpse^bgg^bggFRev+ _^bgg^bgg^bggi,^bgg^bgg=^bggq!^bgg!^bgg #^bgg$^bgg&^bgg&^bgg'^bgg1)^bggs*^bgg*:Rev ^bgg+^bggQ-^bgg.^bgg.^bgg/^bgg3^bgg4^bgg4^bgg5^bgg[7^bgg;,^bgg<^bgg>^bgg@^bggA!^bggB^bggD^bggD^bgg%E^bggE^bggF^bggjG,^bggG^bgg!I^bggI^bggI^bggTJ^bgg-K^bggL,^bggM^bggWO^bggP^bggQ^bggQ^bggR^bgghS,^bggS^bggT^bgg9U,^bggU^bggqV^bggV^bggW^bggbW^bggX^bggY,^bggZ^bggY\^bgg],^bgg]^bggo^^bgg_^bgg:_^bgg_^bgg[`^bgg a,^bgga^bggc^bggd,^bgge^bggf^bggg^bggg^bggmh^bggp^bggEr^bgg}r^bgg s^bggu^bgg^v,^bggv^bgg&y^bggy^bggy^bggz^bggH~^bgg~,^bggO^bgg^bggQ,^bgg^bggY^bgg^bgg/^bgg^bgg^bgg&^bggR^bggƋ^bgg8^bggp,^bgg^bgg^bggٔ,^bggv^bgg^bgg^bgg^bgg/^bggѝ^bgg,^bgg^bggY^bgg^bggJ^bggͦ^bgg^bgg!,^bgg^bgg^bgg:,^bgg)^bgg^bggv,^bgg^bgg^bgg7,^bgg^^bgg`^bgg,^bgg7^bggF^bgg,^bgg ^bgg^bggi,^bgge^bgg^bgg,^bgg^bgg|^bgg?^bgg^bgg ^bgg^bggG^bgg^bggh^bggc^bgg,^bgg^bgg^bgg^bgg(^bgg ^bgg^bgg~,^bgg<^bgg^bgg^bgg^bgg^bgg0 ^bgg ,^bgg^bgg^bgg)^bggX^bgg^bgg^bgga,^bgg^bgg^bgg"^bgg#^bgg4$^bgg&^bgg(,^bggJ*^bgg,^bgg*.,^bgg2/^bggT1^bggU2^bgg2^bgg3^bgg75^bgg6^bgg7^bgg9^bgg:^bgg@^bgglA^bgg_4^bgg_##########......@#---355.8 (60.0)#.#####.##.#<# #.#^bgg`q#.#.# #.# ##########.#.###.# ...........#.....################ ............|................... ........##.###.################ ....%...##.# #.......# #^bgga:---^bgge^bgghE _Done exploring.^bgg 3^bggސ ^bgg 0.0).......%.^bgg( [ _Done exploring.^bggI^bgg.^bggX/^bggA48%^bgg8E _Done exploring._bgg@_bggA$_bggAwWhere to? (Tab - D:4, ? - help)  D - Dungeon _bggwT _bggc [?25h[?0c_bggcd   SunshineJesse the Shooter  Coglin  Health: 53/53 ========================Magic: 7/7========================AC: 4Str: 11EV: 12Int: 9SH: 0_bggd Dex: 19#########XL:  7 Next:  2% Place: Dungeon:4#......@#Noise: ---------  Time: 2355.8 (0.0)#.#####.#a) +2 sling {Septima j) +0 sling (elec) {#.#<# #.#Fire: a) +2 sling {Septima} _bggd #.#.# #.# ##########.#.###.# ...........#.....################_bgge   ............|....................  ........##.###.##################_bggLe   ....%...##.# #.......### _bggye Things that are here: _a +0 war axe; a +0 ring mail; an orc corpse _Done exploring. _bgge _Done exploring. _Done exploring.  What level of the Dungeon? (default 4, ? - help) `bgg [?25l[?1c`bggs45`bgg`bggm`bgg`bggH [ _`bgg!`bgg!`bgg"`bgg'X`bgg`(`bgg),`bgg*`bggM-`bgg,/,`bgg0`bgg\3`bgg[5,`bgg6`bgg:9`bgg:,`bggV<`bgg>`bgg@`bgg@`bggCD`bggE`bggyG,`bggH`bggK`bggM`bggN`bggT`bgg_`bgg7a`bggd,`bgge`bggg`bggi,`bggCk`bgg1m`bggn,`bggo`bggRq`bggs,`bggt`bgguv`bggx,`bggy`bgg{`bggQ},`bgg~`bggl`bgg`bgg\`bggO`bgg`bggw`bggE`bggx`bgg`bggč`bgg`bgg`bggj`bgg,`bggz`bggߔ`bgg'`bggY`bgg>`bggX`bgg,`bgg`bgg+Y  There is a stone staircase leading down here.`bgg`bggدP _`bgg$S`bggSA  You climb downwards.  `bggTUYou hear the sound of rushing water.`bggӖ/  --more--abggY ... ....+##.. ....#..#..#########...............abgg|5....#.........#.#.......#.#......! .. .#..### .## #.. .# #. .. # .# abggF abggځabgg#abgg081.5 (25.7)abggabgg62  You climb downwards.  You hear the sound of rushing water.  There is an entrance to a sewer on this level. Hurry and find it before the _portal rusts away!  Found a clear potion. abggS_There is a stone staircase leading up here.abggabgg Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls labelled USECRI LOMESE  h - 2 scrolls of poisoni - a scroll of brand weapon  m - a scroll labelled ANUYPIZXOPSU [!] read|quaff|evoke[?] describe selectedbbgg:bbgg1AcbggGSunshineJesse the Shooter...Coglin..Health: 53/53 ========================..Magic: 7/7========================+##.AC: 4Str: 11cbggf. ....EV: 12Int: 9#..#..#########SH: 0Dex: 19...............XL:  7 Next:  2% Place: Dungeon:5.......@...#Noise: ---------  Time: 2381.5 (0.0).........#.#a) +2 sling {Septima j) +0 sling (elec) {.......#.#Fire: a) +2 sling {Septima} ......! ...#..### .###.. .##. ..#.#You climb downwards.  You hear the sound of rushing water.cbggThere is an entrance to a sewer on this level. Hurry and find it before the _portal rusts away!  Found a clear potion. _There is a stone staircase leading up here.cbggh  As you read the scroll labelled USECRI LOMESE, it crumbles to dust.cbggVb2.5 (1Tele cbgglcbggi~ _You feel strangely unstable. It was a scroll of teleportation.dbgg-dbggk.dbgg/dbggk2dbgg6,dbggc6dbgg6dbgg7dbgg@>dbggB+4.5 (2dbggH ####  .... ####..### # dbggnH# .# #.......# #.......###+##+### .... dbggHI_You start waiting.dbggLdbggPdbggQ35.5 (3dbggTdbgghW@ _Your surroundings suddenly seem different.ebgg_ebggF##.> #####.ebgg .....#..###.#0#.#.###.#  #.#  ##+##+###ebgg Y..  ..ebgg2ebgg+6.5 (1ebggQ _Found a stone staircase leading down.ebggf3ebggebggebggebggBebggebgg½ebggebggebggebggRebggebggebgg),ebggDebggebggwebggebgg7ebgg)ebgg,ebggVebggbebggebgg%ebggebggTebggebggDebggebggebggCebgg}ebgg ebgg>ebggGebggebggebggyebgg8ebggvebggebggebggebggebggzebggebgg,ebggebgg{ebggNebggE,ebggebggebggLebggebggebggebggebggebggfebgg3,ebggebggebggtebggebgg/ ebgg ebgg ,ebgg ebgg ebgg,ebggYebggebggBebggebgg,ebgg ebggeebggebggebggebgg ebggebggebgg(ebgg ebgg"ebgg"ebgg"ebgg#ebgg%,ebggn&ebggV(ebgg3*ebgg*ebgg*ebgg,ebgg.,ebgg/ebgg1fbggJfbggfbgg,fbggzfbggfbggM,fbggfbggfbggfbgg1fbggfbgg!fbgg=$,fbgg%fbgg&fbgg),fbgg1,,fbgg1Bfbgg2fbgg5,fbgg97fbgg :fbgg=,fbgg?fbggX(((You shoot a sling bullet.mbgg]wThe sling bullet closely misses the orc.You shoot a sling bullet.mbggPmbgg5Q:The sling bullet closely misses the orc.mbggWmbggC[o..o.1-2.9Rev+ mbgg`9{mbggb0 _The orc hits you with a +0 dagger.mbgg<(((mbgg#  You shoot a sling bullet. The sling bullet barely misses the orc.You shoot a sling bullet.  The sling bullet hits the orc but does no damage.mbggmbggtm  The orc is moderately wounded.mbggo{..o.mbggųQ4.0Rev* mbggmbggmbggWP _The orc barely misses you.mbgg= ]  You shoot a sling bullet. The sling bullet hits the orc.mbgg  The orc is severely wounded.You shoot a sling bullet.  The sling bullet hits the orc but does no damage.mbggH k  The orc is severely wounded.mbggjI mbggQ @o.mbggR V2-5.1mbggY mbgg\ P _The orc barely misses you.mbgg (You shoot a sling bullet. The sling bullet barely misses the orc.The sling bullet hits the orc.mbggy  The orc is severely wounded.You shoot a sling bullet.  mbggy 1The sling bullet hits the orc but does no damage.mbggS k  The orc is severely wounded.mbgg mbggQ ooo 3 orcs (1 wandering)mbgg -6.3 (1.2mbggqmbggmbgg(/  --more--mbgg(U _The orc completely misses you.nbggjqYou shoot a sling bullet.  The orc shouts!  The sling bullet hits the orc!nbggirk) 2 orcsnbgg  You kill the orc!You shoot a sling bullet. The sling bullet hits the orc!  Lightning courses through the orc!nbgg()   orcnbggnbggvnbggJV)o.nbgg547.4 (1.1nbgg]3nbgg/  --more--nbggNH _You kill the orc!nbggK(((((nbggpYou shoot a sling bullet. The sling bullet barely misses the orc.You shoot a sling bullet.nbggPnbgg NThe sling bullet hits the orc but does no damage.nbggBp).o..nbgg-8.6 (1.2nbgg 8{nbgg _Something hits you. Something hits you but does no damage.nbgg_(( You shoot a sling bullet. The sling bullet hits the orc!nbgg,3  The orc is almost dead.You shoot a sling bullet.nbgg9:g  Reactivating autopickup.nbgg@nbgg=)o.. 3/54109.8 _You feel a bit more experienced. _Your Fighting skill increases to level 4!nbggnbgg:nbggnbggF _Unknown command.nbggS]  You shoot a sling bullet. The sling bullet hits the orc.nbgg X`()nbgg ((You kill the orc!nbggBa :)).nbgge )61.0nbgg`l nbggn / _You shoot a sling bullet.nbgg nbgg nbggӅ nbggj F _Unknown command.nbggM nbgg nbgg= nbgg H _No target in view!nbgg nbgg nbggw nbggF F _Unknown command.nbgginbggnbggnbggH _No target in view!nbggnbgg8nbggnbggF _Unknown command.obgg###..#..#  .<...### # .#.# .# .#.#.#.# ## ..# # .##...# ###.#..####.### ..:.... #.#..####.####......# #..# #.#####.####..# obgg##.. ..... ..... ### ###..## #####.$ obggobggobggߌd4=---20 _obggobgg;E _Unknown command.No target in view!Unknown command.No target in view! _Unknown command. _Items here: ))) [[ †.obggX o###..#..#  #<...### .# #.# ..# #.#.#.#### #..# ##.##...#. ###.#..####.####..:.obggY #.#..####.####......# #.)@.# #.#####.####..# #.. ..... ...... ### ###..########.$ obggle obgge I---3 _obggLj obggo  Things that are here: _a +0 dagger; a +0 dagger; an orc corpseobgg|c###..#..#  .# <...### .# #.# ..# .#.#.#### #..# ##.##...#..#..####.####..:.  #.#..####.####......# #.))@# obggS}#.#####.####..# #.. ............ ### ###..########.$ obggobggd4Rev+ _obggobggpbggKpbggpbggbpbgg)TM............... ###..#..######### ........ .<...### ..#.# #.#.#### #..# .............##.##...# ##.####..:......  #.#..####.####.@....#.........)).##..######.####..# ##.. ............Rev+ #######pbgg'[pbgg[&5pbgg^pbgg`pbgg}W>M##+##..####### ............... ###..#..######### ........ .#<...### ...#.# .#.#.#### #..# .............##.##...# #:......  #.#..####.####......#...........)).##..#.#####.####..# .#Rev+ .....pbgghpbggkpbggl=pbggNl6pbggqpbggspbgg1>##+##..# pbgg  ..#..# # .# <...### .# #.# ..# #.#.#### #..# ##.##...#..#..####.####..@......# #.#..####.####......#..##...)).##..# #.#####.####..# ..# #.. ...............### ###..########.$..#..# ...#.## .... 7pbgg׏pbgg?\  You pick up a book of Conjurations and begin reading...pbggZ8.0 (2Rev pbgg2pbggje _You add the spells Magic Dart, Searing Ray and Fulminant Prism to your library.qbgg|,............... ###..#..######### # ................. .#<...### .#...#.# ..##.#.#### #..#.....##.##...#... qbggޚ##.#..####.####.........#  #.#..####.#####..#  #..........)).##..#  #.#####.####..# ..# #.. ............... ### ###..########.$.. #..# .... #.##qbggV .... #.# ..#qbggqbggM+9.0 (1qbggqbggqbgg###..#..######### # .................. .#<...### .#...#.# ..# ##.#.#### #..#.....##.##...#... qbggF###.#..####.####.........#  #.#..####.#####..# #..........)@.##..#  #.#####.####..# ..#qbggq #.. ............... ### ###..########.$..qbgg #..# .... #.##qbggs .... #.# qbgg3..# qbgg/qbgg}'70qbggfqbgg,  Things that are here: _a +0 dagger; a +0 dagger; an orc corpseqbggX ................. .<...### ...#.# . ##.#.#### # .....##.##...#... ###.#..####.####.........#  ##.####......#. #..........)).##..# #####.####@.# . ...............## ###..########.$..#.Rev qbggCqbgga-1 _qbggqbggqbgg r <...### ..#.# . ##.#.#### #..# .....##.##...#... qbggJ $###.#..####.####.........#  ##......# #..........)).##..# #####.####..##..#.. .......@.......qbgg ## ###..########.$.. #..# ....qbgg )#.#.qbggc qbgg1 .2qbgg qbgg rbggl>rbgg>g<...### .# rbgg?Q#.# ..# rbgg@?.rbggx?i#.#.#### #..# rbgg?}##.##...#... rbgg@h.#..####.####.........#  rbggF@i#.#..####.####......#..# rbgg@#.rbgg@z.)).##..# rbgg1A#.#####.####..##..#.rbggWA7#.. .rbgg|AY### ###..#rbggAM.$.. rbgg6B*#..# rbgg]BK.... rbggB rbggB rbgg C rbgg\IrbggFJrbggyJ3rbggwNrbggWSrbggHrbgg6Ig<...### .# rbggJR#.# ..# rbggJi#.#.#### #..# rbgg Kg##.##...#... rbgguKg.#..####.####.........# rbggK}#.#..####.####......#..# rbggK#.rbgg*L..)).##..# rbggiL#.#####.####..##..#.rbggL7#.. .rbggLO### ###..#rbggMJ.$.rbggNM*#..# rbggM,.... rbggM*#.## rbgg=N-.... rbggcN rbggN rbgg(VrbggWrbggW4rbgg`rbgg5brbgg<...### .# #.# ..# #.#.#### #..#####.##...#... rbggN.#..####.####.........# .#..####.####......#..#  #...)).##..# .  #.#####.####..##..#...#rbgg#.. .#### ###..#.$...#rbgg <#..# ....##.## ....##.# ..#..# .##rbgg rbgg &5rbggrbggrbggp .<...### .# #.# #..# #.#.######..### ##.##...#... #..####.####.........# #..####.####......#..# # #...)).##..# .. #.#####.####..##..#...# #.. .# ### ###..#.$...# #..# .....# #.## .....##.# ..)..#..# .....#.#+#.#.# .#rbggx rbggy &6rbgg rbggۂ & _Found a war axe.rbgg <...### .# #.# #..# #.#.######..### ##.##...#... ..####.####.........# ..####.####......#..### ..)).##..# .. .#####.####..##..#...# .. .#  ###..#.$...# #..# #.....# #.## ##.# #..# #..rbgg rbggk &7rbggM rbgg sbggB.#.# #..# #.#.######..#####...##.##...#...####.####.........# ####.####......#..####.......)).##..#...... #####.####..##..#...#  .................# # ###..########.@...#  #..# #.....# #.## #.....# #.# #..)..#..# #.....#sbggZ% ..#+#.#..# .#..? .#sbggsbgg#&8sbgg sbgg=u _Found a scroll labelled PECVIA BOCAGO.sbgg+9.0 (2sbgg,sbgg 1 sbgg1sbgg10_You now have 276 gold pieces (gained 5).sbgge#.#.######..#####...##.##...#... ####.####.........# ####.####......#..#### ........)).##..#...... ####.####..##..#...#  .................#  ###..########.....#  #..# #..@..# #.## #.....# #.# #..)..# ..# #.....# ..#+#.#...# .#...? .#..... .#sbggmsbggm,80.0 (1sbggtsbggrvsbgg ....##.##...#... ####.####.........#....#..#### ........)).##..#...... ####.####..##  ..............  ###..######## #..# # )sbgg N.. ...#+#....# .....? ...... ......sbgg# sbgg &1sbgg sbgg\ sbggn  ####.####.........#....#..#### ........)).##..#...... ####.####.#  ..............  ###..########sbgg H #..# # .. ....#+#...#.....sbggm sbgg &2sbgg sbgg W _You hear the slow rusting of a distant drain. sbgg J_You see here a +0 war axe.sbgg| #..#### ........)).##..#...... ####.####.#  ..............  ###..######## #..# #sbgg*}, ). ......#+#......# ..? .#sbggM}4.......sbgg4sbggsbggȆ&3 _sbggosbggqtbgg'#.##.##.##.##+#tbggtbgg&4tbggtbgg( _You open the door.ubgg.####.####......#..####.)).##..#......#.####..##..#...# . .......# # ###..##.....#ubgg  #..# #.....# #.## #.....# #.# #..)..# ..# #.@...#ubgg8.#'#.#..#.#.#ubggX#.....?#.#.#ubggy#......#.#.##......ubgg#.##......#+#ubgg!#......ubggu&ubgg&ubgg '5ubgg/ubgg1ubggZ.........)).##..#...... .#####.####..##..#...# .. .................# ## ###..########.....# #..# #.....# #.### #.....# #.# ... #..)..# ..# .....##.....# .......@#'#.#.#.#.###.....?#.#.# #......#.#.# #.#.# #......#+# #....... #.......6ubggubggWL ' #####.####.# . .............. ## ###..######## #..# ######.# .... #..)..#...##.....# ...#'#.#.##.....? .##......ubggP ubgg0Q &7ubggW ubggHY ubgg3" . .............. ## ###..########.....# #..# #.....#######.. ..... #..)...##... ...#'#.## . #.......ubgg,ubggo,&8ubgg3ubgg;A9.0 (2ubggAubgg M#......#.#.#### #......#+#..... #..........# #..........# ##...# 501.0 (7#......... ###############. xbggy xbgg xbgg ybggybggqybggybgg ybgg%&Xybgg1'ybggx'ybgg(ybggW)ybgg*ybgg/+ybgg+ybgg,ybggl.,ybgg.ybgg0ybgg\1ybgg1ybgg1ybgg53ybgg5,ybgg5ybgg6ybggC8,ybgg8ybgg=e.......#.#.#  #......#.#.#  #......#.#.#  #......#.#.####  #......#+#.....  ybgg#>N#..........#  #..........#  ##.........#######  #..............@# ybggZ> 8  ###############.#   ybgg}>#.#  #.# ybgg>#.# #.#ybgg>  #.# ybgg>r #.# ybgg?b   ybggu?ybgg?ybgg"Hzbgg$ ####+#.........# #..#######  ........##############zbgg!'zbgg'+9.0 (1zbgg)zbgg6+{bgg###+#.........# #######  {bggu........##############{bgg0{bgg&'10{bgg{bgg{bggL ###+#.........# #######  ......##############{bggR{bgg-S&1{bggV{bgg-Y{bgg +#.........# #######  ......##############.{bggyY2{bgg^ ....# #######  ......{bgg^##############...  {bggmqY3{bggC #######  ......##############{bggr###  {bgga<4{bgg{bgg{bgg"A #######  ......##############  {bgg%#{bgg#&5{bggp'{bgg){bgg  ......###############  {bgg{bgg1&6{bgg{{bggn{bgg##############.....#####{bggI{bgg &7{bgg1${bgg&{bggɋ................##########{bgg]{bgg&8{bgg{bgg######...............###############{bgg{bgg&9{bggX{bgg{bggp######........######........###############{bgg{bgg'20{bgg({bgg{bggI{bggRJ{bggN{bgg`P{bgg}{bgg{bgg.{bgg!{bgg){bgg8*{bgg3{bgg{bggr{bgg{bgg{bggh  #.#  #.#  #.#{bggii 2  #.#  #.#  #.# .#.# .######. . #       {bggTp {bggNq &1{bggu {bggw |bgg  #.#  #.#  #.#  #.#  #.#  #.# #.#.# #.######. . #       |bggl|bgg&2|bgg2|bgg|bgg #.#  #.#  #.#  #.#  #.#  #.#  #.#.# #.######. . #       |bgg|bgg&3|bggt|bgg|bgg #.#  #.#  #.#  #.#  #.# # #.#  #.#.# #.######. . #  |bgg0|bgg|bgg-&4|bgg|bgg|bggxT #.# #.# #.# #.# #.# # #.# #.#.#.###.######...#|bgg~|bggn&5|bgg|bgg|bggq #.# #.# #.# #.## #.# #. #.# #.#.##.###.######..#.#|bgg|bgg&6|bgg9|bgg:|bgg #.### #.#.. #.##. #.# #. #.# #. #.# #.#.##.###.######..#.#|bgg?|bgg&7|bggF|bgg|bggH #.# ### #.# ..# #.# #.# #.# #.# #.# #.# #.# #.#.##.###.######..#.#8|bgg«U #.# ### #.# ..# #.# #.# #.# #.# #.# #.# #.# #.#.##.###.######..#.#|bgg|bgg&9|bgg:|bggK|bgg- 4|bgg5% |bgg& }bgg]  #.# ### #.# ..# #.# #.# #.# #.# #.# #.# #.## #.#.##.###.#######.#30}bgg\ak #.# ### #.# ..# #.### #.# #.#.. #.# #.##. #.# #.# #. #.#######.##.###..#####. #...##.##}bggg}bggm<1}bggo}bgg= #.# ### #.# ..# #.# ### #.# #.# ... #.# #.# #.# #.# #.#}bgg2# #.# #.#######.##.###.##.#####. #.# ..# ##.# ###}bgg}bgg&2}bgg}bgg}bggZ  ###..### #...#.######}bgg #######.###.........####..............#.#####@################ #.#.#  }bgg }bggu &3}bgg }bgg r _You hear the slow rusting of a very distant drain.}bggh* ..### #...#.#############.###.........#####.......................#.#####.################}bgg* #@##......#######   }bgg0}bgg2&4}bggg4}bgg6bggf bgg0j ,bgg-l bggqn bggn bgg]r Xbggr bggs bggu bggu bggIv bggXw bggz bgg+z bggz bgg| bgg0~ ,bgg~ bgg3 bgg| ,bgg( bggW bggޅ bgg bgg bgg bgg bgg bgg bggX bgg̍ Bbgg* bggݐ bgg bgg bggɒ bggw bgg bgg bgg^ /#..........# ##.........####### #...............# ###############.#  #.# bgg ? #.#  #.# ########## #.# .......@.# #.#45.0 (11.0)bgg P#######.# #.# ... #.# #.##.# #.# #.#bggޚ -#.# #.#######.########.###.........######. #..........................bgg  #.#####.################### #.#bggg bgg bggX bgg( bggw bgg bgg bgg bgg bggU Xbgg bgg bgg bgg bggb bgg bgg ,bgg7 bgg/ bgg bgg bgg bgg? bgg ,bggg bgg bgg ,bggh bggi bggf bgg bgg bgg bgg4 ,bgg bgg bggw ,bgg bggj bgg bggC bgg bgg bggl bgg bggB bggF bgg bgg bgg bgg bgg bgg; bgg bgg bgg{ bgg bgg@ bgg bgg| bgg bgg& bgg bgg bgg bgg- bgg bggb bgg bgg bgg bgg bgg8 bgg bgg bggq bgg bgg  bgg bgg bgg bggJ bgg bggh bgg bgg  bgg bggi bgg bgg ! bgg" bgg# bgg# bggv$ bgg% bggi' bgg' bgg*( bgg) bgg+ ,bggM, bgg. bgg/ bgg)0 bgg{0 bgg 2 bgg3 bgg3 bgg4 bgg|6 bgg8 bgg68 bgg8 bgg: bggB< bgg`< bgg= bgg> bggA ,bgg B bggC bggE bggE bggF bgg=H bggaJ bggJ bgg2K bggL bggN ,bggO bggS #.###..)..#..#......##.....# ........#'#.# .........#.#.# ####......#.#.# bggS #......#.#.# #......#.#.##### #......#+#...... #..@.......# 79.0 (34bggS . #..........#  ##.........####### #...............#bggT Y ###############.#bgg"T  #.# #.# bggnT #.# ########## #.#bggT bgg X bggBY bgg bgg! bgg bgg bgg bgg BbggC bggm bgg bggbggbggbggbgg[bggbggFbggbgg> _You hear the slow rusting of a distant drain.bgg3bggBbggbgg bgg#bgg#bgg&bgg*bgg-,bgg/bggW3bgg6bgg56bgg'8bgg:bgg:>bggk>bgg?bggCbggFbggGbggHbggIbggjKbggKbggLbgg1PbggQ,bggmRbggSbggSVbggWbgg_WbggXbgg}ZbggZbgg,\bgg^bgg,abgg]abggbbggdbggwgbgggbgghbggjbggembggmbggnbggpbggls,bggtbggvbggIx,bggxbggybggj{,bgg{bgg}bgg,bggbggBJ _Found a stone staircase leading down.bggbggbggibgglN#.#..####.####......#..### #..........)).##..#.....#.#####.####..##..#...##.....................########..########.....# #..# #.....#bgg #.#########.....#####.#......##..)..##...@#......##.....#603.0 (2#...##.#.........#'#.#..>. #.#.........#.#.#... #.####......#.#.#.. #.# #......#.#.#. #.# #......#.#.###.# #......#+#...#.# #..........# bgg(4#..........#bggfbggbgg2bgg8 #.#..####.####......#.. #..........)).##..# #.#####.####..##..#...# #.....................# #######..##.....# #..# #.....# #.##.....# ####.#......##..)..#bgg #..@.#......##.....# #...##.#..#'#.#.>. #.#..#.#.#... #.####......#.#.#... #.# #......#.#.#bgg.. #.# #......#.#.# . #.# #......#+#..bgg   #.# #...#  #bgg~F.# bggbgg14.0 (1.0)bggjbggpbgg #.#..####.####......#.. #..........)).##..# #.#####.####..##..#... #......... #..#..... #..# #.....bgg9 #.##..... ####.#......##..).. #.@..#......##..... #...##.#.#'#..>.. #.#.#.#.... #.####......#.#.bgg`.... #.# #......#.#...... #.# #......#.#.bgg...... #.# #......#+#....... #.# #.bggH #.bggbgg{bgg5bggDbggYbgg$:  #.#..####.####......#.. #.)).##..# #.#####.####..##..# # #..# #..# # #.# ####.#......##..)bgg:  #@...#......## #...##.#.#'# ....>..##.#.#.#.##.####......#.#.##.# #......#.#.##.# #......#.#bgg: .##.# #......#+#.##.# # #bggR Y6bgg^  #..........)).##..# #.#####.####..##..#. #................... #######..########... #..# ##.. #.##########..######.#......##..)#....#....#......##..#.@.##.#.........#'#.....>..##.#.#.#........##.####......#.#.##.# #......#.#.##.# #......#.#.##.# #......#+#.##.# #........#bgg .# # ##bgg bgg &7bgg bgg& bgg #.#####.####..##..#.. #................. ..# #######..######## .... #..# # #..# #.######### #..######.#......## #....#....#......##..###+##...##.#.........##.....@..##.#.# #........##.####......# #.##.# #......# #.##.# #......# #.##.# #......# #.##.# #....... #.# # ########## ## #bggbgg&8bggbggc _There is a stone staircase leading down here.bggF{X.. #................. ..# #######..######## .... #..# # #..# #.######### #..######.#......## #....#....#......#####+##...##.#....... #.....>..##.#. #.##.####...... #.##.# #...... #.##.# #...... #.##.# #...... #.##.# #...... #.# # ########## ## # ######bgg}bgg~$9 bgg _bggnbggbggs  #.#####.####..## .. #............... ..# #######..########.... #..# # #.######### #..######.#......## #....#....### ###+##...##.#bgg  #...@.>..##.#.. #.##.#### #.##.# # #.##.# # #.##.# #bgg<  #.##.# # #........# bggu n########### #....bgg# bgg '10bggo bgg bggE=1.#..#.....#.#.'======1bgg>bgg:E= _As you open the door, it creaks loudly!bgg[ #..........)).## ..#.#.#####.####..## ..#.#............... ..#.#######..######....# #..# #..## #.###### #..######.#...... #....#....## ###@##...##.# #.....>..##.#.. #.##.#### #.##.# # #.##.# # #.##.# # #.##.# # #........# ###########bggϷbggOG------2bgghbggQ _There is an open door here.bgg M#.#..####.####....#.. #.#..........))#...#.#.#####.####..##...#.#.................#.#######..#######bgg9....# .# #..## #.############# #@...#...####'##.bgge#.....>..##.#...#........##.####......#.#bgg_ ##........#bgg$bgg%C------3 bgg% _bgg|*bgg,bgg M..#######.####.... #.#..........))bgg8 l######.####..###...#.#...............#...#.#######..#######....# .# #..## #.############# #....#...#bgg` ,##'##..#.....>..##.#...............#bgg #........# #.......bgg 1..#........#bggP <4bgg bggj bggq ? ................##.## ..###.#..####.#### #.###.#..####.####... #...#.#..........)). #...#.#.#####.####..# #...#.#..............#...#.#######..#######.....# #..#  #.#######..######.#...... #....#....# ###'##...##.# #.....>..##.#.. #........##.#### #........##.# # #........##.# #bgg l #.##.# #bggQ bgg &5bgg7 bgg bggˍ! #.##.#.##<................##.# ..###.#..####.#### #.###.#..####.####.. #...#.#..........)). #...#.#.#####.#### #...#.#............. #...#.#######..######..@..# #..# #. #.####### ##..######.# #....#....# ###'##...##.#bgg #.....>..##.#.. #........##.#### #........##.# # #.##.# #bgg7<bgg&6bggrbgg9 _Found a stone staircase leading up.bgg{ #....#.#  .#.##.#.##<................## ..###.#..####.#### #.###.#..####.####bggAP #...#.#..........)) #...#.#.#####.#### #...#.#............ #.@.#.#######..#### #.....# #..# bgge #.##..## #.######. ##..######.#bgg#. #....#....##.###'##...##.#bgg#.#.....>..##.#..bgg!#.#.##.#### #.##.# #bggbgg~&7bggbgg̲bgg) #<...## #.....#.#  .#.##.#.##<................## ..###.#..####.#### #.###.#..####.#### #...#.#..........) #...#.#.#####.#### #@..#.#........... #...#.#######..### #.....# #..#  #.##..## #.#### #.###..######.# #.# #....#....# #.###'##...##.# #.#.....>..##.#..#.#.##.####8bgg) bgg bgg7 bgg bggM.......#.<...##.#....#.# .#.##.#<..................######.#..####.####.........)#####.####...........#.#######..####.....# #..##.#bgg܎bggƏ&9bgg.bggbggM###..#..#######.. # .......bgg ..#<...##.#.#....#.# ..#.##.#<..................###bgge###.#..####.####.........)#####.####...........#...#.#######..###.# #bgg/.#.###'##.bggbggMD20bggmM...............## ...###..#..#######... # ..................#...<...###..#.#......#.# #....#.#.#.#...<................bggtnD#...######.#..####.####.........)#####.#####...#.#...........#.# #...bgg'ubggu&1bggybgg|bggo`  .. .##+##..###### #..................### #....###..#..######... #.................. #..#.#...........<...# #..#.#.............#.###....#.#.........#.#.......<................#.@.###.#..####.#.#.###.#..####.####.#...#.#..........#.#...#.#.#####.####.#...#.#..........bgga ..#...#.#######..#####.....# #..#  #.##..## #.### #.###..######.#bgg:k <2bgg:m bggo bgg=  #.......###  #... .##+##..##### # #.................###. #....###..#..#####... #......... #..#.#...........<... #..#.#.............#.####....#.##.#........@................#######...###.#..####.bgg g #.#.###.#..####.## #.#...#.#......... #.#...#.#.#####.## #.#...#.#......... ..#...#.#######..####.....# #.. #. #.##bggS bggT &3bgg bgg a _There is a stone staircase leading up here.bgg #...##+ #.####....... #. #.....##+##..#### #. #................###.##....###..#..####....#....... #..#.#.....<. #..#.#.............# ####..@.#.#...#.#bggM........<...............########...###.#..####. #.#.###.#..####.# #.#...#.#........ #.#...#.#.#####.# #.#...#.#........ ..#...#.#######..###.....# #..bggbggW-4 _bggȷbggbgg+9 #. #+ #.####. #. #.....##+##.. #. #... ###.##....###..#.. ....#. #..#.#.< #..#.#. ####.@..#.#.#..<#...###.#..####. #.#.###.#..####. #.#...#.# #.#...#.#.#####. #.#...#.# ..#...#.# ###.....# #bgg"0bgg0&5bgg93bggJ4bgg $ ### #.. #+# #.####....... #.##.....##+##..## #.##..............###.##....###..#..##....#.. #..#.#< #@.#.#.. ####....#.#.# .........<............#########...###.#..#### #.#.###.#..#### #.#...#.#..... #.#...#.#.##### #.#...#.#..... ..#...#.#######bgg bgg &6bgg bgg, bggWbggbggbgggbggbgg bggbgg?bggbbM #+#.....## .+# #.####.......##+##..## #.##..............#.####.##....###..#..###.......#...< #..#.#... ####....#.#.#.........<.............##..bggibgg\j&7bggnbggpbggu M  #+#.....## .+# #.####.......##+##..## #.##..............####.##....###..#..###.....@.#...#####< #..#.#...####....#.#.........#...# #.#.....bgg! bgg# &8bgg( bgg>* bggM#.#  #+#.....## bggA .+# #.####.......##+##..## #.##..............#.####@##....###..#..##.......#...#####<#..#.#...............#..bgg0bgg&9bggQ#bggg%bggBM...#.#  #+#.....## .+# #.####.......##+##..## ..........#.####.##....###..#..###.......#...bgg~C######..#.#...........<.#bggJbggHK'30bgg9ObggNQbggGeM#.#.#...#.#  #+#.....## .+# #.####.......##+##..## bgg ..........####.##....###..#..###.......#..............##..#####.bgg<1bggbggbggg###........#.##'bgg}bgg&2bgg#bgg( _You open the door.bgg DM ## ##.#.##### ......#.#.....  ......  #+#...........# ##.......## . #.####.......##+##..##bgg  ..........#.####.##....###..#..###....bgg7 bgg &3bgg bggL Q _There is an open door here.bggbggbggbggbgg #. ###. ##.########bggU #...... #..#. #. #+#.... ##.......@## #..#######'# #.####....... #.##.....##+##..# #.##............. #.####.##....###..#..# #.......#..######..#.# #..#.#.. ####....#.#bgg bgg -4 _bgg8bgg3bgg # # ### ##.########## #..bgg#.# #..##.# ##. #+#' ###........## #..#######'# #.####...... #.##.....##+## bgg#.##............ #.####.##....###..# #.......#.######..#.# #..#.#.bggbgg&5bggYbggm _You hear the rusting of a very distant drain.bgg  # ## #########bgg - #.. #.# # #.# # #.# #+#.' ###........## #...#######'# #.####...## #.##.....##+##bgg  #.##......... #.####.##....###..# #.......#.######..#.#bggs bgg &6bgg bgg bgg2  # ## ######### # #.# # #.# # #.# #+#.' ###.#........## #....#######'# #.####...###. #.##.....##+### #.##......... #.####.##....###..# #.......#.bgg bgg &7bgg! bgg # bgg= c####.##########..#.......# #.#.# #.#.# #+#...'.####...#.#.#......#######'# #.####.###. #.##.....##+## # #.##........... #.####.##....###..##.......#...........######..#.#8bggm bgg*#######.##########..#.......# #..##.# #.#.# #+#...'.####...#.#.#......#######'# #.####.###. #.##.....##+## # #.##........... #.####.##....###..##.......#...........######..#.# #..#.#.9bgg U#.###.##.#.##########....#.......# #..##.# #....#.# #+#...'.###...#.#.#......#######'# #.####.###. #.##.....##+##..# # #.##........... #.####.##....###..#..##.......#...........######..#.# #..#.#.####....#.#40bggs###.###.#.###########....#.......# #..#.##.......# #....#.# #+#...'.###......##.#.#......#######@# #.####.####. #.##.....##+##..## # #.##.............. #.####.##....###..#..###.......#..............######..#.#< #..#.#.####....#.##.........<....1 _There is an open door here.bgg9AQbggQbgg]%QbggQbggQbggQbggQbggg|  ##.#########............#.#............#+..'.......####......##.#........##......#######'# #.#######. #@##.....##+##..# # ......... #.######..#..###....#########...###.#..#### 2 _bggO  #########............#.#........#+..'.......####......#bgg-P _#.#..##......#######'# #.#######. #.##.....##+##..# # bggPP \......... #.######..#..##bggqP ......#..............##..#bggP s####.#.#.###.#..#### bggP bggHW bggW &3bggz[ bgg] bgg} .......#.#...#+..'####......##.#.##......#######'# #.#######. #.##.....##+##..# # bgg~......... #.######..#..###.......#..............######..#.#<.##.#...#.#...... bgg&bgg{&4bggbggbgg_bggbgg(bggybggbggbgg,bggbgg-bggbggHbgg|bggbggbggObgg,bgg|bgg)bggbggbggPbgg)P  There is a stone staircase leading up here.bggbgg9 _bggbgg bgg,bgg6bgg2bgg,bggbggbggM,bggbggbggG,bggbgg: _Found 10 gold pieces.bgg`bgg~bgg bgg\ bgg bgg bggV bggX #..#.#............bggB ####....#.#.........#.# ..<.......... #########...###.#..####bgg v #.#.###.#..####.# bgg/#.#...#.. #.#...#.#.#####.bggT ###+####.#...#.#....$..@.#...#.#######..bggyA562.0).......##bgg# #....... #.##..## #.#bgg....... #.###..######.#....... #.# #....###..... #.###'##...##.#bgg#..... #.#.....>..##.#..... #.#........##.bggM #........##.#bggbggbggbggH8####....#.##..........<..... #########...###.#..#### #.#.###.#..####. #.#...#.#....... #.#...#.#.#########+####.#...#.#.......bgg8....$....#...#.########......@###.....# ##.# #.##..## ##.# #.###..######.#bgg8Q.# #.# #....#....###...... #.###'##...##. #...... #.#.....>..##.bggF9 #...... #.#........##. #....... #.##. #.##.bgg"@bggA17.0)bggDbggFbggg.........<... #########...###.#..#### #.#.###.#..#### #.#...#.#..... #.#...#.#.#########+####.#...#.#..... #....$....#...#.#######bgg3 #.......###.....# # #.# #.##..## # #.# #.###..###### #.# #.# #....#.. ###...... #.###'##...## #.......#.#.....>..##bgg_ #.......#.#........## #.......# #.## #.# #.##bgg;G #.##bggNbggbgg8bggIbggg bgg. #########...###.#..### #.#.###.#.. #.#...#.#..... #.#...#.#.########+####.#...#.#..... #....$....#...#.###### #.......###.....#  #.# #.##..## bgg/+ #.# #.###..#### #.# #.# #....#.. ###.......#.###'##...# #.......#.#.....>.. #bgg!1.#.#........ #.# #. #.# #. #.+ #. #.bggP?<9bggDbggR #.#.###.#.. #.#...#.#.... #.#...#.#.#######+####.#...#.#.... #....$....#...#.##### #.......###.....#  #.# #.##..## #.# #.###..#### #.# #.# #....#. ###.......#.###'##. #.#.#.....>.. #.#.#........ #.# #. #.# #. #.+ #.bgg #.# #. #.bggbggz'60bggRbggtbgg!- #.#...#.#... #.#...#.#.######+####.#...#.#... #....$....#...#.#### #.......###.....#  #.# #.##..## #.# #.###..### #.###.# #.... ###@......#.###'##. #.#.#.....> #.#.#..... #.# # #.# # #.+ # #.# # #.# # ########bgg(bggp)&1bgg-bgg'0bggǏbggEbgg#bgggbgg,. ######+####.#......$....####...###.....#  #.##..####..####.##.# #....###.......#.###'##.. .....>. #.......#bgg1bgg2&2bggJ7bggY9bgg<  ####+###......$....####.......###.....# # #.##..###.#..###.##.# #....##.......#.###'##.. .....>. #########bggD bggD &3bgg J bggK bgg? P ....$...####.......###.....# . #.##..##.#..#####.# #....##.......#.###'##.. .....>. +bggc bgg &4bgg bggh bgg\  ...###.....# . #.##..###..#####.# #....##.......#.###'##.. .....>. +#bggjc bgg,d &5bggh bggj bgg0   #.##..###..#####.# #....##.......#.###'##.. .....>. +#bgg bgg &6bgg} bgg bggE  #..#####.# #....##.......#.###'##.. .....>. +########bggJ bggpJ &7bgg:M bgg'O bgg& ##.# #....##.......#.###'##.. .....>. +################ bgg bgg &8bgg bgg bggF0/##.......#.###'##.. .....>. +################ bgg5bgg66&9bgg:bgg<bggbggbgg*bggbgg_(bgg(bgg,bgg.bggTbggUbggXbgg[bggޏ3bgg\bggCbggCbggnbggbggbgg,bggbgg)bggТ,bggȣbggǤbgg;,bggbggbgg Bbgg#.......# #.##..## #.###.......# #.###..######.##.......###.# #....#....####.......#.###'##...##.##.......#.#.....>..##.##.......#.#........##.###.......# #........##.# #.......# #........##.# #......@+ #........##.# 75.0 (6#.......# #........##.##.......# #........##.......# ###################bggbggbgg՚#.#'.###bgg#bgg+6.0 (1bggbggɨ( _You open the door.bgga#.# #.##..## #.##.# #.###..######.#.#.###.# #....#....#.###.#.###'##...##.#.#.#.#.....>..##.#.#.#.#.##.#bgga#.#.#.##.# #.#.#.##.# #.......@.#.##.# bggbg#.......###.##.# bggGb#.......# #.# #.......##bggib#bggibgg"j&7bgg'nbgghqQ _There is an open door here.bggk#.# #.##..## #.##.......# #.###..######.#.#.......###.# #....#....#.###.......#.###'##...##.#.#.......#.#.....>..##.#.#.......#.#.##.##.......#.#.##.# ##.bgg#.#.##.# ##.'@#.##.# ##.###.bgg##.# ##.......# #.# #bgg#.......# # ##########bgg|bgg-8 _bggsbggo!bgg8bggvbgg|bggbggbgg,bggbgg(bgggbggbggbgg,bggbggLbggTbggbggbgg}bgg/,bggbggMbggGbggbggbggRbggbggbgg!bggbggVbggbggbggF _You hear the rusting of a very distant drain.bggmbggbgg?bggbggbgg,bgg"bggGbgg,bggibgg bgg8 ,bggG bggbgg ,bggbggbgg bgg9bggbgg~bgg",bggbggtbggE ,bggv!bgg#bgg&,bgg}'bgg)bgg,,bggh-bgg0bgg1bgg2bgg 3bggU5bgg7bggF7bgg18bgg|:bgg<,bgg=bggB@bggB,bgg$EbggGbggHbggIbggzJbggMbgg WbggfWbgg..##.#.........#.#.# ........##.####.@....#.#.# 718.0 (40.0) ........##.# #......#.#.# ........##.# #......#.#.##### ........##.# #......#+#...... .....bgg&...##.# #..........# ........# #..........# ######### ##.........########...............################.#bgg bgg\ bgg= bggs bgg bgg bggi ,bgg bgg bggd bgg bgg7 bgg bgg bgg bgg  bgg. bgg bgg bgg bgg bgg bggE bgg! bgg?" bgg|# bgg$ bgg& bggC& bgg& bgg( bggk) bgg) bgg* bgg+ bgg. ,bgg/ bggR4 <...### .# ..#.# #..# .#.#.######..##### .....##.##...#... .####.........# ##.####......#..#### ......)).##..#...... ##.####..##..#...# bgg4 ........@# 27.0 (9.0) ##..########.....#  #..# #.....#  #.#########.....# ##.#......##..)..##......##.....#.#.........#'#.# ##.#.........#.#.# ##.####......#.#.#bgg5 bgg"9 bgg: bggEtIbggzbgga},bgg,bggbgg/bgg bggbgg,bggobggXbgg܊bggbgg-bgg͍bgg#### ..... ######## # bggѓ{..... .# ..<...### #..# ....#.# #..# ..#.#.######..######..# bgg......##.##...#......# ###.####bgg31.0 (4#.####......#..####### bgg@.......)).##..#......... ###.####..##..#...###### bggdY............# ###..########bgg̔V.....#  #..# #.....#  #.#########.....##.#......##..)..#bgghbggbggbgg 4bggV# bgg1% bgg6PM.### ####### ........ ######### ........ <...### ..#.# #..# ..#.#.######..######..# ......##.##...#.@....#...##### ###.####......#..####### .......)).##..#.........#..#...#..#.....#bgg|<bgg=+2.0 (1bggAbggCbgghbgghbggnbggqbgg' ### #  # #  .# <...### #..# ##.# #..# bgg~ 6...#.#.######..######..# ##.##...#..@...# .####.##### bgg }.####......#..####### bgg )).##..#....####..##..#...bgg A....#..#bgg' .....#  #..# #.....# bggІ bggj &3bgg~ bgg bgg ###    #  .# <...### #..# ###.#.# #..# .... #.#.######..######..# ##.##...#...@..# .####.##### .####......#..# )).##..#...####..##..#.....#..#.....# #..# #.....# bgg bggQ &4bggǕ bgg bgg   ... ... # ..# .# ..# ...### #..# ..###.##.# #..# ..... bgg.#.######..######..# ##.##...#....@.# .####.##### .####......#..# )).##..# bggH# bgg bggObgg&5bggsbggbggV  # bggą.< #### #...  bgg.... ....  ###### # #..#  bgg.A... .# #..#  ..### #..# #..###.##bgg #.# #..# #.....w.. #.######..###### ..##.##...#...... ####...##### bggφ ####......#..#######  .bgg$..)).##..#.........  ####..##..#...######  w   dart slug (asleep)............# bgg .########.....#   #.....#  bggCk  A dart slug comes into view.bgg%<w.wbgg&6bggbggɞ9 _Found a stone staircase leading up.bggx N   .#.##   .<... ### ##...  ... ....  ##### # #..#  bggy P... .# #..#  .### #..# #..###.### .# #..# #.@..w.... .######..######..###.### .##.##...#...... .........#####  ###......#..####### bggy  ..)).##..#.........  ###..##..#...###### .............# bggy f ########.....#  bgg bggx bgg 7bgg bgg r _You hear the brisk rusting of a drain very nearby.bgg8 (( You shoot a sling bullet. The sling bullet hits the dart slug.bgg  The dart slug is moderately wounded.You shoot a sling bullet. The sling bullet hits the dart slug.bggEbgg H.w.bgg c===8.1 (1.1Rev bggzbggd _The dart slug is moderately wounded.bgg> (You shoot a sling bullet.  The sling bullet hits the dart slug but does no damage.bggr  The dart slug is moderately wounded.You shoot a sling bullet. The sling bullet hits the dart slug.bggy .  The dart slug is heavily wounded.bgga `The dart slug launches a dart at you.bggۏ&.bggU^49---9.3 (1.2bgg7Rev+ bgg]bggbgg/  --more--bgg. _The slug dart hits you.bggI( You shoot a sling bullet. The sling bullet hits the dart slug.bgg8 The dart slug is severely wounded.You shoot a sling bullet. The sling bullet hits the dart slug.bggTbggZ9w.bggcZ)40.5bgg]bgg`U _The dart slug is almost dead.bgg[You shoot a sling bullet. The sling bullet hits the dart slug.bggg†bgg (((((((You kill the dart slug!bgg@†......bggo50=--11.6 (1.1Rev* bggbgg0/ _You shoot a sling bullet.bggM##+##+####.o.#~~#.## .<... ##### bggXR... .... ##### ....  #####.### #..# #..†......####..######..###.### .##.##...#......## ###.........#####bggy o   orc (asleep)bgg0bggbggR6---20bggbggst _An orc comes into view. It is wielding a +0 war axe.bgg% M.......##+##+### ###.#~SB#.#.o.#~~~##.#.#### .<.... ######.... ... ..... ##### ....  #####.### #..# #..†......bgg& ####..######..###.### .##.##...#......## S   adder (asleep)B   giant cockroach (asleep)bgg- bgg. bgg/ bgg0 bgg11 bgg9 SBSSSSS 3 adders (2 wandering)Bwandering)bgg: c---3Rev+ bgg: bggC bggE G _The adder hisses angrily. You hear an angry hiss.bgg X.##.......# #.#~∩B#.###+##+### ###.#SBS#.#o.#S~~#.#bgg #.#.##### .<..... .# ########....#..## ... #.........)..# ##### .... bgg) C #####.###bggX  #..# #..†......####..######..###.### .##.##...#......##bgg ...##### ###......#..#######B 2 giant cockroaches (wandering) bgg C..))......bgg bgg$ bgg* bgg bggo bgg SB~~~~SSbgg |1   giant cockroachbgg ?1=bgg 4bgg bggr > _Found a hand axe. Found a glowing drain.bgg<  You shoot a sling bullet.  The adder hisses angrily.  The sling bullet hits the orc!bgg*)((((SB   giant cockroachbgg& bggΊ](You kill the orc!bggZbgg|bggK~∩SB)....bgg;~2===5.8 (1.2Rev* bgg(bgg+/ _You shoot a sling bullet.bgg4bggbgg*R _No reachable target in view!bggÃbggbggbggٓR _No reachable target in view!bggbggmbggbggR _No reachable target in view!bggM.. .#~B.......# #.#~∩~##+##+### ###.#SB).#SS~#.#bggmN##.#.##### ..<.......# #######....#..# ... #.....@...)..# ##### ######..#.#.###....  .. bggN #####.### #..# #..†......bggNQ####..######..###.### .##.##...#......##B 2 giant cockroaches (1 wandering)...##### ###......#..#######bggNbggRbggTbgg#_x~B~Bbgg`t---60Rev+ _bggjbggnbggV##.. .#~~.......# #.#B∩~##+##+### ###.#S~~bggsVS #.).#SSB#####.#.#####.# ......<....... ########.@..#..## ... #.........).. ##### ######..#.#.###.... ..... ##bggV###.### #..# #..†......####..######..###.### .##.##...#......##.bggW bggYbgg/dF~Bbggdh2=---7bggPmbggBqbgg~.. ###+#.. .#~~.......# #.#~∩~##+##+### ###.#SB~ #.).#SSB#####.#.##### ......<@......[40m# #########....#..# ... #.........)..# ##### ######..#.#.### ..... ..... #####.### #..# #..†......####..######..###.### .##.##...#......##bgg{bggJ&8bgg>bggGbgg,M######..## ....... ###+#.. .#~~.......# #.#~∩~bggN##+##+### ###.#SB~ #.).#SSB#####.#@##### ......<....... #########....#..## ... #.........)..# ##### ######..#.#.###.... ..... #####.###bgg]N #..# #..†......####..######..###.###bggTbggX]bgggsBB~BbggMh&9bggrbggDwo _The giant cockroach waves its antennae.bgg5 x........# ######..### .. ....... ###+#.. .#~~.......# #.#B∩~##+##+### ###.#SB #.)@#SS~#####.#.#####bggy r ......<....... #########....#..# ... #.........).. ##### ######..#.#.###.... ..... #####.### #..# #..†......bgg bgg3 V50Rev bggv bgg bgg, ####### ........# ##### ######..### .. ....... ###+#.. .#~~.......# #.#B∩~##+##+### ###@#SB #.).#SS~#####.#.##### ......<....... bgg >#########....#..# ... #.........).. ##### ######..#.#.###.... ..... #####.###bgg bgg ^3=1bggbggbggR.......> ####### ### ........# #####... ######..### ......... ....... ###+#.. .#~~.......# #@#B∩~##+##+### ###.#SB #.).#SS~#####.#.##### ......<....... #########....#..# bggb... #.........).. ##### ######..#.#.###.... ..... bggbggdbggRbggXBS~bgg.&2bggbggbggE######## .......> ####### #### ........# #####.. ######..### ......... ....... ###+#..~ .#~.......# #.#B∩~bgg##+##+### ###.#SS #.).#S~~#####.#.##### ......<....... #########....#..# ... #.........)..# ##### ######..#.#.###bggnbggAS~bggo&3bgg'bgg?bggV ######## .......> bgg{J####### #### ........# #####... ######..### .. ........ ###+#..~ .#~.......# #.#BS~##+##+### ### #.).#S~~#####.#.##### ......<....... #########....#..## bggr... #.........)..bggbggޱbgg~,bgg'bggnbggjbggrBSS~~bgg\4=4bggbgg%o _The giant cockroach waves its antennae.bgg O ######## .......> ####### #### ........# ###### ######..### .bgg .. ....... ###+##.# ...S .#B~.......# #.#SS~##+##+### ###.#~ #.).#~~~#####.#.##### bgg {......<....... #########....#..#bgg bgg" CS∩bgg &5bgg bgg: bgg4bggfbggbbgg ######## .......> #######bgg' #### ........# ####### ######..### #... ........# ###+#... .#BS.......# #.#S∩~##+##+### ###.#~ #.).#~~~#####.#.##### ......<.......bggbgg&6bggbgg2bgg4     >#  .# ## bgg# #. ..### #. # #.#  #.# #.##+##.#  # #.#BS~#.# bggP ##.# #.#BS~#.#  bgg#.# #.#S∩~#.#  bgg##+##+### ###.#~~~#.#  bgg#.).#~~~#.#  bgg)#####.#.#####.#  bgg_>......<.# bgg( bggbgg bggTS~bgg=&7bggbggbgg}X     >#  .# ## # #. bggW..### #. # #.#  .# #.##+##.#  # #.#BSS#.#  #.# #.#BS~#.#  #.# #.#~∩~#.#  ##+##+### ###.#~~~#.#   2#.).#~~~#.#  #####.#.#####.#  bgglf......<.#  bggX=8bggbggbgg<      >#  .# # # #. ..### #. # #.# bgg<  # #.##+##.#  # #.#BSS#.#  .# #.#BS~#.#  .# #.#~∩~#.#  #bgg = :+##+### ###.#~~~#.#     adderbgg8= #.).#~~~#.#  #####.#.#####.# bgg= x ......<.#  bggW <9bgg3[ bgg^ bgg'SS~SS 3 adders~#bggbggbggՠbggbggbgg]SS~~Bbgg['60bggWbgg _No reachable target in view! _The giant cockroach waves its antennae.You open the door.bgga (You shoot a sling bullet.  bggtThe sling bullet completely misses the adder.The sling bullet hits the adder.bgg  The adder is heavily wounded.You shoot a sling bullet. The sling bullet hits the adder.bgg1o  The adder is moderately wounded.bgg=eSB~bggV>c===2.0 (1.2Rev bggKbggQbggZ/  --more--bgg y _The adder bites you but does no damage. The adder closely misses you.bggs    ####### .....># #####.# ####### ......# #######bggxt%. ####..### #....@........ .# ###....S..#.# .# #.##S##.# .# #.#BSB#.# #.# #.#~~~#.# bggt.......# #.#~∩~#.# bgg'u##+##+### ###.#~~~#.#  #.).#~~~#.#  #####.#.#####.# bgg|bgg|bggU~bggbggSS..~Bbgg5--30bggbggC _The adder misses you.bggB    # .># #.# ####### .# #. #..### #...@.S. .# ###..S....#.# #.# #.##S##.# .# #.#~BB#.# #.# #.#~~~#.#  #.# #.#~∩~#.#  ##+##+### ###.#~~~#.#  #.).#~~~#bgg.#  #####.#.#####.# bggbgghbggbggd)S.S.SB~bgg*A--4bgg2bggw6J _The adder barely misses you.bggB bgg  bgg  bggR  bgg  bgg #bgg  bggx B.>#bgg  bgg #.#bggl \ ####### bgg +.# bgg6 #bggu +. bgg #..### #..@.Sbgg 5. bggT .# ###.S.S...#.# bgg #bgg .# #.##B##.#bgg  bgg .# #.#~B~#.#bgg  .##.# #.#~~~#.#  bgg  #.# #.#~∩~#.#  ##+##+### ###.#~~~#.#  #.).#~~~#.#bgg q  #####.#.#####.# bgg# bggh bgg" bgg# bgg- bggk. Sbgg. Bbgg. 'bgg2/ B~bggj/ bgg0 bgg(1 5bgg\1 bgg7 bgg;  bggT< /_The adder closely misses you.bgg< bgg     # .># #.# ####### .# #. #..### #.@.SS. .# ###.S.B...#.# #.# #.##'##.# #.# #.#B~~#.# #.##.# #.#~~~#.# # #.# #.#~∩~#.# bgg# f# ##+##+### ###.#~~~#.# # #.).#~~~#.# # #####.#.#####.# bgg bgg bggM VThe adder attacks as it pursues you! The adder bites you.bgg bgg bgg SS.S.B.B~bggV U1--6bgg; bgg  p _The adder attacks as it pursues you! The adder closely misses you.bgg # .># #.# # .# #. #..### #@.SS. .# ###S.B....#.# bgg>.###.# #.##B##.# .#.# #.#~~~#.# .#.##.# #.#~~~#.# .# #.# #.#~∩~#.# .# ##+##+### ###.#~~~#.# .# #.).#~~~#.# .# #####.#.#####.#bggbggbggbgg(bggbggaSS.B.B'bgg&7bgg`%bgg)S _The adder closely misses you.bgg\'>  You shoot a sling bullet.bgg  The sling bullet hits the adder but does no damage.  You shoot a sling bullet. The sling bullet hits the adder.bgg0]bgg^bggda bggaf The adder is heavily wounded.bggkAB.bggDlb==8.2 (1.2Rev bggubggxR _The adder barely misses you.bgg((  The adder is heavily wounded. _The adder barely misses you.bgg9You shoot a sling bullet.  bgg=The sling bullet barely misses the adder.  The sling bullet closely misses the adder.  The sling bullet hits the giant cockroach.bgg~Pk  The giant cockroach is moderately wounded.bgg9QPYou shoot a sling bullet. The sling bullet hits the adder.bggV2=-bggN/  --more--bgg j  The adder is heavily wounded.bgg SS.   giant cockroachbgg _9.4Rev+ bgg bggj r _The adder barely misses you. The adder bites you but does no damage.bgg2(((((((You shoot a sling bullet.  The sling bullet closely misses the adder.The sling bullet misses the adder.bggeQ  The sling bullet closely misses the giant cockroach.You shoot a sling bullet. The sling bullet hits the adder.bgg&bggm  The adder is severely wounded.bgglRSSB....bggW1-70.6bggbggbgg/  --more--bgg+ _The adder bites you.bgg.[WYou shoot a sling bullet. The sling bullet hits the adder.bggnThe adder is almost dead.You shoot a sling bullet. The sling bullet hits the adder.bggG. 2bggpbggqbgg:rbgg}SBB 2 giant cockroachesYou kill the adder!bgg~2=41.7 (1.1Rev* _The adder barely misses you.bggYbgg͏o _Your Ranged Weapons skill increases to level 6!bggU4bgg]bggF _Unknown command.bgg_  You shoot a sling bullet. The sling bullet hits the adder.bggր-The adder is severely wounded.  You shoot a sling bullet.  The sling bullet barely misses the adder.  The sling bullet hits the adder but does no damage.  Lightning courses through the adder!bggf(.   adderbggV bgg bgg/  --more--bgg  You kill the adder!  The adder bites you.  You are poisoned.bggB#NSB.bgg'49==--62.9 (1.2Pois Rev* bgg1/bggv2$ _The adder poisons you!bgg(((((((You shoot a sling bullet. The sling bullet misses the adder.bgg(  The sling bullet barely misses the giant cockroach.You shoot a sling bullet. The sling bullet hits the adder.bggL SB.....  The adder is almost dead.bggζ g6---4.0 (1.1bggL bgg v _You feel sick. The adder barely misses you. The adder bites you.bgg N-bgg \ _Unknown command.bggj@ { _You feel sick. The adder barely misses you. The adder bites you. _Unknown command.  The sling bullet barely misses the adder.  The sling bullet hits the giant cockroach.  Lightning courses through the giant cockroach!bggF (.   giant cockroachbgg ((((((You kill the giant cockroach!You shoot a sling bullet.bggO bggU /  --more--bgg*Y  You feel sick. The adder bites you.  You are more poisoned.bgg#^ [SB......bgga 3===-75.1bggh bggj $ _The adder poisons you!bgg You shoot a sling bullet. The sling bullet misses the adder.The sling bullet hits the giant cockroach!bgg6 `(.bggm ((((((You kill the giant cockroach!You shoot a sling bullet.bgg 38=====----The sling bullet closely misses the adder.You feel sick. The adder barely misses you. The adder bites you.bgg/  --more--bgg S......  You are more poisoned.bgg( I---6.3 (1.2bgg%bggu$ _The adder poisons you!bggji\(((((((You shoot a sling bullet.bggXThe sling bullet barely misses the adder.bgg{S......  You shoot a sling bullet. The sling bullet misses the adder.You feel very sick.bgg(|^4-7.5bggtbgg= _The adder bites you but does no damage.bggbggT8-bggbggӓF _Unknown command.bgg (((((((You shoot a sling bullet.bgg0 bgg  bgg;The sling bullet closely misses the adder.bggŠ/You shoot a sling bullet.bgg1 bgg~2 bgg28S......  bgg33The sling bullet barely misses the adder.bgg3bgg6bgg73bgg7-bgg7&8.6 (1.1bgg?bggC bgg)DbggyDW_You feel sick. The adder closely misses you. x2bggcN-bggRgbggjF _Unknown command.bgg bgg~y(((((((You shoot a sling bullet.bggK bgg^L bggL4The sling bullet closely misses the adder.bggMbgg S......  You shoot a sling bullet. The sling bullet misses the adder. You feel sick.bgg^1-9.7bgg#bggR _The adder barely misses you.bggbgg8-bggbggF _Unknown command.bggz _  You shoot a sling bullet. The sling bullet hits the adder!bgg C.bgg) (((((((You kill the adder!bggN >.......bgg R0980.9 (1.2bgg^ bggW > _You shoot a sling bullet. You feel sick.bggj 4bggR bgg F _Unknown command.bgg"( bgg( bggy- bgg/ H _No target in view!bgg bggǭ bgg; bgg۶  bgg 8_Unknown command.bggj      >#  .# #  # #.  ..### #.@.  bggF# ###.#.#  ###.# #.##'##.#  #.# #.#~~~#.#  #.##.bgg&# #.#~~~#.#  bggo# #.# #.#~∩~#.#    # ##+##+### ###.#~~~#.#    # bgg #.).#~~~#.#    bgg# #####.#.#####.#   bggJbgg>m29----10bggbgg$ _You feel sick.bgg      >#  .# #######  # #.  ..### #..  # ###.#.#  .# #.##'##.#  .# #.#~~~#.#  .##.# #.#~~~#.#   #.# #.#~∩~#.#   ##+##+### ###.#~~~#.#   #.).#~~~#bgg.#   #####.#.#####.#  bggbgg+----bgg2bggTbgg$ _You feel sick.bggD       >#  .# bgg5E }#######  # #.  ..### #...  # ###.#.#  #.# #.##'##.#  # #.#~~~#.#  bgg~E ##.# #.#~~~#.# bggE  #.# #.#~∩~#.# bggE  ##+##+### ###.#~~~#.# bggE  bgg F #.).#~~~#.#  #####.#.#####.# bgg#F ( bggcM bggM B83bggQ bggT $ _You feel sick.bgg z       >#  .# #######  # #.  ..### #...  # ###.#.#  .# #.##'##.#  # #.#~~~#.#  #.# #.#~~~#.#  #.# #.#~∩~#.#  ##+##+### ###.#~~~#.#  #.).#~~~#.#  #####.#.#####.#ggr{ 00m  bgg bggՁ B74bgg 7Rev+ bgg bgg $ _You feel sick.bggO^   ###### ....>#  ####.# #######  .....# #######.......  ###..### #.......bgg^  .......# ###.#.#  # #.##'##.#  # #.#~~~#.#  # #.#~~~#.#  .# #.#~∩~#.#  #+##+### ###.#~~~#.# bggQ_  #.).#~~~#.#  #####.#.#####.#  ......<.......#  bggg3  You feel sick.bgg(h|=5Rev+ bgg>mbggo[ _You are no longer poisoned.bggPbggbgg^bggbggDbgg bggbggjJ 6 _You start resting.bggbgg<Z7.9 (2Rev bgglbgg3f _You hear the brisk rusting of a drain.bgg^ ###### ....> ####.####### ....#######....... ###..### #...... .......# ####.#  #.##@##.# ~~~~∩..<.......#######....#..##  bgg-ebggeG88.9 (1bggjbggmQ _There is an open door here.bgg  ###### ....> ####.####### bggY ....#######....... ###..### #............. .......# ####.#  #.##'##.# ~@~~∩Rev . #.bggp ###....#..###.........)..# bgg D bgg A  You enter the shallow water.bgg  9Water Rev  _Moving in this stuff is going to be slow.bggMM  ###### ....> ####.####### ....#######....... ###..### #............. .......# ####.#  #.##'##.# ~~~~∩ #+##+### ###.#~~~Water Rev .#......).. ## ######..#.#.###  bggU bggaV .91.5 (1.6bgg5\ bggB^ bggߟ \ ....> ####.####### ....#######....... ###..### #............ .......# ####.#  #.##'##.# bgg* ~~~~ #+##+### ###.#~~~ #.).#~#####.#.####.bggB A #bggW ##..#.#.### .. .# #..#..... bgg D bgg٩ bgg L93.1bggr bgg] T _There is a glowing drain here.bgg{s Ibggu bggv bggy bgggz bggz bgg9| bgg bgg $30bgg 0=bgg߁ bgg bgg" bggo bgg bgg؈ bgg7 bgg bggŌ bggQ bggё bgg K1=bgg bggU bggx bgg& bgg bgg? bgg bgg bgg =2=bgg; bgg bggˤ bgg bggѦ bgg bgg bgg bgg bgg߮ bgg/ bgg/ bggr K3=bgg_ bggu ,bgg> bgg bgg bgg' bgg bgg4 #4bggK 0=bgg۾ bgg~ ,bggc bgg9 ,bgg= bgg bgg K5=bgg bgg ,bgg} bgg] bgg bgg bgg bgg bgg bgg bgg= =6=bgg_ bgg bgg- ,bgg bgg bggO bgg bgg` bgg 57=bgg bgg$ bgg bgg bgg+ bggE ,bgg bgg bgg* bgg bgg O8bgg bgg ,bgg bgg ,bggN bggR N39=bgg bgg bgg bgg8 bgg bgg Bbgg bgg bgg bgg5 bggg B40=bgg bggJ bgg bgg  bgg bgg\ ,bgg; bggf bgg K1=bgg bgg! bgg! bgg" bgg% bggX% bgg& bggt) bgg) bgg?+ bggC3 bgg%9 k 837.1 (44.0) _You start resting.bgg9 #2bgg#: A=8.1 (45bggx? bggIB f _You hear the brisk rusting of a drain.bgg9g4bggmbggqbggvG9.1 (1.0)bggybggF  #####  a Sewer #@..#   #....#  ∩.....#bgg  #......# ##.....# #....## ##..## bggp..#  The world spins around you as you enter the gateway.bggbgg3bgg2+9 (1.8bgg5bggd8 _You enter a sewer!  Found a gate leading back out of this place. _There is an empty arch of ancient stone here.bgglAbggBbggBbggEbgg3J3= _bggKbggKbggLbgg@NbgggNbggNbggPbggP#4bggQ2=bggQbggpUBbggUbggUbggVbgg XbggtXK5=bggYbggrZ,bggZbggl\bgg\bggZ]bgg:_,bgg_bgg/abggiaU6=bggbbggcbggcbggdbggebggfbggfbgg$hbggh%7bggibggjbgg6kbggkbggqmbggmbggKnbggobggHp58=bgglpbggpbggrbggrbggsbgg ubggpubggubggwbggwbggsxbggmzbggz#9bggz2=bgg{bggI},bgg}bgg~bgg4bggbggbggD$50bggt(=bggԁbgg@bggebggbggʄbggbggXbggbgg'bggsbggbgg8?1=bgg`bggbgg6bggXbggbggMbggnbggbgg>bgga#2bgg(=bggbggSbggbgg,bggYbggzbggbggRbggtbggbggObggzU3=bggŽbgga,bggbggO,bggbgg bggXbggD4=bggԒbggM1 _HP restored.bggNbggubggbgg@bgg######∩..####....##bgg[#∩@....##......###h   jackal (asleep)...h~##bgg$079.9 (40.0)bggt-80.9 (41bggѤbgguY _A jackal comes into view.bgg7 + (((((h  (You shoot a sling bullet. The sling bullet hits the jackal.bgg  The jackal is moderately wounded.You shoot a sling bullet.  The sling bullet hits the jackal but does no damage.bgg bgg bgg ,..bgg& D..h..bggb g===2.1 (1.2)Rev bggZ bgg.# a _The jackal is moderately wounded.bgg¸ (((((((You shoot a sling bullet.bgg>  The sling bullet closely misses the jackal.You shoot a sling bullet.  The sling bullet hits the jackal but does no damage.bggbggb...h. .~bgg=3.2 (1.1Rev+ bggbgga _The jackal is moderately wounded.bgg: (((((((You shoot a sling bullet.bgg-  The sling bullet barely misses the jackal.You shoot a sling bullet.bggc?bggU@bggF_.h...bggF:.~bggG(4.3bggLbggwOJ _The sling bullet hits the jackal but does no damage.bgg$ ( You shoot a sling bullet. The sling bullet hits the jackal.bgg  The jackal is moderately wounded.You shoot a sling bullet.  The sling bullet hits the jackal but does no damage.bgg{/h.5.5 (1.2Rev* bgg0bgg4a _The jackal is moderately wounded.bgg`  You shoot a sling bullet. The sling bullet hits the jackal.bggF†bgg (((You kill the jackal!bggI†..bgg-6.6 (1.1bggbggM/ _You shoot a sling bullet.bgg bgg bgg bgg9 H _No target in view!bgg bgg bgg bgg' H _No target in view!bgg\ bgg 4bgg bggq bgg _bgg bgg bgg bggd bgg\ bgg PRev+ bgg bgg bggo bgg bggbggqbggbggbggbggbggbggbgg@bgg bgg" bgg*#∩.....#  #.†....# ##.....#bgg#....####..##bgg .....# ~## bgg".@~# ---~~~# bggB~~.# ~~~~~ ≈≈≈≈≈≈≈~~~~~~~~~bggXw   ribbon worm (asleep)##########wbggmb ~≈bgg(93.6 (7.0---4.6 (8Rev  _A ribbon worm comes into view.bgg\ ((((bgg(wYou shoot a sling bullet. The sling bullet hits the ribbon worm.bgg5 ((The ribbon worm is lightly wounded.  You shoot a sling bullet.bggXbgg%  bggOThe sling bullet barely misses the ribbon worm.bggZbggk~.~≈~bggb   bat (wandering)b~bggpn===5.7 (1.1Rev+ bggbggLV _A bat comes into view.bgg (((((b  You shoot a sling bullet. The sling bullet hits the bat.bgg[2( bgg2((The bat is moderately wounded.You shoot a sling bullet.bgg,bggw~.~≈~~~bgg0(6.8bgg7bgga _The sling bullet completely misses the bat.bggtbggtbggxbgg{H _No target in view!bggL Jbgg O H _No target in view!bgg bgg bggj bgg) bgg A  You enter the shallow water.bgg bgg N  Moving in this stuff is going to be slow.bgg9 bgg [Water Rev+ bgg& B _The bat misses you.bggE bgg@^bgggP#.†....# ##.....# ....## ##..## ..## #...# ##.~## #..~# #~~@# --70#~~b# bgg>h..~~~~~ ≈≈≈≈≈≈≈≈≈≈~~~~~~~~~~~###########ww   ribbon worm ~≈b   bat≈~bggh9--bgg$pbggsN _There are monsters nearby!bgg*sbggN ((((You shoot a sling bullet.bgg  The sling bullet closely misses the bat.You shoot a sling bullet. The sling bullet hits the bat.bgg\k  The bat is severely wounded.bgg]bggfr.b≈~bggg#3bggg-==8.9 (1.1Rev* bgg/obggrL _The bat hits you. The bat hits you but does no damage.bgg'R((((bgg|  You shoot a sling bullet. The sling bullet misses the bat.You shoot a sling bullet.  The sling bullet hits the bat but does no damage.bggOCP  The bat is severely wounded.b.~≈~~b   bat4=900.1 (1.2 _The bat closely misses you.bgg ]  You shoot a sling bullet. The sling bullet hits the bat!bgg, D~bgg c ((((bgg, 9You kill the bat!bgg bgg $~bgg  ~≈~ww   ribbon wormbgg" R=201.2 (1.1bgg( bgg - / _You shoot a sling bullet.bgg ((( You shoot a sling bullet. The sling bullet hits the ribbon worm!bgg  The ribbon worm is heavily wounded.You shoot a sling bullet. The sling bullet hits the ribbon worm.bgg q.~≈bgg@ (2.3bgg bggZ d _The ribbon worm is severely wounded.bgg]  You shoot a sling bullet.  The sling bullet hits the ribbon worm but does no damage.  Lightning courses through the ribbon worm!bggr(((~bgg  (You kill the ribbon worm!bggȕ.~≈~bgg(3.4bggbgg/ _You shoot a sling bullet.bggUbggVbggZbgg]H _No target in view!bggO 4bggz%bgg'H _No target in view!bgg}bggbgg%bggbggZ#. #....##..##  .##.~#..~# ~~~~~..~~~~~~~~~~#≈≈≈≈≈≈≈≈≈≈≈≈≈B#bgg%[~~~~~~~~~~~~≈~############~≈~# ~≈.#B   giant cockroach (asleep) ≈~# ~#bggM(0.0bggĪy---5.0 (1.6Rev* bggbgg6b _A giant cockroach comes into view.bgg~  You shoot a sling bullet.  The sling bullet hits the giant cockroach!(((((~bgg0 (You kill the giant cockroach!bgg bgg >  You shoot a sling bullet.bgg bgg ~~~b≈~b   bat (wandering)bgg ?1===6.1 (1.1bggp bgg~ V _A bat comes into view.bgg>U ((((((You shoot a sling bullet.bggN m  The sling bullet closely misses the bat.bggabggabggbbggj b~≈≈≈~bYou shoot a sling bullet. The sling bullet misses the bat.bggk-7.3 (1.2bggqbggatQ _The bat closely misses you.bgg2   You shoot a sling bullet. The sling bullet hits the bat.bgg  The bat is moderately wounded.You shoot a sling bullet. The sling bullet hits the bat.bgg7D~bgg"c~8.5bgg#bggQ&G _You kill the bat!bggbgg~bggbgg H _No target in view!bggbgg&bggbgg!H _No target in view!bgg hbgghbgg#ibggkbggoA  You enter the shallow water.bggtWater Rev*  _Moving in this stuff is going to be slow.bgguubggubggvbggxbggBzbggz=Rev+ bggI{bgg}bggyA  You enter the shallow water.bggEWater Rev+ bggbgg _No target in view!  You enter the shallow water. _Moving in this stuff is going to be slow. bggZP You enter the shallow water. _Moving in this stuff is going to be slow.bggu4bggbgg=Rev   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bgg  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is goibgg͝dng to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggbgg#bggĠbggbgg~bggbgggbggbggܨbggbggbggbgg*,bggbggҰbggAbggtbgg!bggȷXbgg˺bgg #∩..###....w# ##....###..~.. #∩.....#~~~.. #.†....##~~~. ##.....#~≈~# #....##~≈~# ##..##bgg≈~# #..##≈#...#--- #~≈~# ##.~## #~≈~# #..~#bggGR #~≈~# ###~~~# ≈#≈≈≈##~≈~###~#~~.###≈≈≈#≈≈≈~~~~~~~..~~~~~~~~~~# w   brain worm (asleep)bggq≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈~#≈≈~~~.~~~~~~~~bggN~~~~~~≈~#≈≈~################~≈~#bgg030.7 (22.2)bggbggt.wwbggJ---2.3 (23.8bgggbgge _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is goibggfng to be slow. _A brain worm comes into view.bgg (((( You shoot a sling bullet. The sling bullet hits the brain worm.bggX (((The brain worm is moderately wounded.You shoot a sling bullet.bgg...w~~~===3.4 (1.1)Rev  bgg^_The sling bullet barely misses the brain worm.bgg (((You shoot a sling bullet. The sling bullet hits the brain worm.bgg ((((The brain worm is moderately wounded.You shoot a sling bullet.bgg....w~~4.5bggbggN _The sling bullet barely misses the brain worm.bgg'bgg%p (((((((You shoot a sling bullet.bgg   The sling bullet barely misses the brain worm.  The sling bullet hits the brain worm but does no damage.  Lightning courses through the brain worm!bgg}bgg...~~w~bggȅd5.7 (1.2Rev+ bggRbgg^ _The brain worm is almost dead.bgg^e  You shoot a sling bullet. The sling bullet hits the brain worm.  Lightning courses through the brain worm!†(bggZ ((((((You kill the brain worm!bggu ...~~†~376.8 (1.1Rev* bggw / _You shoot a sling bullet.bgg 4bgg bgg H _No target in view!bggHJbggLbggT_78 M#### bggTT#..S## #∩..## ...# ##....##..~... #∩.~~~.. #.†~~. ##.....~# #....##bggT†# ## #...bggT~# ##.~##~# #.. bggUP#~≈~# ###~~~# ≈#~###~#~~.S   adder (asleep)bgg+U]~~~..~~~~~~~~.~~~bgg\(0.0bgg]7---8.4 (1.6bggbbggXdY _An adder comes into view.bgg} ((((((Sbggcs  You shoot a sling bullet.  The sling bullet hits the adder but does no damage.bgg'  The adder hisses angrily.  You shoot a sling bullet. The sling bullet hits the adder.bgg~bgg9.S..~~† ===9.5 (1.1bggbgg^ _The adder is severely wounded.bgg*%f ((((((bgg%7(You shoot a sling bullet.bgg®`The sling bullet hits the adder. _The adder is severely wounded.  You shoot a sling bullet  The sling bullet closely misses the adder.  You shoot a sling bullet.  The sling bullet hits the adder but does no damage.bgg<...S~~†40.7 (1.2bgg?bgg[C] _The adder is heavily wounded.bggu `(((((((bggt  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet.bgg\ ,bggr ....~S†1.8 (1.1bgg  bggv c _The sling bullet completely misses the adder.bgg  You shoot a sling bullet. The sling bullet hits the adder.  Lightning courses through the adder!!bgg e~(bgg ((((((You kill the adder!bggv....~~†bgg!593.0 (1.2bgg&bgg)/ _You shoot a sling bullet.bggʈbgg bgg%bggH _No target in view!bgg̬Jbggebgg; _bgg^bgg۵f  You see here a brain worm corpse.bggbgg_FRev+ _bggbggvbggr,bggֻbggbggcbggȾSRev+ bggbggbgg:Rev bgg,bgg`bggkA  You enter the shallow water.bggVWater Rev bggbggN _Moving in this stuff is going to be slow.bgg4bgg2bggf  You see here a brain worm corpse.bggbgg,0 _bggbggHbggbggHbggbgg9bggbggrbgg7bggbgg,bggbggbggbggFbggbggbgg,bggJbggfbgg,bggobggbggibggbggSbggObggbggN!bggSbggbggg0bgg%bggbggy  You enter the shallow water.Water bggDbgg!You see here a brain worm corpse.  You enter the shallow water. _Moving in this stuff is going to be slow. _You see here a brain worm corpse.  You enter the shallow waterbggz4. _Moving in this stuff is going to be slow.bgg4bggbggbggP,bgg0bggbgg Mbggg bgg 3  You enter the shallow water. _Moving in this stuff is going to be slow. _You see here a brain worm corpse.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bggX @Water bgg bggN _Moving in this stuff is going to be slow.bgg4bgg+bggbgg)bgg|bggbggKbgg!bggrbgg]bggbggfbggbggG bgg!bgg$,bgg$bgg&bgg(,bggO)bgg-bggi37~≈~# #...##≈≈≈# ~≈~# ##.~###≈≈≈# ~≈~# #..~# #≈≈≈# ~≈~# ###~~~# #≈≈≈# ~≈~###~#~~.###≈≈≈# bggF47~~~~~..~~~~~~~~~~# ≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈~# .~~~~~~~~~~~~~~≈~# ############# ---.#   .# ~~≈~#S   adder (asleep) ≈≈~≈# ~~~S≈~# bgg;{ 84.8 (41.8)  An adder comes into view.bgg<bgg=bgg(ESS~bggFJ---6.4 (43.4bggKbggcO/ _The adder hisses angrily.bgg. (((((((You shoot a sling bullet.bgg[  The sling bullet closely misses the adder.You shoot a sling bullet. The sling bullet hits the adder.bgg ! bgg" bgg" bgg~) OS~≈≈bgg[* D≈~~bgg* g===7.5 (1.1)Rev bgg0 bggT3 ` _The adder is moderately wounded.bgg (((((((You shoot a sling bullet.bggq  The sling bullet closely misses the adder.You shoot a sling bullet.bgg S~~.~~~The sling bullet closely misses the adder.bgg 2-8.7 (1.2Rev+ bggbgg* _The adder bites you.bgg+ (((((((You shoot a sling bullet.bgg  The sling bullet closely misses the adder.You shoot a sling bullet. The sling bullet hits the adder.bgg> S~~.~~~The adder is heavily wounded.bgg?3-9.8 (1.1Rev* bggpEbgg?Gz _The adder barely misses you. The adder bites you but does no damage.bgg٢  You shoot a sling bullet. The sling bullet hits the adder.bgg]* (((((((The adder is almost dead.bgg  S~~.~~~You shoot a sling bullet. The sling bullet misses the adder.bgg)90.9bggtbgg]R _The adder barely misses you.bggi(((((((bgg-  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet.bgg= S~~.~~~The sling bullet barely misses the adder.bgg(2.0bggbggjS _The adder closely misses you.bggH (((((((You shoot a sling bullet.bggFo  The sling bullet closely misses the adder.bgg\ LS~~.~~~ _The adder closely misses you.You shoot a sling bullet.  The sling bullet closely misses the adder.  You shoot a sling bullet. The sling bullet misses the adder.The adder bites you.  You are poisoned.bgg] 2==3.2 (1.2Pois Water Rev* bggc bggg T _The adder poisons you! The adder bites you but does no damage.bgg y  You shoot a sling bullet.  The sling bullet hits the adder but does no damage.bgg  The adder is almost dead.You shoot a sling bullet. The sling bullet hits the adder.bgg H†bgg*4 X  You kill the adder!bgg;8 _0-414.4bgg> bggXB $ _You feel sick.bgg^ N-bggd ^ _No target in view!bggbggkbggbggbgg#49=-bggK$3 _You feel sick.bgg$8-bggm%bgg)l _You feel sick.  You feel sick.8bgg@*<=bgg*bgg-j _You are no longer poisoned.bgg.?Rev+ bggp.bgg_0bgg0&9bgg1bgg3bgg4bgg4bgg6,bggS7bggK9bgg9?Rev bgg#:bgg;bgg<M50=bgg<bgg>,bggg?bgggAbggA)bggGBbggKDbggDV1=bgg:Ebgg`G,bggGbggI,bggJbgg)L,bggLbggNL2=bgg(ObggObggQ,bggRbggT,bggTbggKVbggVV3=bgg$WbggXbggXbggYbgg[bggT[bgg%\bgg]bgg]bgg^bgg`bgg`L4=bggcabggZcbggve7bggfbggib  You see here an adder corpse.bgg/m  You enter the shallow water.Water bggUnbggpN _Moving in this stuff is going to be slow.bgg`r4bggrbgg{tbggvbggjvB=bggwbggybgg(|A  You enter the shallow water.bgg|@Water bgg+}bggN _Moving in this stuff is going to be slow.bgg4bggbggbgg,bggabggKbgg,bggbggbgg",bggbggcbgg7bggbggGbggI  You enter the shallow water.bggח8Water bggcbgg̚enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggjbggbggPbggbggbggˠbggCbggbggBFbgg]bgg$ _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bggp@Water bggbggv  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggK #####~≈~ #~≈~ #~≈. #~≈~ #~≈~ #~≈. bgg'#~≈. #. ---~~#r   quokka (asleep) # #~≈rbgg23038.4 (44.0)bggK---40.0 (45.6bggbggQ0 _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _A quokka comes into view.bgg (((((r  (You shoot a sling bullet. The sling bullet hits the quokka.bgg&9 (The quokka is severely wounded.You shoot a sling bullet.bgg/ bgg ~~~~~r~===1.2 (1.2)Rev bggd bggW a _The sling bullet closely misses the quokka.bgg (((((((You shoot a sling bullet.bgg  The sling bullet closely misses the quokka.You shoot a sling bullet. The sling bullet hits the quokka.bggL# )bgg e~~~~~~~bgg g22.4Rev+ bgg֫ bgg J _You kill the quokka!bgglhbggnibggBmbggoH _No target in view!bggXbgg#bggbggO"bgg[$bgg)Rev  _bggi,Bbgg-bggM.)bgg.bgg0bggy2bgg2bgg33bgg4bgg 6bggg6bgg6bgg8bgg::bgg|:bgg;bgg+<bggdCbgg2DbggEbgg7GbggGbggHbgg6KbggSv ~~~~---.~r   quokka (asleep)≈≈≈~~~r~bggZ056.8 (14.4)bggi`r~rbggaJ---8.4 (16.0bggvo _A quokka comes into view.bggJ (bgg(((( (You shoot a sling bullet. The sling bullet hits the quokka.bgg^o (The quokka is heavily wounded.You shoot a sling bullet.bggbgg~~~≈≈≈r~bggg===9.5 (1.1)Rev bggibgg` _The sling bullet barely misses the quokka.bgg ((((( (You shoot a sling bullet. The sling bullet hits the quokka.bggO (The quokka is almost dead.You shoot a sling bullet.bgg ~~≈≈≈≈r~60.6bgg a _The sling bullet closely misses the quokka.bgg ((((((You shoot a sling bullet.  The sling bullet hits the quokka but does no damage.bgg8F   The quokka is almost dead.You shoot a sling bullet. The sling bullet hits the quokka.†bggp ~≈≈~~≈†bgg d1.8 (1.2Rev+ bgg bggJ  bggr <_You kill the quokka!bggCbggCbgggQ^ _No target in view!bggQYbggYbggZbgg#]bggb^bggc _Rev bgglebgg hbggqO~~~~~.---~S~~J≈≈≈≈≈~~~~†~~#####≈≈≈bggrwJ   endoplasm (asleep) #≈≈≈S   ball python (constriction, asleep) #≈≈≈bggy 5.0 (3  A ball python comes into view.bgg{,bgg+S~~S   ball python (constriction)---6.6 (4.8bggbgg^ _The endoplasm quivers.bgg* (((((((You shoot a sling bullet.bggN  The sling bullet barely misses the ball python.You shoot a sling bullet. The sling bullet hits the ball python.bggA )bgg:C bggM †≈J~~≈≈~J   endoplasmbggQ n===7.7 (1.1Rev+ bggY bgg] O _You kill the ball python!bgg~  You shoot a sling bullet. The sling bullet hits the endoplasm.  Lightning courses through the endoplasm!bggT ((~((bgg (((You kill the endoplasm!bgg †≈~~~~≈bgg! 538.9 (1.2bgg' bgg) / _You shoot a sling bullet.bggbggkbgg]bggH _No target in view!bggbggbggbggH _No target in view!bgg:[Jbgg\bgg"^bggbQ _bggpdURev bggebggfbggh,bggibggkbggmbggm)bggnbggpbggMrbggrbggsbgg'ubggvbgg+wbggwbgg{b  You see here a quokka corpse.bgg~bgg~ _bggNbgg_bggڃbgg5bgg@bggIbgge #~≈~#.. #~≈~#. #.≈~#~ #~≈~#. #~≈~#S####~~####†≈~#~~~~~~~~~~~~≈~#≈≈≈≈≈~~≈≈≈≈≈≈~#~~..~~~@~~†~~~#---###########≈≈≈# #≈≈≈# #≈≈≈# #≈≈≈# #≈≈≈#S   adder (asleep) #≈≈≈# #≈≈≈#bgg^081.7 (12.8)bgg)J---3.3 (14.4bggwbggsY _An adder comes into view.bgg ((((((S    You shoot a sling bullet. The sling bullet hits the adder.  The adder hisses angrily.bggp  The adder is moderately wounded.You shoot a sling bullet. The sling bullet hits the adder.bggw bgg l  The adder is heavily wounded.bgg< bggZ bgg bggܧ ~~b~S≈≈~~b   bat (wandering)bgg g===4.5 (1.2)Rev bggذ bgg. V _A bat comes into view.bggB (((((((You shoot a sling bullet.bgg? o  The sling bullet closely misses the adder.bgg ,bgg bgg bgg bggN  You shoot a sling bullet. The sling bullet misses the adder.bgg; bgg) bgg~ bgg 7S~~≈≈≈SbbS   ball python (constriction, wandering)bgg (5.7bgg# bggV ^ _A ball python comes into view.bggH  You shoot a sling bullet.  The ball python hisses angrily.  The sling bullet hits the bat.bgg~S   ball python (constriction)bgg  You kill the bat!You shoot a sling bullet. The sling bullet hits the adder.bggk †(#≈≈≈#bggbggbggůs~S†~bggQl56.8 (1.1Rev+ bggbggI _You kill the adder!bggXu (((((((You shoot a sling bullet.bgg  The sling bullet completely misses the ball python.You shoot a sling bullet. The sling bullet hits the ball python.bgg%bggbggx~~≈≈≈S†~bgg(7.9bggbgg^f _The ball python is moderately wounded.bggB (((((((You shoot a sling bullet.bgg  The sling bullet closely misses the ball python.You shoot a sling bullet.bggabggabggi~~~..~†Sbggfjl9.1 (1.2Rev* bggqbggti _The sling bullet completely misses the ball python.bggDe  You shoot a sling bullet. The sling bullet hits the ball python.bgg.C~bgg9 (((((((You kill the ball python!bgg6 l~~..~†~bggG: )90.3bgg*@ bggB / _You shoot a sling bullet.bgg bgg\ bggd bgg H _No target in view!bgg 4bgg bgglbgg{bgg; _bggbggX bgg ?Rev+ bggR bgg= bgg,bgg5bggfbggbgg5=Rev+ bggfbggbgg  You enter the shallow water.Water Rev bgg=bggN _Moving in this stuff is going to be slow.bgg URev bggbggACE  There is a large open door here.bggFbggG _bggHbggU*#~≈~# +..+ #~≈~# #..# #~≈~# #..# #~≈~# #..# #~≈~#  #..####~≈~# bggU< #..#?##~≈~#  +..'?##~≈~#  +..'@##~≈~# --- #..#?##~≈~# #~.####.≈~# #~~# #~≈~bggU##~.# #~≈~#≈~####~~####†≈~bggeV#.~~~~~~~~~~~~≈~#≈≈≈≈≈≈~~≈≈≈≈≈≈~#bggVP~~~..~†~~~~†~~~#bgg]1104.3 (14.0)bggJ^H---5.3 (15bggwdbgg g. _u - a scroll of identifybggdbggbggbgg/H _No target in view!bggbggfbgg<bgg H _No target in view!bgg& bgg( 3bgg+ bgg- bgg2 : _bgg^3 bgg3 bgg4 bgg7 I _u - 2 scrolls of identify (gained 1)bgg; 3bgg? bggF %.+..+...# ..# #..###..#+..'.+..'.##~#..#?##~≈~##~.####.≈~#~~bgg}F h~.~~~bggFL 18.3 (3.0)bggL +9.3 (4bgg-R bggT a _v - a scroll labelled UMEESU SOCWbgg bgg bgg bgg bggl bggŠ Bbggw ,bgg bgg bgg͏ bgg bgg bgg ,bgg bgg7 x _g - 2 scrolls of teleportation (gained 1)bgg Ibgg E  There is a large open door here.bgg bgg  _bgg bgg bggf bgg bgg* bgg bggX  #~≈~#+..+ #~≈~##..# #~≈~# #..# #~≈~# #..# #~≈~# ###..####~≈~#bgg  #.#..#.##~≈~# #r'..'.##~≈~# #r'@.'.##~≈~# #w#..#.##~≈~#bgg٭  # #~.####.≈~# #~~# #~≈~# #~.# #~≈~#bgg C≈~####~~####†≈~#rr 2 river rats (asleep).~~~~~~~~~~~~≈~#w   dart slug (asleep)bggX  ≈≈≈≈≈≈~~≈≈≈≈≈≈~# ~~~..~†~~~~†~~~#bgg 16.3 (7  You open the large door.  2 river rats and a dart slug come into view.bggB bggf bggs .rwr.bgg }rrwbggs &====bgg $7.3 (8bgg.  bgg 0_The river rat squeaks loudly. x2bgg%~ ((You shoot a sling bullet.bggC  The sling bullet closely misses the river rat.You shoot a sling bullet.bgg;; bgg=.rThe sling bullet barely misses the river rat.bggCH===-8.5 (1.2Rev bggKL bggLbggAMl_The river rat barely misses you. The river rat misses you.bggzMbggc  You shoot a sling bullet. The sling bullet hits the river rat.bggM  The river rat is moderately wounded.You shoot a sling bullet. The sling bullet hits the river rat.bggl  The river rat is almost dead.bggh-9.6 (1.1Rev+ bggbgg0bgg|Z _The river rat closely misses you. x2bgg; c  You shoot a sling bullet. The sling bullet hits the river rat.bgg o'   river ratbgg ((You kill the river rat!bgg/ +.'bgg# :5/554720.7bgg̨ bgg q _You shoot a sling bullet. The river rat closely misses you.bgg[b You kill the river rat! _You shoot a sling bullet. The river rat closely misses you.  You shoot a sling bullet.  The sling bullet closely misses the river rat.  The sling bullet hits the dart slug but does no damage.  Lightning courses through the dart slug!bggj b†(bgg  You kill the dart slug!You shoot a sling bullet. The sling bullet hits the river rat.bggyw bgg /  --more--bgg  rThe river rat is heavily wounded.bgg0---81.9 (1.2Rev* bgg*bggg _The river rat bites you. The river rat barely misses you.bggV((You shoot a sling bullet.bggi The sling bullet closely misses the river rat.You shoot a sling bullet.  The sling bullet hits the river rat but does no damage.bgg6 & bgg j†rThe river rat is heavily wounded.bggh -3.0 (1.1bgg bgg A _The river rat bites you but does no damage.bgg  You shoot a sling bullet. The sling bullet hits the river rat.bgg~ ((The river rat is severely wounded.You shoot a sling bullet.bgg †rThe sling bullet closely misses the river rat.bgg #1bgg ?=--4.1bgg bgg V _The river rat barely misses you.bgg  You shoot a sling bullet. The sling bullet hits the river rat.bgg= ((The river rat is almost dead.You shoot a sling bullet.bgg †rThe sling bullet completely misses the river rat.bgg\49-5.3 (1.2bgg?bgg. _The river rat bites you.bgg  You shoot a sling bullet. The sling bullet hits the river rat!†bggt% ((You kill the river rat!bgg††-516.5bggAbgg/ _You shoot a sling bullet.bggW4bgg1bggzH _No target in view!bggM50 _bgg;Rev+ 1=bggXbggbggbgg bggg:Rev bggbgg bgg>V2=bggbggX,bgg=bggbggbggbgg?bggbggM3=bggPbgg'bggRbggbggjbggbggK,bggbgg bggҢ94bgg2=bggbggm,bggubgg§bgg,bgg_bggت#5bgg (=bgg3bggbgg,bggbggD  There is a large open door here.  You see here a river rat corpse.bgg/bggq _bgg̶bggbggn,bggָbgg̹bggpbgg9=bgg bggbggbggbgg:bggbggj#∩∩# #~≈..bgg. +..+  +..+  #..#  #@.# bgg---49.5 (23.0) #..# ##..####~bgg#.#..#.##.'..'.# #††..'.##~bggOK #.#..#.## ###~.####. #~~# #~≈bggbggC#---bggj&50.5 (24bggbgg0E _Found two gates leading back out of this place.bggB bgg bggk% bggt( H _No target in view!bgg4bggubgg H _No target in view!bggibggjbggjbgglbggnbggrP _bgg=u,bggvbgg= _You open the large door.bggAbgg~bggŅbggLJbggK,bggbgg%  bgg There is a large open door here.bggbgg^ _bgg|bggo,bggbgg bggH_You now have 290 gold pieces (gained 14).bggbgg4bggbgg bggWbggbggN _s - 2 potions of enlightenment (gained 1)bggbggbbggbggrbggbggPbggbggֵN _s - 3 potions of enlightenment (gained 1)bggKbgg|bggbggabggbggbggkbggbggbggbggbgg,bggxbgg M _You now have 297 gold pieces (gained 7).bgg3bggbgg@[  There is a large open door here.bgg _bggQbggbgg ,bggbggObgg,bggbgg' #~≈.#  #~≈~# bggU#### #~≈~# bgg9#∩∩# #~≈.# #..# #~≈.# ###..####.≈~# bgg#.#..#[##~≈~# #.'..'?##~≈~# #.'.@'!##~≈~# 68.5 (18#.#..#?##~≈~# ###..# ##~≈~#  #..# #~≈~####..###.#..#.#.'..'.bgg#††..'.##~≈~##.#..#.##~≈~# _You open the large door.bgg _Found a potion of degeneration, 2 scrolls of noise and a cloak.bggf| bgg| bggP bgg H _No target in view!bgg)H#~≈.# #~≈~# #### #~≈~# #∩∩# #~≈.# #..# #~≈.# bgg{HK###..####.≈~# #.#..#[##~≈~# #.'..'?##~≈~# #.'..@!##~≈~# #.#..#?##~≈~# bggH###..####~≈~# #.'..'bggH}#††..' bggQbggQ89.0) _bggWbggZ bgg[P_There is a large open door here.bggzc#~≈.# #~≈~# #### #~≈~# #∩∩# #~≈.# #..# #~≈.# ###..####.≈~# #.#..#[##~≈~# #.'..'?##~≈~# #.'..'@##~≈~# bgg!#.#..#?##~≈~# ###..####~≈~# #..###..#.#..#.'..#††.. bggbgg%70 bgg _bggbgg _You see here a potion of degeneration.bgg^ #M~.##~∩∩ #..# #~≈.##..####.bgg֓ 3#..#['..'!.#..#?###..####~≈~#...'bgg7 bgg# $1 bggr _bgg8 bggP u _You see here a scroll of noise.bggn M####~.##~∩∩ #..# #~≈.##..####..#..#?'..'!#.#..#?##~≈~#..bgg2} bgg} -2 _bggŃ bgg N _You see here a +0 cloak.bgg bggVEquip which item? bggK - - Unarmed Inventory Items bgg'Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}bgg?0d - a +0 sling {Arun} bggg`Armour (go to first with [) bgg b - a +0 leather armour (worn)  k - a +0 helmet (worn) Floor Items ([,] to select) bggArmoura +0 cloak[?] describe selected [!] equip|wield|wear[tab] equip|unequip bggbggbgg}#####~≈~#SunshineJesse the Shooter#~≈~#Coglin#~≈.#Health: 55/55 ========================#~≈~#Magic: 7/7========================#### #~≈~#AC: 4Str: 11#∩∩# #~≈.#EV: 12Int: 9#..# #~≈.#SH: 0bgg-Dex: 19###..####.≈~#XL:  7 Next: 51% Place: a Sewer#.#..#@##~≈~#Noise: ---------  Time: 3172.5 (0.0)#.'..'?##~≈~#a) +2 sling {Septima j) +0 sling (elec) {#.'..'!##~≈~#Fire: a) +2 sling {Septima} #.#..#?##~≈~####..####~≈~##..# #~≈~####..####~≈~#bggL#.#..#.##~≈~##.'..'.##~≈~# _Found a potion of degeneration, 2 scrolls of noise and a cloak. _No target in view! _There is a large open door here. bgg_You see here a potion of degeneration. _You see here a scroll of noise. _You see here a +0 cloak.bggbgg#23.5 (1 _bggbggjbggI+4.5 (2bggbggbgg+5.5 (3bggbggbgg%+6.5 (4bggbggbggU$7.5 (5bggbgg 5 _You start putting on your armour. You continue putting on your +0 cloak. x4bgg_bgg;bggZ _You finish putting on your +0 cloak.bgg2  _Unknown command.bggbggtbggǹbggF _Unknown command.bgg<"bgg"bgg$bggD)bgg+bgg,$ _bggJ1bggg3E  There is a large open door here.bggY6bgg6 _bggN8bgg:bggc=bgg=bgg ?bggAbgg+Dbgg_DbggEbggHbggJbggJbgg@PbggRbggUbggeUbggVbggYbgg[,bgg\bgg_bgg%bbggZbbggcbggebggh,bgg1ibggkbggm,bggnbggrpbggqbggHrbggsbgg{ubggxA  You enter the shallow water.bggx@Water bggUybggl{$ bgg{*_Moving in this stuff is going to be slow.bgg}bggO}&bgg}bgg+bgg  You enter the shallow water.Water bggۃbggN _Moving in this stuff is going to be slow.bggbggbggbggbggbggbgg0bggbggʐbggbggbggTbggk #.#..#.##~≈~##~≈. #.'..'.##~≈~##~≈~ #††..'.##~≈~##~≈~ #.#..#.##~≈~#bgg~≈~ ###~.####.≈~#~≈~ #~~# #~≈~#~≈~ #~.# #~≈~#S###~≈~####~~####†≈~#bggY6~~~~~.~@~~~~~~~~~~≈~#≈≈≈≈≈≈≈≈≈≈≈~~≈≈≈≈≈≈~#≈~~.~~~~..~†~~~~†~~~#≈~###############≈≈≈#~ #≈≈≈# #≈≈≈#S   ball python (constriction, asleep) bgg#≈≈≈# #≈≈≈# #≈≈≈#bgg 96.9 (19.4)  A ball python comes into view.bggbggĨbgg!~~~SS)8.5 (21.0bgg8bgg5 _The ball python hisses angrily.bgg * #.#..bgg  j  #~≈. #.'..  #~≈~ #††..  #~≈~ #.#..bggS u  #~≈~ ###~.  #~≈~ #~~# #~≈~#  #~≈~ #~.# #~≈~# bggu ) ~###~≈~####~~  bgg K~~~S~.~@~~~~~~~  bgg =≈≈≈≈≈≈≈≈≈≈≈~~≈≈  bgg "≈~~.~~~~..~†~~~ bgg . ≈~  ~bgg 1#≈≈≈#  #≈≈≈# bgg.  #≈≈≈#  bggH F#≈≈≈#  #≈≈≈# bgg߸ [ #.#..  #~≈. #.'..  #~≈~ #††..  #~≈~ #.#..  #~≈~ ###~.  #~≈~ #~~# #~≈~#  #~≈~ #~.# #~≈~#  ~###~≈~####~~  ~~~S~.~@~~~~~~~  bgg ≈≈≈≈≈≈≈≈≈≈≈~~≈≈  ≈~~.~~~~..~†~~~  ≈~  ~ #≈≈≈#  #≈≈≈# #≈≈≈# #≈≈≈#bgg bgg bgg bggO b _A ball python is nearby!bgge  You shoot a sling bullet. The sling bullet hits the ball python.bgg/d†(((bgg ((((You kill the ball python!bgg^l~~~†~.~bgg&ag===9.7 (1.2)Rev bgg jbggl/ _You shoot a sling bullet.bggbggobggxbggH _No target in view!bgg}bggk~bggbggH _No target in view!bgg4bggbgg!bgg#bgg$% _bgg)bgg,bggW.7bgg /bgg0bgg-4  You enter the shallow water.Water bgg&5bgg38N _Moving in this stuff is going to be slow.bgg9bgg:bgg:bgg=%  bgg.>BYou see here a ball python corpse.bgg?bggG@ _bgg@bggBbggDbggCDbggDbgg^FbggGbgg&HbggHbggJbggKbggLbggLbggNbggObggPbggPbgg2RbggISbggSbggTbggUbggVbggVbggWbgg]YbggZ,bggn[bgg\bggX^bgg^!bgg_bggz`bggcA  You enter the shallow water.bggc@Water bggdbggqfN _Moving in this stuff is going to be slow.bggh<bgg1k,bgginA  You enter the shallow water.bggn@Water bggQobggqN _Moving in this stuff is going to be slow.bgg sbgg3sbggsbgg|ubggfw,bggwbggEybggxzbggz!bggC{bgg}bgg%A  You enter the shallow water.bgg@Water bgg!bgg<  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. bgg_Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggbgg;bggbggbgg,bggbggbgg‹bggbggbggbgg'bggX!bggbggEbggOr _Moving in this stuff is going to be slow.  You enter the shallow water. bgg_Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bggbggԗ^  You enter the shallow water. _Moving in this stuff is goibggng to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbgg&. _Moving in this stuff is goibgg2ng to be slow.bggbggbggؙbgg_bggٛbgg% _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is goibggqng to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg*Water bggbgghbgg{  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbggâ. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg5bggp&bggbggubggĩ _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbggUD.Water bggbggi  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbgg4. _Moving in this stuff is going to be slow.bggbbgg&bggAbggbgg _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. bgg% You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bgg%bggQ^  You enter the shallow water. _Moving in this stuff is goibggng to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbgg4. _Moving in this stuff is going to be slow.bgglbgg,bggl≈≈~~~.~~~~~~~~~~~~~~≈~#≈≈~################~≈~#≈≈.##~≈†#≈≈~##~≈~#≈≈~##~≈~#≈≈~########## #####~≈.#≈≈~~~~~~~~~~~ ~~~~~~≈~ #≈≈~≈≈≈≈≈≈≈≈≈≈ ≈≈≈≈≈~≈~ #≈≈~~~@~~.~~.~ ~~~~~~≈~--- #≈≈.###~≈~#### #####~≈~ #≈≈~# ~≈~# #~≈~ #≈≈.# ~≈~# #~≈. #≈≈~# ~≈~#gg/7m #~≈~#≈≈.# S≈~# #### #~≈~ S   ball python (constriction, asleep)#≈≈~# .≈~# #∩∩# #~≈.#≈≈.# ~≈~# #..# #~≈.#≈≈~####..####.≈~bggM249.3 (49.6) _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  A ball python comes into view.bgg3S~S)bggK---50.9 (51.2bggbgg5 _The ball python hisses angrily.bgg  #≈ #≈≈.##~≈† #≈≈~# #≈≈~# #≈≈~  #≈≈~~~~~~~~~~~  #≈≈~≈≈≈≈≈≈≈≈≈≈  #≈≈~~~@~~.~~.~  #≈≈.###~≈~####  #≈≈~# S≈~#  bgg #≈≈.# ~≈~#  #≈≈~# ~≈~#  #≈≈.# ~≈~# ####  #≈≈~# .≈~# #∩∩#  #≈≈.# ~≈~# #..#  #≈≈~# bgg.e #≈ #≈≈.##~≈† #≈≈~# #≈≈~# #≈≈~  #≈≈~~~~~~~~~~~  bgg/#≈≈~≈≈≈≈≈≈≈≈≈≈  #≈≈~~~@~~.~~.~  #≈≈.###~≈~####  #≈≈~# S≈~#  #≈≈.# ~≈~#  #≈≈~# ~≈~#  #≈≈.# ~≈~# ####  #≈≈~# .≈~# #∩∩#  #≈≈.# ~≈~# #..#  #≈≈~# bgg5bggz6bgg<bgg>b _A ball python is nearby!bggl ( You shoot a sling bullet. The sling bullet hits the ball python.bgg (((((The ball python is moderately wounded.You shoot a sling bullet.bggbgg' bggTiS~≈≈~bgg_~The sling bullet barely misses the ball python.bggg===2.0 (1.1)Rev bgg-bggC _The ball python bites you but does no damage.bggRe  You shoot a sling bullet. The sling bullet hits the ball python.bgg[^†bgg (((You kill the ball python!bggiq†≈~bggl_3.1Rev+ bggqbggTs/ _You shoot a sling bullet.bggVbgg%bggbggF H _No target in view!bggT bggAV 4bggX bgg*Z bgg^ rRev  _bgg\_ ,bgg ` bgguc g  You see here a ball python corpse.bggBe bgge 0 _bggof bggeh bggj bggj bggj bgg]m bgglv #≈≈~##~≈~##≈≈~#~≈.##≈≈~~~~~~~~~~~~~~~~~~≈~##≈≈~≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈~≈~##≈≈~~~~~~.~~.~~~~~~~~≈~#bggv #≈≈.###†≈~##########~≈~##≈≈~# #~≈~# #~≈~##≈≈.# #~≈~# #~≈.##≈≈~# #@≈~# #~≈~#---#≈≈.# #~≈~# #### #~≈~##≈≈~# #.≈~# #∩∩# #~≈.##≈≈.# #~≈~# #..# #~≈.#bgg*w #≈≈~# #~≈~####..####.≈~##≈≈~# #~≈~##.#..#.##~≈~# r   quokka (asleep)bgg^w #≈≈~# #~≈~##.'..'?##~≈~##≈≈~# #r≈~##.'..'!##~≈~##≈≈.# #.#..#?##~≈~#bgg{ -9.5 (6.4bgg6| bggk rr~bgg0 J---61.1 (8.0bgg bgg Y _A quokka comes into view.bgg #≈≈~# ~~~~~~~ ≈≈≈≈≈≈ ~~~.~ †≈~bgg #≈≈~# #~≈~#  #≈≈.# #~≈~#  #≈≈~# #@≈~#  #≈≈.# #~≈~# ####  #≈≈~# #.≈~# #∩∩#  #≈≈.# #~≈~# #..#  #≈≈~# #~≈~ bgg _#≈≈~# #r≈~ #≈≈~# #~≈~bgg2=? #≈≈~# #~≈~ #≈≈.# bggX?bgg_ #≈≈~# ~~~~~~~ ≈≈≈≈≈≈ bgg&a~~~.~ †≈~ #≈≈~# #~≈~#  #≈≈.# #~≈~#  #≈≈~# #@≈~#  #≈≈.# #~≈~# ####  #≈≈~# #.≈~# #∩∩#  #≈≈.# #~≈~# #..#  #≈≈~# #~≈~ #≈≈~# #r≈~ #≈≈~# #~≈~? #≈≈~# #~≈~ #≈≈.# ?bgg ibggibggpbggs] _A quokka is nearby!bgg (((((((You shoot a sling bullet.bgg5  The sling bullet barely misses the quokka.You shoot a sling bullet.bgg~.~~r~~bggc===2.2 (1.1Rev bgg]bgg)J _The sling bullet hits the quokka but does no damage.bggM`  You shoot a sling bullet. The sling bullet hits the quokka.bgg~S@((((bgg;TV†bggT (((You kill the quokka!bggc~.~~†~~bggh-3.4 (1.2bggnbggq/ _You shoot a sling bullet.bgg4bggUbgg.H _No target in view!bgg+ C _Rev bgg0  You enter the shallow water.Water  _Moving in this stuff is going to be slow.bgg2 bgg2 bggN3 bgg9 bgg: bgg: bggp; bgg @ b  You see here a quokka corpse.bggA bgg.B _bggB bgggE bggF bggG bggG bggJ bggK bggL bggL bggoO bggP bgg4Q bggQ bgg\T bggU bggU bggV bggY bgg] Bbgg~^ bgg_ bgg:` bgg` bggc bgge bggae bggf bggh bggj bggSj bggj bggzm bggo bgg9o bggo bggr bggt bgg=t bggt bggmw bgg.y bggsy bggGz bgg| bgg^ Bbggw bgg6 bggg bgg bgg* bgg bgg bgg% bgg؈ bgg bgg A  You enter the shallow water.bgg= @Water bgg) bgg N _Moving in this stuff is going to be slow.bgg bggߔ bgg bgg bggS bgg bgg- bggd bgg; bgg bgg- bgg, bgg bgg bgg bgg' bgg bgg. bgg̦ bgg bggͪ bgg bgg bgg bggt bgg !bgg bgg bggo bgg bggW bgg_ bgg A  You enter the shallow water.bggS @Water bgg bgg N _Moving in this stuff is going to be slow.bgg bgg@ bgg bgg bgg ,bgg bgg bgg Xbgg cbgg %  You enter the shallow water.Water   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterbgg . _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggy  #≈≈~# #~≈~##.#..#.##~bgg  #≈≈~# #~≈~####~.####. #≈≈~# #~≈~# #~~# #~ #≈≈~# #~≈~# #~.# #~ #≈≈~###~≈~####~~####÷ #≈≈~~~†~.~~~~~~~~~~~~ #≈≈≈≈≈≈≈≈≈≈≈≈≈~~≈≈≈≈≈ #≈≈≈~~.~~~~..~÷~~~~÷~ #≈≈≈@###############≈--- #≈≈~.# #≈ #≈≈~.~ #≈ #≈≈~~~# #≈ #≈≈ggn ]m.~.~ #≈ #≈≈≈.~.# #≈ h   jackal (asleep) #≈≈≈#~.. #≈ S   ball python (constriction, asleep) #≈≈≈ ..hS bgg `316.4 (53.0) _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  A jackal and a ball python come into view.bgg ,bgg; 6  The jackal barks!bgg- bgg< bgg bgg bgg 2 hr   river rat (wandering)rhh 2 jackals (1 wandering).hA river rat comes into view. A jackal comes into view.==-8.0 (54.6bgg# bgg' 8 _The ball python moves out of view.bggԝc (((((bggn>((You shoot a sling bullet.bgg$  The sling bullet closely misses the jackal.You shoot a sling bullet.bgg,p  The sling bullet closely misses the jackal.bgg bggbggTT  The river rat squeaks loudly. The jackal barks!bgg r.~h~bggUrr.hh.SS   ball python (constriction, wandering)bgge=9.1 (1.1)Rev bggbgg^ _A ball python comes into view.bgg F ((S)You shoot a sling bullet.  The ball python hisses angrily.  The sling bullet hits the jackal.bgg  The jackal is severely wounded.You shoot a sling bullet. The sling bullet hits the jackal.bgg †   jackalbgg\,bgg]bgg]bgg_bggh.~†r.SS   ball python (constriction).bggjlh220.2Rev+ bggsbggvJ _You kill the jackal!bggs ((( You shoot a sling bullet. The sling bullet hits the river rat.bgg  The river rat is moderately wounded.You shoot a sling bullet.  The sling bullet hits the river rat but does no damage.bggO ,bgg3$ .~r~S.bgg)% (1.3bggv/ bgg1 d _The river rat is moderately wounded.bgg> bgg? bggyJ bggOM  bggM 8_Unknown command.bgg ((You shoot a sling bullet. The sling bullet hits the river rat.bggQ  ((The river rat is heavily wounded.You shoot a sling bullet.  The sling bullet closely misses the river rat.bgg,bgg3-bggc.bgg{7.r~S~.bgg8l2.5 (1.2Rev* bggAbgggDO _The sling bullet hits the ball python but does no damage.bggbggbgg 'bgg*0 _Unknown command.bgg\+bgg (((((You shoot a sling bullet.bgg)v _Unknown command.  You shoot a sling bullet.  The sling bullet hits the river rat but does no damage.  Lightning courses through the river rat!S   ball python (constriction)bgg bggIbggmoS†~†~.bgg543.6 (1.1bgg&bggM _You kill the river rat!bggbggFbgg]bggOF _Unknown command.bggFy%  bggy@You shoot a sling bullet. The sling bullet hits the ball python!bgg(F†bgg  (((((You kill the ball python!bggtm††~~.bgg_Q 4.7 _You shoot a sling bullet.bggxbggFh _Your Dodging skill increases to level 4!bggkbgg bgg=bgg;F _Unknown command.bgg2bgg63bgg;bgg=H _No target in view!bggӜ4bggbggF _Unknown command.bgg5bggbggbggH _No target in view!bggy uRev*  _  You see here a ball python corpse. _bggc {  You see here a river rat corpse.bgg A  You enter the shallow water.bgg EWater Rev+ bgg bgg N _Moving in this stuff is going to be slow.bgg bgg bgg& bgg bggn bgg bgg8 bgg! b  You see here a jackal corpse.bggO bgg l#≈≈~# #~≈~# #~.# #~≈#≈≈~###~≈~####~~####÷≈#≈≈~~~†~.~~~~~~~~~~~~≈#≈≈≈≈≈≈≈≈≈≈≈≈≈~~≈≈≈≈≈≈#≈≈≈~~.~~~~..~÷~~~~÷~~#≈≈≈~###############≈≈#≈≈~†## ##≈≈~†~# #≈≈#≈≈~~@# #≈---9.9 (5.2#≈≈.~h~#bgg <#≈#≈≈≈.~.##≈#≈≈≈#~.S#≈#≈≈≈#....#≈≈≈##~... h   jackal#≈≈≈ ....# S   ball python (constriction)#≈≈ ##.##bgg[ bggN :---bgg bggi  bgg V_There are monsters nearby!bggڒ`  You shoot a sling bullet. The sling bullet hits the jackal!bgg.S   ball python (constriction)bgg# ((((You kill the jackal!bggQbgg.~S~...bgg-@5===31.0 (1.1bggbgg/ _You shoot a sling bullet.bggI ( You shoot a sling bullet. The sling bullet hits the ball python.bgg (((((The ball python is severely wounded.You shoot a sling bullet.bggZbggboS~.....bggbg2.1Rev* bgghbgg`ii _The sling bullet completely misses the ball python.bgg* ((((You shoot a sling bullet.bgg  The sling bullet barely misses the ball python.You shoot a sling bullet.bggB US~~.  You shoot a sling bullet.  The sling bullet barely misses the ball python.  You shoot a sling bullet.  The sling bullet barely misses the ball python.ball python closbggC you. The ball python grabs you.  The ball python constricts you. The ball python bites you.bgg%D 3- 2 3.2Constr Water Rev* bggIK bggK bggFX /  --more--bgg ] _The ball python constricts you.bggr]You shoot a sling bullet. The sling bullet hits the ball python!bggyF†bggk((((You kill the ball python!bgg#†~~.4-12 4.3bgg]bgg' _You shoot a sling bullet.bgg>>bgg>bggEbggG> _Unknown command.bgguebggebggmbggn@ _No target in view!bgg  _5=Rev+ bgg Rev+   You see here a ball python corpse.bgg A  You enter the shallow water.bggM EWater Rev+ bgg d _Moving in this stuff is going to be slow.bgg kRev bgg bggo bgg :=bgg bgg bgg bgg bgg bgg bgg bgg !bgg0 bgg bgg bgg bgg bgg! bgg" bgg" bgg:% N _You now have 312 gold pieces (gained 15).bgg& bgg& bgg' bgg6* bgg\* bgg + bgg0 N _You now have 325 gold pieces (gained 13).bgg32 bggd2 bgg3 bggm5 bgg5 bgg:6 bggL; M _You now have 334 gold pieces (gained 9).bgg; 3bgge< bgg > ,bgg6> bgg@ M _You now have 343 gold pieces (gained 9).bggA 3bggA bggB bggnC ,bggC bggD bggE bggE bggdF bggG bggG ,bggH bgg _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You see here a ball python corpse.bgg bggo _bgg_ bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg bgg ,bgg bgg8 bggQ bgg bggH bgg bgg 7bgg( bgg bgg  You enter the shallow water.Water bgg bgg _Moving in this stuff is going to be slow.bgg   You enter the shallow water.Water  _Moving in this stuff is going to be slow.bggW   You enter the shallow water.Water bggG  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is goibgg dng to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg bgg: bgg bgg$  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg;) hbgg,  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg5  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bgg/9 j  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggz9 bggJ= X _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bgg= bgg?   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggA bggQA bggB bggI bggJ bggJ bgg7K bgg+Q bgg/R bgggR bggUS bgg/Y bgg4Z bggcZ bggZ bggm` bgga bggb bggb bggh bggi bggi !bggj bggm bggo  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bggo @Water bgg2p bggbx   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggy bgg7z bggz bgg҄ bgg bgg5 bgg bgg bgg bgg4 !bgg bgg bgg  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg@ @Water bgg bggș   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg 4bgg7 bgg bgg bggD bgg١ bgg bgg ,bgg2 bggS Bbgg bgg bgg+ bggh bgg bgg cbggH bgg3 _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. bgg ( You enter the shallow water.bgg- NWater bgg   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg <bgg bggj bgg.  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg VWater bgg   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bggO <bgg bgg bgg  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg @Water bgg_ bgg   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg <bgg. bgg bgg7  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg VWater bgg   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg 4bgg{ bggu bgg? bggi bgg bggk bgg ,bgg bgg bgg, bggU !bgg bgg' bgg  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg @Water bgg bggU   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg bgg> bggu bgg Bbgg bgg bgg bgg !bgg bgg bgg  _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.bgg @Water bgg~ bgg   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg   _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water.Water bggq bggN   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg 4bgg2 bggU bgg bgg@ bgg bgg bgg bgg bgg bgg/ bgg bgg bgg) bggq bggE bgg bgg bgg bggM bggt bgg bgg bgg bgg bgg/! bgg$ @ _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You see here a ball python skeleton.bgg% bgg& _bgg& bgg( bggE* bgg* !bggD+ bgg- bgg/ I  You enter the shallow water.bgg0 8Water bgg}0 bggw2 N _Moving in this stuff is going to be slow.bgg3 4bgg3 bgg"5 bgg5 bgg5 bgg 6 bgg7 bgg 9 bggJ9 bgg9 bgg; bgg= Bbgg? bgg? ,bgg @ bggVA bggA ,bggbB bggC bgg~D ,bggD bgg7F bggF ,bgg=G bggH bggI ,bggI bggJ bgg~K ,bggK bgg P d  You see here a quokka skeleton.bggIQ bggQ _bggQ bggZS bggT bgg%T bggoT bggU bggV ,bggV bgg*X bggX bggY bggcY bggb[ bgg] ,bgg] bgg_ bggl` ,bgg` bgga bggb ,bggb bgg1d bggd bggd bgg@e bggf bggg bggh bggh bgg!j bggj ,bggk bggan bggeo bggo bggFp bggq bggs ,bggt bggv bggx ,bgg.y bgg=| bgg~ ,bgg~ bgg bgg ,bgg bgg bgg ,bgg bgg bgg) bggj bgg، bgg bggB ,bggP bgg bggޓ ,bgg bgg bgg bgg bgg 0bggߞ bgg bggأ I  You enter the shallow water.bgg 8Water bgg bgg N _Moving in this stuff is going to be slow.bgg 4bggf bgg bgg 7bgg bgg bgg A  You enter the shallow water.bgg߰ @Water bgg bgg N _Moving in this stuff is going to be slow.bggc bgg bgg& bgg} bggѺ ,bgg% bgg_ bggl ,bggǽ bgg bgg ,bgg bgg: bgg 7bggF bggd bggl  You enter the shallow water.Water bgg bgg0   You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg 4bggf bgg bgg 7bgg bgg ; _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You see here an adder skeleton.bgg  You enter the shallow water.Water bgg. bgg N _Moving in this stuff is going to be slow.bgg 4bgg bgg bggE ,bgg bgg bggH ,bgg bgg bggF ,bgg bgg bgg8 ,bgg bgg bgg bgg bgg bggV !bgg bgg< bgg  You enter the shallow water.Water bgg N _Moving in this stuff is going to be slow.bggG 4bgg bggv bgga Xbgg bgg !bgg bgg bgg 0bgg bgg6 bggn !  You enter the shallow water.Water enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg bgg bggbgg,bggbggbgg|,bggbggbggkbggbggIbggbgg, ,bgg bgg #~≈~## #....##  #≈≈≈ #~≈~# ##..### #≈≈≈ #~≈~# #..### #≈≈≈##~≈~# #...##bgg-{ #≈≈≈##~≈~# ##.~###≈ #≈≈≈##~≈~# #..~# # #≈≈≈##~≈~# ###~~~# # #≈≈≈##~≈~###~#~~.### #≈≈≈@~~~~~~..~~~~~~~~---599.1 (264.8) #≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈ #≈≈~~~.~~~~~~~~~~~~~~bgg[ #≈≈~################~ #≈≈.# #~ #≈≈~# #~  #≈≈~# #~  #≈≈~################~ #≈≈~~~~~~~~~~~~~~~~~~ ---bggPbgg2 _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Partly explored, can't reach some placesbggbgg bggbggbggbggQ _bggbggbggbggbggbgg9bggbggfbgg,bggbgg bgg,bggbggbgg5,bggbgghbggbgg!bggbgg6bgg0bgg<bggObggh  You enter the shallow water.Water bggbggN _Moving in this stuff is going to be slow.bggbggbggbggbgg ,bggbggKbgg}bgg!bggXbggbggi0bggDbgg bggj bgg bgg( bgg bggebggbgg3bggbgg2,bggbgg bgg_,bgg7bgg~bggbggbggvbggbgg,bggbggbgg ,bggbgg'##### ##### ##...## #∩..## #.....####....## #..~...##@.....# 625.0)bgg'#~~~...##.÷....# ##~~~.####.....# #~≈~## #....#≈≈≈ #~≈~# ##..###≈≈≈##≈≈≈ #~≈~# #..###≈≈≈##≈≈≈##~≈~# #...##≈≈≈##≈≈≈##~≈~# ##.~###≈≈≈##≈≈≈##~≈~# #..~# #≈≈≈#bgg(bggK-bggOBj _There is a gate leading back out of this place here.bgg4bgg!bggvbgg86.1 (1.0) _bggbgg7....># ####.# ####### .....# #######.......  ###..### #.............  .......# ###.......#.#  .......# #.##'##.# .......# #.#~~~#.#  .......# #.#~~~#.#  Dungeon:5 .......# #.#~@~#.#  #+##+### ###.#~~~#.#   #.).#~~~#gg89m.#  #####.#.#####.#   ......<.......#   ######....#..##    #.........)..#    ## ######..#.#.###    .. .# #..#.....   bgg9bggBbgg+9 (1.8bgg@bgg} _Welcome back to the Dungeon! _There is a collapsed entrance here.bggbggk Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls of teleportation  h - 2 scrolls of poisoni - a scroll of brand weapon  m - a scroll labelled ANUYPIZXOPSU  t - a scroll labelled PECVIA BOCAGOu - 2 scrolls of identify bgg v - a scroll labelled UMEESU SOCW [!] read|quaff|evoke[?] describe selectedbgg(bggg/bgg=....>#  SunshineJesse the Shooter ####.########   Coglin .....# #######.......   Health: 55/55 ======================== ###..### #.............   Magic: 7/7======================== .......# ###.......#.#   AC: 5Str: 11 .......# #.##'##.#  EV: 12Int: 9 .......# #.#~~~#.#  SH: 0Dex: 19 .......# #.#~~~#.# bggU?  XL:  7 Next: 55% Place: Dungeon:5 .......# #.#~@~#.#  Noise: ---------  Time: 3626.9 (0.0) #+##+### ###.#~~~#.#  a) +2 sling {Septima j) +0 sling (elec) {#.).#~~~#.#  Fire: a) +2 sling {Septima} #####.#.#####.# ......<.......# ######....#..##  #.........)..#   ## ######..#.#.###   ..ggf@;49m .# #..#.....   _Partly explored, can't reach some places.  You enter the shallow water. _Moving in this stuff is going to be slow. _There is a gate leading back out of this place here. _Welcome back to the Dungeon! _There is a collapsed entrance here.bggSibggkJIdentify which item? (\ to view known items) Scrolls (select first with ?)  f - a scroll labelled HAANOV TAOCOLE  m - a scroll labelled ANUYPIZXOPSU bgg?l t - a scroll labelled PECVIA BOCAGO  v - a scroll labelled UMEESU SOCW Potions (select first with !)  n - a blue potion  p - a glowing orange potion  q - a fuming orange potion[?] describe selectedbggPbgg&Xbgg+`....>#  SunshineJesse the Shooter ####.########   Coglin .....# #######.......   Health: 55/55 ======================== ###..### #.............   Magic: 7/7======================== bgg`.......# ###.......#.#   AC: 5Str: 11 .......# #.##'##.#  EV: 12Int: 9 .......# #.#~~~#.#  SH: 0Dex: 19 .......# #.#~~~#.#  XL:  7 Next: 55% Place: Dungeon:5 .......# #.#~@~#.#  Noise: ---------  Time: 3626.9 (0.0) bggav#+##+### ###.#~~~#.#  a) +2 sling {Septima j) +0 sling (elec) {#.).#~~~#.#  Fire: a) +2 sling {Septima} #####.#.#####.# ......<.......# ######....#..##  bgg b#.........)..#   ## ######..#.#.###   .. .# #..#.....   _Partly explored, can't reach some places.  You enter the shallow water. _Moving in this stuff is going to be slow. _There is a gate leading back out of this place here. _Welcome back to the Dungeon! bggbD_There is a collapsed entrance here.bggo]  As you read the scroll of identify, it crumbles to dust.bggo+7.9 (1bggubgg1xP _v - a scroll of immolationbggLbgg Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls of teleportation  h - 2 scrolls of poisoni - a scroll of brand weapon  m - a scroll labelled ANUYPIZXOPSU  t - a scroll labelled PECVIA BOCAGOu - a scroll of identify bggw v - a scroll of immolation [!] read|quaff|evoke[?] describe selectedbgg_G bggO ....>#  SunshineJesse the Shooter ####.########   Coglin .....# #######.......   Health: 55/55 ======================== ###..### #.............   Magic: 7/7======================== .......# ###.......#.#   AC: 5Str: 11 .......# #.##'##.#  EV: 12Int: 9 .......# #.#~~~#.#  SH: 0Dex: 19 .......# #.#~~~#.#bggP   XL:  7 Next: 55% Place: Dungeon:5 .......# #.#~@~#.#  Noise: ---------  Time: 3627.9 (0.0) #+##+### ###.#~~~#.#  a) +2 sling {Septima j) +0 sling (elec) {#.).#~~~#.#  Fire: a) +2 sling {Septima} #####.#.#####.# ......<.......# ######....#..##  #.........)..#   ## ######..#.#.###   bgg7Q [17d.. .# #..#.....   _Moving in this stuff is going to be slow. _There is a gate leading back out of this place here. _Welcome back to the Dungeon! _There is a collapsed entrance here.  As you read the scroll of identify, it crumbles to dust. _v - a scroll of immolationbggS bggU (Identify which item? (\ to view known items) Scrolls (select first with ?)  f - a scroll labelled HAANOV TAOCOLE  m - a scroll labelled ANUYPIZXOPSU  t - a scroll labelled PECVIA BOCAGO Potions (select first with !)  n - a blue potion  p - a glowing orange potion bggV q - a fuming orange potion[?] describe selectedbgg bgg bgg! ....>#  SunshineJesse the Shooter ####.########   Coglin .....# #######.......   Health: 55/55 ======================== ###..### #.............   Magic: 7/7======================== .......# ###.......#.#   AC: 5Str: 11 bgg .......# #.##'##.#  EV: 12Int: 9 .......# #.#~~~#.#  SH: 0Dex: 19 .......# #.#~~~#.#  XL:  7 Next: 55% Place: Dungeon:5 .......# #.#~@~#.#  Noise: ---------  Time: 3627.9 (0.0) #+##+### ###.#~~~#.#  a) +2 sling {Septima j) +0 sling (elec) {#.).#~~~#.#  Fire: a) gg E2m+2 sling {Septima} #####.#.#####.# ......<.......# ######....#..##  #.........)..#   ## ######..#.#.###   .. .# #..#.....   _Moving in this stuff is going to be slow. _There is a gate leading back out of this place here. _Welcome back to the Dungeon! _There is a collapsed entrance here.  As you read the scroll of identify, it crumbles to dust. _v - a scroll of immolationbgg ]  As you read the scroll of identify, it crumbles to dust.bgg +8.9 (1bgg] bggR S _t - a scroll of vulnerabilitybgg_S3bggTbggXbgg]A  You enter the shallow water.bgg ^@Water bggcabggbN _Moving in this stuff is going to be slow.bggebggebggBgbggCibggkbgg0l!bgglbggn@  There is an open door here.bggpbggqp _bggpbggrbggsbggsbggubgg)vbggw,bggxbggE}bgg~,bggbggbggpbggbggbggbggω,bggmbggbggAbggbggbgg~bgg6bgg~bggbggUbggabggbggbgglbggpbggbggbggObgg"bggwbggbggǨbggbggªbggnbggܬbggbggbggbggSbggbggbggbgg8bggbgg.bggMbggbgg!bggabgg#bggbgg(bggibggbggbgg/bggbgg+bggbggbggbggbgg(bgga,bggbggubggbggCbgg:bgg"bggT,bggCbggbgg;bggzbgg^bggbgg,bggbggbgg^bggbggObggTbggbgg3bggbggbgg,bggbgg bggYbggbggbgg/bgg?bggbggbggbggbggbggbgg bggpbgg}bggbgg,bgg bggj"bgg$,bgg]&bgg)P  There is a stone staircase leading up here.bgg,bgg - _bggd.bgg1bgg3bgg/4bgg6bgg8bgg:,bggo;bgg=bgg>bgg?bgg@bggAbggZCbggCbggDbggFbggGbggGbggHbggKbggLbggLbggMbggObggPbgg;QbggQbgg Sbgg0U,bggUbgg:Zbgg[,bgg;\bggabggb,bggdbggjbggm,bgg nbgg^pbggPrbggrbggsbggv,bggwbgg/|N _You now have 361 gold pieces (gained 11).bgg~bgg.bggbggbgg,bggbggUJbgg2bggݎbgg-,bggbgg&bggabggbggRbgg7 _You open the door.bggu3bgg/bgg@  There is an open door here.bggٟbgg> _bggbggbggM,bggbggbggv,bgg)bgg֫7 _You open the door.bggۭ3bggobggbgg,bggbgg@  There is an open door here.bgglbgg _bggbggƶbgg,bggbggbggbggbgg bgg޺bggbggbggbgg¼bggbgg̽bgg-bggRbgg ###.#............# ###.. ##.#.#.###........# #.# #......#..........# #.# #..#.#.#.##.......# #.# #......#[ #.......# #.# #+#......#. ##'##'### ###.#  ##......#.#. #.##.# #.).#  #.........#.###.##.######.#.# .####.......###$@...#.........<..702.1 (73.2) ....##+##..###########.#######... ........................##....... ...###..#..###########..######..# ........................# #..# #...........<...######..# #..# #.............#.# #..# #... #.#.........#.#.######..######..#..............##.##...#......##bggbgg,3.1 (74bggbgg# _Found a robe.bgg|bggbggXbggbgg%bggbggbggN,bggCbggM _You now have 369 gold pieces (gained 8).bggU3bgg&bgg/bgg',bggbggbgg/bggbgg`bggkbgg,bggbggt<  You see here a +0 robe.bggbggo _bgg{bggDbgg,bgg bggSbgg,bggbggbggIbggbgg\bggbgg,,bggbggbggtbggbgg@bggbgg,bggzbggbgg:bgg)bggrbggtbggbggzbggbggbgg% bgg( bggd bggbggbggk,bgg@bggbgg,bggbggbgg,bgg_bgg #Xbgg87 _You open the door.bgg:3bggH<bggAbggCbgg DbggDbgg(TbggV,bggWbggZbgg`],bgg!^bgg`bggb,bggcbggfbggi,bgg jbgglbggnBbggpbggq,bggnrbgg+tbggv,bggvbgg |nbgg|bggG}bgg}bgg<bgg,bggbgg3bggf,bggbgg;nbgg=,bggbggbgg%bgg\bggbggbggƕbggbggbggbggWbggbgg,bggbggbggܞbggbgggbgg/bggkbggbgg)bggpbggbggN _You now have 379 gold pieces (gained 10).bgg3bggbggU7 _You open the door.bggbggbgg(bggbggbggebggbggbggbggYbggѹbggbgg<bggrbgg¼bgg?bggUbggbggٿbgg bggt,bggbggbggbggbgg2bggbgg,bggbggAbgg5,bggbgg%bgg,bggbggbgg,bgg~bggbggbgg+bggybggbgg,bggbggXbgg,bggebggbggBbggmbggbggbggMbggEbgg9,bggbgg3bggbggbggbbggbggbgg=bggbggWbggy,bggbggbgg{bgg,bggNbgg,bgggbgghbggs,bggbgg,bggbgg7 _You open the door.bgg3bggBbgg@  There is an open door here.bgg6bgg _bggbggbggbgg,bggbggbgglbgg,bgg bgg- bggf bgg bggPbgg,bggAbggybggbggJbggbggbggbggMbgg(bggPbgg" .. ..# .##.## #########  ....# #.......#  #...#.#.......#  #5#####...#.#.......#  #>..........'.......##  ..#####@..#.#........##  #.............#'## #.......#.###.# #.## #...........# #.# #####.....#.# #.####.# #.#####'## #.....bggz#5   white imp (wandering) #........# ######..# #........#  #........########...bgg&} 79.1 (76.0  A white imp comes into view.bggm-i.bgg-.-80.1 (77bgg3bgg"5\ _Found a stone staircase leading down. The white imp moves out of view.bgg7 bgg bgg bgg bgg bgg BbggM bgg bgg] bgg bgg2 .... .... ###..... ... ..... .. ...... ..# bgg _..5...##.## ########.# #..  # #.#####...#.#.......# #>..........'.......## ..#####...#.#........###.............#######'##bgg #.......#.###.# #.## 5   white imp (wandering)#...........# .#####.....#.##.#####'#bgg7 12.1 (2.0)bgg @5.bgg +3.1 (3bggC bggN bgg/O .... .... ###  ..... ...  ..... .. ..5... ..# ......##.##   #.........#   #@..#  #...#  #>..........'  ..#####...#.#..  ........ ..#.###.#  ......# .  #####.....#.#   bgg} .... .... ###  ..... ...  ..... .. ..5... ..# ......##.##   #.........#   #@..#  #...# bgg, #>..........'  ..#####...#.#.. ........ ..#.###.#  ......# . bgg #####.....#.#   bggbgg~bggbgg+ ((((5 _A white imp is nearby!You shoot a sling bullet.  The white imp shouts, "Decamp, thou puking pigeon-egg pimple!"bggwo}  The sling bullet hits the white imp but does no damage.  You shoot a sling bullet.bgg 5....  The sling bullet hits the white imp but does no damage.bgg8 ******The white imp gestures at you.bggS....@.bgg@c===4.3 (1.2Rev bggbggbgg/  --more--bggLBQ _The puff of frost misses you.bggKa((((You shoot a sling bullet.bgg+tThe sling bullet hits the white imp but does no damage.  You shoot a sling bullet.bggpVbgg]d.5...bgg],50bggcbggnfE _The sling bullet hits the white imp but does no damage.bgg"`(((You shoot a sling bullet.bgg@  The sling bullet hits the white imp but does no damage.  You shoot a sling bullet. The sling bullet hits the white imp.bgg*bgg*bgg1_..5.bgg2d6.5 (1.2Rev+ bgg7bgg(;d _The white imp is moderately wounded.bgg (((((((You shoot a sling bullet.bggS  The sling bullet closely misses the white imp.You shoot a sling bullet.bgg bgg j......5bgg l7.6 (1.1Rev* bggQ bgg c _The sling bullet barely misses the white imp.bgg0 c  You shoot a sling bullet. The sling bullet hits the white imp.bgg (((((((The white imp is moderately wounded.You shoot a sling bullet.bgg ......5The sling bullet barely misses the white imp.bgg\ (8.7bgg bgg~ @ _The white imp hits you but does no damage.bggTM}  You shoot a sling bullet.  The sling bullet hits the white imp but does no damage.bggO _The white imp hits you but does no damage.  The sling bullet hits the white imp but does no damage.  The white imp is moderately wounded.bggw  You shoot a sling bullet.  The sling bullet hits the white imp but does no damage.  The white imp is moderately wounded.  You shoot a sling bullet.  The sling bullet hits the white imp but does no damage.  The white imp is moderately wounded.bgg3$49bggw5---9.8bggu#bgg#bggk./  --more--bggF _The white imp hits you. The white imp freezes you.bgg9[You shoot a sling bullet. The sling bullet hits the white imp.bggp$The white imp is heavily wounded.You shoot a sling bullet.  The sling bullet hits the white imp but does no damage.bggNThe white imp is heavily wounded.  The white imp gestures at you.bgg> bgg> l0-------91.0 (1.2bggC bggBD bgg#M /  --more--bggr 2 _The puff of frost hits you!bgg< [You shoot a sling bullet. The sling bullet hits the white imp!bggA [.bgg (((((((You kill the white imp!bggR .......----72.2bggW  bggcY !_You shoot a sling bullet.bgg$& 4bgg) bggO- > _Unknown command.bgg! bgg bgg0 bgg @ _No target in view!bggbgg8bggR bggF _Unknown command.bggҙbggmbggbggpbggo1 _bggbggbggbggbgghbgg#2bggަJ=Rev+ bggbggv,bgg bggbggbggbggPRev bgg8bggbggK#3bgg|3=bgg-bggbggQbggbggbgg/bggbggںbgg?bggiM4=bgg,bgg0bgglbgg-bggbggbggbgg;bggbggbggk5=bggbgg,bggpbgg,bggbggbgg:K6=bgg1bgg,bggbggDbggobgg$bggbggbggbgg)bggrbggN7=bggQbgg,bggbgg,bgg0bggbggi%8bggbggbggbggbggabggbgg_bggDbggbgg?bggbgg/#9bggW(=bggbgg+,bggbgg,bggVbggbgg]O50=bggbggbggbggbgg,bggAbggbgg.K1=bggbggbgg4bgg7bgg,bggbgg,bggbggbggU2=bggbgg,bggUbggbggbggbgg?bggK3=bggUbgg,bggbgg6 bggp bgg* bgg ,bgg bggbgg#4bgg2=bggbgg:bggubggbggbgg!bggbggbgg@#5bggc(=bggbgg1 _HP restored.bggbggybggbgg bgg!bgg$"bgg"bgg$bggc&bgg&bgg9'bgg)bgg*bgg+9=bgg+bgg.bgg/,bgg%0bgg(1bgg2,bgg2bgg%5bgg6bgg6bgg7bgg/<@  There is an open door here.bggC=bgg= _bgg>bggNAbggB,bggCbggF@  There is an open door here.bggyHbgg#I _bggIbggKbggZMbggMbggNbggObgg(P,bggPbgg?RbggSbggSbggZTbggUbggLWbggWbggXbggfYbgg[,bgg[bgg\bggR^,bgg _bgg$abggb,bggcbggeBbggkbgg-mbggn,bgg-obggepbggq,bggqbggsbggu,bggubggnvbggw,bggwbggsybggzbggzbgg'{bggD|bggF}bggp}bgg}bggnbggbggbggFbggfbggpbggbgg%bggbgg_,bgg bggmbggbgg4bgg^bggbbggf,bggbgg5bggbgg9bggbggbggbggbggbggbggu,bggbgg՘bggP############### ##.............# #..#####.@..#... ---874.2 (82.0)#.## ##...# bggO###.# #...#... #...# .#...#...##...# #.#..#.#..# ###...# ( #..#.#..#..bgg##...# ## #..#.#..## #####....# ..##. #. #... .......####.#bggbggH---5.2 (83bgg?bgg% _Found 3 stones.bgg>bggv?bggS@bggeCbggdEbggHBbggJ,bggKbgg NbggPbggCPbggQbggnSbggUbggUbggVbggYbgga#################.............### #..#####....#....# #.## ##...#.@.## bggb###.# .#...#...#....# #...# #.#...#...#.#..# #...# #.#..#.#..# # .######### #...# (s#..#.#..# #........ #...# ####..#.#..## ######### s   scorpion (asleep) ....# ..##.##.. #........ ..### .. .. #.####### .## ###.#......bgg/l19.2 (4.0)bggl,80.2 (5bggrbgguv[ _A scorpion comes into view.bgg4bggZbggR _No reachable target in view!bgg  ######  .....###  ...#....#  #.## ##...#.@.##  .#...#...#....#  #.#...#...#.#..#  #.#..#.#..# # . (s#..#.#..#  ####..#.#..##  ..##.##..  .. .. bggoz  ######  .....###  ...#....#  #.## ##...#.@.##  .#...#...#....#  #.#...#...#.#..#  #.#..#.#..# # . (s#..#.#..#  ####..#.#..## bgg{ ..##.##..  .. .. bggbbggӁbggbbgg_ _A scorpion is nearby!bgg^E#################.............####..#####....#....# ##.## ##...#...##..## ##.# .#...#..@#....# ...# #.#...#...#.#..# bggF...# #.#..#.#..# # .########## ...# (s#..#.#..# #......... ...# ####..#.#..## ########## ...# ..##.##.. #......... .### .. . #.. #.########  ## #. ##. ###.#.......  # bggpF[##.#.#.###... bgg3Mbgg`N21.2 (1 _bggRbggTbggq ###############bggs##.............###..#####....#....# #### ##...#...##..## ##.# .#...#...#.... ...# #.#...#..@#.#..##..#.#..# # .##########(s#..#.#..# #.........#..#.#..##....#. ############......#..... bggbgg^&2bggbggbgg( #################.............###..#####....#....# #### ##...#...##..## ##.# .#...#...#....# ...# #.#...#...#.#..#bgg/)#.#.@# # .##########(s#..#.#..#S)#..#.........####..#.#..####..##########..##..bgg)D#.S   water moccasin (asleep)## #.......##.#..#.#.#.##..bggq3  A water moccasin comes into view.Found a glaive.bgg9 .The water moccasin hisses angrily.bgg:&3bggCbgg,E; _The water moccasin moves out of view.bgg z #################.............###..#####....#....# #### ##...#...##..## ##.# .#...#...#.... ...# #.#...#...#.##..#.#..#S##..##########(s#..#.#.@#.)#..#.........####..#.#..####..########## ..##.##.. #......... .##.. . #...######## bgg ## #. ##... ###.#........#S   water moccasin# #.......##.#......#[##..bggw bggf G.Sbgg &4bgg bgg bgg #################.............###..#####....#....# #### ##...#...##..## ##.# .#...#...#.... bgg} ...# #.#...#...#.##..#.#..#.##..##########(s#..#.#..#S)#..#.........####..#.#.@####..########## ..##.##..# #......... .## . #.... #.######## bgg ## #. .##....###.#....... # bgg .. #..##.#.#.### ######### #. ###......#.. #bgg .......# ## #.#..#.#.#.##?....#['.###'bgg! bgg, bggA- &5bgg2 bgg4 S _Found a scroll of immolation.bgg< f##.............###..#####....#....# #### ##...#...##..## ##.# .#...#...#.... ...# #.#...#...#.##..#.#..#.##..##########(s#..#.#..#S)#..#.........####..#.#..####..##########bgg[=  ..##.##@.# #......... .##..#...#....$.##.######## ## .##...##....###.#....... # #.... #..##.#.#.### #bgg= #########..#. ###......#.. #.......#.. ## #.#..#.#.#.##S   adder (asleep). ? ....#[#S'bgg= g.###' '###......#.#.# #.bggF  An adder comes into view.Found 14 gold pieces.bggO SS.bgg(P &6bggW bgg[ / _The adder hisses angrily.bgg; ..#####....#....# #### ##...#...##..## ##.# .#...#...#.... ...# #.#...#...#.#.#.#..#.##..##########(s#..#.#..#S)#..#.........####..#.#..####..########## ..##.##..##..##......... .##..#...#@...$.##.######## ## ##...##....###.#....... #  #.... #..##.#.#.###.##S #.  #........## ## #.........#.###. bggbgg&7bggsbggbgg }#.## ##...#...##.. #.# .#...#...#....# ..# #.#...#...#.#..# # #.#..#.#..#.##..############ (s#..#.#..#S)#..#..........# ####..#.#..####..############ ..##.##..##..##.......... ### ..#...#....$.##.######### # .##...##@...###.#........ #.... ##..##.#.#.### #########..#. ###......#... .......#.. ## #.#..#.#.#.## .#. S #.#......#[##. .bggF# #. #'#......#.###'# .## ##......#.#.# #.# .## #...#.###.# .#######'###.####.###.....#bgg<8bggWbggbgg.# .#...#...#....# .# #.#...#...#.#..### #.#..#.#..#.##..############ .# (s#..#.#..#S)#..#........... .# ####..#.#..####..############ .# ..##.##..##..##........... bggL## ..#...#....$.##.######### .##...##....###.#......... #.... ##@.##.#.#.### bggp$########..#. ####......#... ......#.. ## #.#..#.#.#.###. S #.#......#[##.bgg# #. #'#......#.###'#### ##......#.#.# #.### #...#.###.# #######'###.####.###.....#. # #.##.....##+##..##########bggA"bgg"&9bgg(bgg)bgg- Jbggv/ bggbgg`bggbggbgg#bgga bgg bgg bgg bggnN _You now have 393 gold pieces (gained 14).bggbgg bggbggXbgg@bgg@bggjbggJbggbgg!bgg"bgg"bgg%bgg)bgg)bgg*bggq.bgg9 ###############  ##.............###  #..#####....#....####  #.## ##...#...##..## ##.# .#...#...#....# bggf:1..# #.#...#...#.#..## ...# #.#..#.#..#.##..## ...# (s#..#.#..#S)#..# ...# ####..#.#.@####..########## ...# ..##.##..##..##.. .bgg:### ..#...#......##.######## ## .##...##....###.#... # #.... ##..##.#... ##########..#. ####......#..... S   water moccasin #bgg;m.#.. ## #.#..#.#.#.##.. S   adder.......#. S #.#......#[##..bgg%;.......# #. #'#......#.###'bgg0H,97.2 (8bggH+8.2 (9bggQbgg@Tbggf;bgg$<bggDbggEHR _No reachable target in view!bggN bgg bgg# bgg>'  bgg' D_No reachable target in view!bgg ##.............###..#####....#....###### ##...#...##..## ##.# .#...#...#.... ...# #.#...#...#.#..###..#.#..#.##..##########(s#..#.#..#S)#..#.........####..#.#..####..########## ..##.##@.##..##......... .##..#...#......##.######## ## .##...##....###.#....... #  #.... ##..##.#.#.### #bgg7#########..#. ####......#..... #. '.......####......#.#.# #.bggubgg:29.2 (1 _bggbgg^ ^#..#####....#....#### #.## ##...#...##..## #.# .#...#...#....# ..# #.#...#...#.#..## #.#..#.#..#.##..############ (s#..#.#..#S)#..#..........# ####..#.#..####..############ ..##.##..##..##.......... ### ..#...#.@....##.######### bgg &# .##...##....###.#........ #.... ##..##.#.#.### #########..#. ####......#... .......#.. ## #.#..#.#.#.## .bgg% #. S #.#......#[##...  .# #. #'#......#.###'#  .## ##......#.#.# #.#  .bggk y## #...#.###.# bgg` bgg (900bggM bgg bgg D.## ##...#...##.. .# .#...#...#....# .# #.#...#...#.#..### #.#..#.#..#.##..############ .# (s#..#.#..#S)#..#........... .# ####..#.#..####..############ .# ..##.##..##..##........... ## ..#...#......##.######### bggA h.##...##.@..###.#......... #.... ##..##.#.#.### ########..#. ####......#... ......#.. ## #.#..#.#.#.###. S #.#......#[##.# #. #'#......#.###'#### ##......#.#.# #.### #...#.###.# #######'###.####.###.....#.bggI bgg &1bgg6 bgg bgg T## ##...#...##..## # .#...#...#....# # #.#...#...#.#..## # #.#..#.#..#.##..## # (s#..#.#..#S)#..#.> # ####..#.#..####..##. # ..##.##..##..##. # ..#...#......##.#..##...##..@.###.#.#.... ##..##.#.#.###...#. ####......#.#.. ## #.#..#.#.#.##.bggT#. S #.#......#[##.# #. #'#......#.###'##'## ##......#.#.# #.##.## ## #.#.###.##.'###.####.###.....#.bgg\bgg\&2bggbbggCdbgg[###....#....#### ##...#...##..##  .#...#...#....#  #.#...#...#.#..##  #.#..#.#..#.##..##############  (s#..#.#..#S)#..#...........># bggo ####..#.#..############.# ..##.##..##..##............#..#...#..bgg..#########..#.##...##....###.#.....bggI #.... ##..##.#.#.### bggs$######..#. ####......#....#.. ## #.#..#.#.#.##.#. S #.#......#[##......bggC# #.'#......#.###'##'#bgga## ##.#.# #.##.# bgg |.....## ## #..#.###.##.#bggbgg&3bggbggbgg[ ...........### ###....#....#### ##...#...##..## .#...#...#....# #.#...#...#.#..###.#..#.#..#.##..############## (s#..#.#..#S)#..#...........>#  ####..#.#..############.# ..##.##..##.@##............# ..#...#......##.#########..##.##...##....###.#..... #.... ##..##.#.#.### #####..#. ####......#....#.. ## #.#..#.#.#.##.#. S #.#......#[##.......# #.'#......#.###'##'##bgg ## ##.#.# #.##.#bgg bgge &4bggv bgg bgg M############ ...........### ####..#### ##..# ...# .#...#.#..## #.#..#.#..#.##..#############bgg  (s#..#.#..#S)#..#...........>####..#.#..####@.#############.##..##..##............# .#...#......##.#########..##.##...##....###.#............S   water moccasinbgg bggz bgg g.bgg &5bggU bgg bggUM ############ ...........### ####..#### ##..# bggf#....# .#...#.#..## #.#..#.#..#.##..############# (s#..#.#..#.)#@.#...........>bgg,D####..#.#..####..#############.##..##..##............# ..#...#......##.#########..##bggMV#.# bggbggISS   water moccasinbgg&6bggbggbgg]_ ############ ...........### ####..#### ###..# .S..# .#...#.#..## #.#..#.#..#.##@.#############bgg (s#..#.#..#.)#..#...........>####..#.#..####..#############.##..##..##............#.#...#......##.#########..##.##...##....###.#.... bgg#.... ##..##.#.#.### #####..#. ####......#.... ###.#.#.bggbggOF.Sbgg&7bggbgg,bgg5~ ((You shoot a sling bullet.bggw@  The sling bullet misses the water moccasin.You shoot a sling bullet.bgg+ .SThe sling bullet closely misses the water moccasin.The water moccasin bites you.  You are poisoned.bgg 4=======-----===8.4 (1.2Pois Rev bgg bgg <-----bggF /  --more--bggWrQ _The water moccasin poisons you! The water moccasin bites you!bggfYou shoot a sling bullet.  The sling bullet hits the water moccasin.bggQ%((The water moccasin is lightly wounded.  You shoot a sling bullet.bgg 0--Pois Rev+ The sling bullet barely misses the water moccasin.You feel very sick.bggM/  --more--bgg. .SThe water moccasin closely misses you.bggH--9.5 (1.1bgg:&bgg(> _The water moccasin bites you but does no damage.bggbgg/  --more--bggD _The water moccasin bites you but does no damage.bggE '(bgg} 7(You shoot a sling bullet.bgg6 The sling bullet closely misses the water moccasin.You shoot a sling bullet.  The sling bullet hits the water moccasin!bgg .SThe water moccasin is heavily wounded.bggQ _28-2.8bgg bgg4 c _You feel sick. The water moccasin misses you.bgg bgg 8-bggz bgge  bgg 8_Unknown command.bgg _Unknown command.bgg  You shoot a sling bullet.  The sling bullet hits the water moccasin.bggʉ  The water moccasin is almost dead.You shoot a sling bullet.  The sling bullet hits the water moccasin but does no damage.bgg" 19The water moccasin is almost dead.bgg1 /  --more--bgg%[ feel sick.5.0bgg0bggS> _The water moccasin bites you but does no damage.bggqO ^((You shoot a sling bullet.bgg The sling bullet closely misses the water moccasin.You shoot a sling bullet.  The sling bullet hits the water moccasin.bgg SbggEm ..You kill the water moccasin!8-826.1bggdu : _You feel sick.bggڶN-bggӼbggF _Unknown command.bgg bgg! bgg" bggR% bgg( ,bgg* 3 _You feel sick.bgg* 87bgg+ bggU/ I _You feel sick.  You feel sick.bgg/ l6-Rev* bgg0 bgg 3 $ bgg-3 F_You are no longer poisoned.bgg_3 ?Rev+ bggB4 bgg5 bggL6 J7=bgg7 bgg8 bgg8 bgg9 bgg: bgg; bgg; bggF= bgg= >8=bgg= 7Rev bggj> bgg? bgg$@ bgg@ bggB bggB bggC bggD bgg"E bgg5F bggG bggG R9=bggH bggI bggJ bggJ bgg\L bggL bgg5M bggN bggN T20=bggO bggQ bgg5Q bggQ bggKS bggzS bgg&T bggU bggV I1=bggV bggEX bggsX bggY bgg_ ,bggk_ bgg` bgg` bgga bgg4c bggc S2=bggEd bgg(f ,bggf bggCi ,bggi bggk bggl T23=bggm bggn bggn bggo bggFq bggq bggNr bggs bggt bggu bggv bggUw K4=bgg#x bggy bggy bggz bgg.| bgg| bggI} bgg bgg 95bgg* bgg Xbgg bgg bgg bggL bgg' bgg bgg& S6=bgg bggɌ bgg bgg bgg bggˏ bgg̐ bgg bgg K7=bgg bggq bgg bggX bggƗ bgg bgg bggZ bgg bggY bgg bggb S8=bgg2 bggG bgg bggR bgg4 bgg bggB bgg= bgg K9=bgg bgg bggʩ bgg bggά bgg bgg bgg bgg bgg' bggg bgg3 T30=bgg bgg bgg bggʶ bgg[ bgg bgg_ bgg bggk K1=bggJ bgg bgg bgg bgg bgg bgg bgg bgg 92bgg bgg ,bgg bgg bgg= bgg bgg ,bgg4 bgg9 bggs S3=bgg bggC bgg bggd bgg bgg bgg2 bgg bgga K4=bggZ bggd bgg bgg? bgg bgg bgg3 bgg% bggD bgg bgg bgg S5=bgg bgg bgg bgg bgg bgg bggq bgg bgg K6=bggO bggq bgg bgg bgg bgg bggu bggp bgg bgg bgg bgg S7=bgg bgg\ bgg bgg bgg ,bgge bggD bggy K8=bgg bgg bgg3 bgg bgg ,bggH bgg ,bgg bgg bggQ S9=bgg bggk bgg bgg bggZ bgg bgg bgg bgg6 X40=bgg bgg ,bgg bgg] bgg bggP bgg bgg %1bggn bggi bgg bgg bgg bgg bggR bggA bgg` bgg bgg bgg K2=bggS bgg/ bggO bgg bgg ,bgg bgg bgg bgg6 N3=bgg bgg bgg bgg bgg bgg bgg bggA bggp bgg= bgg bggB K4=bgg bgg bgg bgg= bgg` bgg bgg bgg bgg* U5=bgg bgg bgg bgg bggj" bgg" bggm# bggP% bggz% bggE& bgg' bgg' K6=bgg( bgg) bgg.* ,bggm+ bgg+ bgg+ bgg, bgg- U7=bgg- bggh. bgg. bgg. bggz0 ,bgg1 bgg 2 ,bgg2 bggv3 bgg3 %8bgg4 bgg4 bgg+5 bgg5 bgg6 bgg6 bgg,7 bgg8 bgg88 K9=bgg8 bgg9 bgg9 bgg: bgg,; bggL; bgg; bgg'= bgg= V50=bggw> bggR@ ,bgg@ bgg:B bggfB bgge bgge K5=bgg|f bggh bggi bggj bggj bggk bgg1m bggYm bggn bggo bggp bggp bggHq bggar bggUs bggs 9=bggt bggt bgg!v bggHv bggv bggw bggx bggx bggmy bgg| bgg:~ bggb~ bgg bgg bggO Z###############  ##.............###  #..#####....#....####  #.## ##...#...##..## bggއ R###.# .#...#...#....# #...# #.#...#...#.#..## #...# #.#..#.#..#.##..######### #...# (s#..#.#@.#.)#..#........--- #...# ####..#.#..####..######### ....# ..##.##..##..##........ ..### ..#...#......##.####### .## .##...##....###.#...... bgg. .# #.... ##..##.#.#.###s   scorpion (asleep) .##########..#. ####......#.... .#.......#.. ## #.#..#.#.#.##.#.......#. ? #.#......#[##.bgg 34059.1 (143.0)bgg6 I---604bgg bgg bgg` #  ########  ........###  #....#....####  #.## ##...#...##..##  .#...#...#....#  #.#...#...#  #.#..#.#..#.##.. (s#..#.#@.#.)#.. ####..#.#..####.. ..##.##..##. .... #.... #.... ##..## #### ##  ? [bggp,bgg, bggu- bgg-F######## bgg4. bgg.........### bgg. bgg/#....#....#### bggu/ #.## ##...#...##..## bgg/ .#...#...#....# bgg0] #.#...#...#bggh0$ bgg0 #.#..#.#..#.##..bgg1. (s#..#.#@.#.)#..bgg1 ####..#.#..####..bggQ2~ ..##.##..##.bgg2  bgg2....bgg 3" bggd3,#....bgg3q #.... ##..##bgg39 ####bgg4 ##  ? [bgg?bggAbggBbgg5 bggz_ _A scorpion is nearby!bgg ############### #.............### .#####....#....####  #.## ##...#...##..# ###.# .#...#...#....# .#...#...#.#..## #.#..#.#@.#.##..#########bgga (s#..#.#..#.)#..#........ #####..#.#..####..#########..# #S.##.##..##..##........ ..###.#...#......##.########.##...##....###.#.... #.... ##..##.#.#.###S   adder (wandering)#########..#. ####......#.... ###.#.#.bggbggVbggbgg#1bgg.0) _bggbggbggm ###############  ##.............###  #..#####....#....####  #.## .##...#...##..##  ###.# ..#...#...#....  #...# #.#...#@..#.#..##  #...# #.#..#.#..#.##..########  #...# (s#..#.#..#.)#..#....... bgg X##...# ####..#.#..####..######## #....# #S.##.##..##..##....... ...### ....#...#......##.###### S   adder (wandering) #.## ...##...##....###.#..... #.# .. #.... ##..##.#.#.### #.##########..#. ####......#..bggbgg"S.S2bgg%/ _The adder hisses angrily.bgghM ############### #.............### .#####....#....####  #.## .##...#...##..###.# ..#...#@..#....# #.#...#...#.#..## #.#..#.#..#.##..#########...# (s#..#.#..#.)#..#.......###S##.s   scorpion (asleep)..... #.... ##..#bgg$<3bgg(bgg*bgg] ############### #.............### .#####....#....####  #.## .##...#@..##..###.# ..#...#...#....# #.#...#...#.#..## #.#..#.#..#.##..########  bggg (s#.S#.#..#.)#..#....... ######..#.#..####..######## #....# #..##.##..##..##....... S   adder ...###.#...#......##.#######.##...##....###.#....bgg bgggS.4bggbggbggI s ############### #.............### .#####..####  #.## .##...#...##..###.# ..#...#...#....# bgg& |#...#...#.#..###.#.S#.#..#.##..########   (s#..#.#..#.)#..#....... S   adder#####..#.#..####..######## #....# #..##.##..##..##....... ...###.#...#......##.######bggZ bgg bgg Y.#SbggH &5bgg bgg bggyt ###############  ##..........@..###  #..#####....#....## #.## .##...#...##..## ###.# ..#...#...#.... #...# #.#...#...#.###  #...# #.#..#S#..#.##..#######   #...# (s#..#.#..#.)#..#......   ##...# ####..#.#..####..#######  ##....# #..##.##..##..##...... bggvbgg#~S.S   adderbgg~&6bggtbggbggY (((You shoot a sling bullet. The sling bullet hits the adder.bgg ((((The adder is lightly wounded.  You shoot a sling bullet.bggAbbggjz..S....bgglk\===7Rev bggpbggt_ _The sling bullet barely misses the adder.bgg (((((((You shoot a sling bullet.bgghs  The sling bullet closely misses the adder.You shoot a sling bullet.bgg@ bgg bgg TS....bgg ..bgg d8.3 (1.2Rev+ bggH bgg ` _The sling bullet closely misses the adder.bgg (((You shoot a sling bullet.bgg  The sling bullet closely misses the adder.You shoot a sling bullet. The sling bullet hits the adder.bggi S..  The adder is severely wounded.bgg{ -9.4 (1.1bgg bgg = _The adder bites you but does no damage.bgg4 (((You shoot a sling bullet.bggE`  The sling bullet closely misses the adder.You shoot a sling bullet.bgg S..  The sling bullet closely misses the adder.700Rev* bgg!bgg{ _The adder bites you but does no damage. The adder closely misses you.bgg4N(((bggv.  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet.bgg` S..  The sling bullet closely misses the adder.bgg-1.5 (1.1bggFbgg= _The adder bites you but does no damage.bgg6N(((bgg  You shoot a sling bullet. The sling bullet misses the adder.You shoot a sling bullet. The sling bullet hits the adder.bggK5 S..  The adder is almost dead.The adder barely misses you. The adder bites you.  You are poisoned.bggM4==-2.6Pois Rev* bggQbggT, _The adder poisons you!bgg (((You shoot a sling bullet.bggu  The sling bullet barely misses the adder.You shoot a sling bullet. The sling bullet hits the adder.bggtySbgg  †..  You kill the adder!bgg. n2--43.8 (1.2bgg bgg] $ _You feel sick.bggZ bggȷ 8-bgg bgg H _No target in view!bgg5 bgg bggΎ bggɑ H _No target in view!bggbggRbggtbggbgg <1bgg3 _You feel sick.bggfbggbgg  _You feel sick. _No target in view! _No target in view! _You feel sick. _You feel sick.  bggp0-Rev+ bggbggj _You are no longer poisoned.bgg[bggbgg,bggbgg"bggU#L1=bgg$bggg'bgg':Rev bgg(bgg!+bggZ+bggn,bgg%/l2=bgg0bgg,3,bggm4bgg77bgg^8bgg:bgg%;bggO;D3=bgg<bgg>bgg>bgg!@bgg,bggbgg1bggWbgg bgg bggM U4=bgg bggbggVbggbgg0,bgg:bgg-bggK5=bggbggbgg`,bggbgg> bgg$!bggZ!bgg!bgg#bgg#bgg'$bgg$bgg'&bgg6(bgg(9=bgg|)bggN,bgg!4 ###############  ##.............### #..#####....#†...####bgg5(#.###..##...#...##..#####.##....#...#...#....#...##..#.#...#...#.#..## #...#. #.#@.#.#..#.##..####--- #...#..#(s#..#.#..#.)#..#...#...#..####..#.#..####..#### bgg%6#####....# #..##.##..##..##... .......### ....#...#......##.## ....#.## ...##...##....###.#. s   scorpion (asleep) ...##.# ..##.... ##..##.#.#. ##.##.##########..#. ####...... ....#.#.......#.. ## #.#..#.#.bgg8096.8 (23.0)bgg#################.............###..#####....#†...#######..##...#...##..#####.##....#...#...#.......##..#.#...#...#.#..###..##.#..#.#..#.##..####bggz?g#(s#..#.#..#.)#..#...##...#..####@.#.#..####..#### #####....# #..##.##..##..##... .......### ....#...#......##.###.## #....##...##....###.#.##.# ##..##.... ##..##. bgg?##.##.##########..#.# ####..... ....#.#.......#.. ### #.#..#.# # ? (... #.'bgg?bggKbggL&9bggSbggV% _Found 3 stones.bggH.............### #..#####....#†...#### #.###..##...#...##..#####.##....#...#...#....# # #...##..#.#...#...#.#..## # #...#..##.#..#.#..#.##..### # #...#..#(s#..#.#..#.)#..#.. # ##...#..####..#.#..####..### ######....# #@.##.##.... bggI['.......####......#...#......##.# #....#.## ##....##...###.#.# ##..##.....##..##.#.# .##.##.##########..#.#..####.... .....#.#.......#.. ### . #.#..#.# ##...#.#.#. ? ( #.#.....  ##...#.#.# #. #'#  .......'.## #......# bgg]SbggS(100bgg[bgg]bgg #..#####....#†...#### #.###..##...#...##..#####.##....#...#...#....# ## #...##..#.#...#...#.#..## .# #...#..##.#..#.#..#.##..## .# #...#..#(s#..#.#..#.)#..#. .# ##...#..####..#.#..####..## bggfq.######....##..##..##.##... .'.......####...@..#...#......## .#....#.## ##....##...###. .....##.# ##..##.....##..##.#.bgg##.##.##########..#.#..####.... ......#.#.......#.. ### . #.#..# .##...#.#.#. ? ( #.#....#...#.#.# #. #'# ........'.## #. ###...#.#bggm..## ## .bgg<1bggbgg%bgg  #..#####....#†...#### #.###..##...#...##..## ###.##....#...#...#....## #...##..#.#...#...#.#..## ..# #...#..##.#..#.#..#.##.. ..# #...#..#(s#..#.#..#.)#..# ..# ##...#..####..#.#..####.. ..######....##..##..##.##..##..## ..'.####..@...#...#......## ..#....#.## ##....##...##....###.##.# ##..##.....##..##.#.##.##.##########..#.#..####.#.#.#.. ### . #.#..# ..##...#.#.#. ? ( #.##...#.#.# #. #'#.'.## ##bgg@ s#...#.#.## ## #bgg> bgg &2bgg bgg< bggB? ##.............###  #..#####....#†...## #.###..##...#...##..## ###.##....#...#...#.... #### #...##..#.#...#...#..# #...#..##.#..#.#..#.##..bgg;C.# #...#..#(s#..#.#..#.)#...# ##...#..####..#.#..####...######....##.@##..##.##..##...'.......####......#...#......#....#.##..##...##....#....##.# ##..##.....##..####.##.##########..#.#..####........#.#.#.. ### . #.# ...##...#.#bgg{C.#. ? ( #.# #####...#.#bggC.# #. #'# ..........' ##bggJbggmK&3bggTbggni ###############  ##.............###  #..#####....#†...## #.###..##...#...## ###.##....#...#...#.... ##### #...##..#.#...#...#..# #...#..##.#..#.#..#.##.# #...#..#(s#..#.#..#.)#.# ##...#.@####..#.#..####..######....##..##..##.##..##...'.......####......#...#......#....#.##..##..#....##.# ##..##.....##..####.##.##########..#.#..####. s   scorpion......#.#.#.. ### . #.#. ....##...#.#bggxo.#. ? ( #.#.#####...#.#.# #. #'#.bggrbggz:s.bgg3{&4bggbggbggl ############### #.............### .#####....#†...### #.###..##..# ###.##....#. #####..#.#...#...#.#.##.#..## #s.#..#.#..#.) ##...#..####..#.#..##########....##..##..##.##..##'.......####......#...#......#....#.## ##....##...##....bgg m...##.# ##..##.....##..####.##.##########..#.#..###... ### . ..... ? ( #.bgg*wbggw&5bggXbgg]bggG ############### #.............### .#####....#†...### #.###..###..# ###.##..... #####..#.#...#...#.#.##.#..## #s.#..#.#..#.) ##...#..####..#.#..##########....##..##..##.##..##'.......####......#...#......#....#.## ##....##...##.......##.# ##..##.....##..####.##.##########..#.#..###... ### .bggbggM&6bggbgg9M ############### #.............### .#####....#†...### #.###..##...#...##..# ###.##....#.... ######@.#.#...#...#.#.##.#..## #s.#..#.#..#.) bgg....# ##...#..####..#.#..####..## bggbgg&7bggbgg bgg ############# ##.............### #..#####....#†...####  #.###..##...#...##..## ###.##.@..#...#...#....# #### #...##..#.#...#...#.#..## #...#..##.#..#.#..#.##.# #...#..#s.#..#.#..#.)#.# ##...#..####..#.#..##bgg 9######....##..##..##.##..##..#'.......####......#...#..#....#.## ##...##....##.# ##..##.....##..bgg bgg+ &8bggj bgg bggw# ##.### #..#####....#†...#### #.###..##...#...##..## ###.##..@.#...#...#....#  #...##..#.#...#...#.#..## #...#..##.#..#.#..#.##..## #...#..#s.#..#.#..#.)#..## ##...#..####..#.#..####..#######....##..##..##.##..##..#'.####......#...#......##....#.## ##....##...##....###.# ##..##.....##..##.#bggbgg.&9bggbggbggk| ##### ##.....### #..#####....#†...#### #.###..##...#...##..## ###.##...@#...#...#....#  #...##..#.#...#...#.#..## # #...#..##.#..#.#..#.##..# .# #...#..#s.#..#.#..#.)#..#. .bgg| {# ##...#..####..#.#..####..# .######....##..##..##.##..##..##. s   scorpion'.####......#...#......##.#....#.## ##....##...##....###.##.# ##..##.....##..##.#.bgg8 bggl bggh Is(bgg '10bgg bggΒ bgg J (((You shoot a sling bullet.bgg  The sling bullet closely misses the scorpion.You shoot a sling bullet.bgg*bggIs..bggc===2.0 (1.2Rev bgg#bgg$&b _The sling bullet barely misses the scorpion.bgg,>  You shoot a sling bullet.bgg The sling bullet barely misses the scorpion.The sling bullet hits the scorpion but does no damage.  The sling bullet hits the scorpion but does no damage.  Lightning courses through the scorpion!bggCEo  The scorpion is heavily wounded.bggE(3.2bggLbggaMbggV/  --more--bgg _The scorpion barely misses you. The scorpion closely misses you.bgg f(((You shoot a sling bullet.bgg[ |The sling bullet closely misses the scorpion.You shoot a sling bullet.bgg s..  The sling bullet barely misses the scorpion.4.3 (1.1bgg 7Rev+ bggG bgg 9 _The scorpion stings you but does no damage.bgg bgg bggZ bggw F _Unknown command.bgg |  You shoot a sling bullet.  The sling bullet hits the scorpion but does no damage.bggxR  The scorpion is heavily wounded.You shoot a sling bullet. The sling bullet hits the scorpion.bgg k  The scorpion is almost dead.bgg g5.4Rev* bgg bggc A _The scorpion stings you but does no damage.bgg>4bggF\ _Unknown command.bgg|  You shoot a sling bullet.  The sling bullet hits the scorpion but does no damage.bgg+  The scorpion is almost dead.You shoot a sling bullet. The sling bullet hits the scorpion.bgg0r†bgg.bgg1986.5bggbggL _You kill the scorpion!bgg4bgg6bgggF _Unknown command.bggٰbgg1bgg0bggH _No target in view!bgg?bgga@bgg3GbggIF _Unknown command.bggbgg9bgg0bgg҉H _No target in view!bgg0 bgg0 bgg1 bgg5 bgg7 bgg(= } _bgg= bgg@ bggxB bggC :Rev+ bggD bggVF bggbH bggH bggI bgghK bggM ,bggN bggP bggR bggR bggS bgg^V bggX bggyY :Rev bggZ bgg] bggx` ,bggb bggaf bggi ,bgg[k bggm bggTp bggp bggr bggt bggv bggv !bggw bggy bgg{ bgg{ bgg} bggx bggԁ ,bggd bgg bgg ,bggÊ bggd bggv ,bgg4 bgg8 bgg bgg8 bggl bggW bgg  ##.............### #..#####....#†...#####.###..##...#...##..#####.##....#...#...#....##...##..#†#...#...#.#..###...#..##.#..#.#..#.##..########...#..#(.#..#.#..#.)#..#......bgg ##...#..####..#.#..####..####### ##....##..##..##@##..##..##......--- ....####......#...#......##.#####.## ##....##...##....###.#.... ##.# ##..##.....##..##.#.#.### ##.##########..#.#..####......#...#.......#..#####.$#.#..#.#.#.# o   orc (asleep) .#.#.......#.. ?#( ..#[##.......#..#. o ..#'#......#.#'.......## ##......#.#.#bgg 32.5 (16.0)  An orc comes into view. It is wielding a +0 flail.bggo yoo.bgg H---3.5 (17bgg bggM + _Found 10 gold pieces.bggk    ....#†...####  ##...#...##..##  ..#...#...#....#  .#†#...#...  .##.#..#.#.  .#(.#..#.#..#.)  .####..#.#.##..##@#.....#...#..... ##....##...##.... ##..##.....##..#..#.#....#####.$#.. ?#o ..#[#..#. . ..# bggǷ    ....#†...#### bgg 4 ##...#...##..##  ..#...#...#....#  .#†#...#...  .##.#..#.#.  .#(.#..#.#..#.)  .####..#.#.##..##@#bgg& .....#...#..... ##....##...##.... ##..##.....##..#..#.#....#####.$#.. ?#o ..#[#..#. . ..# bgg5 4bgga bgg [ _An orc is nearby!bggS9E   ....#†...####  ##...#...##..##  ..#...#...#....#  .#†#...#...  .##.#..#.#.  .#(.#..#.#..#.)  .####..#.#.##..##@#.....#...#.....bgg]< ##....##...##.... ##..##.....##..#..#.#....#####.$#.. ?#o ..#[#..#. . ..# bgg   ....#†...####  ##...#...##..##  ..#...#...#....#  .#†#...#...  .##.#..#.#.  .#(.#..#.#..#.)  .####..#.#.##..##@#.....#...#..... ##....##...##.... ##..##.....##..#..#.#....#####.$#.. ?#obgg ..#[#..#. . ..# bgg/bgg6bggbgg[ _An orc is nearby!bggE-bgg.bggAbggAR _No reachable target in view!bgg4bggbggR _No reachable target in view!bggH#..#####....#†...#####.###..##...#...##..###.##....#...#...#....#  bgg u#...##..#†#...#...#.#..##...#..##.#..#.#..#.##..#########...#..#(.#..#.#..#.)#..#....... ##...#..####..#.#..####..######## #....##..##..##.##..##..##....... bggG...####......#..@#......##.###### #.## ##....##...##....###.#..... #.# ##..##.....##..##.#.#.### #.##########..#.#..####......#... #.#.......#..#####.$#.#..#.#.#.## #.#.bgg#.. ?#o ..#.#......#[# #.#.#..#. . ..#'#......#.##  ..'.## .. ##......#.#.#  bgg.#.#.## #...#.## bggbgg84.0) _bggrbggHbggDbggbggbgg=bgg>4bggbggЉbgg[o` ###..##...#...##..#####.##....#.......##..#†#...#...#.#..##..##.#..#.#..#.##..########(.#..#.#..#.)#..#....... #bgg.pA###..#.#..####..######## #....##..##..##.##..##..##....... ...####......#...#......##.###### #.## ##....##..@##....###.#..... ##..##.....##..##.#.#.############..#.#..####......#..##...####.# ....#######'###.####.......###...bggppD bggybggz&5bggbgg6bgg{ @###.##....#...#...#....# #...##..#†#...#...#.#..# #...#..##.#..#.#..#.##..######### #...#..#(.#..#.#..#.)#..#........ #...#..####..#.#..####..######### ....##..##..##.##..##..##........ ..####......#...#......##.####### .## ##....##...##....###.#...... .# ##..##.#.#.### .##########..#.#..####......#... .#.......#..#####.$#.#..#.#.#.## .#.#.. ?#o ..#.#......#[##. .#.#..#. . ..#'#......#.# .'.## .. .##......#.#.# #..## ##...#.### ...#######'###.####.###.... ##.# #.##.....##+##..########bggѲ bgg@ &6bggT bgg׻ bgg...##..#†#...#...#.#..# ...#..##.#..#.#..#.##..########## ...#..#(.#..#.#..#.)#..#......... ...#..####..#.#..####..########## ...##..##..##.##..##..##......... .####......#...#......##.######## ## ##....##...##....###.#....... # ##..##.#.#.### ##########..#.#.@####......#... #.......#..#####.$#.#..#.#.#.## #.#.. ?#o#..#.#......#[##. #.#..#. .#..#'#......#.###' '.## .. ..##......#.#.# #. #..## O##...#.###. O   ogre (asleep).#######'###.####.###..... #.# #.##.....##+##..#########.. #.##.....................bgg)  An ogre comes into view. It is wielding a +0 giant club.bgg1O.Obgg20===7bggf8bgg;& _The ogre shouts!bgg4 (((You shoot a sling bullet. The sling bullet hits the ogre.bgg  The ogre is lightly wounded.  You shoot a sling bullet. The sling bullet hits the ogre.bggBbggGR..O.8.6 (1.1Rev bggZbggx^_ _The ogre is moderately wounded.bgg ((You shoot a sling bullet. The sling bullet hits the ogre.bgg>  The ogre is heavily wounded.You shoot a sling bullet. The sling bullet hits the ogre.bgg bggG U.O.bgg _9.7Rev+ bgg bgg ] _The ogre is severely wounded.bggp (You shoot a sling bullet. The sling bullet hits the ogre.bgg=  The ogre is severely wounded.You shoot a sling bullet. The sling bullet hits the ogre!bgg  bgg JO.bgg )40.8bgg bgg X _The ogre is almost dead.bgg^  You shoot a sling bullet. The sling bullet hits the ogre!bgg j)bgg_ ((((You kill the ogre!bggg \)...bggt!bgg*B...##..#†#...#...#.#..##SunshineJesse the Shooter ...#..##.#..#.#..#.##..########## Coglin bgg,+...#..#(.#..#.#..#.)#..#......... Health: 55/55 ======================== ...#..####..#.#..####..########## Magic: 7/7======================== ...##..##..##.##..##..##......... AC: 5bgg+<Str: 11 .####......#...#......##.######## EV: 13Int: 9 ## ##....##...##....###.#....... SH: 0Dex: 19 # ##..##.....##..##.#.#.###... XL:  7 Next: 118% Place: Dungeon:5 ##########..#.#.@####......#..... Noise: ===------  Time: 4141.9 (1.1) bgg+*#.......#..#####)$#.#..#.#.#.##.. a) +2 sling {Septima j) +0 sling (elec) { #.......#.. ?#o#..#.#......#[##.. Fire: a) +2 sling {Septima} bggF,E#.......#..#. .#..#'#......#.###' Rev* '.......## .. ..##......#.#.# #. #........##.## .##.........#.###.  ..#######'###.####.......###.....  bgg,#.# #.##.....##+##..#########  #.. #.##..................... You shoot a sling bullet. The sling bullet hits the ogre.  The ogre is severely wounded.You shoot a sling bullet. The sling bullet hits the ogre! bgg,_The ogre is almost dead.You shoot a sling bullet. The sling bullet hits the ogre!  You kill the ogre!bggI. _You shoot a sling bullet.  You have reached level 8!bgg9/  --more--bggN M61/618/828 9% bggr bgg R _You feel stronger.bggcbggdbggFfbggip,bggp% _bggtbggwbggybgg9z:Rev+ bgg|bggN _You now have 403 gold pieces (gained 10).bgg7bggy#..##.#..#.#..#.##..############..#(.#..#.#..#.)#..#..........#..####..#.#..####..#############..##..##.##..##..##.......... ####......#...#......##.######### # bgg##...##....###.#........  ##..##.#.#.### #########..#.#..####......#... .......#..#####)@#.#..#.#.#.##---3.9 (2.0 .#.. ?#o#..#.#......#[##. .#..#. .#..#'#......#.###'# .## .. o.##......#.#.# #.# ..###.##...#.###.# bggy.#######'###.####.###.....# o   orc .# #.##.....##+##..########## .. #.##...................... bggL #.####.##....###..#..##########bgg:---bgg bgg5#[ _An orc is nearby!bggz (( You shoot a sling bullet. The sling bullet hits the orc.bgg1*  The orc is heavily wounded.You shoot a sling bullet.  The sling bullet hits the orc but does no damage.bgg bgg޽ .o.===5.0 (1.1Rev* bgg3 bggi [ _The orc is heavily wounded.bggt V((((bgg  You shoot a sling bullet. The sling bullet barely misses the orc.bgg bgg e.o...bgg% -6.2 (1.2bgg bgg w _You shoot a sling bullet. The sling bullet barely misses the orc.bggm& ((You shoot a sling bullet.bgg  The sling bullet closely misses the orc.You shoot a sling bullet.bgg; o.  The sling bullet closely misses the orc.bgg?-7.3 (1.1bggbggQP _The orc barely misses you.bgg+D((bgg!D  You shoot a sling bullet. The sling bullet barely misses the orc.You shoot a sling bullet. The sling bullet hits the orc.bgg JSbggU@).bgg(8.4bggbgg/G _You kill the orc!bggWe4bgggbggiH _No target in view!bgglbggXmbggvbgg)yH _No target in view!bggbggRbggKg _bggbggbggbgg{bggbggLbgg bgg9 :Rev+ bgg bgg bgg ,bgg- bgg bgg ,bgg bggc bgg bgg bgg! bgg# bgg% PRev bggY' bgg) bgg+ bgg, bgg/ bggg2 bggW4 bgg4 bgg%6 bgg 8 bggj: ,bgg; bgg= bgg? bgg@ !bggqA bggC bgg*F bgg}F bggH bggrK bggKN bggN bgg`P bggS ,bggT bgg] k _v - 2 scrolls of immolation (gained 1)bgg~_ bgg_ bgg!a bgge bggth ,bggl bggp bggr ,bggs bgg+x bggy bggz bggz bgga bggH ,bgg bgg bgg ,bgg bgg bggz ,bgg bgg bgg bggI bgg bgg bggm bgg bgg bggl bgg bgg bgg bggu bgg bggH bgg bgg bgg ,bgg@ bgg bgg ,bgg bgg7 bgg] ,bgg bgg bggu ,bgg bgg bgg_ ,bggQ bgg bgg ,bgg bgg bgg Bbgg bgg bgg bggf bgg bgg ,bgg bgg bgg bgg bgg bggQ bgg bgg bgg bgg7 bgg bgg bgg bgg bgg ,bgg bgg bgg ,bgg bgg bggV bgg bgg@ bgg bgg ,bgg bgg bgg ,bgg bgg bgg ,bgg bgg bggv bgg bgg bggX" bgg# bgg# bggk$ bggA& bgg' ,bgg\( bgg* bgg%+ ,bgg+ bgg~- bggS. bgg}. bgg. bgg0 bgg1 ,bgga2 bgg3 bgg4 bgg5 bgg5 bgg-7 bgg8 ,bggF9 bgg: bgg{< bgg< bggJ= bgge@ @  There is an open door here.bggA bgg>B  _bggB bggPD bggE ,bgg6F bggG bggH ,bgg>I bggkJ bggrK bggK bgg-L bggO bggP ,bggRQ bgg S bgg9T bggjT bgg:U bggJW bggX ,bggY bgg[ bgg ] ,bgg] bgg` bgga ,bgggb bggc bgg)e ,bgge bgg^g bggth bggh bggCi bggHj bggwm ,bggm bggUq @  There is an open door here.bggr bgg1s  _bggs bggu bggv bggv bggw bggx bgg,z ,bggz bggi| bgg} ,bgg~ bgg bgg ,bgg͂ bggU bggr ,bgg߅ bggЇ bggΈ ,bggl bggO 7 _You open the door.bgg bgg$ bgg bgg @  There is an open door here.bgg bgg  _bgg bggF bgg= bggo bgg֕ bgg bgg bgg' bgg bgg bgg bggŚ bgg bgg bgg˜ bgg bgg bgge bggF bggv bggɟ bgg bgg ,bgg bgg bgg3 ,bgg bgg bgg bggԧ bgg3 bgg< bgg bggR bgg bgg# bgg ,bgg bggV bggj bgg bgg bgg bgg bgg0 bggk bggg bgg_ bgg bgg bggж bggķ bgg bggF bgg& bgg2 ,bgg bgg| bgg= bggƼ bgg bgg bggܾ bgg bggd bggm bggX bgg bgg bgg bgg8 bggo bgg bgg bgg bgg bgg bgg bgg bggJ bgg bgg bgg bgg bgg bgg bgg bgg bggN bgg bggk ,bgg bgg bgg bgg bggg bgg bggc V  #.#  #.#  #.# .   #.# ..   #.# ...  bgg  #.# o...   #.# .....   #.####......   #...@'...... --- bgg  #..###......   #..# ...##   #..# !.#bgg   #..# ##  #..#o   orc (asleep)  #...  #.## bgg 246.4 (98.0)  You open the door.  An orc comes into view. It is wielding a +0 hand axe.bggx H .  The orc shouts!bgg 6===7.4 (99bgg bgg' _The orc moves out of view. _Found a lumpy sapphire potion.bgg bggt bggw bgg{ bgg  #.# # #.# ######## #.# ......# #.# .....# #.# ....#bgg  #.# .o.# #.# .. #.####. #....@. #..###.bgg8 #..# #...# #..# .bggv m!.# #..# +## #..# o   orc bgg bgg# ,0.0)bgg, W.obgg1 <---8.4 (1 _bggG6 bgg: Q _There is an open door here.bggJ>2 #.# #.# #######  #.# .......  #.# .......  #.# .......  #.# .......  #.# o......  #.####.......  #....@.......  #..###.......  #..# #...###  #..# .!.#  #..# +##  #..# #... #.##bgg” #.# #.# #######  #.# .......  #.# .......  #.# .......  #.# .......  #.# o......  #.####.......  #....@.......  #..###.......  #..# #...###  #..# .!.# #..# +## #..#  bggP---bggҰq _An orc is nearby!bggn2 #.# #.# #######  #.# .......  #.# .......  #.# .......  #.# .......  #.# o......  #.####.......  #....@.......  #..###.......  #..# #...###  #..# .!.#  #..# +##  #..# #... #.##bgg> #.# #.# #######  #.# .......  #.# .......  #.# .......  #.# .......  #.# o......  #.####.......  #....@.......  #..###.......  #..# #...###  #..# .!.# #..# +## #..#  bggF4bggRNbggX (((((( _An orc is nearby!bggt  You shoot a sling bullet. The sling bullet barely misses the orc.You shoot a sling bullet. The sling bullet hits the orc.bggrebgg o .....oThe orc is moderately wounded.bggq0-===9.6 (1.2Rev bggwbggy: _The orc hits you with a +0 hand axe.bgg%  You shoot a sling bullet. The sling bullet hits the orc.  Lightning courses through the orc!bggrC)bggM) ((((((You kill the orc!bgg\i.....)bgg-50.7 (1.1Rev+ bggbgg/ _You shoot a sling bullet.bggd bggEe bggqk bggFn H _No target in view!bgg_ 4bgg bggG bgg 1=Rev  _bgg bgg bgg3 bgg bgg ,bggg bgg bgg ,bgg8 bgg bgg bgg B=bgg? bgg ` #.# #.......##... #.# #.......# #... #.# #.......### ###. #.# #...#. #.####)..#. #....'..........#. #..###..........#. #..# ##...###.. bgg #. #..# #.@.# #.--- #..# ##+## #. #..# #. #... ## #.##bgg bggn -5.7 (5.0bgg G---6.7 (6bgg, bgg0 [ _u - a lumpy sapphire potionbggbgg׼bggbgg1'...bgg00'#.#..##.##.#..####bgg"bggL======7.7 (1bggxbgg= _As you open the door, it creaks loudly!bgg-I3bggJbggMbggObggPbgg_SbggV@  There is an open door here.bggXbgg1Y _bgg'Zbgg^\bgg^bgg^bgg_bgg7fXbggHgbggthbgghbgghbggibggjbgg.kbggkbgglbggmbggmbggnbggBpbggyq,bggqbggztbggSubggubggubggSzXbggzbggn{bgg{bgg|bggo}bggKbggvbgg!bggbgg<,bgg„bggcbgg BbggA@  There is an open door here.bgg^bgg _bggbggbggbggbgg̖bggbgg;bggmbggbggobggbgg"bggbggӵbggEbggAbggVbgg{bgg@bggbggWbggbgg'nbggmbggbgg bggbggbgg bggObggbgg9bggbggbggbggbggKbggvbggbgg&bggbggUbggbgg7 _You open the door.bggjbggbgg?bggbgg7bgghbggbggbggk,bgg/bggbgg\ #.......# #.......###.# #  #.......###### ###.......#.###  #............# #.......#.#. ###)...........######.......#.#. ..'............'....#.......#.#. ###............####.#.......#.#. bgg6# ##...###.....####.#.......'.#. # #...# #.###......#.......###. # ##'## #.# #..@...#.......# #.------89.7 (32.0) #####.# #.# #......#.......# ### bgg......# #.# #......######### #####.# ### #......# #####.# #........ ......#bgg-######.### ####### +# .. ... ### bgg!bggbgg?L------90.7 (33bggbgg5 _Found a runed translucent door.bgg<IbggWAbggDbggPEbgg>Ibgg JbggLbggMbggqMbggNbggSBbggTbggW,bggXbggZbgg\bgg<]bgg]bgg_bgga,bgg|bbggebggXgbgggbggUhbggLkbggm,bgg\nbggpbggs,bggRtbggvbggAybggybggzbgg|bgg=bgg",bggbggmA _The adder hisses angrily. x2bgg܎bgg\bggbggbggٕbggbggbgg3bggޜbgg,bggbggbggbggqbgg;bggڲ##'## #.# #......#.bgg@G# #..... ##.# #.# #......#.......# ### ...# #.# #......######### .# ####W#......######## ##.# ...#S#.............. bggr...# ..##S######.######## ### ...#+#........# bggv .#......#######  bggѳ####.#....@..#  ...#.#####.# bgg ### #.# #  bggk#.# #.. #.# #.##.bgg.305.7 (15bgg̻,6.7 (16bgg%bggZ _x - a smoky silvery potionbggIbggbgg_'## #.# #......#.# #. #.# #.# #......#.# ## #.# #......# bgg.# ####W#......# .# ...#S#........ # ..##S######.#  ...#+#........# .#......# ####.#.....@.# 0.0)...#.#####.# ### #.# .# #.# [.#.. ...bggGf#.# #### bgg^%bggC)+7.7 (1bgg/bgg1) _Found a chain mail.bggC bgg bggp bgg¾ bgg+ bggB Bbgg% ,bgg bgg bgg .# #.# #......######### .# ####W#......######## # ...#S#........ .# ..##S######.# # ...#+#.#  .#......#######  ####...#  ...#.#####.#  #.# #@#  #.# #[....~s~ #.. .....♣~~~#.# ######~.#.# ~##. #s   scorpion (asleep) bgg2 +9.7 (2bgg/ ,10.7 (3bgg bgg [ _A scorpion comes into view.bggM #.#         ...#+  ####  ..# #.# ### #.# #@# #.# #[....~s~  #.. .....♣~~~  #.# ######~.  #.# ~#  #. # bgg~y #.#         ...#+  ####  ..# #.# ### #.# #@# #.# #[....~s~  #.. .....♣~~~  bggaE#.# ######~. #.# ~# #. # bggO(4bgg!,bggi/_ _A scorpion is nearby!bggƙ> (((((s  You shoot a sling bullet.  The sling bullet hits the scorpion but does no damage.  Lightning courses through the scorpion!bgg ((The scorpion is severely wounded.You shoot a sling bullet.bggbgg|....s.~bggĪc===1.9 (1.2Rev bggobggc _The sling bullet closely misses the scorpion.bgg=b  You shoot a sling bullet. The sling bullet hits the scorpion.bggAd((((~bggE (((You kill the scorpion!bggOR....~~~bggU 173.1Rev+ _You shoot a sling bullet.bggYbgg\o _Your Ranged Weapons skill increases to level 7!bgg4bggbgg#H _No target in view!bgg bggS bgg bgg H _No target in view!bggbggbggbggbgg!bgg%WRev  _bgg-B  You see here a +0 chain mail.bgg80bgg0 _bgg2bgg<6bgg9,bgg:bgg<bggL?bgg?bggAbggbggbggb!bgg4bggbggbggbgg\ bgg bgg;A  You enter the shallow water.bggVWater bggN _Moving in this stuff is going to be slow.bggbggV&bggAbggbggKbggbggbggbggDbggbggbggi"bgg#bgg&$bggj$bgg7&bgg-'....#.......#.#........##.# #.. ####.#.......#.#........##.# #.. ####.#.......'.#.##.# #.. .....#.......###........##.# #.. .....#.......# #........# #.. bgg......#.......# ########## ##. .....######### #. .....##################### ................@......r--- ####.#########..######## .......# ##.♣.#.# .####### #.≈..#♣~# ### .......# #~~~~♣~... ... .#####.###.≈~≈~♣~..♣ ### r   quokka (asleep) .# #.##.♣.≈.~.≈~~.# .# #[....~.~#≈~.~~.. ..........♣~~~.~~.~~..bgg7024.7 (11.6)bgg58H---5.7 (12bgg>bgg&AY _A quokka comes into view.bgg ((((((rYou shoot a sling bullet.bgg (The sling bullet hits the quokka but does no damage.  You shoot a sling bullet.bgg bgg bgg ^....r..bgg2 g===6.8 (1.1)Rev bgg) bggz" ` _The sling bullet barely misses the quokka.bgg `  You shoot a sling bullet. The sling bullet hits the quokka!bgg S((((†bggC (((You kill the quokka!bgg `....†..bgg _7.9Rev+ bgg` bgg+ / _You shoot a sling bullet.bggYv bgg1w bgg} bggO H _No target in view!bggzbgg{bgg%|bgg8bggnbgg҅WRev  _bggbggbgg,bggbggA  You enter the shallow water.bggVWater Rev bggbggN _Moving in this stuff is going to be slow.bggFURev bgg'bggbgg#7bggbgg>bgg$0bggbggbgg,bggxbggbggI  You enter the shallow water.bgg8Water bggbggRN _Moving in this stuff is going to be slow.bggbggbggbggyBbgg{bgg,bgg]bggbgg,bggbggbgg),bggbggbgg,bggMbggvbgg,bgggbggbgg,bgg bgg[bgg,bgg:bggibggbggbgg bggUbgg,bggHbgg`bggEbggobggbggbgg,bggbggbgg,bggbggbggbgg.bggbgg"bgg,bggbggbgg8bgg,bgg)bgg<,bggbgg-bgg,bgg-bggAbgg,bggbggbgg ,bggbggbgg,bggdbggbgg,bgg\bggbgg,bggbggs bggO ,bgg bggA bgg ,bggh bgg bggr,bggbggbgg,bgg[bgg#bgg,bggxbggybggm,bggbggbggCbgg[bggbggbbggK,bggbgg/bgg,bggBbggbggbggbggebggbggM ,bgg bgg"bgg(#bgg?#bgg#bgg4$bgg%bgg2&bggv&bgg*'bgg(bgg(bgg(bgg)bgg*,bgg*bgg+bggl,,bgg,bggj-bgg.bgg.bggn/bgg0bgg12,bgg2bgg25bgg5,bgg5bgg6bggk7,bgg7bgg=9bgg9bgg:bgg1:bgg:bgg;,bgg;bgg<bgg:=,bgg|=bgg >bgg>,bggC?bgg@bggA,bgg$BbggBbggsC,bggCbggWDbggD,bggJEbggFbgg&G,bggGbggFHbggnI,bggIbgg|Jbgg-K,bgg{Kbgg*LbggL,bggMbggMbgg|N,bggNbggrPbggfR,bggRbggxTbggV,bggWbggXbgg[,bgg[bgg\bgg^,bgg=_bgg`bggya,bggabggbbgg{c,bggcbggdbgge,bggebggefbgggbgg9gbggYgbgg hbggh,bgghbggibggAj,bggjbggKkbggk,bgg8lbgglbggn,bgg~obggpbggqbgg rbggRrbggsbggu,bggubgg@wbggx,bggybggzbggv|bgg|bgg|bgg~bggF,bggbggbggƃ,bgg bggbggN,bggɇbgg&bggߊ,bggHbgg~bgg,bggpbgg"bggH....#+#  ........# #.  ........# #.  ...#######.  ..#.  #############.#h   #.#. ###  bgg #.#.####.#   #.#.@....#  ---### #.######.#  ......# #.# #.#  bgg4#####.# #.# #.#  ...##.# #.# #.#  #.###.# #.# #.#   h   hound (asleep) #.# #.#######.# #.#  bggY#.###.........######.##  .bgg.....................#  bgg}1419.1 (91.2)bggI---20.1 (92bggbggX _A hound comes into view.bgg  #.  #. #. #. bgg#h  #.#. ###  #.#.####.#  #.#.@....#  #.######.# ......# #.# #.# bggC<.# #.# #.# ...##.# #.# #.# #bggo.###.# #.# #.# #.# #. #.# #.###...## ......................# bgg=3  #.  #. #. #. #h  #.#. ###  #.#.####.#  #.#.@....#  #.######.# ......# #.# #.# .# #.# #.# bgg>...##.# #.# #.# .###.# #.# #.# .# #. #.# .###...## .....................# bggSD4bggNr _A hound is nearby!bgg$  #.  #. #. #. #h  #.#. ###  #.#.####.#  #.#.@....#  #.######.# ......# #.# #.# .# #.# #.# ...##.# #.# #.# #.###.# #.# #.# #.# #. #.# #.###...## ......................# bgg k  #.  #. #. #. #h  #.#. ###  #.#.####.#  #.#.@....#  #.######.# ......# #.# #.# .# #.# #.# ...##.# #.# #.# .###.# #.# #.# .# #. #.# .###..bgg .## .....................# bggѯ bggZ bggt bgg \ _A hound is nearby!bgg  ((h  You shoot a sling bullet. The sling bullet hits the hound.  The hound barks!bggcU (The hound is moderately wounded.You shoot a sling bullet.bggs ,bgg n..hbgg4 |====1.1 (1.0)Rev bgg bggf ` _The sling bullet closely misses the hound.bgg, y  You shoot a sling bullet.  The sling bullet hits the hound but does no damage.bgg.  The hound is moderately wounded.You shoot a sling bullet. The sling bullet hits the hound.bggK@ o  The hound is moderately wounded.bgg@ ===-2Rev+ bgg,F bggH R _The hound barely misses you.bgg3y (You shoot a sling bullet.bgg  The sling bullet closely misses the hound.You shoot a sling bullet. The sling bullet hits the hound.bggu hThe hound is heavily wounded.bgg@-3bggbgg{ _The hound closely misses you. The hound bites you but does no damage.bgghy (You shoot a sling bullet.bggu  The sling bullet closely misses the hound.You shoot a sling bullet. The sling bullet hits the hound.bgglj hThe hound is severely wounded.bggmbgg"o[0-4.2 (1.1bggo?Rev* bggtbgg{x bgg y_The hound bites you.bggEy  You shoot a sling bullet.  The sling bullet hits the hound but does no damage.bgg  The hound is severely wounded.You shoot a sling bullet. The sling bullet hits the hound.bggg.  The hound is severely wounded.1=5.3 _The hound barely misses you. x2bgg y (You shoot a sling bullet.bggj  The sling bullet barely misses the hound.You shoot a sling bullet.bgg hThe sling bullet closely misses the hound.bgg\59-6.5 (1.2bggbggqR _The hound bites you but does no damage. The hound bites you.bgg y (You shoot a sling bullet.bgg<  The sling bullet barely misses the hound.You shoot a sling bullet.bgg hThe sling bullet barely misses the hound.bgg= e6--70bgg bgg * _The hound bites you.bggEs y (You shoot a sling bullet.bgg  The sling bullet barely misses the hound.You shoot a sling bullet.bgg hThe sling bullet closely misses the hound.bgg9f4--8.6 (1.1bggbgg- _The hound bites you. x2bgg  You shoot a sling bullet. The sling bullet hits the hound.  Lightning courses through the hound!!bgg[.bggs (You kill the hound!bggJ&.bggK-219.7bggebgg/ _You shoot a sling bullet.bggjbggbggpbggH _No target in view!bgg&bgg'4bgg?*bgg*% _bgg.h5bggH/bggv/bgg/bgg+1bgg1:Rev+ bgg1bgg2bgg3#6bggO3)=bgg3bgg4bgg4bgg'5bggI6bggs6bgg6bggA8bgg"9@7=bggd97Rev bgg9bgg:bgg;bggo;bgg<bgg<bggj=bgg>bgg>bgg>bggK@bgg@.8bgg@bggbgg?,bgg@bgg"BbggC,bggDbggFbggG,bggBHbgg QbggR,bggSbggUbggVbggWbgg\WbggXbggZ,bggL[bgg\bgg,^,bgg^bgg2`bgg\b,bggtcbggTdbgge,bggfbggnbggJpbggpbgg&qbggsbggubgg7ubggubgg\xbggy,bggbzbggn|bgg~,bgg~bgg!bgg,bgg~bgg?b  You see here a quokka corpse.bgg=bgg _bggbggkbgg,bggbggbggc,bggbggibgg,bggbgg bggbggݚbgg]bggZbgg",bgg,bggbgg,bggWbgg"bgg,bggժbggbgg,bggbggobggI  You enter the shallow water.bgg߶8Water bggbggSN _Moving in this stuff is going to be slow.bggp<bggľbggbgg:0bggbggxbgg,bggbggbgg,bggSbggbggbggbgg(bggbgg%,bggbggbgggA  You enter the shallow water.bgg@Water bggbggN _Moving in this stuff is going to be slow.bgg"bgg^bggbgg|bggA  You enter the shallow water.bgg@Water bgg@bgg  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.bgg/4bggbggbggbgg!bgg bgg bggr0bggXbggbggbgg,bggbggbgg<,bggbggbgg,bggFbgg> bggO",bggU#bggM%bggy(,bgg)bgg+bgg.,bgg30bgg2bgg4,bgg5bgg9bgg;,bgg->bggG@bggB,bggCbggEbgglHbggHbggIbggLbggbPbggQbggS,bggUbggZ _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _The adder hisses angrily.bggea  Demonprawn's ghost turns its malevolent gaze towards you.bggcbgg7g3bggSibggm< _You hear an angry hiss.bggp3bggqqbggqvbgg){,bgg:|bgg bggnbggbggbggɋbgg*bggpbggbggLbggbggbggrbggƒbgg,bggbgg`bgg,bggbggdbgg~,bgg+bggɵbgg0,bggbggz _Demonprawn's ghost shrieks, "Very impressive. But it won't help. Nothing will."bggbggWbggbgg\bgg ,bggbggbggw,bggfbggbgg,bggbgg bggR ,bgg bggG bgg, ,bgg@ bgg" bgg' ,bgg( bggl- bgg0 ,bgg32 bgg7 bggc9 ,bgg: bggB bggpE ,bggF bggM bggO ,bgg+Q bgg X bgg4Z ,bgg[ bggb bggd ,bgg%f bggnl bggn ,bggcp bggw bggLz ,bgg{ bgg bgg ,bgg bggޑ i #.# #........  #.# ##########.......#  #.# #.......##.......#  #.# #.......##.......#  #.# #.......##.......# bgg=  #.# #.......###### ###......#.# #............# #......#.####)...........######......#....'.......@....'....#......---571.1 (141.4)  #..###............####.#...... bggp  #..# ##...###.....####.#......  #..# #...# #.###......#...... bgg  #..# ##'## #.# #......#...... bgg0 d #..#####.# #.#:#......#......  #........# #.#~#......#######  #.######.######S#......#######  ##.######.##...#S#.............bgg :---bggɘ bgg. T _Key pressed, stopping explore.bggp Ibgg bgg1 bgg : _bgg bgg ,bgg bgg bgg ,bggj bgg9 bgg ,bggQ bgg\ bgg ,bggk bggF bgg ,bgg) bgg bgg bggK bgg} bgg bgg$ ,bggV bggG @  There is an open door here.bgg bgg  _bgg bgg bgg ,bgg bggI bgg7 ,bggP bgg" bgg$ ,bgg% bgg( bggV* ,bgg, bgg/ bgg1 ,bgg3 bgg!6 bgg=8 ,bgg9 bgg,= bgg? ,bgg-@ bggC bgg$E ,bgg?F bgg7I bggJ bgg6K bggK bggLO bggP ,bggQ bggT bggBU ,bggU bgg X bgg?Y ,bggY bgg3\ bggP] ,bgg] bgg` bgg\a ,bgga bggCd bggGe bgge bggf bgg"h bggri ,bggi bggl bggtm ,bggm bggp bggWq ,bggq bggs bgg*u ,bggu bggw bggdy ,bggy bgg{ bgg} ,bggi~ bgg bgg] ,bgg bgg bggU ,bgg bgg bgg ,bgg bgg @  There is an open door here.bggѐ bggS  _bgg bgg bgg ,bggR bgg8 bgg ,bgg bgg bgg ,bgg bgg bggd ,bgg& bggޥ bgg ,bgg bggҩ bgg ,bgg2 bgg bgg ,bggR bgg bggݳ ,bgg bgg& bggo bgg bggL bgg? bggc bgg bgg\ bgg bggm ,bgg bgg6 bgg ,bgg0 bggb bgg ,bggn bggv bgg ,bggm bgg bgg ,bgg bgg* bgg ,bgg bgg bgg bgg bgg bgg bgg ,bggU bggy bgg bgg bggP bgg bgg^ ,bgg bggC bgg bggM bggv bgg bgg ,bgg bgg bgg ,bggi bgg bgg ,bgg bgg( bgg+ ,bgg bggH bggl ,bgg bgg @  There is an open door here.bgg bggi  _bgg= bgg% bgg-( ,bgg) bgg/ bgg1 bgg1 bgg2 bgg~9 bgg+; bggp; bgg< bgg&B bggC bggD bggD bgghJ bgg6L bgg`L bgg!M bggR bggT bggT bggU bgg6^ R  There is a stone staircase leading down here.bgg^ bgg{_  _bgg_ bgg|e bggg ,bggh bggm bggo ,bgg=p bgg u bggv bggv bggiw bgg{ bgg} ,bgg~ bgg bgg ,bgg bgg bgg5 ,bgg4 bggX bgg ,bgg bgg bgg ,bgg: bggѝ bgg bgg bgg^ bgg/ @  There is an open door here.bgg2 bgg  _bgg` bggֲ Xbgg bgg ,bggw bggr bgg3 ,bgg bgg bgg0 ,bgg bgg bggE ,bgg bgg bgg bgg ,bggy bgg Bbgg bgg bgg bgg' bggN bgg Bbgg% bgg bgg bgga bgg bgg bggp bgg bgg" bggt bgg\ bgg bgg bgg bggt ,bgg bgg bggA Bbgg bgg bgg: bgg bgg bggu bgg bgge bgg bgg bgg bgg bgg bgg bgg bggY bgg bgg bgg8 bgg bgg bgg} bgg bgg bggY bgg$ bgg^ bggF bgg bgg! ,bgg" bgg' @  There is an open door here.bgg) bggD*  _bgg8+ bggL. bgg0 ,bgg2 bggi5 bgg*8 bgg_8 bgg9 bgg< bgg@? bggw? bgg@ bgg6E bggG ,bgg5I bggL bgg,bgg?bggSBbggE,bggHbggKbggL,bggwMbggTObggPbggQbggQbggmSbggOU,bggVbggXbgg],bgg^bggcbggWhbgg2ibgg`ibggljbggpbggubgghvbggy,bgg{bggS#..# #...# #.###......#.......## #..# ##'## #.#~#......#.......# bggS]#..#####.# #.#:#......#.......# #..# #.#~#......## #.######.######S#...... #.######.##...#S#...............bggx..##..##W######.##.bggo##...#+#........# ##.♣ #.#...@..####### #.≈..#740.3 (45.2bggÈ) #.####.#.......# #~~~~♣bgg #......#.#####.###.≈~≈ ########.# #.##.♣.≈.~bgg #.#####[....~.~# #bgg`..♣~~~. W   Demonprawn's ghost #.##~.#.. SS 2 adders (1 wandering) #.# #.~#~.bggn #.# ##~#bggzbgg4bggbgg[gIbgg ~..................0.0)bggbggH] _Could not explore, unopened runed door.cggcggsdA book of the Dragon. A magical book of spells which allow some command over dragons and their aspects. Stash search prefixes: {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - Cause FearHexescggԋ4 no  b - FireballConjuration/Fire 5 no  c - Dragon's CallSummoning9 no Select a spell, or (g)o to location.cggcggA]#..# #...# #.###......#.......## SunshineJesse the Shooter #..# ##'## #.#~#......#.......# Coglin #..#####.# #.#:#......#.......# Health: 61/61 ======================== #........# #.#~#......######### Magic: 8/8======================== #.######.######S#......########## AC: 5Str: 12 #.######.##...#S#................ EV: 13Int: 9 .........##..##W######.#########. SH: 0Dex: 19 cgg ###########...#+#........# ##.♣.# XL:  8 Next: 21% Place: Dungeon:5#.#...@..####### #.≈..# Noise: ---------  Time: 4740.3 (0.0)#.####.#.......# #~~~~♣ a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~#.#####[....~.~##..........♣~~~. W   Demonprawn's ghost#.#########~.#.. SS 2 adders (1 wandering)#.##.~#~.#.###~#~. _Demonprawn's ghost turns its malevolent gaze towards you.You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Could not explore, unopened runecggid door.cggcgg cggcgg& #..# #...# #.###......#.  #..# ##'## #.#~#......#.#  #..#####.# #.#:#......#.#  #.# #.#~#......#  #.######.######S#...... ##.######.##...#S#. #.##..##W######.###...#+#.# ##.♣. #.#..@...####### #.≈.. #.####.#.# #~~~~ #......#.#####.###.≈~≈ ########.# #.##.♣.≈. #.#####[....~.~[4cggB'0m #.♣~~~ #.#~.# #.# #.~#~ #.# ##~#~cgg2cgg221.3 (1 _cgg+;cgg=cggAP#..# #...# #.###......#.# #..# ##'## #.#~#......#.# cggz#..#####.# #.#:#......#.# #.# #.#~#......# #.######.######S#......# #.######.##...#S#.. .##..##W######.#.#...#+#.cgg2# ##.♣.##.#...@..####### #.≈..##.####.#.# #~~~~♣#......#.#####.###.≈~≈~cggH########.# #.##.♣.≈.~#.#####[....~.~##.♣~~~.#.#~.#.#.# #.~#~.#.# ##~#~.cggcgg&2cggcggcgg3l R..# #...# #.###......#.# ..# ##'## #.#~#......#.# # ..#####.# #.#:#......#.# # .# #.#~#......# .######.######S#......# .######.##...#S#..##..##W######.#.#...#+#.# ##.♣.#.cggl #.#....@.####### #.≈..#♣#.####.#.# #~~~~♣~#......#.#####.###.≈~≈~♣########.# #.##.♣.≈.~.#.#####[....~.~#≈#..♣~~~.~#.#~.#..~#.# #.~#~.~#.# ##~#~.~cggw cggw &3cgg cgg' cgg# #...# #.###......#.###. .# ##'## #.#~#......#.# #. .#####.# #.#:#......#.# ## #.#~#......# cgg######.######S#......# ######.##...#S#.##..##W######.#..#...#+#.# ##.♣.#.##.#.....@####### #.≈..#♣~#.####.#.# #~~~~♣~.#......#.#####.###.≈~≈~♣~cggD;########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~#...♣~~~.~#.##~.#..~##.# #.~#~.~##.# ##~#~.~.cgg&cggD'&4cgg/cgg1cgg cgg:!cggG+cgg-cgg 9 cgg); Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls of teleportation cgg;  h - 2 scrolls of poisoni - a scroll of brand weapon  m - a scroll labelled ANUYPIZXOPSU  t - a scroll of vulnerability  v - 2 scrolls of immolation [!] read|quaff|evoke[?] describe selectedcgg5 cgg; c.# #...# #.###......#.......###. SunshineJesse the Shooter .# ##'## #.#~#......#.......# #. Coglin .#####.# #.#:#......#.......# ## Health: 61/61 ======================== .......# #.#~#......#########Magic: 8/8======================== ######.######S#......############ AC: 5Str: 12 ######.##...#S#.................. EV: 13Int: 9 cggY< .......##..##W######.#########..# SH: 0Dex: 19 #########...#+#........# ##.♣.#.# XL:  8 Next: 21% Place: Dungeon:5#.#.....@####### #.≈..#♣~ Noise: ---------  Time: 4744.3 (0.0)#.####.#.......# #~~~~♣~. a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~♣~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~#..........♣~~~.~~ W   Demonprawn's ghost#.#########~.#..~#[3cgg< 7m SS 2 adders (1 wandering)#.##.~#~.~##.###~#~.~. _Demonprawn's ghost turns its malevolent gaze towards you.You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Could not explore, unopened runed door.cgg|B P  Okay, then.cgg C cggnH cggJ . _cggX[?25h[?0c  Search for what [? for help]? cggJ[?25l[?1ccgg$cgg&14 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=]  a - [D:5] a runed translucent doorb - [D:5] a +0 chain mail  c - [D:5] a book of the Dragon  d - [D:5] a +0 hand axe  e - [D:5] a +0 club  f - [D:5] a +0 dagger (3 further duplicates)  g - [D:5] a +0 ring mail  cggnh - [D:5] a +0 robe (1 further duplicate)  i - [D:5] 3 stones (3 further duplicates in 1 pile)  j - [D:5] a +0 flail  k - [D:5] a +0 leather armour  l - [D:5] a +0 war axe (1 further duplicate)  m - [D:5] a glaive  cgg׹n - [D:5] a hand axecggl*cgg0cgg:.# #...# #.###......#.......###. SunshineJesse the Shooter .# ##'## #.#~#......#.......# #. Coglin .#####.# #.#:#......#.......# ## Health: 61/61 ======================== .......# #.#~#......#########Magic: 8/8======================== ######.######S#......############ AC: 5Str: 12 ######.##...#S#.................. EV: 13Int: 9 .......##..##W######.#########..# SH: 0Dex: 19 #########...#+#........# ##.♣.#.# XL:  8 Next: 21% Place: Dungeon:5#.#.....[4cgg;I7m@####### #.≈..#♣~ Noise: ---------  Time: 4744.3 (0.0)#.####.#.......# #~~~~♣~. a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~♣~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~#..........♣~~~.~~ W   Demonprawn's ghost#.#########~.#..~# SS 2 adders (1 wandering)#.##.~#~.~##.###~#~.~. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Could not explore, unopened runed door. _Okay, then.Search for what [? for help]? .cggCcggYDcggLcggO. _cggxr [[?25h[?0c  Search for what [Enter for "."]?  cgg#* [?25l[?1c cggE  cgg8G =1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=]  a - [D:1] the +0 pair of boots "Nydag" {Harm rPois Will-} (115 gold) cggD cggvM cggLW.# #...# #.###......#.......###. SunshineJesse the Shooter .# ##'## #.#~#......#.......# #. Coglin .#####.# #.#:#......#.......# ## Health: 61/61 ======================== .......# #.#~#......#########Magic: 8/8======================== ######.######S#......############ AC: 5Str: 12 ######.##...#S#.................. EV: 13Int: 9 .......##..##W######.#########..# SH: 0Dex: 19 #########...#+#........# ##.♣.#.# XL:  8 Next: 21% Place: Dungeon:5#.#.....[4 cggXy7m@####### #.≈..#♣~ Noise: ---------  Time: 4744.3 (0.0)#.####.#.......# #~~~~♣~. a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~♣~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~#..........♣~~~.~~ W   Demonprawn's ghost#.#########~.#..~# SS 2 adders (1 wandering)#.##.~#~.~##.###~#~.~.You enter the shallow water. _Moving in this stuff is going to be slow. _Could not explore, unopened runed door. _Okay, then. _Search for what [? for help]? .  Search for what [Enter for "."]? boot cgg` cgg` cggh cggj. _ cgg\ _Unknown command. cggSh cgg$k}Equip which item?  - - Unarmed Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun}  cggk/Armour (go to first with [)  b - a +0 leather armour (worn)  k - a +0 helmet (worn)  w - a +0 cloak (worn)[?] describe selected [!] equip|wield|wear[tab] equip|unequip cggX  cgg.# #...# #.###......#.......###. SunshineJesse the Shooter .# ##'## #.#~#......#.......# #. Coglin .#####.# #.#:#......#.......# ## Health: 61/61 ========================  cgg.......# #.#~#......#########Magic: 8/8======================== ######.######S#......############ AC: 5Str: 12 ######.##...#S#.................. EV: 13Int: 9 .......##..##W######.#########..# SH: 0Dex: 19 #########...#+#........# ##.♣.#.# XL:  8 Next: 21% Place: Dungeon:5 cgg#.#.....@####### #.≈..#♣~ Noise: ---------  Time: 4744.3 (0.0)#.####.#.......# #~~~~♣~. a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~♣~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~#..........♣~~~.~~ W   Demonprawn's ghost#.#########~.#..~# SS 2 adders (1 wandering)#.##.~#~.~##.###~#~.~. _Moving in this stuff is going to be slow.  cgg&+_Could not explore, unopened runed door. _Okay, then. _Search for what [? for help]? . _Search for what [Enter for "."]? boot _Unknown command. cggP  Okay, then. cgg cggD _ cgg m[?25h[?0c  Search for what [Enter for "boot", or ? for help]?  cggu [?25l[?1c cgga glove cgg  cgg0  cgg2 X _Can't find anything matching that.cgg2(cgg(Where to? (Tab - Sewer @ (x,y), ? - help)  D - Dungeon cgg[ cgg% [?25h[?0ccgg& I.# #...# #.###......#.......###. SunshineJesse the Shooter .# ##'## #.#~#......#.......# #. Coglin .#####.# #.#:#......#.......# ## Health: 61/61 ======================== .......# #.#~#......#########Magic: 8/8cgg' 8======================== ######.######S#......############ AC: 5Str: 12 ######.##...#S#.................. EV: 13Int: 9 .......##..##W######.#########..# SH: 0Dex: 19 cgg=' W#########...#+#........# ##.♣.#.# XL:  8 Next: 21% Place: Dungeon:5#.#.....@####### #.≈..#♣~ Noise: ---------  Time: 4744.3 (0.0)cgg' C#.####.#.......# #~~~~♣~. a) +2 sling {Septima j) +0 sling (elec) {#......#.#####.###.≈~≈~♣~ Fire: a) +2 sling {Septima} ########.# #.##.♣.≈.~.≈#.#####[....~.~#≈~cgg3( '#..........♣~~~.~~ W   Demonprawn's ghost#.#########~.#..~# SS 2 adders (1 wandering)#.##.~#~.~##.###~#~.~. _Search for what [Enter for "."]? boot _Unknown command. _Okay, then.Search for what [Enter for "boot", or ? for help]? glove _Can't find anything matching that.  cggp( QWhat level of the Dungeon? (default 1, ? - help) cgge [?25l[?1ccggl46cggKocggqcggcgg/ _cggecgg?cggR,cggcggpcggg,cggcggcgg,cggĮcgg(ncggP,cgglcggcgg*,cggcggcggNBcgg]cggcggcggcggcggccggcgg|cggcggfcggcggcggcgggcggcggcgg cgg]cggcgg2cgg/cggcggUcggcggcggpcgg[cgg,cggcggEcgg ,cgg;!cgg$cgg%,cggs&cggk)cgg+,cgg+cggE/cggL0,cgg0cgg7Unknown command. _Okay, then.  Search for what [Enter for "boot", or ? for help]? glove _Can't find anything matching that.  You see here a quokka skeleton. _cgg8cgg9cgg2;cggf;cgg;cggY@cgg@cggAcggeAcgg/CcggDcggDcgg EcggFcggHcggaHcggHcggcJcggLKcgg}KcggKcggTMcggNcggO,cggOcggP,cggPcggQcggMRcggxRcggRcggWScggT,cgg_TcggUcggUcggUcgg"VcggVcgg^WcggWcggWcggMXcggXcgg YcggiYcggYcggZ,cggZcggi[cggm],cgg]cgg\_cgg`,cggZacggccggecggecgggcgghcggNjcggjcgg$kcgglcggocgg8ocggpcggqcggscgg@scggscggtuY  There is a stone staircase leading down here.cggvcgg|wcgg x$ _cggxcgg\;6cgg&,cggcgg-K _You see here a quokka skeleton. _There is a stone staircase leading down here. _You climb downwards.  Found 21 gold pieces and a scroll of poison.  Found a stone staircase leading up.  upcggUcgg .. $### .#.  .. ... ...  .$ ... ....  .##.. ....#  .#.##....#  ..#......  #.  #@....... 87.1 (42.8) #.......##....  #......#.# .  ...#..# h...5... .#..#### ....cggWsh   hound (asleep). ## ..5   shadow imp (asleep) ?<. cggcggcgg d _There are monsters nearby!cgg) ((h  cgg7*You shoot a sling bullet. The sling bullet hits the hound.  The hound barks!cgg. (The hound is moderately wounded.You shoot a sling bullet.cggq8 o  The sling bullet closely misses the hound.cgg9 cggUB .h..55wandering)cgg |====8.2 (1.1)Rev cgg- cggʢ ' _You hear a shout!cggkAcggBcggcgg F _Unknown command.cggި (5  cgg_pYou shoot a sling bullet.  The shadow imp shouts!  The sling bullet hits the hound but does no damage.cggA. ((The hound is moderately wounded.You shoot a sling bullet.cggܿ  The sling bullet barely misses the hound.  --more--cgg4@ 6 hear a shout!cggI :h.cgg'J `.5.# ...cggJ a===-90cggK 7Rev+ cggU cggV J _The hound barely misses you.cgg8Z X(You shoot a sling bullet.cgg yThe sling bullet closely misses the hound.You shoot a sling bullet.cggmo aThe sling bullet closely misses the hound.cgg1p hcggp 5cggp .cggq cgg$r -cggSr '90.3 (1.1cggx cgg,{  cgg{ cgg;| '_The hound misses you.cggj| cggq cggZ cgg cgg  cggL cgg "_Unknown command.cgg cggz (You shoot a sling bullet.cggb  The sling bullet closely misses the hound.You shoot a sling bullet. The sling bullet hits the hound.cggtl  The hound is heavily wounded.cggW5h.cgg+#0cgg\r-1.4Rev* cggcggR _The hound bites you. The hound bites you but does no damage.cgg4cggcggS"F _Unknown command.cggyz (You shoot a sling bullet.cgg"7  The sling bullet closely misses the hound.You shoot a sling bullet.cgg hThe sling bullet barely misses the hound.The hound barely misses you.cggA8*cggbn  The shadow imp gestures at you.cgg78@cgg`8E47------cgg8&2.6 (1.2cgg?cggG@cgguI/  --more--cggJNG _Pain shoots through your body! The hound bites you.cggX(You shoot a sling bullet.cgg/The sling bullet closely misses the hound.You shoot a sling bullet.  The sling bullet hits the hound but does no damage.cggdWhThe hound is heavily wounded.cgg:_6-----3.7 (1.1cggcggrk _The hound barely misses you. The shadow imp hits you.cggcggycggcgg cggW@_Unknown command.cggKqcggqcggycgg|F _Unknown command.cgg>_  You shoot a sling bullet. The sling bullet hits the hound.cggdG  The hound is heavily wounded.You shoot a sling bullet. The sling bullet hits the hound!cggL †5   shadow impcgg X  You kill the hound!cgg = 7/62244cggs R0 _The shadow imp closely misses you.cgg cgg  cggU [_Your Fighting skill increases to level 5!cggF?  You shoot a sling bullet. The sling bullet hits the shadow imp.cgg ^ _Your Fighting skill increases to level 5!shadow imp.  The shadow imp is heavily wounded.  You shoot a sling bullet.  The sling bullet hits the shadow imp but does no damage.  Lightning courses through the shadow imp!!cgg D.cggW '.cgg[ 6855cggSa cgged N _You kill the shadow imp!cggv cggw cgg,} cgg 0 _Unknown command.cgg cggU*4cggK+cgg.H _No target in view!cggMcggOcggZ\ _Unknown command.cgg]cggcggcgg H _No target in view!cggcggcggcgg cgg8_Unknown command.cgg^4cggcggcgg; _cgg\cggcggcgg<9cgg\cggcgg$Rev+ cggcggcgg%,cggcggNcggcggcggcggSf50=Rev cgg cgg,cggcgg^,cggcggcgg#1cgg3=cggcggcgg6!cggcgg 0cgg8 cggcggK2=cggcggcggcggcggcgg&cggcgg,cggK!cgg$cgg|$U3=cgg!&cgg4BcggZ7cgg7cgg8cgg;cggb;%4cgg/<cgg>cgg>cggk?cggAcggAcggBcggEcgg@F55=cggtFcgg}GcggIcggIcggeJcgg]L,cgg!McggOcggOcgg!QcggTcgg#U#6cggPU2=cggVcggZ,cgg8[cgg]cgg]cgg_cggacgg(b#7cggSb(=cggccggg,cggvhcgg  The ufetubus is heavily wounded.You shoot a sling bullet. The sling bullet hits the ufetubus.cggcggʏcggI5...cgg e1=9.5 (1.2cggcgga _The ufetubus is severely wounded.cgg?  You shoot a sling bullet. The sling bullet hits the ufetubus.cgg; (The ufetubus is almost dead.You shoot a sling bullet.cggU 5The sling bullet completely misses the ufetubus.The ufetubus hits you but does no damage.40.7cgg[cgg^V _The ufetubus closely misses you.cggz (You shoot a sling bullet.cggZj  The sling bullet closely misses the ufetubus.You shoot a sling bullet. The sling bullet hits the ufetubus!cggxo)cggt†2=71.8 (1.1cggcggsL _You kill the ufetubus!cggccggdcggVecggShcggp78 M... ). ... $### .#.... .... .....$ ... .........##.. .....#.##....##...#0.0 #<... #.....†.##...#......#.# ......#..# .. .....cggq7....cgg&{cgg5---2.8 (1cggecgg$ _Found a spear.cgg 4cgg cgg cgg cgg cgg cgg cgg . ... .... ). ...#. .$###...#.. .....>...$ ...............##.......#.......#.##....##.@.#......---3#.#..cgg F #..#<....... #.....†.##.... #......#.# .......#..# .. ......... .#. ....#### ...## .cgg# cgg +4.8 (2cgg= cgg& ; _Found a stone staircase leading down.cggecggecgg"p,cggt=Rev+ cggcgg}VRev  _You now have 413 gold pieces (gained 10).cggNMcgg _You now have 424 gold pieces (gained 11).cgg cggxcgg(#..........##.....# #.##......)..#....#.##..  #.........###...#.....  cggf#.............>.....#  #.......#............ ?  #.......##.......## ...  #........#.##....##....  ......##...#...........  .##... #.#.....@...#.. 57.8 (13.0)##..#..#<.......## ##.....†.##....... #......#.#..............#..##......................#.#.......$...#### .............. #####.....!... ?<.cggB8.8 (14cgg#cgg'_ _Found a potion of degeneration.cggq3cgg'tcggwcgg{cggzBcgg0,cggcgg·cggG{#.##.##..# ...##.....# #. ......)..#....#.##.. # ..###...#..... .. ......>.....## ... ......#............#? ......##.......##......= ..##....## ....##...#......@.......60.8 (2.0) #... #.#.........#...... cgg*V##..#..#<.......## .....  ##.....†.##....... ###......#.#.......... ....#..##............ ..........#.#.......$ ...#### .............  . #####.....!...cggXcgg+1.8 (3cggcgg_I _Found a steel ring.cggh. .# ... ##.##..# ..##.....# #. )..#....#.##.. #####...#..... .....>.....## .#............#?....##.......##......=..#.##....##0 ...##...#......... ... #.#.... #..#..#<.......##..... #†.##.......###.. #......#.#.......... ..#..##............ <......#.#.......$ ..#### ........cggi[39;49mcggtcgg*z+2.8 (1cgg{cgg~9 _Found a stone staircase leading up.cggcggcggcggcgg>##..##... ..  .#.... ##.##..# ..##.....# #. )..#....#.##.. #####...#..... cgg.....>.....## ....>#............#?....##.......##.@....=..#.##....####...#......... cgg.. #.#.........#. ..#..#<.......##.....†.##.......###..cggrc   centaur (asleep)cggc...#.#.......... ....#..##............ .<c......#.#$cggr 0  A centaur comes into view.cgg+3.8 (1cgg@cgg; _Found a stone staircase leading down.cgga .. .#....#..#.....# #.)..#....#.##.. ##. ...#..... .... .>.....## ....> ........#?..... #.@....=.. #......... ...........  ....#........ <.......##........ cggzb†.##.......###.... .......... .... .......... .<c $cggS .. .#....#..#.....# #.)..#....#.##.. ##. ...#..... .... .>.....## ....> ........#?..... #.@....=.. #......... ...........  ....#........<.......##........†.##.......###.... .......... .............. .<$cgg4cggcgg^ _A centaur is nearby!cggα G (((((c  (You shoot a sling bullet. The sling bullet hits the centaur.  The centaur shouts!cgg8 (The centaur is moderately wounded.You shoot a sling bullet.cggP cggU cgg k....c..cgg c===4.9 (1.1Rev cgg cgg a _The sling bullet barely misses the centaur.cgg0 ((((You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.cgg (((The centaur is moderately wounded.You shoot a sling bullet.cgg  ...c.(launcher)..  The sling bullet barely misses the centaur. (((((((The centaur wields a +0 shortbow. The centaur shoots an arrow.cgg9g...@...cgg:_6.0Rev+ cggEcgg^Fcgg0R/  --more--cggL _The arrow misses you.cgg(((You shoot a sling bullet. The sling bullet hits the centaur.cgg3\ The centaur is moderately wounded.You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.  Lightning courses through the centaur!!cgg.b D)cgg 3...cgg 1367.1cggw cgg K _You kill the centaur!cggp cggQq cggJ| cgg\ H _No target in view!cgg'IcggJcggBRcgg\H _No target in view!cggcggp _cggRev cgg cggx _g - 3 scrolls of teleportation (gained 1)cgg4cgg3cggcgg"Bcgg(cgg*,cgg+cgg/cgg*2cggI3!cgg~4cgg8cgg=0cgg9AcggbEcggI,cggpMcggPcggScggATcgg#......#.## ..... cgg [ .  cgg; b#<.......##....)...##  .†.##.......###  #.#...........  ##............#..<.. cgg՜  ...#.#........##....   ..............  . #####.....!....  #.?<@.........##  ................##  .........#.........  cgg\ .?.......##.... .f............. .#...#......#....##  #.........##.. cgg #......#.##  cggɴ cggV cgg cggN _ _A sleepcap is nearby!cgg} (((((You shoot a sling bullet.cgg, |  The sling bullet hits the sleepcap but does no damage.  You shoot a sling bullet.cgg cggR d...f..cgg g===7.3 (1.2)Rev cgg cgg L _The sling bullet hits the sleepcap but does no damage.cgg2 ((((You shoot a sling bullet.cgg  The sling bullet hits the sleepcap but does no damage.  You shoot a sling bullet. The sling bullet hits the sleepcap.cggs?cggJ\.....fcggJ,80cggVL _The sleepcap is lightly damaged.cgg[ (((You shoot a sling bullet.  The sling bullet hits the sleepcap but does no damage.cgg  The sleepcap is lightly damaged.  You shoot a sling bullet. The sling bullet hits the sleepcap.cggBicggrY..f.cgg~sd9.4 (1.1Rev+ cgg{cggBc _The sleepcap is moderately damaged.cggۀ ((You shoot a sling bullet.  The sling bullet hits the sleepcap but does no damage.cgg   The sleepcap is moderately damaged.You shoot a sling bullet. The sling bullet hits the sleepcap.cgg2cggCf..cggPh90.5Rev* cggإcgg` _The sleepcap is heavily damaged.cggZ (You shoot a sling bullet.  The sling bullet hits the sleepcap but does no damage.cgg ((((((The sleepcap is heavily damaged.You shoot a sling bullet.cggecggrf....?..1.6cgguzcgg|f _The sling bullet completely misses the sleepcap.cggV { (((You shoot a sling bullet.cggr  The sling bullet completely misses the sleepcap.You shoot a sling bullet. The sling bullet hits the sleepcap!cggn .?fThe sleepcap is almost destroyed.cggpo -2.8 (1.2cggt cggv V _The sleepcap closely misses you.cgg b  You shoot a sling bullet. The sling bullet hits the sleepcap!cgg" C<cggD (((You destroy the sleepcap!cgg2 R.?<cgg6 593.9 (1.1cgg> cggA / _You shoot a sling bullet.cggcggcggcgg]H _No target in view!cggcgg3cgg cggcggcgg; _cgg%  cgg+There is a stone staircase leading up here.cggcggM _cgg cggcgg $Rev+ cggGcgg_cggg _h - 3 scrolls of poison (gained 1)cggcggcggcgg cggO cgg cggcggcgg} #......#.#........ ....#..##............#..<. ..........#.#........##... ...#### ..........cgg ..# #####.....!.......# ...######..<..........## ......## ..............#...............?@......##........---8.9 (5.0cgg_.......##...##....##.....#.........##..... #......#.## .....cgg*##### ....##.#.. ..... ...cggNC ..)... ..cggcggG---9.9 (6cgg#cgg#' _Found a falchion.cgg cggC cgg cggTcgg  #......#.# ....#..##......#..< cgg.#.#.## ...#### .... ..# #####.....!.#...######..<...##.......#.@.......##0.(......#...#......#.....#.........##.......#......#.## .....##....##.#.. ..... ...cgg ..)... ..cgg2)r900.9 (1Rev cgg-cgg64 _Found 6 stones.cgg6+1.9 (2cgg<cgg^?d _y - a scroll labelled QUPNOI HOPHEPTcggB 4cgg= cgg% cgg}( cgg( cgg, cgg- cggE/ ,cgg0 cgg2 cgg4 7cgg=6 cgg8 cgg: 0cgg; cgg~= cgg? ,cgg4@ cggE cgg^H ,cggI cggL cggU  ...####.....†.## .....#......#.#........ .$.......#..##........ ...............#.#cggV ......#### ............### #####.....!.##...######..<.....###.........................##.## ##.............. ##.(......#...#. #........#.........# #........#......#.## F   marrowcuda (dormant)cggW C.########....##.#...F ..... .....)... ..cgg[ +7.9 (6cggc gFF.cggOd +8.9 (7cggl cggp ] _A marrowcuda comes into view.cgg [ † .....#.. .$....... cgg ......... ........####  ........###  .....##...######..< .###........... .......@....... ..#............ cggc J##........... ##.(......#. #........# cgg #........# F########..  .. ..... ...  ..)... .. cgg cgg0y † .....#.. .$....... ......... ........####  ........###  .....##...######..< .###........... .......@....... ..#............ ##........... ##.(......#. #........# #........# F########.. .. ..... cggya ..)... cgggcggcggcggea _A marrowcuda is nearby!cgg (((((You shoot a sling bullet.cgg_ _A marrowcuda is nearby!  You shoot a sling bullet.  The sling bullet hits the marrowcuda but does no damage.  You shoot a sling bullet.  The sling bullet hits the marrowcuda but does no damage.  Lightning courses through the marrowcuda!!cggcgg0?..(cggX.F.cgg,a===9.9 (1Rev cgg߬cgg(c _The marrowcuda is severely damaged.cgg (((( You shoot a sling bullet. The sling bullet hits the marrowcuda.cggf  The marrowcuda is almost destroyed.You shoot a sling bullet. The sling bullet hits the marrowcuda.cgg)D.cggVe..(..cggTn4611.0 (1.1Rev+ cgge$cgg&Q _You destroy the marrowcuda!cggcggQcggcggH _No target in view!cgg? cgg cggЩ cggҬ H _No target in view!cgga cgg cgg cggx cgg cgg mRev  _cggT cgg cgg cggU cgg cgg cgg* cgg; cgg cgg cggK cggV cgg   #........#.##   ## #O......##...# cgg r  ##. #..##...##.#   #..##.####..#..#<   #......####.....†.##   #........#......#.#..  cggW { #...$.......#..##   ##.........#.#   #.#### ....cgg h---  #............### #####.  #.^.......##...######..< cgg " #.....###.........  #..............  cgg ###....#................ O   ogre (asleep)  ##.. ##............cgg/ ...  # ##.(......#...#.  #........#.cgg_ "....cggi -5.0 (4.0cgg G---6.0 (5cgg cggs cgg x _An ogre comes into view. It is wielding a +0 giant club.cgg ## #O. ##. #.. #..##.####..#..#< #......####.....† #........#... #...$.......# ##............ #.....@.....####  #............###  #.^.......##...< #.....###...... #............ ###....#....... ##.. ##...... .# ##.(...cgg ## #O. ##. #.. #..##.####..#..#< #......####.....† #........#... #...$.......# ##............ #.....@.....####  #............###  #.^.......##...< #.....###...... #............cgg| ###....#....... ##.. ##...... .# ##.(...cgg^cggcggcgg\ _An ogre is nearby!cgg[ ((((cgg((OYou shoot a sling bullet. The sling bullet hits the ogre.  The ogre shouts!cggJ  The ogre is lightly wounded.  You shoot a sling bullet. The sling bullet hits the ogre.cgg8%cgg&cgg/|..O....cgg0c===7.1 (1.1Rev cgg8cgg;_ _The ogre is moderately wounded.cgg ((((You shoot a sling bullet. The sling bullet hits the ogre.cgg> j _The ogre is moderately wounded.  You shoot a sling bullet. The sling bullet hits the ogre.  The ogre is moderately wounded.  The sling bullet hits the ogre but does no damage.  Lightning courses through the ogre!cggcggԩ^.O...cgg,80cgg7Rev+ cggcgg̶ cgg.N_The ogre is heavily wounded.cgg H (cgg x(( You shoot a sling bullet. The sling bullet hits the ogre.cgg5  The ogre is severely wounded.You shoot a sling bullet. The sling bullet hits the ogre.cgg% cggg X.O..cggP &9cgg cggB X _The ogre is almost dead.cgg ^  You shoot a sling bullet. The sling bullet hits the ogre.cgg; )((cgg (((((You kill the ogre!cgg|....)..cggY/520cgg?Rev* cggacgg/ _You shoot a sling bullet.cgg cgg_ cggYcggH _No target in view!cggJcggcggJcgg?WRev+ _cggcgg9cggcgg cgg]$cgg$cgg%cgg]+M _You now have 440 gold pieces (gained 9).cgg-cgg-cggG2cgg5cgg7cggN7:Rev cgg98cgg<cgg>cggU?cgg @cggECcggSEcggEcggFcgg#Icgg Kcgg\KcggLcggQcggScggT!cggBUcggWcggYcggZcgg[cggk]cgg_,cgg`cggccggd,cggZecgg|fcggvg,cggShcggjcggkcgglcggmcggfqcgg5s,cggAtcggwcggwcgg'xcggjycgg{cggDBcggcggك,cggcggцcgg ,cggZcggcggi ##........  cgg` ##...........####   #............### ###   #.^.......##...#####  cgg #.....###.........   #................  cgg  ###....#.......   ##..###..........  cgg  #@### ##.(......#---cgg  #...# #........#   #..... #........#.  cgg:  #........########   .$.......# cggc  #........W# W   phantom (dormant)cgg  ##.#.#....+cgg  ## .######  cggg0399.0)cgg¡W.WcggI---40.1 (20cggcggZ _A phantom comes into view.cgg@ ##.... ##......  #.......  #.^.......# #.....###..cggA+ #........ ###....# ##..# #@### ##.( #...#  #.....  #....... .$.....W.#  #.........#  ##.#.#....+  ## .###### cggBcgg  ##.... ##......cgg   #.......  #.^.......# #.....###.. #........ ###....# ##..# #@### ##.(cgg^  #...#  #.....  #....... .$.....W.#  #.........#  ##.#.#....+ ## .######cgge cggY cggL cgg ^ _A phantom is nearby!cgg ((((You shoot a sling bullet.cggkz ((The sling bullet hits the phantom but does no damage.cggD cgg]....W..cggQ===1.2 (1.1)Rev cggcgg' cggPt _You shoot a sling bullet. The sling bullet misses the phantom.cgg (((You shoot a sling bullet. The sling bullet hits the phantom.cggBL  The phantom is lightly damaged.  You shoot a sling bullet.  The sling bullet hits the phantom but does no damage.cggcgg..W.2.4 (1.2Rev+  _The phantom is lightly damaged.cggno (( You shoot a sling bullet. The sling bullet hits the phantom.cggn  The phantom is moderately damaged.You shoot a sling bullet. The sling bullet hits the phantom.cggj|cgg`S.W.cgg-3.5 (1.1cgg7cgg?b _The phantom is moderately damaged.cggU ((((((You shoot a sling bullet.cgg  The sling bullet closely misses the phantom.You shoot a sling bullet.cggacgghWW.....cggik40Rev* cggpcggsb _The sling bullet closely misses the phantom.cgg5`((((((cggz%  You shoot a sling bullet. The sling bullet misses the phantom.You shoot a sling bullet. The sling bullet hits the phantom.cgg` W.....  The phantom is heavily damaged.cgg) -5.7 (1.2cgg޾ j _The phantom barely misses you.cgg {  You shoot a sling bullet.  The sling bullet hits the phantom but does no damage.cgg  The phantom is heavily damaged.You shoot a sling bullet. The sling bullet hits the phantom.  Lightning courses through the phantom!cgg/ D.cgg '.cggX >3/63656.8 (1.1cgg cgg N _You destroy the phantom!cggWcggXcgg`^ _No target in view! cgga cggb cggh cggPjH _No target in view! cggA? cgg @ cggA cggC cggE cggJQ _ cggK cggLL cggL cggN cggP cggQ cggQ cgggS cggU cggWU cggU7Rev+  cggV cggmY, cggLZ cgg ^N _You now have 454 gold pieces (gained 14). cgg_ cgg_ cggo` cggb cggOd cggd:Rev  cgge cggi cggk, cggl cggn cggp cggp cggq cggs cggu cgg0v cggv cgg>| cgg%M cgg cgg0 cgg~ cgg ###....#..... ##..###............... ##.######.(......#...#... #...#.###........#....... #......##........## ##........########....##.# #.........# .....  cggЍ#.........# ..)...  ##.#.#...@+--- ###.###### ###  cgg`###≈~≈#≈~≈~#.'~≈~≈'.58.8 (12.0) cgg≈~≈~#.≈~≈#### cgg~ cgg(====== cgg)%9.8 (13 cgg cggt= _As you open the door, it creaks loudly! cggI cgg|J cggP cgg9SH _No target in view! cgg 4 cgg  cgg H _No target in view! cgg  cgg  cgg  cggy  cggP  cgg : _ cgg @  There is an open door here. cggc A  You enter the shallow water. cgg @Water  cgg  cggY N _Moving in this stuff is going to be slow. cgg  cgg  cgg  cgg  cggU  cgg  cgg  cggI  cgg@  cgg  cgg  cgg`  cgg  cggz ! cgg  cgg: @  There is an open door here. cgg  cgg}  _ cgg  cgg\  cgg ##....#........####..###................ ##.######.(......#...#......#.  cggt U#...#.###........#.........## #......##........#......#.## .... #........########....##.#.. .........#≈≈~≈#.......#... .........#≈~≈~#....)...... #.#.#....'~≈~≈'.@.#.... ------69.2 (9.4) ###.######≈~≈~#........ cgg ### #≈≈~≈####......###### ...............(#... cgg +.#. cgg;  cgg O------70.2 (10.4) cgg]  cggC % _Found 7 stones.!cggռ!cgg!cgg!cgg!cgg!cgg=!cgg~,!cggh!cgg!cgg/!cggn!cgg!cgg,!cgg!cgg!cggq!cgg!cgg !cgg!cggQ!cgg!cgg!cggY!cgg,!cggf!cgg!cgg!cgg\!cgg!cgg{!cgg2!cggg!cgg!cgg!cgg,!cgg!cggp !cgg` ,!cggC !cgg !cggG!cgg!cggt!cgg!cgg!cgg!cggN _You now have 469 gold pieces (gained 15).!cggd!cgg!cggz!cggM!cgg!cggM!cgg!cggT!!cgg2#,!cgg$!cggC&!cggI(,!cgg)!cgg*!cgg1,!cgg~,!cggs-!cggG1!cgg2!cgg)3!cgg3!cgg5!cgg7!cgg8!cgg8!cgg7;!cgg<,!cgg=!cggj?!cgg@!cggA!cggA!cgg~D!cggE!cgg7F!cggEG!cggH!cggI!cggJ!cggMJ!cgg K!cggL,!cggL!cggO!cggYT!cggT!cggyU!cggV,!cgg'W!cgg'X!cggX!cggY!cggjY!cgg[,!cgg \!cgg8^N _You now have 489 gold pieces (gained 20).!cgg_I!cgga!cggHb!cggb!cggb!cggc!cggsd,!cggd!cgg[g!cggl........## .................#.> ...#......#....##.......##.......!cggmD.###......## ....##.#..##....... #....#....... ).....#..### .#..............@..# 5003.2 (33.0 !cgg*m@..........###......# #...........##...### #..........###...# #...........#...## !cgg|m#.....(........## ##.#....##.#..#.##  ###.#...####.#..##  ##..#..###.#.....#!cggq!cggCr,4.2 (34!cggv!cggx; _Found a stone staircase leading down.!cgg(!cgg!cggW!cgg!cggy!cggB!cgg!cgg!cgg!cgg!cggf!cgg!cggn!cgg!cgg!cgg!cggj!cgg!cggb!cgg!cggF!cgg!cgg>!cgg!cggJ!cgg!cggV,!cgg!cgg !cgg !cggr !cgg !cgg#%  !cggn-There is a stone staircase leading down here.!cgg5!cgg _!cgg!cgg!cgg!cggW!cgg!cgg!cggn!cgg!cgg!cgg!cgg!cgg,!cgg!cggJ !cgg| !cgg !cgg#!cgg*A#..<...≈≈≈≈≈≈##.......~.. ... ........... .h ..!... .. .!cgg*..###... .....##.#..## .##.............###.####....#...#..#.>##.@...# ....#....##..#.....## !cgg*...##.###...###......## #######......!cgg!+\ ...#.......## h   black bear (asleep) .......#..### ............!cgg+X# ...###......#!cgg4-17.2 (13!cgg5,8.2 (14!cgg6;!cgg>] _A black bear comes into view.!cggr'c<.. ... ...... .h #.... .. ###... . #.#..## .# ......###.## .......#...# >##.@...# ..#.....## !cgg!(.###...## .## #####..#.##.###...#!cgg <.. ... ...... .h #.... .. ###... . #.#..## .# ......###.## .......#...# >##.@...# ..#.....## .###...## .## #####..#.##.###...#!cggG!cgg!cgg$!cggc !cggS_A black bear is nearby!!cgg V (((!cggU ((hYou shoot a sling bullet. The sling bullet hits the black bear.!cgg'  The black bear is lightly wounded.  You shoot a sling bullet.  The sling bullet hits the black bear but does no damage.!cgg !cgg h.h....!cgge g===9.3 (1.1)Rev !cgg !cggK 8 _The black bear is lightly wounded.!cggHy (((( !cggDIUYou shoot a sling bullet. The sling bullet hits the black bear!!cgg (((The black bear is moderately wounded.You shoot a sling bullet."cgg "cggn...h..."cggR-200"cgg"cggve _The sling bullet closely misses the black bear."cgg ((( You shoot a sling bullet. The sling bullet hits the black bear.  Lightning courses through the black bear!"cgg r  The black bear is almost dead.You shoot a sling bullet. The sling bullet hits the black bear."cgg"cggZ.h.."cggZG1Rev+ "cgg"cgg"cgg^ _The black bear is almost dead."cgg& (((((((You shoot a sling bullet."cggzm  The sling bullet closely misses the black bear.You shoot a sling bullet. The sling bullet hits the black bear."cggr)"cggp....†.."cggw 772 _You kill the black bear!"cgg"cgg h _Your Dodging skill increases to level 5!"cgg"cgg\"cgg"cgg) "cgg:_No target in view!"cgg  _No target in view!"cgg/ 4"cgg1 "cgg{3 "cgg4 "cgg 8 ; _"cgg9 "cgg9 "cgg9 "cgg: "cgg2< "cgg> ,"cgg? "cggB "cgg_D "cggD "cggD 7Rev "cggE "cggKJ f  You see here a black bear corpse."cggK "cggM _"cggP ,"cggQ "cgg*R "cggS "cggU "cggdW "cggW "cggX "cggg[ "cggW] "cgg] !"cgg^ "cgga "cgg+k . =.... ...l. .. ~~"cggl + #...##.##~~. #......#~~###....###......~~~#)...##....#.........~# #.......~#........!..## #..<...≈≈≈≈≈≈≈..@.....#"cggl --- ##.......~.......###.##.............## ....##.........## ...###...#....####.#..###.†##l   iguana (asleep)"cggm ..###.##.#...#.#.>##.....#"cggSs & "cggs R30.3 (8  An iguana comes into view."cggw| `.ll"cggO} G---1.3 (9"cggH "cgg 0 _The iguana hisses angrily.#cggg ..... .. ~~  #..l##.##~~  #......#~~# ..###......~~~# .)#cggsT..#.........~# ............~# .........!..## <..@.....# ~.......###.## .......##......###....####.†####.##...#>##.....##cgg`m ..... .. ~~  #..l##.##~~  #......#~~# ..###......~~~# )..#.........~# #cgg............~# .........!..## <..@.....# ~.......###.## .......##......##....###.†####.###cggˮ...#>##..#cgg 4#cgg#cgg #cggYX_An iguana is nearby!#cgg ..... .. ~~  #..l##.##~~  #......#~~# #cgg8x..###......~~~# .)..#.........~# ............~# .........!..## <..@.....# ~.......###.## .......##......###....####.†####.##...#>##.....##cggNj ..... .. ~~  #..l##.##~~  #......#~~# ..###......~~~# #cggq)..#.........~# ............~# .........!..## <..@.....# ~.......###.## .......##......##....###.†####.##...##cggҌb>##..#cgg#cgg#cgg#cgg{[ ((((#cggx( _An iguana is nearby!You shoot a sling bullet.#cgg3 ((The sling bullet hits the iguana but does no damage.  You shoot a sling bullet.#cgg#cggL..l....===2.3 (1Rev #cgg#cgg` _The sling bullet barely misses the iguana.#cgg) ((((You shoot a sling bullet. The sling bullet hits the iguana.#cgg  The iguana is lightly wounded.  You shoot a sling bullet. The sling bullet hits the iguana.#cgg5 #cggB .l...3Rev+ #cggJ #cggL a _The iguana is moderately wounded.#cgg N ((#cgg0 Y(You shoot a sling bullet. The sling bullet hits the iguana.#cgg\ &  #cgg] The iguana is moderately wounded.You shoot a sling bullet.  The sling bullet hits the iguana but does no damage.#cgg #cgg X.l..#cgg{ -4.4 (1.1#cgg #cgg a _The iguana is moderately wounded.#cgg  You shoot a sling bullet.  The sling bullet hits the iguana but does no damage. _ Lightning courses through the iguana!#cgg̞J.((#cggP!#cgg& (((((You kill the iguana!$cggtkJ.......$cggpp805.5Rev* $cggE _You shoot a sling bullet.$cgg$cgga$cgg/ $cggX H _No target in view!$cggX$cgg$cggɥ$cgg$cgg $cggsARev+ _$cgg,$cgg\$cgg$cggx$cgg+M>.. ... ##... ..# ~# =.... ..... .. ~~#  #...##.##~~# ... #......#~~# ..##....##~~~# ...##....#~# $cgg#.~# ................@..## --- .<...≈≈≈≈≈≈≈........# ~.###.##...## ####.........#####...#....## ##.#..###.†####.#$cggU#....#...#$cgg޿-7.5 (2.0$cgg}G---8.5 (3$cgg$cgg[ _z - a smoky sapphire potion$cgg+J$cgg$cgg&Rev $cgg$cgg,$cggZ$cgg$cggR,$cgg$cgg$cggzA  You enter the shallow water.$cggVWater Rev $cgg$cgg>N _Moving in this stuff is going to be slow.$cgg%?$cgg$cggG$cgg,$cgg$cggb$cgg$cgg$cggN$cgg$cgg$cgg$cgg8$cgg$cgg/$cggT$cgg$cgg$cgg$cgg$cgg$cgg$cgg$cgg$cgg$cgg$cgg<,$cgg$cgg0$cgg$cgg$cgg $cgg$cgg1$cggg$cgg$cggg$cgg'$cggc$cgg$cggR$cgg$cgg$cggK$cggR$cgg,$cgg-$cgg$cggb$cgg$cgg$cgg$cgg'$cggR$cgg$cggK$cgg$cgg$cggI$cgg$cgg$cgg$cgg$cgg $cgg[ $cgg $cgg $cggs $cgg $cgg $cggq $cgg $cgg B$cggS $cggv B$cggY $cgg ,$cggt $cgg $cgg ,$cgg $cgg $cgg $cgg $cggn $cgg $cgg $cgg4 $cgg $cgg $cgg ,$cgg $cgg $cgg' $cgg] $cgg $cgg $cggA ,$cgg $cgg $cgg ,$cgg $cgg $cgg $cgg- $cggX $cgg $cgg $cgg $cgg $cggz $cgg $cgg $cgge $cgg! $cggE" $cggv" $cgg" $cggK# $cgg# $cgg# $cgg$$ $cgg$ $cgg:% $cggx% $cgg% $cgg& $cgg' $cgg' ,$cgg( $cgg^) B$cgg* $cgg+ $cgg9+ $cggf+ $cgg., $cgg=- $cggt- $cgg- $cggR/ $cggh0 $cgg$1 ,$cgg42 $cgg93 $cgg3 $cgg3 $cgg5 $cgg6 ,$cgg 7 $cgg7 $cggH8 ,$cgg8 $cgg/9 $cgg9 ,$cgg9 $cgg: $cgg ; ,$cggq; $cgg; $cgg~< ,$cgg< $cggY= $cgg= $cgg.> 7$cgg> $cggV? 0$cgg? $cggLC $cggMF A  You enter the shallow water.$cggF @Water $cggF $cggJ N _Moving in this stuff is going to be slow.$cggK $cggK $cggAL $cgg+O $cggO B$cggR $cggS $cggS $cggS $cggX $cggX $cgg4Y $cggY $cggN^ $cgg _ ,$cgg_ $cgg*e $cggf $cggMf $cggf $cggl $cggl $cggm $cggem $cggr $cggs $cggs $cggs $cggx $cggy $cggz $cggwz $cgg ~ $cgg~ $cggA $cgg $cgg* $cgg $cgg $cgg $cgg $cgg $cgg4 $cgg_ $cgg $cggʌ $cgg $cgg* $cgge $cggc ,$cgg $cggѕ $cggǖ ,$cgg $cgg $cggg ,$cggŚ $cgg $cgg $cgg $cggH $cgg $cgg $cgg2 ,$cggx $cgg_ $cgg¨ $cgg? $cgg $cgg $cgg= $cgg $cgg/ $cggd $cggҳ $cggI $cgg $cggD $cgg ,$cgg^ $cgg- ,$cgg $cgg/ $cgg ,$cggJ $cgg $cggt $cgg ,$cgg $cgg# ,$cgg $cggp $cgg ,$cggO $cgg $cgg ,$cggU $cggx $cgg_ $cgg ,$cgg $cgg $cgg $cgg_ $cgg $cgg $cgga $cgg $cgg $cgg $cgg $cgg $cgg $cgg ,$cggc $cgg $cgg ,$cgg $cgg $cggZ $cgg $cgg{ $cgg3 $cgg $cgg !$cgg4 $cgg& $cgg $cgg $cggq $cggh $cgg ,$cgg $cggQ $cgg ,$cgg $cgg~ $cgg ,$cgg $cgg $cgg $cgg) $cgg $cgg& $cgg ,$cgg $cgg $cgg ,$cggd $cgg $cggl ,$cgg $cgg1 $cgg ,$cgg $cgg $cgg ,$cgg $cgg2 $cgg ,$cgg= $cggv $cgg ,$cgg  $cgg $cgg ,$cgg $cgg* $cggt ,$cgg1 $cgg! $cgg ,$cgg! M _i - 2 scrolls of brand weapon (gained 1)$cgg'  #~~~~ .......#... #~~~~ #.......... #~### #........## ##~# # .####.........#####~~# # ......#...##~~~# #  .. .........##~~~### .......#~#~~### ..%.....$@.........#~#~~##193.3 (154.8)$cgg\( %.# #. ............##.#...####~~# #.##.. .###.###......##......#~~# #..... ......##..............#~~#..###....>.................#~## .....#...........#.##.......##~## .##......=.......#..........#~~## .##.................#...##.##~~#...........##......#~~##$cgg, $cgg- ,45$cgg*2 $cgg3 , _Found a flux talisman.$cgg~ 3$cgg߀ $cgg؅ $cgg1 $cggˉ $cgg $cgg ,$cggm $cggY N _You now have 504 gold pieces (gained 15).$cgg $cgg $cgg $cgg $cgg ,$cgg` $cgg $cggD ,$cgg| $cgg $cgg ,$cggѭ $cgg $cgg . .. ...... .. ##.# ......## h..#... .......#... ##..... #..........   #........## . ####...##.. .......@..........#.... ..............# .. .#.....##.................... $cggi .##.##..# #...%................ .##.....# #...##.#... .#....#.##....###.#.##.... h   black bear (asleep) ###...#............##............ ....>.....###....>...............#....#.##......$cgg 200.3 (6.0)  A black bear comes into view.$cgg o.hh$cggx 4==1.3 (7$cgg $cgg 4 _The black bear growls angrily.%cgg .. . ..   .. ##.#   .h.#...   ##.....   ....... #....%cgg  .......####.... .......@....... ................. .##............ #...%........ #.............#....###.###.............##...>.....###....>......%cggp? .. %cgg*q. ..   .. ##.#   .h.#...   ##.....   ....... #....  .......####.... .......@.......%cggq4 ................. .##............ #...%........ #.............#....###.###.............##...%cggq>.....###....>......%cggiz4%cgg;%cgga _A black bear is nearby!%cggI (((((You shoot a sling bullet. The sling bullet hits the black bear.%cgguK  The black bear is lightly wounded.  You shoot a sling bullet. The sling bullet hits the black bear.%cggm.h....%cgg a=2.4 (1.1Rev %cggv%cggL8 _The black bear is lightly wounded.%cgg&z ' %cggz ((((You shoot a sling bullet.  The sling bullet hits the black bear but does no damage.%cggK (The black bear is lightly wounded.  You shoot a sling bullet.%cggڇ %cgg! T.h....%cggH c30Rev+ %cgg %cgg d _The sling bullet barely misses the black bear.%cggQ R ((((%cgg S =(((You shoot a sling bullet.%cgg  The sling bullet barely misses the black bear.You shoot a sling bullet. The sling bullet hits the black bear!%cgg\_ %cggg h....h...%cggph -4.5 (1.1%cggo %cggNr b _The black bear is heavily wounded.&cgg ((You shoot a sling bullet.  The sling bullet hits the black bear but does no damage.&cgg$ (The black bear is heavily wounded.You shoot a sling bullet.&cgg@G.h.5.6Rev*  _The sling bullet barely misses the black bear.&cgg (You shoot a sling bullet.  The sling bullet hits the black bear but does no damage.&cgg*Hl((You shoot a sling bullet. _The sling bullet barely misses the black bear.  The sling bullet hits the black bear but does no damage.  The black bear is heavily wounded.You shoot a sling bullet.&cgg&cgg\P..h&cgg;(6.7&cgg&cgge _The sling bullet closely misses the black bear.&cggx (((You shoot a sling bullet.&cggw  The sling bullet barely misses the black bear.You shoot a sling bullet. The sling bullet hits the black bear!&cgg ..hThe black bear is almost dead.&cgg(7.8&cgg &cgg$  _The black bear closely misses you. The black bear completely misses you. x2&cggcd  You shoot a sling bullet. The sling bullet hits the black bear.&cggJ  The black bear is almost dead.You shoot a sling bullet. The sling bullet hits the black bear.&cggp  The black bear is almost dead.The black bear misses you. The black bear barely misses you.&cgg{q (8.9&cggw &cggry X _The black bear closely misses you.&cgg\ (((You shoot a sling bullet.&cgg  The sling bullet barely misses the black bear.You shoot a sling bullet. The sling bullet hits the black bear.&cgg7 S&cgg R..†&cgg ~ kirmisher4/649190 &cggQ A_You kill the black bear!&cgg &cgg o _Your Ranged Weapons skill increases to level 8!&cggZ4&cggf_&cggaH _No target in view!'cgg]'cgg'cggD'cgg@'cgg'cggE; _'cgg'cgg'cgg_'cgg'cgg5f  You see here a black bear corpse.'cgg'cgg( _'cgg"'cgg'cgg'cgg<:Rev+ 'cgg'cgg'cggM'cgg'cgg)'cgg'cggv'cgg'cgg.'cgg'cgg'cgg'cgg'cggS'cgg 'cggK:Rev 'cggg'cgg'cgg'cgg6'cgg'cgg'cgg,'cgg'cgg'cggQ .## 'cggrT##.. ..  ##.....# ##.. #... ..# 'cggS#.... #..##..### .....####........#.  #...#....#........  'cgg##........#@......h ### ---  .# #........... #~  ..# #..#........ ##~#~ 'cggB ....##.#.........##... #~~~~  ....#.....#... #~~~~ 'cggXC .##......###.......... #~### h   black bear (asleep)  .........# #........## ##~# # 'cgg .......†####.........#####~~# #  ...#...##~~~# #'cgg/10.0)'cgg~I---20.9 (11'cgg'cgg] _A black bear comes into view.'cggC| .##  ##.. ..  ##.....#  ##.. #... ..#  #.... #..##..###  .......#.  #........  #@......h ###  .# #..................  ..# #..#..............  #.........##...  ...........#...  ..###..........  ..# #........## ##~#  †####.........  .. 'cgg$ .##  ##.. ..  ##.....#  ##.. #... ..#  #.... #..##..###  .......#.  #........  #@......h ###  .# #..................  ..# #..#..............  #.........##...  'cgg...........#...  ..###..........  ..# #........## ##~#  †####.........  .. 'cgg'cgg'cgg'cgga _A black bear is nearby!'cggq  ((((((hYou shoot a sling bullet. The sling bullet hits the black bear.  The black bear growls angrily.'cgg (The black bear is lightly wounded.  You shoot a sling bullet.'cgg{ 'cgg~ t  The sling bullet closely misses the black bear.'cgg 'cgg+ .....hSS   adder (wandering)'cggӈ ;===2.0 (1.1)'cgg 'cgg3 Y _An adder comes into view.'cgg (((((S  You shoot a sling bullet.  The adder hisses angrily.  The sling bullet hits the black bear but does no damage.'cgg  The black bear is lightly wounded.  You shoot a sling bullet. The sling bullet hits the black bear.'cggl 'cgg ,'cgg% v...h.S.'cgg|& _3.1Rev+ 'cgg- 'cggp2 e _The black bear is moderately wounded.'cggx(((((The black bear is lightly wounded.  'cgg:You shoot a sling bullet. The sling bullet hits the black bear. _The black bear is moderately wounded.You shoot a sling bullet.  The sling bullet barely misses the black bear.  The sling bullet hits the adder.(cgg]  The adder is lightly wounded.  You shoot a sling bullet. The sling bullet hits the black bear.(cgg(cggd(cgg..h.S.40(cgg(cggb _The black bear is heavily wounded.(cgg{G (((((((You shoot a sling bullet.  The sling bullet closely misses the black bear.(cgg;  The sling bullet closely misses the adder.You shoot a sling bullet. The sling bullet hits the black bear.(cggU(cggV,(cgg6`.h.....S(cgg`l5.2 (1.1Rev* (cggk(cggmc _The black bear is severely wounded.(cggE ( You shoot a sling bullet. The sling bullet hits the black bear.(cgg ((((((The black bear is almost dead.You shoot a sling bullet.(cggyM(cggiY .h.....S.h(berserk)The sling bullet barely misses the black bear.(cggZ(6.3(cggCb(cgge\ _The black bear goes berserk!(cgg  (You shoot a sling bullet. The sling bullet hits the black bear.(cgg۟  The black bear is almost dead.You shoot a sling bullet. The sling bullet hits the black bear.(cggQ (cgg (cggb (cgg& ThS.(cgg' (7.4(cgg- (cgg/ ^ _The black bear is almost dead.(cgg1. d  You shoot a sling bullet. The sling bullet hits the black bear.(cgg3 .S   adder(cgg (((((((You kill the black bear!You shoot a sling bullet.(cgg\C (cggKJ @S......(cggK (cggqT WSunshineJesse the Skirmisher.##Coglin##.. ..Health: 64/64 ========================(cggT ##.....#Magic: 8/8========================##.. #... ..#AC: 5Str: 12#.... #..##..###EV: 13Int: 9.....####........#.SH: 0(cgg2U Dex: 19#...#....#........XL:  8 Next: 102% Place: Dungeon:6(cgglU C##........#@S...... ### Noise: ===------  Time: 5228.4 (1.0).# #.................. #~## a) +2 sling {Septima j) +0 sling (elec) {(cggU u..# #..#.............. ##~#~ Fire: a) +2 sling {Septima} ....##.#.........##... #~~~~ Rev* ....#.............#... #~~~~(cggU .##......###.......... #~### S   adder(cggTV `.........# #........## ##~# #.......†####.........#####~~# #(cggV ...................#...##~~~# #The black bear is almost dead.You shoot a sling bullet. The sling bullet hits the black bear. _The black bear is almost dead.You shoot a sling bullet. The sling bullet hits the black bear.  You kill the black bear!You shoot a sling bullet.(cggX _The sling bullet closely misses the adder.You have reached level 9!(cggc /  --more--)cgg  Your experience leads to an increase in your attributes!Increase (S)trength, (I)ntelligence, or (D)exterity? *cggCq9/699/94219 1%  *cgg8L_You feel agile. x2*cgg  You shoot a sling bullet. The sling bullet hits the adder!*cgg  The adder is severely wounded.You shoot a sling bullet. The sling bullet hits the adder.*cgg0 q†*cggHC9.5 (1.1*cggL*cggNI _You kill the adder!+cgg+cgg+cgg#+cggvH _No target in view!+cgg+cgg+cggܮ+cggH _No target in view!+cggk4+cggl+cggAq+cggz..#  ..####.....  ##.....# ##.. #... ..# #.... #..##..### .....####........#.)...#....#.@. 0.0+cggr{/ ##........#.†###  .# #.........~###..# #..#......##~#~#....##.#...##...( #~~~~#....#.............#...# #~~~~.#####..........# #~###~..# #.+cgg{.### ##~# #~.†####.#####~~# #~+cgg+cgg6---30.5 (1+cgg+cgg֏1 _Found a spear and 5 stones.+cgg@~+cggӃfRev+ +cgg!+cgg+cgg+cgg:N _You now have 519 gold pieces (gained 15).+cgg64+cggߏ+cgg+cgg̓+cgg=+cggG+cgg+cggў+cgg2:Rev +cggt+cgg+cgg+cggN+cgg+cgg+cgg +cggg+cggƪ+cggu+cgg7+cggu+cggg+cgg0+cgg+cggV+cgg+cgg,+cgg+cggй+cgg?,+cgg+cggK+cgg +cgg +cggt +cggI +cggJ +cgg4 +cgg +cgg& +cgg +cgga" +cgg6 +cgg9 ,+cggW: +cgg_= +cgg@@ ,+cgg`B +cggI +cggL ,+cggN +cggP +cggES ,+cggT +cggX +cggM[ +cgg[ +cgg] +cgg_ +cgga ,+cggc +cggf +cggh ,+cggBj +cgg,m +cggn ,+cgg&p +cggq +cggs ,+cggOu +cggx ,+cggz +cggm N _You now have 530 gold pieces (gained 11).+cgg` +cggӆ +cggC +cgg& +cggL ,+cgg +cggZ +cgg ,+cggT +cgg= +cgg: +cgg +cgg^ +cgg +cggt ,+cgg +cggӿ +cgg ,+cgg? +cgg +cggm ,+cggR +cgg B+cgg &+cgg X+cgg +cgg ,+cgg n+cgg +cggR ,+cgg +cggC +cggO +cggN ,+cgg +cggt ,+cgg +cgg +cgg ,+cgg +cgg +cgg ,+cgg +cgg +cgg' ,+cgg! +cgg|" +cgg# ,+cgg$ +cgg& +cgg* X+cgg+ ,+cgg, +cggK +cgg$M B+cggO +cgg2Q ,+cgg*R +cggU +cggU +cgglV +cggV +cggVY +cggxZ +cgg[ +cgg[ +cgg] +cgg_ ,+cggD` +cgg0b +cgghc +cggc +cggEd +cgg$g +cggui +cggi +cggj +cgg n +cggWp +cggp +cggq +cggt +cgg3v +cggv +cggVw +cggy +cggz +cgg{ +cgg{ +cgg} +cggF +cgg +cgg" +cgg +cgg, +cggڅ +cgg& +cgg +cgg" ,+cgg +cgg +cgg B+cgg 7 _You open the door.+cggG 3+cgg• +cggD +cgg/ +cgg +cgg +cgg V  There is an open door here.+cggܢ 5 _+cgg +cggt +cggܦ +cggJ +cggߨ +cgg +cgg4 ,+cgge +cggѮ +cggH +cgg +cgg +cgg +cgg +cggC +cgg ,+cgg +cgg( +cgg +cggm +cgg +cgg +cgg ,+cgg1 +cgg +cgg< ,+cgg3 +cgg +cgg ,+cgg= +cgg +cgg +cggu +cgg_ +cgg +cgg +cggc +cgg +cgg +cgg ,+cgg +cgg ,+cgg +cgg N _You now have 547 gold pieces (gained 17).+cgg7 3+cgg +cgg +cgg +cgg^ +cgg +cgg{ +cgg ,+cgg +cggV +cgg3 ,+cgg +cgg +cggA ,+cggw +cgg +cggi ,+cggu +cgg +cggL +cgg +cgg +cgg +cgg\" +cgg" +cggx# +cggm% +cgg& +cgg& +cgg' +cgg?+ +cgg/ ,+cgg32 +cgg~6 +cgg: ,+cgg= +cgg@ +cggDC ,+cgg?E +cggxS +cggIV ,+cggX +cggYa B+cggRf +cggLk +cgg@m +cggm +cggn +cggq +cgg,s +cggs +cggUt +cggw +cggy ,+cgge{ +cgg2~ +cgg +cgg< +cggt +cgg߄ +cgg +cgg +cggP +cgg +cgg ,+cgg +cgg& +cgg +cgg +cgg~ +cgg] +cgg0 +cgg. ,+cgg +cgg ,+cggɪ +cgg& c  You see here a hound skeleton.+cgg +cgg  _+cgg +cggJ P  There is a stone staircase leading up here.+cgg 5 _+cgg +cggS #..........##.....###......##......)..#....#.##....####.........###...#..........#.............>.....###....#.......#............#.....+cgg O #.......##.......##......=.##........#.##....##........####.......##...#............... ##.##..##...##.#@........#.......---34717.0) #..##.####..#..#<.......##....).. #......####.....÷.##.......###... #....)...#......#.#.............. +cgg E#...........#..##............#..< #.................#.#........##.. ...........####.................. ..#########.....!....... ^##...######..<..........#+cgg +cggN +cgg# T _Key pressed, stopping explore.+cgg I+cggT +cgg +cgg P _+cgg +cggx +cgg- +cgg5 +cgg? ,+cgg +cgg +cgg +cgg +cgg) +cgg +cgg +cggB +cgg] +cgg! +cgg% +cgg& +cgg' +cgg* +cgg, ,+cggJ. +cgg0 +cgg+3 +cgg3 +cgg5 +cggG9 +cggk; +cgg; +cggP= +cggN? +cggA ,+cggC +cgg F +cgg>H ,+cggI +cggJK +cggM ,+cgg|N +cggP +cggS +cggS ,+cgg.V +cggX ,+cggUZ +cgg` B # #### ###... #'.## ## #≈≈≈≈≈#..###. +cgga #....≈##..###..# #....≈#.....##.# ###....≈#.....# ##.+######..## ###..@......... ##...................†# #...#.....+cggb O... ####..##..... #...........#.....##..... ###........##.##..####...% +cgghc #..........##.....### ##......)..#....#.##....### #.........###...#.+cggk %#####+cggk o.....#.'61.5 (14.0)+cggbt >======+cggt %2.5 (15+cgg{ +cgg} = _As you open the door, it creaks loudly!,cgg%,cggu&,cgg*,cgg=X,cggC  There is an open door here. _,cgg_# ##.. #.....## #### #,cgg`o######'.## ##....#≈≈≈≈≈#..###..... #....≈##..###..# #....≈#.....##.# ###@...≈#.....#------4.5 (2.0) ##.'######..##......###...........# ##.............†##,cgg` #...#.............. ####..##................. #...........#.....###........##.##..####...%..,cgga3#..##.....###,cgga=------,cggg,cgg)iE _Done exploring.,cggI,cgg30'.,cgg,cgg,cggEJE _Done exploring.,cggaR ,cggS 3,cggv 4,cggx ,cgg5{ E _Done exploring..cgg;.cgg2Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 3 scrolls of teleportation  h - 3 scrolls of poisoni - 2 scrolls of brand weapon  m - a scroll labelled ANUYPIZXOPSU .cgget t - a scroll of vulnerability  v - 2 scrolls of immolation  y - a scroll labelled QUPNOI HOPHEPT [!] read|quaff|evoke[?] describe selected.cggE .cgg ##....# SunshineJesse the Skirmisher##.....# Coglin#.....## Health: 69/69 ========================#### ###...#. Magic: 9/9========================######'.## ##..... AC: 5Str: 12#≈≈≈≈≈#..###...... EV: 14Int: 9#....≈##..###..#.. SH: 0Dex: 21#....≈#.....##.#.. XL:  9 Next:  1% Place: Dungeon:6###@...≈#.....#..... Noise: ---------  Time: 5364.5 (0.0)##.'######..##......# a) +2 sling {Septima j) +0 sling (elec) {###...................# Fir.cgg $e: a) +2 sling {Septima} ##...................†###...#...................####..##.................. #...........#.....##...... ###........##.##..####...%.. #..........##.....###.......  _Key pressed, stopping explore. _As you open the door, it creaks loudly! _There is an open door here. _Done exploring. _Done exploring. _Done exploring..cggS P  Okay, then..cgg .cgg .cgg . _/cgg4 3/cgg5 /cgg(A /cggB /cggC $ _/cggH V  There is an open door here./cggIJ /cggJ  _/cggK /cggN /cggQ ,/cggS /cggV /cggX ,/cgg?Z /cgg\ /cgg^ /cggA_ /cggy` /cgg d /cggqd /cggd /cgge /cggg /cgg{i ,/cggj /cggl /cgg|n ,/cggfo /cggJq /cggRs ,/cggnt /cggvv /cgg'x ,/cggsy /cggR{ /cgg>} ,/cggz~ /cgg O##...................†####./cggU #...#......................####..##.....................#...........#.....##........###........##.##..####...%#..........##.....###..../cgg ##......)..#....#.##....###.####.........###...#............###.............@.....###....>75.5 (1/cggΈ 1.0)#.......#............#...#.......##.......##......=..... ###........#.##....##...... #.......##...#...... #..##...##.#.........### #.####..#..#<.......##....)...## ...####.....÷.##.......###..... .)...#.#.........../cgg$ /cggd c _There is a stone staircase leading down here.0cgg40cgg50cgg<0cgg2B0cgg{MN6.5 (1.0) _0cgg: #. ##.## ....## #  ....##.#  #....#.#  #......  #....##.# 7 0cgg ##  ##  ..#  #...###.### ..... .# ...... ##o   orc wizard (asleep) .....o   orc (asleep) .o.o. 0cgg0cgg oowandering)o.oYou climb downwards.0cgg()6==7.3 (1.80cgg10cgg; _The orc wizard shouts! You hear a shout! _There is a stone staircase leading up here.0cggͲ &Read which item? Scrolls  c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 3 scrolls of teleportation  h - 3 scrolls of poisoni - 2 scrolls of brand weapon  m - a scroll labelled ANUYPIZXOPSU  t - a scroll of vulnerability  v - 2 scrolls of immolation  y - a scroll labelled QUPNOI HOPHEPT [!] read|quaff|evoke[?] describe selected1cgg05 1cgg: 1cggC SunshineJesse the Skirmisher#.Coglin##.##Health: 69/69 ========================....## #Magic: 9/9========================....##.#AC: 5Str: 12#....#.#EV: 14Int: 9#......SH: 0Dex: 21#....##.#XL:  9 Next:  1% Place: Dungeon:7#.@....#Noise: ==-------  Time: 5377.3 (0.0)#......#a) +2 sling {Septima j) +0 sling (elec) {........#Fire: a) +2 sling {Septima} #...###.###..... .#...... ##o   orc wizard.....1cggZD o   orc (wandering).o.o. _Okay, then. _There is an open door here. _There is a stone staircase leading down here.  You climb downwards. _The orc wizard shouts! You hear a shout! _There is a stone staircase leading up here.1cggK n  Okay, then.1cggO 1cggR . _2cgg9 (((((((You shoot a sling bullet.2cggK _Okay, then.shoot a sling bullet.  The sling bullet closely misses the orc wizard.  You shoot a sling bullet.  The sling bullet hits the orc wizard but does no damage.  Lightning courses through the orc wizard!2cgg?o   orc2cgg=G,2cggP_ ....o..o 2 orcs.o)..  You kill the orc wizard!2cggSg3=8.3 (1Rev 2cgg2X2cgg[2cggc/  --more--2cggV q _An orc comes into view. It is wielding a +0 dagger.2cgg v (((((You shoot a sling bullet. The sling bullet hits the orc.2cgg ((The orc is moderately wounded.You shoot a sling bullet.2cggڢ2cgg2cggW.......o.o.2cggLd9.4 (1.1Rev+ 2cgg2cgg^V _The sling bullet closely misses the orc.3cgg/UYou shoot a sling bullet. The sling bullet hits the orc!3cgg(((()   orc3cggY (((You kill the orc!3cgg3cgg.....o)....3cggC-8003cgg3cgg/ _You shoot a sling bullet.3cgg  You shoot a sling bullet.  The sling bullet hits the orc but does no damage.  Lightning courses through the orc!3cgg3d((()3cggc ((((You kill the orc!3cggT...)...3cgg&13cgg3cgg / _You shoot a sling bullet.3cgg^3cgg23cgg3cggH _No target in view!3cggd 3cgg 3cgg 3cggO H _No target in view!4cgg _Rev  #.# ##.# #...  ... . #.# ... ##.###.....#....## #.......@...##.#---5.4 (4.......#....#.####....##.......#...... #....##.#...## ##.<....# #......#[ ........# #...###.###....) .#gg40m4cggf4cgg5G---6.4 (54cgg4cgg+ _Found a plate armour.4cggO `4cgg {#.###. ##.##.!. #...#... .......> #.#....###.###...#....## ##...........##.##....#.##0##....##.......#....... #....##.###. ##.<....# .. #......#[ ## ........#. #...###.###....) .#)... ##4cgg 4cggR +7.4 (14cgg 4cgg ; _Found a stone staircase leading down.5cggw5cggx5cggEz5cgg~5cgg5cgg,5cgg+5cgg ## #.# ###.# ##.## #.!..# #...####...S ...> #.# .###.###  ## #5cgg, .......##.# #........#....#.####....##.......#........#....##.#.....##.###.<....#S   water moccasin (asleep) ..... ... #......#..[.. ##.........#.... #...#5cgg}$##.###5cggۤ&85cgg39.4 (25cggĬ5cgg$a _A water moccasin comes into view.6cgg6cggWhere to? (Tab - D:6 @ (x,y), ? - help)  D - Dungeon 6cggR 6cggc SunshineJesse the SkirmisherCoglin## #.#Health: 69/69 ========================###.# ##.##Magic: 9/9========================#.!..# #...#AC: 5Str: 12###...S ...EV: 14Int: 9......> #.#SH: 0Dex: 21.......###.###XL:  9 Next:  3% Place: Dungeon:7#.....@#....## #Noise: ---------  Time: 5389.4 (0.0)6cggd ##...........##.#a) +2 sling {Septima j) +0 sling (elec) {#........#....#.##Fire: a) +2 sling {Septima} ...##....##.......#..........#....##.#......##.###.<....#S   water moccasin (asleep)..... ... #......#..[.. ##.........#.... #...###.### _No target in view! _No target in view! _Found a plate armour. _Found a stone staircase leading down. _A water moccasin comes into view.Okay, then.6cgge 6cggk 6cggn . _6cgg7 ((SYou shoot a sling bullet.  The sling bullet hits the water moccasin.6cggX0  The water moccasin is lightly wounded.  You shoot a sling bullet.  The sling bullet hits the water moccasin.6cggr6cgg6cggv.>S6cgg b===90.4 (1Rev 6cggi6cgg< _The water moccasin is lightly wounded.7cggifo  You shoot a sling bullet.  The sling bullet hits the water moccasin.7cggsE((((sling bullet hits the water moccasin. _The water moccasin is lightly wounded.  You shoot a sling bullet.  The sling bullet hits the water moccasin.  The water moccasin is lightly wounded.  You shoot a sling bullet.7cggz !..SThe sling bullet completely misses the water moccasin.7cgg_{-1.3 (0.97cgga7cgg&T _The water moccasin misses you.7cgg/  You shoot a sling bullet.  The sling bullet hits the water moccasin.7cgg'  The water moccasin is moderately wounded.You shoot a sling bullet.  The sling bullet hits the water moccasin.7cgg Du  The water moccasin is heavily wounded.7cggOEd2.3 (1.0Rev+ 7cggK7cggL7cggV/  --more--7cggSXY _The water moccasin barely misses you.7cggUfYou shoot a sling bullet.  The sling bullet hits the water moccasin.8cgg)B((((The water moccasin is heavily wounded.You shoot a sling bullet.8cgg!..SThe sling bullet completely misses the water moccasin.8cgg7-3.4 (1.1Rev* 8cgg8cgg<r _The water moccasin bites you. The water moccasin misses you.8cgg-_o  You shoot a sling bullet.  The sling bullet hits the water moccasin.8cggJ  The water moccasin is heavily wounded.You shoot a sling bullet.  The sling bullet hits the water moccasin but does no damage.8cggou  The water moccasin is heavily wounded.8cggqe4--408cggw8cggFx8cgg/  --more--8cgg!1 _The water moccasin bites you.9cgg@i((((You shoot a sling bullet.9cgguO The sling bullet closely misses the water moccasin.You shoot a sling bullet.  The sling bullet hits the water moccasin!9cgg !..SThe water moccasin is severely wounded.The water moccasin bites you but does no damage.9cgga59---5.3 (0.99cggA9cgg9cgg/  --more--9cgg4 1 _The water moccasin bites you.9cggm You shoot a sling bullet.  The sling bullet hits the water moccasin.  Lightning courses through the water moccasin!9cggr E†9cgg~ ~((((You kill the water moccasin!9cggу k!..†9cgg 60--106.3 (1.0 _You shoot a sling bullet.9cggǐ 9cgg8 i _Your Fighting skill increases to level 6!9cgg8 J9cgg F _Unknown command.9cgg 49cgg 9cgg H _No target in view!:cggm:cggn:cggmu:cggcxF _Unknown command.:cggƼ:cgg̽:cgg;:cgg:cgg2; _:cgg:cggf:cgg:cgg,:cgg:cgg:cggm1=Rev+ :cgg.:cggH,:cgg:cgg,:cggK:cgg^:cggw2=Rev :cggn:cgg],:cgg:cgg,:cgg:cggd:cgg&3:cgg:cgg:cgg!:cgg:cgg0:cgg:cgg:cggK4=:cgg#:cgg ,:cgg:cgg :cgg`:cgg:cgg95:cgg%2=:cgg:cgg,:cgg:cgg3!,:cgg":cgg%&,:cgg':cgg*:cggo+%6:cgg,:cgg0:cgg0:cgg1:cgg3:cgg\4:cgg5:cgg9a7=:cgg@B:cgg>A:cggoE,:cggjG:cggJ:cgg}KU8=:cggM:cgg1P:cggzP:cggR:cggHU,:cggV:cggXY:cggY:cggYD9=:cgg#[:cggh_1 _HP restored.:cgg!b:cggb:cggc:cggf:cggg,:cggXh:cggRj:cgg3m:cggm:cggyn:cggrp:cggr:cggfs9=:cgg&t:cgg!v:cggx,:cggx:cggL,:cgg:cggq _e - 6 potions of curing (gained 1):cgg˅:cgg:cgg:cggR:cggr:cgg:cgg@:cggz:cgg,:cgg#:cggS:cggQ5 ### #.# ###.## ##.## #....###...#:cgg ####....# ...!...##......># #.#.......†###.###---.......##......#....##....... ##...........##.:cgg###.. #........#....#.# ......##....##...... .W#...........#....## W   phantom (dormant):cgg@ ...#.......##.###.<.....###.. #..... :cgg~..[.. ##........:cggg1434.3 (38.0):cgg(H---5.3 (39:cggԮ:cggZ _A phantom comes into view.:cggb; ### #.#  ###.## ##.##  # #....###...#  ... ####....# ...  .!...##......># #.#  .......@.....†#  .......##......  ....... ##..... ..###.. #...... # ......##... .W#.:cggz<l.. ...#.#.###.< ....##  ..[.. :cggPj ### #.#  ###.## ##.##  # #....###...#  ... ####....# ...  .!...##......># #.#  .......@.....†#  .......##......  ....... ##..... ..###.. #...... # ......##... .W#... ...#.:cgg#.###.< ....##  ..[.. :cggf:cgg3:cgg:cggF^ _A phantom is nearby!:cgg< ((((WYou shoot a sling bullet.:cggu ( :cgg (((The sling bullet hits the phantom but does no damage.  You shoot a sling bullet.:cggŔ :cggj t...W...:cgg] g===6.3 (1.0)Rev :cggd :cgg a _The sling bullet barely misses the phantom.:cgg%( ((( You shoot a sling bullet. The sling bullet hits the phantom.  Lightning courses through the phantom!!;cggk  The phantom is severely damaged.You shoot a sling bullet. The sling bullet hits the phantom.;cggd;cgg]..W.;cggd7.4 (1.1Rev+ ;cgg;cgg` _The phantom is almost destroyed.;cgg)( ;cgg((You shoot a sling bullet.  The sling bullet hits the phantom but does no damage.;cggX  The phantom is almost destroyed.You shoot a sling bullet.  The sling bullet hits the phantom but does no damage.;cggz;cggV.W.;cgg,80;cgg;cgg ` _The phantom is almost destroyed.;cgg (((((((You shoot a sling bullet.;cggBd  The sling bullet barely misses the phantom.You shoot a sling bullet.;cgg|W......;cgge9Rev* ;cgg;cggb _The sling bullet closely misses the phantom.;cgg(a  You shoot a sling bullet. The sling bullet hits the phantom.;cggh,  The phantom is almost destroyed.You shoot a sling bullet. The sling bullet hits the phantom.;cgg2 \.;cggw '.;cggn /440;cgg ;cgg N _You destroy the phantom!;cggf{ ;cgg]| ;cgg ;cggz H _No target in view!;cgg{;cggw;cgg ;cgg];cgg;cgg+; _;cggמ;cgg;cggL;cgg5;cgg;cggR,;cgg;cgg;cgg{;cgg:Rev+ ;cggԮ;cgg8;cgg ### #.# ###.## ##.# ###### #....###... #....######....# ...;cgg [ #.!@..##......># #.#---4.4 (4 #.............†###.# #..........###.. #...........##...............###...#........#...###. ......##....##.;cggLP.. .. ..#...........#>P ......#.......##.###.# ....###... #;cgg;cggG---5.4 (5;cgg;cggA _Found a staircase to the Ecumenical Temple.# #......#.............†####...@......##......#.8.4 (3#...........##.......$.###...#.....P ......#.......##.#P.. .# ....###.... >.... ..[.. ##. .... #.P........## ..PP..P.#.....###.... .........# >.... ..[oo...?......# . .... o   orc wizard (asleep)o............ooo 3 orcs (asleep)o##........ cggL>H#.#.........####### #..........#....#####.....#.....##......##.........#...........#......#....##>cggf?..........#................###...#..##P...###.........##..#.#PPP@........#.......##.###PP>#.....PP..P.#.....###..........# >.... ..[oo...?# .. ....o......oo 2 orcs (asleep)...o## #.>cggH>cgg;J>cggK>cggeM>cgg]...oo.oo   orc wizard (wandering)o..ooo 3 orcs (2 wandering)>cgg^:==5.0)>cggm>cggvq% _The orc shouts!>cggǂ  ....#....###### .......#.....##.. ..##.........#...... ...#......#..## ....#...........## .......###... ##......P...###.........## #..#.#PPP.........#.....>cgg< ` ##.###PP@P.# #....PP..P.#.....### #..........# >.... ..[?......# .. .. .oo.o... .o..##...y   killer bee (wandering) .... #..o   orc wizard (wandering) #.?y......ooo 3 orcs (2 wandering)>cgg   A killer bee comes into view.Found a scroll labelled OKIOS FOOREPAI.  The orc wizard shouts! The orc shouts! The killer bee buzzes angrily.>cgg E  You hear an angry buzzing noise.>cggG >cgg ,>cgg >cgg֜ >cgg' >cgg o.o.o...o.##.yyy 2 killer bees (1 wandering)o...yoo6>cggb >cgg _A killer bee comes into view. _There is a staircase to the Ecumenical Temple here.?cgg[?cgg?cgg?cggK _You can't go up here!?cgg4?cgg?cgg:?cgg?cgg ?cgg?cgg?cgg o?.y.   killer bee.?cggZ ;*?cgg$  ooo 3 orcs  The orc wizard casts a spell.The orc wizard flickers and vanishes!?cggi ?cggj ?cgg{ o..o{7?cggx ?cgg<  #...# #...##.##.# ##...# #...# #._.# #._.###.#.## #._.# #._.# #...####...####...# ##...####...# ?cgg= ####.##.###.###._.###.###.##.######..#####.##...##.#####..## ##.#..####.##.##.####..#.## ####.####.####.#.#.####.####.## #...######...##...##...######...#Temple #._........_....@...._........_.# #...######...##...##...#### ####.####.####.#.#.####.####.######.#..####.##.##.####..#.####..#####.##...##.#####..## ####.##.###.[40?cgg}> Cm###._.###.###.##.#### #...####...## #...####...####...# #._.# #._.# ##.#.###._.# #._.#  #...# #...## #.##.##...# #...#  _Deactivating autopickup; reactivate with Ctrl-A.You climb downwards. Welcome to the Ecumenical Temple! Found eight altars.?cgg> S  Found a staircase back to the Dungeon.?cggB ____?cgg 6--8.2 (1.8?cgg+ D__?cgg i___?cggP -- _Reactivating autopickup.?cgg /  --more--Bcggb _There is a staircase back to the Dungeon here.Ccgg>, __.###.#.## #.__..####...####...# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## #..####.##.##.####..# Ccggs-y####.####.####.#.#.####.####.#### #...######...##...##...######..._........_....<...._........_..######...##.@.##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## ##...###### #...####..__#.## ##### ####.## #.##.#.#### ##### Ccggj4z____Ccgg5390 _Ccgg;T___Ccggr<Ccgg_  ..####...####...# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## #..####.##.##.####..# ####.####.####.#.#.####.####.#### #Ccgg <...######...##...##...######..._........_....<...._........_..######...##...##...######.. ####.####.####.#@#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####.#.###._.###.#...._#.###.###.###.##Ccggp c___Ccgg! '70Ccgg L__Ccggc Ccgg / ###.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## #..####.##.##.####..# ####.####.####.#.#.####.####.#### #...######...##...##...######..._........_....<...._........_CcggG ..######...##...##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##@##.####..#.## .#####.##...##.#####. ####.##.###.###._.###.###.##.####__..#.###.##.##.##..##Ccgg y__1Ccgg h___Ccgg Ccgg ,  ##..#####.##...##.#####..## #..####.##.##.####..# ####.####.####.#.#.####.####.#### #...######...##...##...######..._........_....<...._........_..######...##...##...######.. ####.####.####.#.#.####.####.### Ccgg_x ##.#..####.##.##.####..#.## .#####.##.@.##.#####. ####.##.###.###._.###.###.##.#### #...####...## #...####...####...##.##..###.#.#.##.####Ccgg?c___Ccgg&2Ccgg 7_CcggZCcggw #..####.##.##.####..# ####.####.####.#.#.####.####.#### #...######...##...##...######..._........_....<...._........_..######...##...##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####. ####.##.###.##.###.##.#### #...####...## #...####...####..._.# #._.# ##.#.###._.# #._#.#.###...####...#CcggCf_3Ccgg____ _There is a glowing silver altar of Zin here.CcgghCcgg$ Ccgg41####.####.####.#.#.####.####.#### #CcggwE...######...##...##...######...Ccgg_........_....<...._........_CcggU..######...##...##...######.. #CcggX###.####.####.#.#.####.####.### Ccgg ##.#..####.##.##.####..#.## Ccgg8X.#####.##...##.#####. Ccgg[####.##.###.###._.###.###.##.#### #CcggD(...####...## Ccggz#...####...Ccgg0_.# #._.# ##.#.###._.# #._Ccgg.CcggD..## #.##.##..Ccggu .Ccgg.Ccgg.Ccgg #CcggJ!...CcggQ#._.# #._.#CcggCcggCcggw_Ccgg _Ccgg_Ccgg_CcggCcggCcggH4 Ccgg _CcggCcgg6_Ccggg_Ccgg_CcggCcggDcggKU ...######...##...##...######..._........_....<...._........_Dcgg !/..######...##...##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####. ####.##.###.###._.###.###.##.#### #...####...## #...####...####..._.# #._.# ##@#.###._.# #._...## #.##.##... ##### ####.## #.##.#.#### ####._.#...# #...#Dcgg*___5Dcgg^/G__Dcgg341 _Found a bloodstained altar of Trog.Dcgg<u _........_....<...._........_..######...##...##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####. ####.##.###.###._.###.###.##.#### #...####...## #...####...####..._.# #._.# ##.#.###._.# #._.Dcgg..## #@##.##... ##### ####.##.#### #### ##.###.###.## ...##### #####DcggQ__Dcgg&6Dcgg[___DcggDcgg  ..######...##...##...######.. ####.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####. ####.##.###.###._.###.###.##.#### #Dcgg...####...## #...####...####..._.# #._.# ##.#.###._.# #._...## #.##.##... ##### ####.##.#### #### ##.###.###.## Dcgg=| ##.##.##.#####Dcggjb___Dcggb&7DcggPS__DcggDcgg} ###.####.####.#.#.####.####.###  ##.#..####.##.##.####..#.## .#####.##...##.#####. ####.##.###.###._.###.###.##.#### #Dcgg>f...####...## #...####...####..._.# #._.# ##.#.###._.# #._...## #.##.##... ##### ####.##.#### #### Dcggn##.###@###.##  ##.##.##. ##.#.#.##.#####...#Dcgg9_Dcggm&8Dcgg:_DcggKDcggV M...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## ###.##.###.###._.###.###.##.###..####...## #...####...####..__.# ##.#.###.__...# #...## #...# #... ##### ####.## #@##.#.#### #######.###.#####.##.##..## Dcggü ##.#.#.##.#####...#Dcgg/ b___Dcggk &9DcggI Dcgg EcggrelM_........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## ###.##.###.###._.###.###.##.###..####...## #...####...####..__.# ##.#.###.__...# #...## Ecgge#...# #... ##### ####.## #.##.#.#### #######.###.#####.##.##..#######EcggiH__Ecggj'80Ecgglc___Ecgg?nEcggM..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## ###.##.###.###._.###.###.##.###..####...## #...####...####.._Ecgg Y_.# ##@#.###.__...# #...## #...# #... ##### ####.## #.##.#.#### #######.###.###.##...Ecgg+l___Ecgg&1EcggGm___EcggEcgg`M###.####.####.#.#.####.####.###..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## ###.##.###.###._.###.###.##.###..####...## #.@.####...####..__.# ##.#.###.__...# #...## #.##.##...# #... ##### ####.## #.##.#.#### #####._.EcggIfd___Ecggg&2Ecgg;kT__EcgglEcggeM ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## ###.##.###.##Ecgg .###.##.###..####...## #...####...####..__.# ##.#.###.__ #...# #...## #.##.##...# #...#..#...Ecgg@6_Ecgg&3Ecgg[|____EcggZ _There is a glowing silver altar of Zin here.Ecgg M.#####.##...##.#####.  ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..# Ecgg3 ##..#####..#####..## ###.##.###.###._.###.###.##.###..####...## #...####...####.. #._.# #._.# ##.#.###._.# #._.##.#.#EcggG__EcggL-4 _Ecggd___EcggbEcgg!M####.##.###.###._.###.###.##.####.#####.##...##.#####. EcggK" ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#.#.####.####.####Ecgg" #..####.##@##.####..#  ##..#####.##...##.#####..## ###.##.###.###._.###.###.##.### #...####...## #...####...####...#___##.##..#Ecgg"Ecgg(K__Ecgg)&5Ecgg /R__Ecgg0Ecgg<EcggsM...####...####...# ##...####... Ecggq=####.##.###.###._.###.###.##.####.#####.##...##.#####.  ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######.._........_....<...._........_...######...##...##...######... ####.####.####.#@#.####.####.#####..####.##.##.####..#  ##..#####.##...##.#####..## Ecgg7####.##.###.###._.###.###.##.####__..#.###.Ecggt____Ecgg&6Ecggn!_Ecgg3_EcggEcgg4MEcgg#_.# #._.###.#.## #._.# #._...####...####...# ##...####... EcggG####.##.###.###._.###.###.##.####Ecggr.#####.##...##.#####. Ecgg7 ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######..Ecgg^_........_....<...._........_...######...##.@.##...######... ####.####.####.#.#.####.####.#####..####.##.##.####..###..#####.##...##.#####..###.###._.###.#....Ecgg _.# #.# Ecgge___Ecggh&7Ecgg_______EcggdEcggb|4MEcgg|...##.##.# ##..._.# #._.###.#.## #._.# #._Ecgg|...####...####...# ##...####... Ecgg}####.##.###.###._.###.###.##.####Ecgg2}.#####.##...##.#####. Ecggr} ##.#..####.##.##.####..#.## Ecgg}l###.####.####.#.#.####.####.###..######...##...##...######.._........_....@...._........_Ecgg}...######...##...##...######... ####.####.####.#.#.####.####.####Ecgg!~##.#..####.##.##.####..#.####...####Ecgg~/ ## #...####_..__#.##Ecgg̅______Ecgg†&8Ecggߋ`____EcggEcggˎ\ _There is a staircase back to the Dungeon here.EcggM#### ####.##.#### ####...##.##.# ##..._.# #._.###.#.## #._.# #._...####...####...# ##...####... EcggS####.##.###.###._.###.###.##.####.#####.##...##.#####.  ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.###..######...##.@.##...######..Ecgg_........_....<...._........_...######...##...##...######... Ecgg####.####.####.#.#.####.####.########Ecgg0(##.Ecgg_\._.# ##.#.###._EcggEcgg____Ecgg[-9 _Ecgg+;__Ecggfb____Ecgg)_Ecgg5 Ecgg\mM ##.###.###.## #### ####.#.##.# ##.#### ####...##.##.# ##...Ecggn^_.# #._.###.#.## #._.# #._...####...####...# ##...####... ####.##.###.###._.###.###.##.####.#####.##...##.#####.  ##.#..####.##.##.####..#.## ###.####.####.#@#.####.####.###..######...##...##...######.._........_....<...._........_ Ecggvn"#...######...##...##...######...#.....##..## #...####.EcggtS__Ecggsu'90EcggyQ__Ecggd|EcggM.##.##.##  ##.###.###.## #### ####.#.##.# ##.#### ####...##.##.# ##..._.# #._.###.#.## #._.# #._...####...####...# ##...####... ####.##.###.###._.###.###.##.####.#####.##...##.#####.  ##.#..####.##@##.####..#.## ###.####.####.#.#.####.####.###..######...##...##...######.. #._........_....<...._........_.#....#### .##.##.##...##._.cggsH__1Ecggd___EcggEcggWpM####.##.#.#.## #..##.##.##  ##.###.###.## #### ####.#.##.# ##.#### ####.EcggW..##.##.# ##..._.# #._.###.#.## #._.# #._...####...####...# ##...####... ####.##.###.###._.###.###.##.####Ecgg6X.#####.##.@.##.#####.  ##.#..####.##.##.####..#.## ###.####.####.#.#.####.####.### #...######...##...##...######...#_..<..##...##...EcggX Ecgg a__2Ecggc8_EcggeEcggWM...####...## ####.##.#.#.## #..##.##.##  ##.###.###.## Ecgg#### ####.#.##.# ##.#### ####...##.##.# ##..._.# #._.###.#.## #._.# #._...####...####...# ##...####... ####.##.###.##.###.##.####Ecgg8.#####.##...##.#####.  ##.#..####.##.##.####..#.## ####.####.####.#.#.####.####.####_#...###.##Ecgg7_Ecgg&3Ecggd___Ecgg5X _There is a broken altar of Ashenzari here.EcggI =M_.# #._.# ...####...## ####.##.#.#.## ..##.##.##  ##.###.###.## EcggJ #### ####.#.##.# ##.#### ####...##.##.# ##..._.# #._.###.#.## #._.# #._...####...#EcggJ  ##...####... ####.##.###.###._.###.###.##.####.#####.##...##.#####.##.#..####.##.##.####..#.##_ .#.#. EcggP ____EcggQ -4 _Ecgg9Z Y__Ecgg M.._.# #._.# ...####...## ####.##.#.#.## .##.##.##  Ecggd $##.###.###.## #### ####.#.##.# ##.#### ####...##.##.# ##..._.# #._.###.#@## #._.# #._...####...####...# ##...####... Ecgg ####.##.###.###._.###.###.##.######..#####.##...##.#####..##...Ecgg c___Ecgg) &5Ecgg _____Ecgg 7 _Found a burning altar of Makhleb.Ecgge/ CM#### ####.._.# #._.# ...####...## ####.##.#.#.## .##.##.##  ##.###.###.## #### ####.##.#### ####.Ecggb0 ..##.##@# ##..._.# #._.###.#.## #._.# #._...####...####...# ##...####... ####.##.###.###._.###.###.##.####_.<.Ecgg5 {____Ecgg6 &6Ecgg9 o___Ecgg: Fcggn[?25h[?0c  Search for what [Enter for "glove", or ? for help]? Gcgg [?25l[?1cGcggk'`___okaGcgg(Gcgg-c____Gcgg/X _Can't find anything matching that.Gcgg@  ...# #...__..####...#####.##.#.#.## ##..##.##.#####.###.## ##### ####.#.##.# ##.#### ##### #...# #...# ##...# #...__.###.#@## #.__..####...####...# ##...####.. #Gcgg z###.##.###.###._.###.###.##.###_.<. #...######...##...##...######...# GcggM X___GcggH -7 _Gcgg n___Gcgg HcggƍE __..####...#####.##.#.#.## ##..##.##.#####.###.## ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #..._HcggO_.###.#.## #.__..####...####.@.# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## _... ####.####.####.#.#.####.####.#### HcggS___Hcgg~&8Hcggޘn___HcggHcggv ..####...#####.##.#.#.## ##..##.##.##.###.###.## ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #...__.###.#.## #.__Hcgg..####...####...# ##...####.. ####.##.###.##.###.##.###  ##..#####.##...##.#####..## #..####.##.##.####..#_Hcgg.#.#.##.#..####.##.##.####..#.##Hcggvs___Hcgg$&9HcggU d___Hcgg` _There is a broken altar of Ashenzari here.Hcggu ###.##.#.#.## ##..##.##.###.###.###.## ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #...__.###.#.## #.__Hcgggv..####...####...# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####..#####..## #..####.##.##.####..# Hcggv ####.####.####.#.#.####.####.####_#...###.####..#####.##...##.#####..##HcggY|S__Hcggf}/500 _Hcgg8_HcggHcgg^  ##..##.##.###.###.###.## ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #..._Hcgg_.###.#.## #.__..####...####...# ##...####.. ####.##.###.###._.###.###.##.### Hcgg/: ##..#####.##...##.#####..## #..####.##@##.####..# ####.####.####.#.#.####.####.#### #Hcgg]...######...##...##...######..._..<..Hcgg##...##... Hcgg####.##.###.###._.###.###.##.#### HcggUm___Hcgg1&1HcggLn___HcggHcggxd` ###.###.## ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #...__.###.#.## #.__Hcggd..####...####...# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## #..####.##.##.####..# ####.####.####.#@#.####.####.#### #...######...##...##...######...HcggeI_........_....<...._........_....####Hcgg8e.##.##.##...##HcggZe._. Hcgge#...####...## #...####...####...# HcggkK__Hcggl&2Hcgg?oQ__HcggpHcggn ##### ####.#.##.# ##.#### ##### #...# #...##.##.# ##...# #...__.###.#.## #.__..####...####...# ##...####.. ####.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## Hcgg#..####.##.##.####..# ####.####.####.#.#.####.####.#### #...######...##.@.##...######..._........_....<...._........_Hcgg_..######...##...##...######.......##..## #...####. Hcgg/#._.# #._.# ##.#.###._.# #._.# Hcgg^___Hcggh&3Hcggy____HcggJcgg ...# #...# ##...# #..._Jcgg4_.###.#.## #.__..####...####...# ##...####.. #Jcggt###.##.###.###._.###.###.##.###  ##..#####.##...##.#####..## Jcgg#..####.##.##.####..# Jcgg####.####.####.#.#.####.####.#### #Jcgg...######...##...##...######...Jcgg_........_....@...._........_Jcgg3..######...##...##...######.. ####.####.####.#.#.####.####.###JcggM"###Jcgg###...# ##.#.###._ #...# #...## #.##.##...# #...# Jcggkw____Jcgg&4Jcgg_____Jcggd _There is a staircase back to the Dungeon here.Kcgg? ____As you read the scroll of teleportation, it crumbles to dust.Kcgg@&5Kcgg'@7Tele KcggEx____KcggH\ _You feel strangely unstable.Lcggo___Lcgg=______Lcgg|LcggF _Unknown command.Lcgg^ :_Lcgg ______Lcgg6 ____Lcgg6 -6 _Lcgg t____Lcgg Lcgg  .............#....######.. .............#.....##..... ..##.........#............ ...#......#..........##...Lcgg 3 ..........#...........##.. ................###...#... ##......P...###......... #..#.#PPPy........#......Dungeon:7Lcgg  ##.###PP@P........#...... Lcggֻ #....PP.oP.#......Lcgg1  #..........# >.... ..[. ....oo......# .. .... .............. LcggT .o..##......... y   killer bee Lcggz .... #......... o   orc wizard Lcgg ... #.?....... ooo 3 orcs Lcgg LcggB T  You climb upwards. Welcome back to the Dungeon!Lcgg Lcgg Lcgg oo.?.oThe killer bee barely misses you. x2; The orc hits you with a +0 dagger.LcggE1 c7-=7.7 (2.5Lcgg@ LcggF _The killer bee stings you but does no damage. _There is a staircase to the Ecumenical Temple here.Mcgg McggxMcggkMcgg~F _Unknown command.Mcgg( (((((((You shoot a sling bullet.Mcgg  The sling bullet barely misses the killer bee.You shoot a sling bullet.Mcgg>. p......yMcgg2 4  ## . ### ### #.#Mcgg3 S###.## ##.## #### #....###...# ...######....#....# ....##......># #@# ............†###.### ......##......#....## # .......##...........##.# .###...#........#....#.## .........##....##.......# ....#...........#....##.# ....#.......##.###.<....# ....###......... #......#The sling bullet barely misses the killer bee.Mcgg6 McggB McggB d-8.8 (1.1Rev McggE McggG @ _Your surroundings suddenly seem different.Ncgg~aNcgga8-NcggeNcgg@gF _Unknown command.NcggLn 4Ncggn Ncgg=s Ncggw i8- _Ncggx Ncggx Ncgg`y Ncgg~ Ncgg~ !Ncgg# Ncggà Ncgg K9=Ncgg Ncgg 1 _HP restored.NcggB Ncgg} Ncgg Ncgg3 Ncgg ,Ncgg Ncgg NcggD Ncggp Ncgg Ncggž Ncgg[ Ncgg 9=NcggA Ncgg! Ncgg ,Ncggz Ncgg NcggK Ncggj Ncgg Ncgg Ncgg4 ,NcggU Ncgg Ncgg ,Ncgg~ Ncgg Ncgg Ncgg Ncgg Ncggj Ncgg/ ,Ncgg Ncgg Ncgg2 Ncgg} Ncgg Ncgg Ncgg Ncgg6 Ncgg+ NcggF Ncgg G........##...........##.# Ncgg ..###...#........#....#.## #.........##....##.......# .....#...........#....##.# Ncgg .....#.......##.###.<....# .....###..........#......#  >.... ..[...##.........# # .. .y.....#...###.### ........@.)# .#Ncgg# Y .......)...# ## ##............  .....[........# NcggA ########...#### #... Ncgg_ y   killer bee (wandering) #... Ncgg} 8##.. Ncgg  24.8 (16.0)  A killer bee comes into view.Ncggc Ncgg Ncgg] Ncgg* H yyyNcggj yy 2 killer beesThe killer bee buzzes angrily. You hear an angry buzzing noise. x2Ncgg 5==5.8 (17Ncgg Ncggu 7 _The killer bee moves out of view.OcggA (((((((You shoot a sling bullet.Ocgg_&  OcggnThe sling bullet barely misses the killer bee.You shoot a sling bullet.OcggOcggEOcggOcgg:OcggROcggD.y.y.....yy 3 killer bees=6.0)Rev OcggOcgge _The sling bullet closely misses the killer bee.OcggGD(((((((Ocgg5TYou shoot a sling bullet. _The sling bullet closely misses the killer bee.The sling bullet misses the killer bee.You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.  Lightning courses through the killer bee!!OcggW 2OcggbOcggddOcgg_gOcgghOcggNv.†....y.....yOcgg#x.77OcggӁOcggnN _You kill the killer bee!Pcggs##......#....## # .....##...........##.# .###...#........#....#.## ....##....##.......# #...........#....##.# #.......##.###.<....# ....###..........#......# >.... ..[...##.........#  .. y.†....#.@.###.### . ....y.....)# .# Pcgg@v ....y..)...# ## ##............ .......[........#########...######...#...##..Pcgg'PcggPcggPcgg&PcggW..y.   killer beePcgg0---8PcggTPcggPcgg g.....†###.### ##......#....## # .....##...........##.# ###...#........#....#.## ....##....##.......# #.....#....##.# #.......##.###.<....# ...###..........## Pcgg H.... ..[...##..@......# . y.†....#...###.### ......y...)# .#  .......)...# ## . ##............ ......[........# ########...######...#...PcggPcgg-PcggPcggPcgg2y.yy 2 killer beesPcggB---9PcggS(Pcgg*Pcggk ##>###.## .....†###.### ##......#....## # .....##...........##.# ##...#........#....#.## ....##....##.......# #...........#....##.# #.......##.###.<....# ###..........## . ..[...##.........# Pcgg]l G. y.†....#y..###.### .......y..)# .#  .......)...# ## ##............ .....[........#########...######...Pcggp Pcggq Pcggs PcggSt Pcgg\ iy.y.Pcggɀ '30PcggΉ Pcgg Pcgg ######....#....# ##>###.## .....†###.### ##......#....## # ....#....##.# #...#........#....#.## ....##....##.......# #....#....##.# #.......##.###.@....# ###..........#......# PcggU h. ..[...##..y......# y.†....#.y.###.###..........)# .#.......)...# ####.................[........#########...####Pcgg< PcggŶ Pcgg Pcgg hy.y.Pcgg 6=1Pcgg7 Pcgg _The killer bee misses you. _There is a stone staircase leading up here.Qcgg!Qcgg!Qcgg,*Qcgg+Qcgg07>y.Qcgg7&2Qcgg?Qcgg U  ##...................†####. #...#......................  ####..##.....................  .....#.....##.........  ###.##.##..####...%.....  #..#.....###..........  ##......)..#....#.##....###.###  #...###y..#............##Qcgg v6  #.......###....>...  #.......#............#.........  #.......##.##......=..... ###....##....##............ #.......##...#................... #..##...##.#.........#........##. y   killer bee #.####..#..#<.......##....)...##. ...####.....÷.##.......###....... .)...#......#.#.................. _The killer bee barely misses you. The killer bee misses you. x2Qcgg[QcgggQcgg4p5-4.3 (2.5QcggcyQcgg|} _You climb upwards. _There is a stone staircase leading down here.QcggՊB((Qcgg[  You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.Qcgg5 .yThe killer bee is lightly wounded.  The killer bee barely misses you.Qcggm c===5.4 (1.1Rev Qcgg\ Qcgg C _The killer bee stings you but does no damage.Qcgg B((Qcgg/ The killer bee barely misses you. _The killer bee stings you but does no damage.  You shoot a sling bullet. The sling bullet misses the killer bee.  You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.Qcgg0 .yThe killer bee is lightly wounded.  The killer bee closely misses you.Qcggr1 c60Rev+ Qcgg; Qcgg8= C _The killer bee stings you but does no damage.Qcggx ~ ((You shoot a sling bullet.Qcgg_$  The sling bullet barely misses the killer bee.You shoot a sling bullet.QcggӮ+ .Qcgg`yThe sling bullet barely misses the killer bee.QcggU4--7QcggQcggr _The killer bee stings you. The killer bee barely misses you.Rcgg~ ((You shoot a sling bullet.Rcgg@  The sling bullet closely misses the killer bee.You shoot a sling bullet.Rcggm .yThe sling bullet closely misses the killer bee.Rcgg5--8.5 (1.1Rev* RcggRcgg _The killer bee misses you. The killer bee closely misses you.Rcgg~ ((You shoot a sling bullet.Rcggf  The sling bullet completely misses the killer bee.You shoot a sling bullet.Rcgg= .yRcggNThe sling bullet barely misses the killer bee.Rcgg,90RcggRcggF _The killer bee stings you but does no damage. x2Rcgg~ ((You shoot a sling bullet.Rcgghs  The sling bullet barely misses the killer bee.Rcgg  .yYou shoot a sling bullet. The sling bullet misses the killer bee.The killer bee stings you but does no damage.Rcggġ.40.6 (1.1Rcgg٨Rcgg#W _The killer bee barely misses you.Rcgg  You shoot a sling bullet. The sling bullet hits the killer bee.Rcgg P ((RcggD eThe killer bee is moderately wounded.You shoot a sling bullet.Rcggc .yThe sling bullet closely misses the killer bee.The killer bee stings you but does no damage.Rcgg 4610Rcgg Rcgg! X _The killer bee closely misses you.Rcggk d  You shoot a sling bullet. The sling bullet hits the killer bee.Rcgg ((The killer bee is moderately wounded.You shoot a sling bullet.Rcggd ~ .yThe sling bullet closely misses the killer bee.Rcgg CThe killer bee stings you but does no damage.Rcgg` &2Rcgg Rcgg3 W _The killer bee barely misses you.Rcgg>~ ((You shoot a sling bullet.Rcgg&  The sling bullet closely misses the killer bee.You shoot a sling bullet.Scgg .yYou shoot a sling bullet.  The sling bullet closely misses the killer bee.  You shoot a sling bullet.  The sling bullet barely misses the killer bee.killer bee barely misses you. The killer bee stings you!  You are poisoned.Scgg58===--3Pois Rev* Scgg(Scgg49--ScggZ#/  --more--Scgg/ _The killer bee poisons you!Scgg{ \You shoot a sling bullet. The sling bullet hits the killer bee.Scgg~ r((The killer bee is heavily wounded.Scgg  .yYou shoot a sling bullet. The sling bullet misses the killer bee.You feel very sick.The killer bee completely misses you. The killer bee stings you!  You are more poisoned.Scgg 48======----4Pois Scgg' Scgg( ;----Scgg3 /  --more--Scgg7 2 _The killer bee poisons you!ScggU B((ScggYN  You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.Scgg .yThe killer bee is almost dead.You feel very sick.Scgg \4-5Scgg 7Pois Scgg Scgg S _The killer bee closely misses you. x2Scgg$ N-ScggScggF _Unknown command.Scgg~ ((You shoot a sling bullet.Scgg'  The sling bullet closely misses the killer bee.You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.TcggAi 36=======---Pois The killer bee is almost dead.You feel very sick.Tcggo/  --more--Tcgg+Gr .y The killer bee barely miTcggGsses you. The killer bee stings you.  You are more poisoned.TcggHB---6TcggPTcggR) _The killer bee poisons you!Tcggs5\You shoot a sling bullet. The sling bullet hits the killer bee!TcggW;*.Tcgg;1Tcggp((You kill the killer bee!TcggIC..  You shoot a sling bullet.TcggzNe2-207TcggTTcggUS _You feel very sick.TcgglTcggm8-TcggtTcggrvF _Unknown command.TcggTcggb Tcgg'Tcgg *^ _You are too injured to fight recklessly!Tcgg Tcgga Tcgg Tcgg!  You start resting.29-Tcgg% 26--Pois Tcgg& Tcgg6) e _You feel very sick. x2Tcggl) K4--Tcgg, Tcgg/ Tcgg0 k3-Rev+ Tcgg1 Tcgg?4 Tcgg4 @1-Tcgg5 Tcgg8 Tcgg8 D0--Tcgg9 Tcgg@ z-TcggA R19Rev TcggTB TcggD Tcgg'E 88TcggMF TcggiU D=---Tcgg] E 56.6 (9 _You feel sick. x8TcggE_ z---7.6 (10.0)Rev TcggLf Tcgg|h [ _You are no longer poisoned.UcggUcggcUcggUcggNUcggUcggMUcggUcgge0UcggUcggUcggi79UcggUcggG,Ucgg.Ucgg,UcggUcggUUcgg820UcggUcggM,UcggUcgg'BUcggTUcggۣI1=UcggޤUcgg=,Ucgg UcggUcgg3UcggUcggi2=UcggͰUcggUcgg:UcggeUcggUcggUcgg UcggjUcggB3=UcggUcggn,UcggUcgg,Ucgg-Ucgg,UcggUcggUcggS4=UcggUcgg,Ucgg3Ucgg),UcggUcggM5UcggUcgg,Ucgg~Ucgg,UcggUcgg6=Ucgg7UcggUcggUcggUcgg%77Ucgg2=UcggUcgg+,UcggnUcggqUcggUcggUcggUUcggUcggkUcggUcggG78Ucgg.XUcgg,UcggUcggUcggT29=UcggUcgg ,Ucgg( Ucgg ,UcggZUcggLUcggL30=UcggUcgg,UcggGUcggVUcggUcggUcgg$Ucggo91UcggUcgg,Ucgg0 Ucgg!,Ucgg#Ucgg%i2=Ucgg'Ucgg+)Ucggc)Ucgg*Ucgg,Ucgg,Ucgg.Ucgg0UcggY0Ucggb1UcggG3Ucgg3#3Ucgg3(=Ucgg4Ucgg7UcggY7Ucgg8Ucgg:Ucgg;Ucgg@<Ucgg>Ucgg#?94UcggCUcggSFUcggFUcggGUcggIUcgg+JUcgg4KUcggMUcggJM#5UcgglM0=UcggNUcggPUcggPUcggQUcggSUcgg TUcggHUUcggWUcgg)XK6=UcggYYUcggP[Ucgg[Ucgg\Ucgg^Ucgg^Ucgg_Ucgga,UcggcUcggeUcgg`e97UcggfUcggiUcggIiUcgggjUcggAlUcggtlUcggmUcggoUcggo=8=UcggpUcgg@qUcggsUcggJsUcgg}tUcggvUcggvUcggwUcggzUcggjzK9=Ucgg{Ucgg}Ucgg~UcggEUcgg1UcgghUcggUcggUcgg܄:40UcggFUcgg6UcggUcggUcggsUcggUcggUcggaUcggݏUcgg<Ucgg3Ucggy#1Ucgg0=UcggUcgg UcggGUcggϘUcggUcggUcggUcggӝUcgg#2Ucgg/(=UcggUcgg۠UcggUcggߡUcggUcgg٤UcggZUcggO3UcggUcggک,UcggUcggUcggTUcggUcgg4=Ucgg_,Ucgg(UcggJUcggUcgg"UcggWUcggK5=UcggKUcggz,UcggBUcgg{,UcggBUcgg,UcggUcggUcgg#6Ucgg.0=UcggUcgg,,UcggUcggUcggYUcggUcgga7=UcggUcggxUcggUcgg;Ucgg?,UcggUcgg]Ucgg98UcggUcgg9,UcggUcggHUcggtUcgg4Ucgg{UcggN49=UcggRUcggc,Ucgg Ucgg+,UcggUcggw,UcggUcggd50=UcggUcgg,UcggCUcggPUcgg%1UcggUcggs,UcggUcgg,UcggUcgga2=UcggUcgg,UcggUcgg Ucgg:UcggUcggUcgg?3=Ucgg;UcggUcggUcggUcggUcggUcgg9UcggUcggf;4UcggUcgg,Ucgg.UcggEUcggnUcggUcggO,UcggUcggUcgg;K5=UcggUcgg ,Ucgg Ucgg Ucgg Ucgg Ucgg UcggU6=UcggUcgg,UcggUcggUcggUcggUcggUcgg%7UcggUcggUcggUcgglUcggxUcggUcgg}UcggUcggUcggD8=Ucgg~UcggUcggUcgg`UcggnUcggUcgg2 UcggJ!Ucgg!UcggL"Ucgg#Ucgg#U9=Ucgg$Ucgg%,Ucgg\&UcggS'Ucggt'Ucgg(Ucgg4)Ucggj)&60Ucgg&*Ucgg8+Ucggd+Ucgg+Ucgg -Ucgg/-Ucgg-Ucgg/Ucgg/K1=UcggT1Ucgg}2,UcggE3Ucgg4,Ucgg672=Ucgg8Ucgg:Ucgg ;Ucgg/<Ucggz>,Ucgg?UcggAUcggA%3UcggnBUcggfCUcggCUcgg,DUcgg=E,UcggFUcggFUcggGUcggGUcgg"Ia4=UcggxIUcgg-NUcggOUcggPU5=UcggHQUcgg\RUcggxRUcggSUcggST,UcggTUcggHVUcggV6UcggWUcggX,UcggYUcggAZ,UcggZUcgg]UcggL]K7=Ucgg^Ucgg a,UcggaUcggbUcgg13.0)VcggFVcgg9######....#....# .##......>###.## .........†###.### ...##....## # ....##....##.# #...#....#.## ......##....##.......# .#.....#...y##.# Vcgg:7 .#.##.#### .###..........## .. ..[...##...#  y.†..###.###  ..........)# .#  .......)...# ##y   killer bee  ##............ .....[........# ########...####VcggE<:=VcggLVcggP5=5.1 (2.5Vcgg/Vcgg _You climb downwards. The killer bee closely misses you. x3 _There is a stone staircase leading up here.VcggVcgg~VcggVcggfF _Unknown command.VcggQ Vcgg' Vcgg Vcgg¬ Vcgg -6.1 (1.0Vcggɳ Vcgg`  ##...................†####. #...#......................  ####..##.....................  .....#.....##.........  ###.##.##..####...%.....  #..#.....###..........  ##......)..#....#.##....###.###  #...###...#............##6  #Vcggka......y@.....###....>...  #.......#......#.........  #.......##.##......=..... ###....##....##............ #.......##...#................... #..##...##.#.........#........##. #.####..#..#<.......##....)...##. ...####.....÷.##.......###....... .)...#......#.#.................. _The killer bee closely misses you. The killer bee misses you.VcggaVcgg:hVcgg5-7.6 (2.5VcggWVcgg _You climb upwards. _There is a stone staircase leading down, spattered with blood here.Wcgg;d  You shoot a sling bullet. The sling bullet hits the killer bee.Wcggh  The killer bee is lightly wounded.  You shoot a sling bullet. The sling bullet hits the killer bee.Wcggt  The killer bee is moderately wounded.Wcggc===8.7 (1.1Rev WcggWcggS _The killer bee misses you. x2Wcggl (((((((You shoot a sling bullet.Wcgg_  The sling bullet closely misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.Wcgg, ......yThe killer bee is heavily wounded.The killer bee misses you. The killer bee stings you.  You are poisoned.Wcgg~3===---90Pois Rev+ WcggzWcgg,:---Wcgg5/  --more--Wcgg / _The killer bee poisons you!Wcgg ^(((((((You shoot a sling bullet.WcggV/ The sling bullet closely misses the killer bee.You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.Wcggb ......yThe killer bee is heavily wounded.You feel very sick.Wcgg8 u58===-30Wcgg: Wcggm 8-Wcgg /  --more--Wcgg`p _The killer bee stings you. The killer bee barely misses you.Wcgg!w You shoot a sling bullet. The sling bullet hits the killer bee.Xcggj The killer bee is severely wounded.You shoot a sling bullet. The sling bullet hits the killer bee.XcggThe killer bee is almost dead.1==---1Rev* XcggXcggJ} _You feel sick. The killer bee completely misses you. The killer bee stings you.XcggXcgg:---Xcgg%XcggF _Unknown command.Xcgg  You shoot a sling bullet. The sling bullet hits the killer bee.  Lightning courses through the killer bee!Xcgg:.Xcgg!Xcggf (((((((You kill the killer bee!Xcggݠ,.......Xcgg_6032XcggުXcggɬ> _You shoot a sling bullet. You feel sick.Xcgg;nXcggnXcggxXcgg{F _Unknown command.XcggJ(Xcgg)Xcggs0Xcggu2H _No target in view!XcggUK 48-XcggO 7-Xcgg}P XcgguQ g6Rev+ Xcgg@R Xcgg`X ^5----Xcgg0a  6.7 (4 _You start resting. You feel sick. x5----7.7 (5Rev+ Xcgge XcggNf  Xcgg~f U_You are no longer poisoned.Ycgg 6=Ycgg(PRev YcggYcgg׏b7=YcggmYcgg,YcggYcgga7YcggΙYcgg8Ycgg28YcggաXYcgg,YcggȥYcgg*YcgglYcggYcgg0YcggN49=Ycgg*Ycgg9,YcggYcggYcgg\YcggYcggӷYcgg B50=Ycgg)YcggYcggYcggٻYcggYcgg,YcggYcggNYcgg%1YcggYcgg[,YcggYcgg,Ycgg3YcggeYcggK2=Ycgg&Ycgg-,YcggYcgg,YcggYcgg=YcggN3=Ycgg5YcggYcggYcgg]YcggNYcggyYcggYcggYcggYcggYcggK;4YcggYcggV,YcggHYcggjYcggYcggYcggYcggYcggD5=YcggqYcgg,YcggYcgg,YcggYcggYcgg@U6=YcggYcgg,YcggYcgg7YcggsYcggYcggYcgg%7YcggFYcggYcggYcggYcggI,Ycgg0Ycggp,Ycgg YcggW Ycgg K8=YcggY Ycgg ,Ycgg YcggI,YcggYcgg YcggEU9=Ycgg.YcggYcgguYcgg\YcggYcggYcgg,YcggYcgg$&60Ycgg#YcggR&Ycgg&Ycgg'Ycgg *YcggF*YcggZ+Ycgg-Ycgg.YcggC.D1=Ycgg/Ycgg1Ycgg1Ycgg3YcggH5Ycgg|5Ycgg9BYcggl:Ycgg<Ycgg?=#2Ycgga=2=Ycgg>YcggIAYcggAYcggBYcggE,Ycgg FYcggtHYcggH%3YcggJYcggFLYcggLYcggMYcggOYcgg^PYcggQYcggSYcgg)TK4=YcggUYcggW,Ycgg+YYcggV[,Ycgg\Ycgg_Ycgg`_U5=Ycgg$aYcggpc,YcggdYcgg^g,YcgghYcgg$kYcggvk%6Ycgg$mYcggzpYcggpYcggrYcggtYcggtYcgggvYcggyYcgg9yYcggzYcgg>}Ycgg}K7=Ycgg~YcggWYcggYcggYcggYcgg%YcggYcggYcggYcgg&N8=YcggYcggYcggCYcggݐYcggYcgg7YcggYcgg_ _You start resting.Ycgg1811.7 (74.0)Ycgg"YcggkS9=2.7 (75YcggYcgg," _HP restored.YcggYcggYcggoYcggVYcgg 13.7 (1.0)Ycgg|Ycgg t######....#....# .##......>###.## .........†###.### ...##....## # ....##....##.# #...#....#.## ......##....##.......# .#.YcggP S....#....##.# 7 .#.##.#### .###..........## .. ..[...##...#  y.†..###.###  ..........)# .#  .......)...# ##  ##............ .....[........# Ycgg 9########...####Ycgg :=Ycggo YcggD -5.2 (2.5Ycgg+ Ycggl0 } _You climb downwards. _There is a stone staircase leading up here.Zcgga/IZcgg%5Zcggx9Zcgg>: _Zcgg?Zcgg;D,ZcggEZcggGZcggMZcggfMZcggwNZcggSZcggXZcggOXZcggYZcgg\Zcgg b,ZcggcZcgghZcggOmZcggmZcggnZcggJpZcggrZcgg(sZcggGuZcggEyZcgg=,Zcgg6ZcggZcggZcggZcgg8Zcgg’Zcggo,ZcggZcggZcggZcggԟZcggɠZcggOZcgg,ZcggӯZcgg3ZcggնZcgg1Zcgg3ZcggZcgg#ZcggqZcgg ZcggZcgg,ZcggZcggZcggo,ZcggjZcggZcggZcggOZcggZcggZcgg,ZcggZcggpZcggoZcggZcggZcggQZcgg\,ZcggZcggmZcgg,Zcgg=ZcggZZcggZcgggZcggZcggZcggnBZcggZcggZcgg^ZcggZcggZcgg,ZcggZcgg Zcgg BZcgg ZcggZcggZcggZcggZcggw,ZcggTZcggZcgg  #.#.........# ###....####.# . ##.......### ..#...#......## Zcgg!.....######...# .......#.....## ...##.........# ###.......# #@###...## #.......# .## ...Y....# ........... #...........Y   ice beast (asleep) ............ ............. Zcggq*043.2 (28.0)Zcgg +,4.2 (29Zcggc0Zcgg=] _An ice beast comes into view.Zcgg$h ....#  .#  . .###  ..##  ###...#  #.....##  .......#  ###.......#  #@#  #.......#  .......##  ...Y....#  ...........  #...........  ............  ............. Zcgg%Ov ....#  .#  . .###  ..##  ###...#  #.....##  .......#  ###.......#  #@#  #.......#  .......##  ...Y....# ........... #...........  ............ ............. ZcggPZcggSa _An ice beast is nearby!Zcgg ((YYou shoot a sling bullet.Zcgg (((((The sling bullet hits the ice beast but does no damage.  You shoot a sling bullet.Zcgg Zcgg z.Y......Zcggy g===5.3 (1.1)Rev Zcgg Zcgg c _The sling bullet barely misses the ice beast.Zcgg ( You shoot a sling bullet. The sling bullet hits the ice beast!Zcgg ((((((The ice beast is moderately wounded.You shoot a sling bullet.Zcgg~ Zcgg AY......60Rev+  _The sling bullet barely misses the ice beast.Zcgg }  You shoot a sling bullet.  The sling bullet hits the ice beast but does no damage.Zcggx  The ice beast is moderately wounded.You shoot a sling bullet. The sling bullet hits the ice beast.Zcgg ZcggB q The ice beast is heavily wounded.Zcggl1---7.4 (1.1Zcgg Zcgg#Zcggp:_The ice beast hits you. The ice beast freezes you![cggSiYou shoot a sling bullet. The sling bullet hits the ice beast.  The ice beast is heavily wounded. _The ice beast hits you. The ice beast freezes you!  The sling bullet hits the ice beast but does no damage. [cgggT, Lightning courses through the ice beast![cgg!YD.[cggZ (((((((You kill the ice beast![cggmQ.......[cggr2---880Rev* [cgg)s[cggw[cggz/ _You shoot a sling bullet.[cgg[cgg[cgg[cggSH _No target in view![cgg\[cgg[cgg[cggɚ[cggWRev+ _[cgg[cgg[cggr[cgg/[cggt&3[cgg[cgg,[cggn[cggPRev [cgg[cggk[cgg#4[cgg)=[cgg[cgg[cgge[cgg[cgg[cgg,![cgg [cgg0[cgg[cgg4[cggU5=[cgg[cggB[cgg[cgg6[cgg[cgg[cgg %6[cgg[cgg",[cgg[cgg`,[cgg;[cgg[cggK7=[cggQ[cgg-,[cgg.[cgg[cgg[cgg[cggR[cggU8=[cggd[cgg,[cgge[cgg,[cggU[cgg[cggK9=[cgg[cgg 1 _HP restored.[cggh[cgg[cgg[cgg[cgg,[cgg[cgg[cgg[cgg[cgg[cgg [cgg1 . ##.......### ..#...#......## .....######...# .......#.....##[cggN ...##.........#. ###.......#o.. #.###...##.....####.......#.......@.......##---....#...#. #.[cggf....##.......[cgg...o   orc (wandering)##.#[cggV .....###[cggP073.4 (25.0)[cgg!Q.o[cgg!?=---[cgg!%4.4 (26[cgg=([cgg#0q _An orc comes into view. It is wielding a +0 whip.\cgg (((((((You shoot a sling bullet.\cggx}o   _An orc comes into view. It is wielding a +0 whip.   The sling bullet closely misses the orc.  You shoot a sling bullet.  The orc shouts!  The sling bullet hits the orc.\cgg3\cgg;`..o.....\cgg<;===5.3 (0.9)\cgg<,Rev \cggB\cgg3F^ _The orc is moderately wounded.\cggv (((((((You shoot a sling bullet.\cggE  The sling bullet closely misses the orc.You shoot a sling bullet.\cggq\cgg ?.......\cgg-6.3 (1.0\cgg\cgg8^ _The sling bullet closely misses the orc.\cgg+\cgg\cgg.\cggH _No target in view!\cgg:E4\cggI\cggLH _No target in view!\cgg^: \cgg: \cgg; \cgg"? \cggG  . ##.### ..#...#......##. .....######...#.. .#.....##... ...##.#... ###.#.o #.###...##.####.#.......##.#.#.. #.. ##. .... ...\cgg H o   orc ##...# .....#.##\cggL &0\cgg$T U.o\cggX <---7.3 (1 _\cgg[ \cgg] \cggGv (You shoot a sling bullet.  The sling bullet hits the orc but does no damage.\cgg  The orc is moderately wounded.You shoot a sling bullet. The sling bullet hits the orc.\cgg \cgg U.o\cgg 7===8.4 (1.1\cgg \cggd \ _The orc is severely wounded.\cgg= (((((((You shoot a sling bullet.]cgg  The sling bullet completely misses the orc.You shoot a sling bullet. The sling bullet hits the orc.]cgg)]cggL......)]cggc90Rev+ ]cgg#]cgg6&G _You kill the orc!]cgg)4]cggx]cgg#H _No target in view!]cgg]cggɹ]cgg(^ _No target in view!]cggQ]cgg]cgg]cgg]cggc]cgg . ##.###.../...#...#......##.........######...#..........#.....##.....##.#... ###.#.. #.###...##Y......####.#..###.....#.#.. #.... ##.#.. ......## ....Y   sky beast (wandering) ##.....#]cggx .....#..##]cgg&0]cgg6---80.4 (1]cgg` ]cgg= _A sky beast comes into view.Things that are here: _a +0 whip; a +0 robe; an orc corpse]cgg D(((((((]cgg  YYou shoot a sling bullet. The sling bullet misses the sky beast.You shoot a sling bullet. The sling bullet hits the sky beast.]cgg ]cggX `....Y.....]cggY! 0===1]cgg' ]cgg+ 7 _The sky beast is lightly wounded.]cgg* ((((( You shoot a sling bullet. The sling bullet hits the sky beast!]cgge  The sky beast is moderately wounded.You shoot a sling bullet. The sling bullet hits the sky beast.]cggL8]cgg:]cggD..Y...2.5 (1.1]cggJ]cggoNa _The sky beast is heavily wounded.^cggQ (((((((You shoot a sling bullet.^cgg[  The sling bullet barely misses the sky beast.You shoot a sling bullet.^cggV...Y...^cggzl3.4 (0.9Rev* ^cgg^cggc _The sling bullet barely misses the sky beast.^cgg (((You shoot a sling bullet. The sling bullet hits the sky beast.^cgg#  The sky beast is heavily wounded.You shoot a sling bullet. The sling bullet hits the sky beast.^cgg^cggj^cgg-S..Y.^cgg-4.5 (1.1^cgg$^cgg&b _The sky beast is severely wounded.^cgg  (((((((You shoot a sling bullet.^cgg-&  ^cggnThe sling bullet closely misses the sky beast.You shoot a sling bullet.^cgg^cgg!^cggz ......Yff   sleepcap (wandering)  The sling bullet barely misses the sky beast.^cggy,50^cggͫ^cgga ^cggM_A sleepcap comes into view.^cggD[ f  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.^cgg  The sky beast is severely wounded.You shoot a sling bullet. The sling bullet hits the sky beast.^cggLf ^cggp f.  The sky beast is severely wounded.^cggq -6.6 (1.1^cggy ^cgg} Z _The sky beast completely misses you.^cgg2  (((((((You shoot a sling bullet.^cgg^ bThe sky beast is severely wounded. _The sky beast completely misses you.  The sling bullet closely misses the sky beast.  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.^cgg L  ......Yf.  The sky beast is severely wounded.^cggN \2---70^cggCU ^cggX T _The sky beast hits you. The air twists around and strikes you.^cggC  You shoot a sling bullet. The sling bullet hits the sky beast._cgg# (((((((The sky beast is almost dead._cgg_cggK ...f..Y.  You shoot a sling bullet. The sling bullet misses the sky beast._cgg&8_cggp_cggW _The sky beast closely misses you._cggj}  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage._cgg (((The sky beast is almost dead.You shoot a sling bullet.  _cggNThe sling bullet closely misses the sky beast._cgg+ _cgg _cggV?.f.Y_cggLThe sling bullet hits the sleepcap but does no damage._cggY_cggӉ53_cgg!------_cggQ&9.7 (1.1_cgg)_cgg_cgg`_cgg  _cgg--more--_cgg_cgg@ R _The sky beast hits you. The air twists around and strikes you!_cgg((You shoot a sling bullet.  The sling bullet barely misses the sky beast._cggThe sling bullet hits the sleepcap but does no damage.  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage._cgg(_cgg2 .fYThe sky beast is almost dead._cggY3]4---900_cgg;_cgg<`cggl/  --more--`cgg M _The sky beast misses you.`cggv(You shoot a sling bullet.  The sling bullet barely misses the sky beast.The sling bullet hits the sleepcap.`cggU  The sleepcap is lightly damaged.  You shoot a sling bullet.  The sling bullet barely misses the sky beast.`cgg/  --more--`cgg\"z  The sling bullet hits the sleepcap!  Lightning courses through the sleepcap!!`cggj&C.`cgg8{.YYou destroy the sleepcap!`cggܱh45---301`cgg`cggFL _The sky beast hits you. The air twists around and strikes you!`cgg4`cgg5`cgg><`cgg?> _Unknown command.`cgg΁^(((((((You shoot a sling bullet.`cgg   The sling bullet barely misses the sky beast.You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.`cgg ......YThe sky beast is almost dead.`cgg&2`cgg\`cggW _The sky beast closely misses you.`cggr*`cgg*`cgg2`cgg5F _Unknown command.`cggbU}  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.`cgg((((((( _The sky beast closely misses you. _Unknown command.  You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.  The sky beast is almost dead.You shoot a sling bullet.`cggd ......YThe sling bullet barely misses the sky beast.`cggweh6=--3`cggk`cggnW _The sky beast closely misses you.`cgg3 `cgg˷ `cgg `cggž F _Unknown command.`cgg  (((((((You shoot a sling bullet.`cgg  The sling bullet closely misses the sky beast.You shoot a sling bullet.`cgge) ......YThe sling bullet closely misses the sky beast.`cggR* &4`cgg. `cgg 1 O _The sky beast misses you.`cggA `cgg^B `cggI `cgg_L F _Unknown command.`cgg c  You shoot a sling bullet. The sling bullet hits the sky beast.`cggT (((((((The sky beast is almost dead.You shoot a sling bullet.`cgg ......YThe sling bullet barely misses the sky beast.`cgg -5.6 (0.9`cgg0 `cgg/ O _The sky beast misses you.`cgg4`cggj`cggF _Unknown command.acgg pc  You shoot a sling bullet. The sling bullet hits the sky beast.acgg7uG†acgg (((((((You kill the sky beast!acgg X......†acgg7/70=56.6 (1.0acggTacgg/ _You shoot a sling bullet.acggw]acgg]acggcacgg/fF _Unknown command.acgg\ _No target in view!acgg_WacggWacggOYacggO]acgg'bW8 _acgg dacggIdacggeacgg%iacggi:Rev+ acggjacggnacgg;o:9acggpacgguacggBuacggvacggzacggzacgg*|acgg1acgg:Rev acggeacgg acggQO50=acggZacgg,acggacggD,acggacggԐv1=acggCacgg0acggacgg?,acggHacgg;2acggacgg˝,acggߞacgg,acggacgg{acggƥK3=acggacggϨacggacggacggRBacggoacggǯU4=acgg acgg,acggacggacggMacggacggacggacggacggacgg%5acgg acgg)acggacggacgg,acggacggacggD6=acgg{acgg,acggacgg,acggacggk7=acggacgg,acggacgg,acggacgg[;8acggacgg,acggacggacggacggacgg,acggacgg7acggaK9=acggMacggacggacggVacggacgg;acggacgg&acggV60=acggacgg,acggZacgg,acggacgg~;1acgg acgg ,acggW acgg,acggacgga2=acggacgg{acggacggacggj,acggacgg`acggU3=acggp acgg",acgg|#acgg%,acgg&acgg*acggR.,acggc2acggB3acgg34acggj5acgg8acggs9acggS;acgg>acgg?acggAacggfLw5=acgg;O,acggUacgg9YacggYacgg[acgg&`acgg`U6=acgg&bacgg"eacggzeacgg>gacggj,acggkacggpacggq%7acggBracgg9uacgguacggvacgg7{acggOacggacggmacggacgg acggX" o.---960.6 (64.0)o   orc wizard (wandering)acgg" :---acggr+ acgg. b _An orc wizard is nearby!acggQ  .   .../...  .......  .......  .......  .......   ....... #.###...##  .......####.......# acggR c o.....†@.........##  #.....#..........#  ..... #............  .... ##...........  #.. .............  ## ..............  ##............#  .....#......## acgg  .   .../...  .......  acgg .......  .......  .......   ....... #.###...##  .......####.......#  o.....†@.........##  #.....#..........#  ..... #............  .... ##....... acgg% #.. ......... ## ..............  ##.........acggX h .....#.... acgg acggK acgg acggF acgg b _An orc wizard is nearby!acgg((((((o   _An orc wizard is nearby! _An orc wizard is nearby!  You shoot a sling bullet.  The orc wizard shouts!  The sling bullet hits the orc wizard but does no damage.  Lightning courses through the orc wizard!acgg:, (The orc wizard is severely wounded.bcggXpbcgg{x.o....†bcgg{g===1.7 (1.1)Rev bcggbcgg*w _You shoot a sling bullet. The sling bullet misses the orc wizard.bcggd  You shoot a sling bullet. The sling bullet hits the orc wizard.bcggd)(((((bcggE ((You kill the orc wizard!bcggx.)....†bcgg}8=720Rev+ bcggR bcggy$/ _You shoot a sling bullet.bcgg4bcgg|bcggNH _No target in view!bcgg_ bcgg bcggTbcgg$bcgg ; _bcggbcgg:Rev bcggbcggbcgg#bcgg#V9=bcggv&bcgg(bcgg bcgg o---5.7 (3o   orc (wandering)bcgg :---bcgg bcgg [ _An orc is nearby!bcggx  .   .../...  .......  .......  .......  .......   ....... #.###...##  o......####.......#  .)....†@.........##  #.....#..........#  ..... #............  .... ##...........  #.. .............  ## ..............  ##............#  .....#......## bcgg\  .   .../...  .......  .......  .......  .......   ....... #.###...##  o......####.......#  .)....†@.........##  #.....#..........#  ..... #............  .... ##...........  #.. ......... ## ..............  ##......... .....#.... bcgg bcgg; [ _An orc is nearby!bcgg ' bcgg ((((((oYou shoot a sling bullet.  The orc shouts!  The sling bullet hits the orc.bcgg&  The orc is lightly wounded.  You shoot a sling bullet. The sling bullet hits the orc!bcggB,C)bcgg[.....†bcgghl===6.7 (1Rev+ bcggbcgg bcgg9_You kill the orc!ccgg)|ccggccggՂccggd ccgg:_No target in view!ccgg"ccggE#ccgg*ccggb-H _No target in view!ccgg`ccgg'accgg=bccggdccgghRev  _70=ccggjccgg}rccgg|$ . ##.###./...#...#......###....######...#......#.....##o..##.#..####.#.. #.###...##ccgg}.)......####.#.)....@).##---.#.....#.#.##... ##..#... ....... ###. ....o   orc (wandering). ##.......#.. .....#...##ccgg_+8.7 (2ccggJccgg.oooo 2 orcs (1 wandering)ccggAG---9.7 (3ccggccggv _You see here a sky beast corpse.ccgg@  You shoot a sling bullet.  The orc shouts!  The sling bullet hits the orc. Lightning courses through the orc!ccgg )(((((o   orcccgg ((You kill the orc!ccggw ccgg U.)...ccgge a.).....occgg 6===70.7 (1ccgg ccgg  ccggų !_You shoot a sling bullet.ccggD% ((((( You shoot a sling bullet. The sling bullet hits the orc.ccgg  The orc is almost dead.You shoot a sling bullet. The sling bullet hits the orc.ccgg C)ccgg7 <)....ccgg.; ]1Rev+ ccgg@A ccgg:C G _You kill the orc!ccgg.ccgg.ccgg87ccgg9H _No target in view!dcgg dcgg4 dcggdcgg+H _No target in view!dcgg!dcggdcggdcggdcggdcggPW= _dcggdcgg< #.#...#dcggM ###....####..###+###..##.......###/...#...#......##>.#dcggx....######...#......#.....##).......##.........#dcgg....####.......#......@...# #.###...##dcgg)---2dcgg%..)......####.......#))....†).........###.....#dcggZ#.......##.......dcgg7I........###.......dcgg\#..#.............####......dcgg;......##............#dcggdcgg=#---dcgghS3.7 (2Rev dcgg dcgg ; _Found a stone staircase leading down.dcggdcggdcggTdcgg;dcggdcggUdcggdcgg̾dcggSdcggdcggdcggdcgg~,dcggdcggndcggLdcgg!dcggidcggtdcggdcggBdcgg\dcgg("#...#####  ##...#..##  ###.....#  ##.......#  #........#### dcgg0 #.#.... . ###....####.# ###+###..##.......##...#......##>.#..........######...#.............#.....##dcgg.).......##........#.....####.#....# #.###...##....)......#####dcgg,..))....†)...##....#.....#dcggC+8.7 (5dcgg+9.7 (6dcggdcggu 0 _A - a wand of warping (13)dcggdcggTdcgg)dcggH _No target in view!dcgg dcgg dcgg dcgg H _No target in view!dcgg3dcggdcgg5dcggGdcgg$ _dcggpdcgg_dcgg,dcggdcgg dcgg,dcggdcgg dcgg,dcggdcggdcggO ,dcgg dcgg 4 ##...##### ##...#..## ###.....# ##.# #.#### #.#.#dcggC .###....####.#.###+###..##.###....#...#.......>.#....######...........#......).......##dcggq.......####......# #.###........)......####.#.....))....†).##  ....#.....#.#dcggs%#....#....#...≈#....#.......'84.7 (5dcgg/b======5.7 (6dcgg7dcgg1;= _As you open the door, it creaks loudly!ecggF3ecggecggecgg,ecgg,ecggecggDecggecgg @  There is an open door here.ecgg ecggR  _ecgge ecggecgg,ecggecggecgg?ecggecgg^,ecggd_;  There is an open door here. _ecgga,ecggdecgg,gecggRi,ecggjecggqmecggboecggoecgg(qecggKwecgg{,ecgg7}ecggecggecggecggzecgg}ecgg4ecggwecggecgg׌ecgg},ecggecggLecgg$,ecggecggecgg,ecgg͝ecggUecggecgg8ecgg,ecgg,ecggQecgg'ecgglecggecggEecggecgg ,ecggecggecgg,ecggecggTecggX,ecggecggecggM?.... #..............##......... #.?............ .....[..#..............########..!..........# ..##..................# #.#...................###.#.......................#...≈..........#.##..#......#.....##.#......------.....##.....##.##........ #.........###'#@.....?..........................>.###................. @   Maggie (wand, polearm, asleep)###.# ##............)... #. ...... .....ecgg( 6008.7 (23.0)  Maggie the Vainglorious comes into view. She is wielding a +1 heavy partisanand carrying a wand of warping.Found a scroll of teleportation.ecggq.@@)ecggY==----9.7 (24ecggecgg _Maggie shouts! _You see here a potion of heal wounds.ncgg (((((You shoot a sling bullet. The sling bullet hits Maggie.ncgg~  Maggie is lightly wounded.  You shoot a sling bullet. The sling bullet hits Maggie.ncggd)] .....  Maggie is lightly wounded.ncgg(2#.###PP>P..####.< #....PP.oP.#.....###..........#. #....oo....#.>[...##..... .....?......#.....#...## .................)## ..o.##........)...## .... #...##......... ... #.?..........[.#...ncgg2...#########...#..!...#...##.....##......# #.#.......##...............###.#.......####...........#...≈...##...........#.##..##.......!#.....##.#.......#.#.ncgg3 .......##.....##.##.....####. ....... #.........###'###..## ncgg ;ncggq ncgg* ncgg* 63---======10.7 (1.0)Rev ncgg3 ncgg6  ncgg`6 __Maggie zaps a wand. Space twists violently! The rupture engulfs you! You blink.ocggIocggKocgg ocggF _Unknown command.ocgge Jocgg Q _ocgg ,ocgg ocgg 94ocggU 3---ocgg+ ocgg\ ocgg 0ocgg ocgg ocggocgg]+------4.7 (4........#.##..@   Maggie (wand, polearm)@.!.#...##....###'ocgg=------ocggocggS[ _Maggie is nearby!pcgg E(((((pcggx&((pcggJ,f  You shoot a sling bullet. The sling bullet closely misses Maggie.pcggӷf  You shoot a sling bullet. The sling bullet closely misses Maggie.pcgg.....@.===5.7 (1Rev pcgghpcgg _Maggie gives herself a magical halo, but it quickly sputters out.pcgg% (((((You shoot a sling bullet. The sling bullet hits Maggie.pcgg| ((Maggie is lightly wounded.pcgg6pcggCw.......@pcggD5=6Rev+ pcgg/OpcggTV _You shoot a sling bullet. The sling bullet barely misses Maggie.pcggp(((((((pcgg0+ f  You shoot a sling bullet. The sling bullet closely misses Maggie.pcgg ....@..  You shoot a sling bullet. The sling bullet barely misses Maggie.pcgg ******Maggie casts a spell at you.pcgg{Y m.@....pcgg:Z x52-----====7pcgg;i pcggl 0 _The bolt of fire hits you!pcggX p(((((((pcgg  You shoot a sling bullet. The sling bullet barely misses Maggie.  You shoot a sling bullet. The sling bullet hits Maggie!pcggB, ....@..  Maggie is moderately wounded.pcgg@5 ******Maggie gestures at you while chanting.pcgg .@....8pcggϾ ?Rev* pcgg pcgg R _The bolt of fire misses you.pcgg ((((You shoot a sling bullet. The sling bullet hits Maggie!pcggc (((Maggie is heavily wounded.pcgg ><P.#.....###......#.>........[.?......#..........................)..................) #..............##.. #.?..................[  .#..........@...#  ..!........(.#...#  ..........(..# #.#  .........(...###.#  ........(.....  .......(...#.#  ......(!#.....  .##.....   You shoot a sling bullet. The sling bullet barely misses Maggie.  Maggie mumbles some strange words.pcggJ><P.#.....###......#.>........[.?......#..........................)..................) #..............##.. #.?..................[  .#..........@...#  ..!..........#...#  .............# #.#  .............###.#  ..............  .......@...#.#  .......!#..... pcggj .......##.....   pcgg+[===-9pcggypcggW _Maggie attempts to bespell you! You resist with almost no effort.qcggMBp(((((((qcgge  You shoot a sling bullet. The sling bullet barely misses Maggie.qcggb` ><P.#.....###......#.>........[.?......#..........................)..................) #..............##.. #.?..................[  .#..........@...#  ..!........(.#...#  ..........(..# #.#  .........(...###.#  ........(.....  .......(...#.#  ......(!#.....  .##.....  qcggta You shoot a sling bullet. The sling bullet closely misses Maggie.  Maggie mumbles some strange words.qcggDn3 ><P.#.....###......#.>........[.?......#..........................)..................) #..............##.. #.?..................[  .#..........@...#  ..!..........#...# qcggnv .............# #.#  .............###.#  ..............  .......@...#.#, mesmerising)  .......!#.....  .......##.....    Maggie attempts to bespell you!qcggp3=-----20Mesm Rev* qcgg5}qcgg] _You are mesmerised by Maggie!qcgg1 ((((You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.qcggr  Maggie is heavily wounded.You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.qcggB....  You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.  Maggie is heavily wounded.  You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.  Maggie is heavily wounded.qcgg/  --more--qcgg!G ***qcgge"^***Maggie casts a spell at you.rcggri.@....rcggms37------====1.8 (1.1rcggrcgg( _The bolt of fire hits you!rcgg=2((rcgg]((You shoot a sling bullet. The sling bullet hits Maggie.rcggQvv(((Maggie is heavily wounded.rcggrcgg ...@...rcgg` a===-20rcggrcggN _You shoot a sling bullet. The sling bullet barely misses Maggie.rcgglw (((You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.rcgg  Maggie is heavily wounded.You shoot a sling bullet. The sling bullet hits Maggie!rcggrcgg,D..................@........##....rcgg2z8=------3.9 (1.1rcgg¢rcggd[ _Maggie is severely wounded.rcgg @ ((You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.rcggn  Maggie is severely wounded.You shoot a sling bullet. The sling bullet hits Maggie.rcggtd| ..  Maggie is severely wounded.rcggmn ******Maggie points at you and mumbles some strange words.rcgg...@..40rcgg8rcgg= rcgg/  --more--scggٰP _The bolt of fire misses you.scggUp(((((((scgg4 You shoot a sling bullet. The sling bullet closely misses Maggie.  You shoot a sling bullet. The sling bullet hits Maggie!scggscggy............@............#..!#.....5scggscgg=N _Maggie is almost dead.scgg(h(You shoot a sling bullet.  The sling bullet hits Maggie but does no damage.scgg ((((((Maggie is almost dead.scggv .@....scgg_.You shoot a sling bullet. The sling bullet closely misses Maggie.scgg[9=6.8 (0.9scggscggP _Maggie closely misses you.scggS (You shoot a sling bullet. The sling bullet hits Maggie.scgg 8MThe sling bullet closely misses Maggie. _Maggie closely misses you.You shoot a sling bullet. The sling bullet hits Maggie.hit  You break out of your daze!scggJ f)scggv (P.#.....###......#.>........[....#..................................................##........................@...........#.........................#...!#.......##.....scgg~ , 40/71537.8 (1.0Rev*  _You kill Maggie!Your Ranged Weapons skill increases to level 9!scgg scgg scgg7 /  --more--tcggi _Your Dodging skill increases to level 6!tcggf #....PP.oP.#.....###..........#.  #....oo....#.>........[...##..  .....?......#......#...#  ..........)  ..o.##.....)...  .... ###..........  ... #.?.......[ .#.######### ..!#...##.....##.. ..)..# #...## ....###.#.### tcgg.....#...≈...##. ....#.##..#....... !#.....##.#.#.# .##.....##.##### . #.........###'###..# .@....?...........tcggtcgg7---8 _tcggItcggtcgg:  #....oo....#.>........[...##.. .....?......#......# ..........)  ..o.##)... .... ###......... ... #.?.......[ .#.######### ..!#...##.....## ...# #...## ....###.#.## .....#...≈... tcgg 4....#.##..#....... !#.....##.#.# .##.....##.### . #.........###'###.. .@....?.................... ......>.#.tcggj tcgg B---9tcgg tcgg fA - a wand of warping (22) (gained 9 charges)  Things that are here:tcgg6 ,30.8 (2tcggI tcgg _a +1 heavy partisan; +0 steam dragon scales; the human corpse of Maggieucggucgg; Equip which item?  - - Unarmed Inventory Items Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} Armour (go to first with [) ucggђ b - a +0 leather armour (worn)  k - a +0 helmet (worn)  w - a +0 cloak (worn) Floor Items ([,] to select) Hand Weapons a +1 heavy partisan Armour+0 steam dragon scales[?] describe selected [!] equip|wield|wear[tab] equip|unequip wcggwcgg wcggUI #....oo....#.>........[...##... SunshineJesse the Skirmisher.....?......#..............#... Coglin..............................) Health: 40/71 =============-----------..o.##.....................)... Magic: 9/9========================.... #..............##......... AC: 5wcgg˶Str: 12... #.?..................[.... EV: 14Int: 9.#..............#########.. SH: 0Dex: 21..!..........#...##.....##. XL:  9 Next: 53% Place: Dungeon:7..........@..# #.#.......## Noise: ---------  Time: 6030.8 (0.0)wcggP.............###.#.......## a) +2 sling {Septima j) +0 sling (elec) {.................#...≈...## Fire: a) +2 sling {Septima} ...........#.##..#.......#. Rev* .......!#.....##.#.......#........##.....##.##.....### ....... #.........###'###.. wcgg.@....?.................... .................>.#.......  wcgg=_Your Dodging skill increases to level 6!A - a wand of warping (22) (gained 9 charges)  Things that are here: _a +1 heavy partisan; +0 steam dragon scales; the human corpse of Maggiewcgg-  You're wielding all the weapons you can. Replace which one?(? for menu, Esc to cancel)< or a - a +2 sling {Septima}; > or j - a +0 sling of electrocution {Malena}{cgg?{cgg@{cggM{cggO. _|cgggVMPP.oP.#.....###..........##....oo....#.>[...#?##..........)o.#.......). #..##........ #.?......[..#....#########.!...##.....##.|cggW.)..# .....###.#.............#...≈...##...........#.##..#.......#.....?.........|cgg%c|cggQdf11.8 (1Rev+ |cggd_|cggn|cggp|cgg  oo....#.>........[...##........?......#...........)o.##)..... ##...... #.?......[ .#..#########.!#...##.....##.|cgg 5 #.#.......##....##.........#...≈.#Rev+ ....?..........................>.#....... |cgg |cgg[ &2|cgge |cggN  Things that are here: _a +1 heavy partisan; +0 steam dragon scales; the human corpse of Maggie}cggPz}cgg|yEquip which item?  - - Unarmed }cgg|Inventory Items Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima} }cgg|i j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} }cgg|Armour (go to first with [)  b - a +0 leather armour (worn)  k - a +0 helmet (worn)  w - a +0 cloak (worn) }cgg|Floor Items ([,] to select) Hand Weapons a +1 heavy partisan }cgg*}Armour+0 steam dragon scales[?] describe selected [!] equip|wield|wear[tab] equip|unequip ~cgg~cgg&~cgg  #....oo....#.>........[...##... SunshineJesse the Skirmisher.....?......#..............#... Coglin..............................) Health: 41/71 =============-----------..o.##.....................)... Magic: 9/9========================~cgg?.... #..............##......... AC: 5Str: 12... #.?..................[.... EV: 14Int: 9.#..............#########.. SH: 0Dex: 21..!..........#...##.....##. XL:  9 Next: 53% Place: Dungeon:7~cggz*..........@..# #.#.......## Noise: ---------  Time: 6032.8 (0.0).............###.#.......## a) +2 sling {Septima j) +0 sling (elec) {~cgg.................#...≈...## Fire: a) +2 sling {Septima} ...........#.##..#.......#. Rev+ ~cgg!.......!#.....##.#.......#........##.....##.##.....### ....... #.........###'###.. .@....?....................~cggw .................>.#.......  _a +1 heavy partisan; +0 steam dragon scales; the human corpse of MaggieYou're wielding all the weapons you can. Replace which one?(? for menu, Esc to cancel) _< or a - a +2 sling {Septima}; > or j - a +0 sling of electrocution {Malena}  Things that are here: _a +1 heavy partisan; +0 steam dragon scales; the human corpse of Maggie~cggZ~cggk23.8 (1 _~cgg%~cgg1d  You start removing your armour.~cgg72=4.8 (2Rev ~cgg=~cggSW5.8 (3~cgga~cgg:b+6.8 (4~cggj~cggt~cgg:uY3=7.8 (5~cgg}~cgg, 2~cggU`5 _You continue removing your +0 leather armour. x4~cgg~cgg~cgg  You finish removing your +0 leather armour.  You start putting on your armour.8.8 (6~cgg ~cgg~cggV$9.8 (7~cggn~cggD~cggH440.8 (8~cgg~cgg?~cgg+1.8 (9~cgg~cgg?E2.8 (10.0)~cggc~cggH 7 _You continue putting on your +0 steam dragon scales. x5~cgg~cgg~cggah _You finish putting on your +0 steam dragon scales.cgg9PcggPcggQZcgg\F _Unknown command.cggcggDrop what?28/52 slots (_ for help) Hand Weapons (select all with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} Armour (select all with [)  k - a +0 helmet (worn)  w - a +0 cloak (worn)  B - +0 steam dragon scales (worn)b - a +0 leather armour Wands (select all with /)cggr - a wand of polymorph (6)  A - a wand of warping (22) Scrolls (select all with ?)c - a scroll of butterflies  f - a scroll labelled HAANOV TAOCOLE  g - 2 scrolls of teleportation  h - 3 scrolls of poisoni - 2 scrolls of brand weapon  m - a scroll labelled ANUYPIZXOPSU  t - a scroll of vulnerability  v - 2 scrolls of immolation [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]cggfcgg #....oo....#.>........[...##... SunshineJesse the Skirmisher.....?......#..............#... Coglin..............................) Health: 44/71 ==============----------..o.##.....................)... Magic: 9/9========================.... #..............##......... AC: 7Str: 12... #.?..................[.... EV: 15Int: 9.#..............#########.. SH: 0Dex: 21..!..........#...##.....##. XL:  9 Next: 53% Place: Dungeon:7..........@..# #.#.......## Noise: --------- ggB37m Time: 6042.8 (0.0).............###.#.......## a) +2 sling {Septima j) +0 sling (elec) {.................#...≈...## Fire: a) +2 sling {Septima} ...........#.##..#.......#........!#.....##.#.......#........##.....##.##.....### ....... #.........###'###.. .@....?.................... .................>.#....... You finish removing your +0 leather armour.  You start putting on your armour. _You continue putting on your +0 steam dragon scales. x5 _You finish putting on your +0 steam dragon scales. _Unknown command.Okay, then.cgg cggd . _cgg3cggcggcgg p5= _cgg ,cggAcggv,cggcggwcggcggncgg!cgg"K6=cgg$cggB',cgg`)cgg,,cgg.cgg1cgg297cgg3cgg7,cgg9cgg<cggx=cgga?cggtBi8=cggDcggH,cggiJcgg-N,cggP........#... #....P...P.#.....###.... #..#.>..[ ......?#.. ....... .....##......... ......#..............##. ......#.@......... ......#..............## ............#...##. ...............)..# #.#. ..................###.#. ................... .cgg|[37m...............#.##.. #............#.....##.# #...##.....##.##148.8 (106.0)97cggicggd _C - a scroll labelled OKIOS FOOREPAIcgg3cgg cgg$cggW'cggO+,cgg&,cggE0,cggG2cgg5cgg8,cgg:cgg=cgg#@,cggAcggKN ...#......#....## ..........#...........##................###...##......P...###. #..#.#P.P...# ##.###P.>P# #....P...P.#.....### ..#...#.>...... ......# .......... ......##....... .......#..............##cgg5L' .......#.............. .......#......## ...................#...# ................)..# #.# ...........###.#cgg}S253.8 (4.0)cggS+4.8 (5cggZcgg-]. _D - a scroll of identifycgg N cggqN cggO cggyU cgg[ Bcgg ` Bcgga cggd cggf ,cggg cggj cggZl ,cggm cggp cggq ,cggu ,cggv cggv cggw cggz cgg{ ,cgg} cgg6 cgg ,cgg cgg cgg ,cgg cgg cgg& ,cggN cgg cgg ,cgg8 cgg cggv Xcgg ,cggR cgg cgg ,cgg cgg)   ............#.. ................ .#...................) ##.#......... # #..... #.........# ###............#. ##...........## #@...........## #........ #... #...##..... ##....####.#### ##.... #.# ....  .. .... ##.....## .... .. ...You pick up a book of Party Tricks and begin reading...cggJ \68.8 (14.0)9.8 (15cgg, cggɵ r  You add the spells Apportation, Jinxbite and Alistair's Intoxication to your _library.cgg"3cgg7cgg֟cggcgg>cggcggXcgg9,cgg cgg٫cggcggcggîcggicggBcggcgg(,cggcgg1cgg,cgg"cggcgg,cggcggcgg,cggtcggKcggR #.......... #........... #...........##...... ##....####.#### ##.....##.# #......#... ......###.....## .........#. ... #....#..... y......##.... ......#... .............. #.............. #. y   killer bee (asleep)...#. ......./......## cgg 77.8 (8.0)  A killer bee comes into view.cgg+8.8 (9cggcgga2 _Found a wand of warping (9).cggo - ((((y  You shoot a sling bullet. The sling bullet hits the killer bee.  The killer bee buzzes angrily.cgg (((The killer bee is moderately wounded.cgg{  You shoot a sling bullet. The sling bullet misses the killer bee.cgg} H  You hear an angry buzzing noise. x2cgg~ cgg ....y...yy 2 killer beesA killer bee comes into view.cggy a===9.8 (1Rev cgg cggϏ cggV /  --more--cgg5 _The killer bee buzzes angrily.cggx(((((((You shoot a sling bullet.cgg\xThe sling bullet closely misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.cggThe killer bee is moderately wounded.You hear an angry buzzing noise.cgg(cggzcgg$ yyy.....yy cggl$i 4 killer beesA killer bee comes into view. x2cgg*%'80cgg.cggu0cggC=/  --more--cgg% _The killer bee buzzes ancggE grily.cggu| R((((((cgg| 7(You shoot a sling bullet.cggn ]The sling bullet barely misses the killer bee.cgg You shoot a sling bullet. The sling bullet misses the killer bee.You hear an angry buzzing noise.cgg cggq QThe killer bee closely misses you.cgg# yy..y.......cgg G1Rev+ cgg< cgg cgg C _The killer bee stings you but does no damage.cgg} cgg cgg' cgg. F _Unknown command.cgg (((((((You shoot a sling bullet.cggq  The sling bullet barely misses the killer bee.You shoot a sling bullet.cgg cgg cgg  cgg n The sling bullet closely misses the killer bee.cgg+ cgg. cggK1 y..y.....  The killer bee stings you but does no damage.2.7 (0.9cgge4 cgg_; P _The killer bee misses you.cggK cggZL cggU cggY F _Unknown command.cgg]d  You shoot a sling bullet. The sling bullet hits the killer bee.cgg6# (((((((The killer bee is lightly wounded.  You shoot a sling bullet.cggYcggcggcggWcggcggcggs  The sling bullet barely misses the killer bee.cggB yyy..y...y 5 killer bees..  The killer bee misses you.cggl3.7 (1.0Rev* cggcgg] _A killer bee comes into view.cgg)cggcggcgg F _Unknown command.cgg9  As you read the scroll of teleportation, it crumbles to dust.  You feel strangely unstable. The killer bee completely misses you.cggN  The killer bee barely misses you. The killer bee closely misses you.cggt  The killer bee stings you.  The killer bee stings you but does no damage.cgg66----4Tele Rev* cgg]cgg:4--cggٳ/  --more--cggP& _The killer bee cgg(misses you.cgg2 #.###.......................##.##....####.#####.....##.#......#...cgg ###.....## .#. ..... #... #yyyy#.. .....y.##.........#... ....... #.. 4............ #....#. .cgg0 I...../......##cgg6 cgg cgg_ The killer bee attacks as it pursues you!  The killer bee stings you!  You are poisoned.cggX cgg) cggG cggK cgg yy.y.yy..y 5 killer beescgg 59==-----5Pois Rev+ cgg cgg cgg k _The killer bee poisons you! The killer bee barely misses you.cggR  ###......###.#..................##.##....####.#######.##......#...###@....## ..y....#. ..... #y.y #.yy.#. .......##.cggL ...#... ........... #............ #.#. .cgg cgg cgg .You feel very sick.cgg cggN cgg cggq cgg  cgg  The killer bee stings you but does no damage.  The killer bee stings you.  You are more poisoned.cgg. cgg- Qyyy...cgg 3===-----6cgg cggK t _The killer bee poisons you! The killer bee closely misses you.cgg#. ##..#......##.#.......#...........##.##....####.######.##..@...#...###.y...## .cggc#. ..... #yy. #....#. .......##.#... ......... #.... #.cggb  You feel very sick.cgg[cggcggcgg$cgg cggMyy..cggGM47==----cgg{7cggEcgg0 _The killer bee stings you.cggK.....#.###.... ##..#......##...........#...........##.##....####.######.@...##.#...y..#...###yy...## .#. ..... #y.. #....#. .......###... .. #.cggcgg.........#### .........# #.###...## .)......####.......# .))....†).........## .#.....#..........### ......##.....cggi## ......###.....## .#....................# ####........... ..##............## .. .....#......## #......##......##......#.#..#..##.#.##.. cgg... cgg!cggBO  Your surroundings suddenly seem different.cggn5---8cgg: _You feel sick.cgg cgg 8-cggcggF _Unknown command.cggǔcgg`cggmcggcggǜm4-Rev cggcggV3 _You feel sick.cggT3-cggܣcggM _You feel sick.1=-cgg$3 _You feel sick.cgg8-cggcgg\3 _You feel sick.cggE0cggcgg{3 _You feel sick.cgg739=cgg!cggcgg= _You feel sick.  cggV&cggwcggj _You are no longer poisoned.cggcgg2cggcggbcggpcggcgg,:40cgg*cggcggcggcgg,cggcgg,cggcgg&cgg{91cggPcgg,cggcgg,cggcgg cggk=2=cggcggcgg cggycggNcgg#cggYcgg3cggcgg a3=cggN ,cgg cggcggcgghcggcgg94cggFcggcggcggcgg,cgg0cgg,cggWcggJi5=cgg cgg!cgg!cgg"cggC&,cgg1'cgg)cgg)K6=cgg*cgg>,cgg\,cgg-cgg/cgg@/cgg/cgg1cgg197cggb2cgg*5cggg5cgg56cgg9,cgg`:cgg<cggR<L8=cgg<cggo>,cgg?cgg3A,cggAcgg/EcggvED9=cggKFcgg>I,cggIcggLcgg+Mcgg$NcggDQcggQcgglRcggUcgg'V:50cggVcgg=Y,cgglZcgge[cgg[cgg\cggw51=2=cgg}Q3cggcggրcggcggӆ,cggчcggъ,cggZcggHa4=cggcggg,cggӑcgg,cggcggEcggN5=cggcgg ,cggcgg,cggcgg;6cggpcggt,cggcggR,cggfcgg cggbK7=cggDcgg,cggcgg,cggcggcggU8=cggscggcggcggcgg,cggscgg)cggcggcggcggxcgg%9cggcgg,cggcgg,cggcggIb60=cggcgg,cggcggcggcgg}cgg k1=cggcgg ,cggcgg,cggcggcgg2cggcgg,cggcgg,cggcgg[cggcggZcgg93cgg(=cgg9cggrcggcggIcgg7 cggn cggr cggcgg N4=cggcggcgg)cggcgg}cggcggcggcgg%5cggcggb6=7=89=70=cgg9gBcgggcgggcgghcggqkcggkcggkD1=cgglcggqcggscggtcggtcggycgg&}cggi}cgg~cggԀcgg,,cggxcggˈcgg׋cgg%9=cggcggcgg2cggycgg=cggcggHcggcggcgg2cgg,cgg<cggåcgg+cgg̫cggcgg"cggcggGcggVcggcggcggcggScggcggJBcgg,cggcgg cggcp_l - 4 potions of heal wounds (gained 1)cggocggcgg5cggcggcggcgg*cggcggcgg_cggcggcggcgg2cggcggcgg7cgg cggI _D - 2 scrolls of identify (gained 1)cgg cgg4 cgg cggcgg]cggcgg7cggcggc ..##.......... cgg# N.##..#................. ....####............... ....##...##............ .............#......# cggR /...........#......# #.##....##......## cgg #.............#.# #@##......#..##.#cgg 031729.0) cgg K##..##.##...... cgg!#...##.###....###...#### ######cgg4! #..### .........##......#cgg_! #..<..##cgg(cgg)-8.7 (130cggf.cgg29 _Found a stone staircase leading up.cggcggcgg.cgg)"cgg',cgg+,cggl/cgg0cggv0cgg5cgg*9cgg9cgg:cgg;cggA?cgg?cgg-@cggZDcggF,cggGcggIcggM,cggNcggQPcggpS,cggScggTcgg WcggWcggWcggZP  There is a stone staircase leading up here.cgg_cgg`5 _cggbcggcggRAcggAcggBcggDcggG,cggmIcgg-KcggwM,cgg~NcggQ,cggRcggUN _You now have 589 gold pieces (gained 17).cggXX3cggYcgg[cggc^cgg^cgg_cggacggd,cggecgggcggj,cggkcggmcggv #y.....#. <.... .##... .....##....#............##.........#............. .............#...... #............####...#................#........@......##.......#67.7 (49.0).##.#.........##....#..# ##.............###.. .#..............##.................#.###.. ##...........###.# #..  #...........# ### ##.  ##.........cggQ}[33m## ##.. ##........# #... cgg,8.7 (50cggcgg\H _Found a stone staircase leading up.cgg,9.7 (51cggcggdC _A - a wand of warping (31) (gained 9 charges)cggFcggcggcggcgg,cgg,cggcggcggcggcggxcggcggcggcgg,cggcgg?cgg`,cgg!cggcgg[ ,cgg3 cggY cgg5,cggNcgg cggT,cgg^cggcgg,cggcgg(!cgg@$cgg$cggK%cgg!'cggA*,cgg+cgg3.cgg!1cggm1cgg 2cggH4cgg7,cgg 9cgg;cgg>,cgg?cggAcgguE,cgg]FcggyJcggM,cggMcggOcggzRcggRcggScggXcgg[cgg4\cgg\cgg_cgg8c,cgg;dcggfcggicgg&jcggkcggmcggspcggpcggqcggscggv,cggwcggycgg~,cgggcgg|cggcggJcgg cggcggD,cggKcgg)cggcggcggcggcgg,cggcggcgglBcggcggs,cgg7cggpcgg,cggcgg3cggcgg-cggcggMcggXcggcggWcgg<cggcggcggcggcggcgg,cgg5cggNcgg,cggcggVcgg,cggcgg cggX,cggtcggqcgge ,cgg cgg cggp,cggTcgg<cgg,cggcggcgg,cggcggcgg$4###.................cggo% #..#.......##...#...........#.[..#......#.......#........). ##... # #..........411.7 (42 cgg%#........ ###...#. ##...##.cgg% ##......##... #..................cgg% #.................. #.....##..... ##....####.####....cgg&cgg.cggX/cgg/%2.7 (43cgg5cgg7) _Found a scale mail.cggc cggf cgg7 Xcgg ,cgg@ Xcgg ,cggP cgg+ cgg8 cgg= XcggCA cggC ,cggE cggF cggK BcggR cggX ,cgg   You see here a +0 scale mail. _cgg Bcggҏ cgg ,cgg2 cgg cgg cggU cgg cgg cgg cgg cggG cgg߮ cggò cgg cgg cgg cgg cggU cggE cggY cggl cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg? cggR ,cggL cggp cgg ,cgg cgg cgg ,cgg cgg cgg4 ,cgg cgg' cgg cggx cgg cgg cgg ,cgg cgg cgg ,cgg cgg cgg ,cgg cgg cggw ,cggj cgg cggq+ cggI, cgg- cgg3 ,cgg4 cggq6 cgg; ,cgg0< cgg= cggG cggI cggL cggrL cggL cggM cggQ cggQ cggFR cgg0U cggW ,cggX cggg cgg_n BcggUr cggv ,cggw cgg} cgg> ,cgg͂ cggއ cgg ,cgg΍ cggs cggŕ ,cggU cgg cgg ,cgg՜ cgg cgg ,cgg cgg cgg ,cgg cgg cgg cgg cgg ,cggS cggʿ cggZcggdE########...### ### #####...##.....# ###.## ## ##.#.........####### #....### #.............#....######....# cgg f..............#.....##......>### #..##.........#†### #...#......#...###. ...........#....## #...............@###...##64.7 (52 ###......P...###.....y...##....##..#.#P.P.........#...#cgg_f##.###..>P........#...## ####....P...P.#.....###....... #..#..........#.>........[...##cggf<y   killer bee (wandering) #..............#........#.. cggf...................... .......##.....................)cggWgcggpcggsa _A killer bee is nearby!cggE ((((yYou shoot a sling bullet.cgg~  The sling bullet hits the killer bee but does no damage.  You shoot a sling bullet.cggTcggVcgg]K..y..cggn^g===5.6 (0.9)Rev cgggcggiN _The sling bullet hits the killer bee but does no damage.cggØ ((You shoot a sling bullet. The sling bullet hits the killer bee.cgg!  The killer bee is lightly wounded.  You shoot a sling bullet. The sling bullet hits the killer bee.cgg,cgg cggcggy....yy 2 killer bees (1 wandering)cggFd6.6 (1.0Rev+ cgg(cggpe _The killer bee is moderately wounded.cggq : ycgg sYou shoot a sling bullet. The sling bullet hits the killer bee.cgg (((The killer bee is moderately wounded.You shoot a sling bullet.cgg3  The sling bullet barely misses the killer bee.cgg4cggi<y.......   killer beecgg<-7.5 (0.9cggBcggCX _The killer bee closely misses you.cggN(((cggt  You shoot a sling bullet. The sling bullet misses the killer bee.cggƜcggƞ  You shoot a sling bullet. The sling bullet misses the killer bee.cgg?cgg(cgg{cgg,cgg(cggcyy.y..y..#.y.yyyy 5 killer bees (3 wandering)cggW69-8.4cggʯ?Rev* cgg)cggFr _The killer bee stings you. The killer bee barely misses you.cggl ?yyyYou shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet. The sling bullet misses the killer bee. _The killer bee stings you. The killer bee barely misses you.  The killer bee buzzes angrily. x2  The sling bullet hits the killer bee but does no damage.cgg (((The killer bee is moderately wounded.cggd} cgg} cgg %  cgg؂ wYou shoot a sling bullet. The sling bullet misses the killer bee.cgg? cgg cgg cgg cggK yy.yy.......#y..cgg1 a7--9.3cgg cggJ 0 _The killer bee stings you.cgg i(((((((cgg  You shoot a sling bullet. The sling bullet misses the killer bee.cggcggcggBcgg  You shoot a sling bullet. The sling bullet misses the killer bee.The killer bee stings you but does no damage.cggcggcgg # yy..yy.y....#...>..  cgg!vThe killer bee closely misses you.The killer bee stings you but does no damage.cgg!W8-70.2cgg-cgg0X _The killer bee closely misses you.cggZa ########...### ### #. SunshineJesse the Skirmisher cgga ####...##.....# ###.## ##. Coglin ##.#.........####### #....###.. Health: 68/71 ======================-- #.............#....######....#... Magic: 9/9======================== ..............#.....##......>###. AC: 7Str: 12 #..##.........#.............†###. EV: 15Int: 9 #...#......#..*****...##......#.. SH: 0cggbDex: 21 ...........#..***yy....##........ XL:  9 Next: 53% Place: Dungeon:7 cggNb#.............**@###...#........# Noise: ===------  Time: 6470.2 (0.9) ###......P...###yy*y.....##....## a) +2 sling {Septima j) +0 sling (elec) {  #..#.#P.P....****.#...........# Fire: a) +2 sling {Septima} cggbr ##.###..>P........#.......##.## Rev* ####....P...P.#.....###.......... #..#..........#.>........[...##.. yyyyy 5 killer bees #..............#..............#.. cggb................................. .......##.....................)..The killer bee stings you but does no damage. _The killer bee closely misses you.Read: scroll of butterfliesPress: ? - help, Q - select action, ( or ) - cycleDir - look around, f - activatecggeoLook: a killer bee (moderately wounded)cgg  ########...### ### #. SunshineJesse the Skirmisher  ####...##.....# ###.## ##. Coglin ##.#.........####### #....###.. Health: 68/71 ======================-- #.............#....######....#... Magic: 9/9======================== ..............#.....##......>###. AC: 7Str: 12 #..##.........#.............†###. EV: 15Int: 9 #...#......#..........##......#.. SH: 0Dex: 21 ...........#.....yy....##........ XL:  9 Next: 53% Place: Dungeon:7 #...............@###...#........# Noise: ===------  Time: 6470.2 (0.9) ###......P...###yy.y.....##....## a) +2 sling {Septima j) +0 sling (elec) {  #..#.#P.P.........#...........#gg m Fire: a) +2 sling {Septima}  ##.###..>P........#.......##.## Rev* ####....P...P.#.....###.......... #..#..........#.>........[...##.. yyyyy 5 killer bees #..............#..............#.. ................................. .......##.....................)..Read: scroll of butterfliesPress: ? - help, Q - select action, ( or ) - cycleDir - look around, f - activateLook: a killer bee (moderately wounded)  As you read the scroll of butterflies, it crumbles to dust.  cgg ,You hear the flapping of tiny wings.cggL /  --more--cgg1  The killer bee is knocked back by the sudden gust. x4  The killer bee stings your butterfly!  Your butterfly dies!cgg4 _Your butterfly disappears in a burst of colours!cggz5 cgg)> The killer bee barely misses your butterfly.The killer bee stings your butterfly.cggF /  --more--cgg|0 cgg ...### ###  #.....#  .........####### ............#.bb.#####....b.#....b##......>cgg.....b#.b.by.y......†.#..bbbbb.bb##...#..bbbbb....#.cgg͒....bbb@......P...###bby..... cgg+ #..#.#P.P....b.bbb#...  ##.###..>P..b.y..y#cggS|..#....b#.cgg..#.>.b......[cgg8(ally target)...cgg“....#...... ..............cggb)Your butterfly disappears in a burst of colours!cggc7---1.2 (1.0cgggEbbbcggèEbbbbb.bbbbbbbbbbbbcggbbbbbbcggβ[ _The killer bee closely misses your butterfly.cggrbbbbb#.b.bbbbbb.bbbbbbbbbbbbbbbbb---cggTbbbbb#.b.bbbbbb.bbbbbbbbbbbb.bbbbbbcggcggMbbbbb#.b.bcggnbbbbb.bbbbbbbbbbbbb.bbbcggUbbbcggcggybbbbb#.b.bbbbbb.bbbbbbbbbbbb.bbbbbbcggK > _Unknown command.cgg4T####...##.....# ###.## # ##.#.........####### #....###. #.............#.bb.######....#. ....cggTb.#....b##......>### #..##........b#.b.by.y......†...#......#..bbbbb.bb##......#. ...........#..bbbbb....##...... #.cggRU..bbbb###...#.# ###P...###@by......##....#  #..#.#P.P....b.bbb#...........#.###..>P..b.y..y#.......##.# ####....P...P.#....b###.......... #cggU..#..........#.>.b......[...##............#.............. 4 cgg3V................... .##......).##......cggT`cggbcggbcggBccggccggdcgg]dcggdcggecggjecggecgg'fcggfcggfcggkgcgghcgghcgg"icggicggjcggjcggkcggkcgg?lcggmlcgglcggmcggosYou swap places. The killer bee misses your butterfly.cgg_pcggqcggr[The killer bee barely misses your butterfly.cgg@scggtcggRtcggtcggOucggucggvcggvcggwcggcgg|Bcgg̀cggmcggcggAcgg( .b.#.b...b.#bb..bcggGbbbbbbb.bbb..bbb.###bbb..y.yb....bb.cggі..bb 3The killer bee closely misses you.cgg.=2cgg[b.#.bb.#bb..bcggت3bbbbbbb.bbbbbb.###bb..y.ybb....bbbbcggKb _The killer bee barely misses your butterfly.cggbb.#.bb.#bb..bbbbbbbbb.###bbb..y.ybb....bbbbcggcggcbb.#.bb.#bb..bbbbbbbbbbbbb.###bbb..y.ybb....bbbbcgg F _Unknown command.cggBP.#.........####### #....#............#.b..######.... .....b.#.b...##......>### ##..##.......b.#bb..b.y......†### ##...#......#.bbbbbb.bb##...... ............#b.bbb.....b##..... ##...bbb.###b..  ###cggP-P...###.by......##  #..#.#P.P..b.@y.yb#........... ##.###..>Pb....bb.#.......######....P...P.#.....###.........  #..#..........#.>..b.....[...## ##..cggHQ..#..b...........# ............. ###.......)..#.......##......#.......[cgg_cgg`cgg`cggacgga,cggbcggccggccggVdcggdcgg\ecggecggecggfcgg=gcgggcggehcgg#jcggjcggn  Something barely misses your butterfly. The killer bee stings you.cggncggocggmpcggqcggqcgg[rcggrcggrcgg|scggscggttcggtcggucggvcggvcgg  The killer bee closely misses your butterfly.Something misses your butterfly. The killer bee stings your butterfly.  Your butterfly dies!cggYu  Your butterfly disappears in a burst of colours!cgg cggcggcggcggxcggcgggcggcggfcggcggXcggcggČcggCcggcgg$cggޠ<...b..bb.b.y..b....bcggvb....bbb###.b.b###b.bb.bb.@yy......y..bb>...b....by 4 killer bees (ally target)cggʡcgg&3cgg.bbbbb....bbbb.b###b.bb.bb....bcggcggX _The killer bee closely misses you.cggibbbbb....bbbb.b###b.bb.bbb....bcggKjcgg2{bbbbb....bbb###b.bb.bbbbbcggEF _Unknown command.cgg*###....#....######.... #......b.#...b.##......>## ###..##.......b.#..bb..y......†#...#......#.bbbb.y.bb##...... #............#b.b..b....b##..... ###.b.b..bbb###... cgg ###......Pb.b###b.bb.b...## #..#.#P.P..b..yy..#.......... ##.###..>P..@.y...#######....P...P.#b....###........cgg( #..#..........#b>........[...## ###....#b....b........# #........... .###.......)cgg33 ally target) ...#........##.....cggi.#....................[.#########cgg  Something barely misses your butterfly. The killer bee stings your butterfly!  Your butterfly dies!cgg,cggcgg,cggcggYcggcggcggKcggF,cgg  Your butterfly disappears in a burst of colours!The killer bee attacks as it pursues you!cgg,cggcggcggcggJcggcggcgg&cggcgg cgg cgg& cgg cgg cgg cggT cgg cggcggcggcgg7cggEcggcgg3cggcgg %..bby...b.b..b.bbb###.b.b.###b..b...byy.bb>P.b@y..bcgg%.b......bcgg+&]4Rev+ cgg6gbbbb..b.bbb###.bb.###b..bbyy.bb>P.b@y..bbbcgg0<X _The killer bee closely misses you.cgg "bbbb###.bb.###b..bbcgg b>P.b@y..bbbcggʌ cgg bbbb.###b..bbb>P.b@y..bbbcgg F _Unknown command.cggr  ###.#....######....#  #......#.....##......>  ###..##......b..#..b...y......†  ###...#......#.bbbb.b.bb##......  #.b.#..b..y...b.##  ###.b..b.bbb###.b.# ###......P.b.###b..b.....## #..#.#P.P...byy.b.# ##.###.b>P.@by..b.#.## ####....P...P.#.b...### #..#.#.>cggX .[...  ###..#.....b. ##.b... ..#.##........... 3.#..............##.#.............[.#.cggcggcggcggcggw,cggcggcggcgggcggcgghcggcggscggcggcggcggUcggQ  You swap places. The killer bee stings your butterfly.  Your butterfly dies!cggcggcgg2#You swap places. The killer bee stings your butterfly.  Your butterfly dies!  The killer bee stings you.  You are poisoned.cggy$cgg(%cgg%cgg,&cgg&cggH'cgg'cgg(cgge)cgg%*cgg*cgg1+cgg+cgg+cggG,cgg,cggC-cgg-cgg.cgg/cgg/cggb0cgg0cgg1cgg1cggh2cgg2cgg?3cgg3cggc4cgg4cggv5cgg5cgg{6cgg6cggg7cgg7cgg8cgg8cgg!9cggS9cggD\b..bb.b....b..###b.b.###y...b.y.bb.bPb@yybb.cgg6E b#.bbbb.by 4 killer bees (ally target)cggE#7cgg-F===5Pois Rev+ cggTbbbbbbbbbPb@yybbb#.bbbbbcgg Zcgge/  --more--cggi 2 _The killer bee poisons you!cggه  ###.#....######.... #.....#.....##......> ###..##....b..b.#..b...y......† ###...#......#...bb.b.bb## #.b..#..b..y...b.## ###.b...bb..###b..# ###......P.b.###y...b....## #..#.#P.P....y.bb.#cgg ##.###..bP@byybb..#. ####....P...Pb#.bb..### #..#.b#.>.[... ###.#.....b#.b...... #..#.##......b.... #...#........##.#.....#.cgg-You swap places.cgg,cgg(cggmcggБcggPcggcggcggfcggcgg5cgg|cgg֔cggcggbcggcggzcggԖcgg!cggacgg&,cgg^cggcgg7cggcggcggWcggcggƛcggcggj,cgg(cggcggVcggcggvcgg&:.....b..b#.b.b..bb.....###..bby.yb..>P@yy..bb.Pb#.b.bbbb...cgg6\5--6cggjbb..bbby.ybbb.PbcggɺbbbbbcggK _You feel very sick.cgg:& bbb..bbbby.ybbb.Pb#.bbbbbcgg!' @--cgg8 bb#.bb..bbbby.ybbb.Pb#.bbbbcggA > _Unknown command.cgg y #..#.....##.. ###..##...#..b...y...... ###...##..bbb.b.bb##.... #.....b#.bb..y...b.## ###b..bb..b..###... ###......P...###..b.b....##cgg  #..#.#P.P.by.yb...#..... ##.###..>P.yy..b..#####....P.b@Pb#.b...###..... #..#........bb#.>........[###....bb#.....b...###.cggZ |...........###.... .#..cgg ..#.......## [.#.......cgg t.#.....#####.#...##..cgg ,cgg ,cgg cggb cgg/ cgg cgg cgg cggw cgg cggR cgg cgg cgg cgg cgg/ cggZ You feel sick. The killer bee stings your butterfly!  Your butterfly dies!cgg cgg cgg cgg cgg cgg cgg cgg% cgge cgg cgg cggY cgg cggp cgg cgg cgg cggO cgg cgg? cgg cggX cgg cgg cgg cgg cgg cgg cgg cgg[ cgg cgg& v..#b.....bbbPbb.bPb.y...byy....b@Py..b.b.bbcgg8 .37cgg bbbbPbbbPb.y...bbb.bbcgg f _Your butterfly disappears in a burst of colours!cggFbbbbPbbb.y...bbb.bbbcggcggbbbbPbbbPb.y...bbb.bbbcggSF _Unknown command.cgg9 ###.##### #.........#.....## ###..##.........#......y. ###...#......#......b.bb #...#b..b.y...b.#####.........bb..y..###...#..###.....bPb..###.b..b....## #..#.#PbPb.y...b..# ##.###..@Pyy......#. ####....P.b.Py#.....###.. #..#cgg....#.>........[ ###.b.b.#.....b  ##.....b...... ###..#.......##..b..y 5 killer bees (ally target) ..#....### .[.....#.....#....####cggQ,cggq,cggcggcggcggcgg~cggcggcggcggcgg>cggcggDcggcgg?cggcggcggHcggcgg3  You feel sick.cgg<cggcggrcggcggcggB cgg cgg>!cgg'",cgg<#cgg#cggt$cgg$cgg3%cgg%cgg6bb..#.....b..b.Pbby###...Pby...bbcggu7b@Py..byyP.b..b.b.bbb......bcggi;2-=8Rev cggcHFbbbbbb@Py..bb..bbbbbbcggO _The killer bee barely misses your butterfly. _There is a staircase to the Ecumenical Temple here.cgg@ bb..bbbby...bbb@Py..bbbbbbbcggA 8-cggQ bbb..bbbby...bbb@Py..bb..bbcggQ dbbbbcggU F _Unknown command.cgg3bbb..bbbby...bbb@Py..bbbbbbcggcggzbbb..bbby...bbb@Py..bb..bbbbbbcggLK _You can't go up here!cggbbb..bbbby...bbb@Py..bb..bbcggabbbbcggcggcbb..bbbby...bbbb..bbbbbbcgg`cggcgg$cggcggcgg)cgg\cggcggcggcggcggcggUcggcggcggrcgg  You feel sick. The killer bee stings your butterfly.  Your butterfly dies!cggcgg-  Your butterfly disappears in a burst of colours!The killer bee stings the plant. The plant begins to die.  The killer bee stings you but does no damage.cggcgg@cggcgg`cggcgggcggcggfcggcggicggcggqcggcggcgg cggcgg 5=---The killer bee closely misses you. The killer bee stings you!cgg/  --more--cgg 0 cgg cgg cgg cggm cgg cgg cgg cgg cgg# cgg cgg% cgg cggw b..bb..b...bb.P.y.y.b.....@Py..bbb..bbbb....b...bb..cgg J---=9cgg gbb..b...bbbbb..bbbbcggL _The killer bee barely misses you. The killer bee misses you.You climb downwards. Welcome back to the Ecumenical Temple!cgg Bcgg0 cggX cgg cgg cgg cgg' cgge cgg cgg2 cggk cgg cgg cgg9 cggJ #...# #...##.##.# ##...# #...# #._.# #._.###.#.## #._.# #._.# #...####...####...# ##...####...# ####.##.###.###._.###.###.##.######..#####.##...##.#####..## ##.#..####.##.##.####..#.## ####.####.####.#.#.####.####.## #...######...##..y##...######...#Temple #._........_....@...._........_.# #...######...##ycggӗ ..##...#### ####.####.####.#.#.####.####.######.#..####.##.##.####..#.##  ##..#####.##...##.#####..###.##.###.###._.###.###.##.#### 2 killer bees #...####...## #...####...####...# #._.# #._.# ##.#.###._.# #._.# #...# #...## #.##.##...# #...cggߠ h____cgg cgg0 7--80.7 (2.5cgg r_____cgg cgg _Your summoned allies are left behind. You feel sick. _There is a staircase back to the Dungeon here.cggo2__cggo____cggo9--cggw~____cggy> _Unknown command.cggM8____cgg:cggAB___cgg]A3_cggvDF _Unknown command.cgg!H ___You shoot a sling bullet. The sling bullet hits the killer bee.cggA ____The killer bee is moderately wounded.You shoot a sling bullet. The sling bullet hits the killer bee.cgg:U, 46==--The killer bee is heavily wounded.You feel sick. The killer bee stings you.  You are more poisoned.cgg[/  --more--cgg5~J __cgg~_The killer bee poisons you! The killer bee completely misses you.The killer bee barely misses you.cggR--===1.7 (1.0cggn____cggz; _The killer bee stings you but does no damage.cggj3 ___You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.cgg  ____The killer bee is heavily wounded.You shoot a sling bullet. The sling bullet hits the killer bee.cgg~\ n _____The killer bee is severely wounded.You feel sick. The killer bee misses you. The killer bee barely misses you.cggM] y52Rev+ cggd d___cggSf cggo /  --more--cggG _The killer bee misses you. The killer bee closely misses you.cggD ___(((((((_You shoot a sling bullet.cggv The sling bullet closely misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee!cgg| __   killer bee_cggQ B__......__You kill the killer bee!You feel sick. The killer bee misses you.cgg [3-6cggI 3.6 (0.9cggs _____cgg1 C _The killer bee stings you but does no damage.cgg k____cggv 8-cgg ____cggN F _Unknown command.cggu ___You shoot a sling bullet.cgg (((((((__The sling bullet hits the killer bee but does no damage.  You shoot a sling bullet.cggLH: _.....y___The sling bullet closely misses the killer bee.You feel sick.cgg`ID24.5cggRO______cggnRC _The killer bee stings you but does no damage.cgg:(___________ _Unknown command.cggx __ _You shoot a sling bullet. The sling bullet hits the killer bee.cgg  (_((((((__The killer bee is moderately wounded.You shoot a sling bullet.cgg ___.....y___The sling bullet barely misses the killer bee.You feel sick. The killer bee misses you. The killer bee stings you.  You are more poisoned.0cgg====-5.5 (1.0Rev* cgg__-cgg.)/  --more--cggw2 _The killer bee poisons you!cgg"(_((((((___cggDJh____cggJ_You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet.cggCK_...cgg..y___The sling bullet barely misses the killer bee.You feel very sick.cgg]38-6cggK_____cggD _The killer bee barely misses you. The killer bee closely misses you.cgg&t______cggt8-cgg|v____cgg~F _Unknown command.cgg_(_((((((__cgg" ___You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.cggvi __.....y__The killer bee is moderately wounded.67.4 (0.9cggF~9_cgg{j _You feel sick. The killer bee closely misses you. x2cgg\5 ___cgg{< ____cgg> F _Unknown command.cgg' _(_((((((___cgg  ____You shoot a sling bullet. The sling bullet misses the killer bee.cgg'  _.....y_You shoot a sling bullet. The sling bullet misses the killer bee.cgg( t29=---8.3cgg)0 _____cgg2 z _You feel sick. The killer bee misses you. The killer bee stings you.cgg |____cgg :---cgg _____cgg F _Unknown command.cgg n___cgg cggx d___cgg ^ _You are too injured to fight recklessly!cgg_____cggcggz_____cggF _Unknown command.cgg;l___cgg$<cgg%C_____cggE^ _You are too injured to fight recklessly!cggB_____cggBcggJw____cggLF _Unknown command.cgg ___________ _Unknown command.You are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!cgg_(((((((___cggφ_____You are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!  You shoot a sling bullet. The sling bullet misses the killer bee.cgg(__.....y___Unknown command.You are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!  You shoot a sling bullet. The sling bullet misses the killer bee.cggt4==-9.3 (1.0cgg_______cgg%zYou are too injured to fight recklessly!Unknown command.You are too injured to fight recklessly!  You shoot a sling bullet. The sling bullet misses the killer bee. _You feel sick. The killer bee closely misses you. The killer bee stings you.cggs(_((((((___cgg ____You shoot a sling bullet. The sling bullet misses the killer bee.cgg:S __cggo.....y__cggYou shoot a sling bullet. The sling bullet misses the killer bee.You feel sick.cggR2--90cggf____cggF _The killer bee stings you but does no damage. x2cgg 7 _cgg` _ _You shoot a sling bullet. The sling bullet hits the killer bee.cggޤ 7 _(_((((((___The killer bee is severely wounded.You shoot a sling bullet.cgg0 = ___.....y____The sling bullet closely misses the killer bee.cgg0 CThe killer bee stings you but does no damage.cggV1 G-1.2 (0.9cgg{7 ____cgg9 W _The killer bee barely misses you.cgg}Y _(((((((___You shoot a sling bullet.cggf ____The sling bullet completely misses the killer bee.cgg 8    _.# #._.###.#.## #.(.# #._..####...# ##(.#.###._.###(#  #.##...##(#  #.##.##(# .####.#.#(####.#...##..(##...#_.._....@...._.._#...##...##...#.####.#.#.####.  #.##.##.#  #.##...##.# #.###._.###.#..## #...####.. #._.# ##.#.###._.# #._   You shoot a sling bullet. The sling bullet misses the killer bee.cgg@   _.# #._.###.#.## #.(.# #._..####...# ##(.#.###._.###(#  #.##...##(#  #.##.##(# .####.#.#(####.#...##..(##...#_.._....@...._.._#...##...##...#.####.#.#.####gg7m.  #.##.##.#  #.##...##.##.###._.###.#..## #...####.. #._.# ##.#.###._.# #._    _.....y__You feel sick. The killer bee barely misses you. The killer bee stings you.19=-2.1cgg6_____cggKV _* * * LOW HITPOINT WARNING * * *cggP ____You shoot a sling bullet.  cgg8The sling bullet hits the killer bee but does no damage.cgg> _(((((((__The killer bee is severely wounded.cgg"2m ___.....y___You shoot a sling bullet. The sling bullet misses the killer bee.cgg2B-3.0cgg$;d____cgg]=g _You feel sick. The killer bee closely misses you.cgg2p _(_((((((___cgg% " ____You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet.cgg  __.....y___The sling bullet barely misses the killer bee.89____ _You feel sick. The killer bee misses you. The killer bee closely misses you.cggu  You shoot a sling bullet. The sling bullet hits the killer bee!  Lightning courses through the killer bee!!cgg&p_†_cggwv_.# cgg0 _(_((((((_You kill the killer bee!cgg ___.....†_You shoot a sling bullet. You feel sick.cgg7-94.8Rev* cggw____cggq[ _You are no longer poisoned.cgg? ### ####.#.##.# ##.#### ##### ...# #...##.##.# ##...# #...# ._.# #._.###.#.## #._.# #._.# ...####...####...# ##...####...# ###.##.###.###._.#.##.######..#####.##...##..##  ##.#..####.##.#..#.## cgg5M##.####.####.#.#.####.####.#### ...######...##..@##...######...# ._........_....<...._........_.# ...######...##...##...######...# ###.####.####.#.#.####.####.######.#..#.##.####..#.##  ##..##...##.#####..####.##.###.###._.###.###.##.#### ...####...## #...####...####...# ._.# #._.# ##.#.###._.# #._.#cggik____cgg[c8=---5.8 (1.0cggBc___cggHw _You see here a killer bee corpse.cgg:cggcggLcggcggcgg5Xcgg[cggk9=Rev+ cggcgg/cggxcggcggcgg0cggdcgg[PRev cggEcggcggL920cggcggcgg2cggcgg@cggcggecggcgg7R1=cggcgg0cggvcggu,cgglcgg cggf S2=cgg cgg ,cgg cgg3cgg6cgg,cggcggcggI4=cggcgg,cggcggO,cggcgg,cggcgg~i5=cggcgg ,cgg cggu"cgg"cgg"cgg#cggE$76cgg$cgg&cgg&cgg'cgg_)cgg)cggG*cgg<,_7=cgg,cgg.cgg.cggz/cgg1,cggq1cgg3cggS3S8=cgg$4cgg5,cggl6cgg,8,cgg8cggX:cgg:cgg;cgg3=cgg=79cgg(>cgg?,cgg@cggyB,cggFCcggDcggET30=cggEcggG,cggwHcggIcggxJcggJcggvLcggLK1=cggtMcggOcggIOcggOcggQcggQcggRcggTcggT92cggSUcgg[W,cggWcggX,cggXcggYi3=cgg_Zcgg9[,cgg[cggy\,cgg\cgg],cgg^cgg^a4=cggi_cgg`,cggacgg{c,cggccggdO5cgg2ecggf,cggUgcgghcgghcgg{icggjcggAkS6=cggkcggmcggmcggfncgg;pcggxpcggqcggra7=cggscggu,cggvcggx,cgg9ycgg{,cgg{cgg}cgg"~98cgg}~cgg,cggcggǀ,cgg.cggOcggȂS9=cggqcgge,cgg3cgg,cgg]cggTcggL40=cggcgg,cggcgg',cggcggIcgg91cggcgg,cggcgg,cggWcgg,cgg֘cggi2=cgg]cgg,cggdcggBcggcggPcggJcggD3=cggcgg,cggOcgg,cgg14cggƮcgg,cggcgg4cggS5=cggcgg,cgg[cgg ,cggfcggqcggK6=cggcggջcgg"cggcgg,cgg@cggcgg cggcggO7cggPcgg,cgg>cgg,cggcggS8=cggcggcgg*BcggcggJcggcgg"a9=cggcggwcggcggjcgg|cggcgg5cgg:P50cggcgg',cggcggcggcggjcgg,cgg7cggcggN51=cgg,cgg,cggcggcgg^cggcgg2=cggcggcggTcggcgg%3cggcggcggcggcgg,cggcggcgg4K4=cggcgg[ cgg cgg3 cgg cgg cgg cgg%cggU5=cggNcgg6cggcggcgg,cggUcggcgg,cggYcgg%6cggcgg}cggcgg[cgg#,cgg8$cgg%cggB&K7=cgg'cgg(cgg(cggw)cggy+,cgg6,cgg-cgg7.U8=cggK/cgg]1,cgg1cgg2cgg63cggc4cgg5cgg@6%9cgg6cgg8cgg9cgg9cgg"<,cgg<cggC>,cgg?cgg!Ab60=cggAcggBcggCcggwCcggyEcggEcggXFcggHcggkHU1=cgg*IcggOcggP;2cggbQcggScgg;ScggScggnU,cggUcgg{Wa3=cggWcggX,cggXcggY,cggZcggR[cgg[U4=cgg\cgg]cgg5^cgg^cgga,cggacggc,cggRdcggfcggZf%5cgggcgghcgg&icggcicgg>kcggkcgglcggsmcggmK6=cggncggpcggpcggjqcggr,cggscgg}ucgguU7=cggvcggwcggxcggxcggz,cggA{cggs|cgg|%8cgg}cgg,cgg(cggЁ,cggcgg,cgg_cggXcggK9=cggQcgg<,cggЊcgg͌,cggbcgg[cggV70=cggcggT,cgggcggMcggcggGcgg _--- .___ _You start resting.cgg__6670.0)__cgg51=cggݢ%61cggEy_____cgg" _HP restored.cggSx...# #...##.##.# ##...# #...# #._.# #._.###.#.## #._.# #._.# #...####...####...# ##...####...# cggyj####.##.###.###._.###.###.##.####  ##..#####.##...##..##  ##.#..####.##.#..#.## ####.####.####.#..####.#### #...######...##..†##...######...# #._........_....@...._........_.# #...######...##...##...######...# ####.####.####.#.#.####.####.####  ##.#..####.##.##.####..#.## ##..##...##.#####..## ####.##.#._.###.###.##.####cgg:{X  #...####...## #...####...####...#  #._.# #._.# ##.#.###._.# #._.#  #...# #...## #.##.##...# #...# cggU]___cgg17.8 (1.0)cggQy____cgg]d _There is a staircase back to the Dungeon here.cgg1nw___cggCocggu[___cggzwM _You can't go down here!cgg____cgg_____cggF _Unknown command.cggUQ h___________cgg6U _____cgg0[ -8 _cgg*^ ______cggg ###.............#....######..  #...............#.....##.....  ###..##.........#......y.....  ###...#......#......b.bb##... #............#.....y...b.##.. ###...........y....###...#... ###......P...###....b.... #..#.#P.P.........#......Dungeon:7 ##.###.....#...... ####....P.y.y.#...... #..#..........#.>........[. ###..............#.....b.....###..............................#.......##.................. yyy 3 killer bees ggs5d..#...........#..............##.. .[............#.................. ..............#..............####=cggcggT  You climb upwards. Welcome back to the Dungeon!cgg)cgg:)1.yy. _Unknown command.  You climb upwards. Welcome back to the Dungeon!  The killer bee barely misses you. The killer bee stings you!  You are poisoned.  The killer bee poisons you! The killer bee misses you.The killer bee barely misses you. The killer bee closely misses you.cggx64==---=70.3 (2.5Pois cgg~cgg --- _The killer bee barely misses you.cgg/  --more--cggYg _There is a staircase to the Ecumenical Temple here.cggEcggXFcggPcggR> _Unknown command.cgg. ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##.........#......y..... Health: 64/71 =====================---  ###...#......#......b.bb##... Magic: 9/9========================  #............#.....y...b.##.. AC: 7Str: 12 cggU ###................###...#... EV: 15Int: 9 ###......P...###....b....## SH: 0Dex: 21 #..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@y**......#...... Noise: =--------  Time: 6670.3 (0.0) ####....P.y***#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#.......***#.>........[. Fire: a) +2 sling {Septima}  ###..............#.....b..... Pois  ###............................ ###..#.......##.................. yyy 3cggY killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### _There is a staircase to the Ecumenical Temple here. _Unknown command.Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecgg ..**PP***@y........cgg- ....P#*P*cggI P.#P***Aim: a plant (chance to blink: 50%)cgg/a @.P*y.***cggq .*@yP*y*.***cggУ D*.cggn .@y.y..*********cggӚw****...cgg8y**.***.***.cggE@y***...cgg@y.*****cgg+ y***.***.***cgg+y****...cgg@y*.y**.***.cgg@y**y***.***cgg@y..*****cggv y**.***.***.cgg y***.***.***cgg1gy****...cggPy*@y*.y**....cggPy.@y**y******cgg1j ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##.........#......y..... Health: 64/71 =====================---  ###...#......#......b.bb##... Magic: 9/9========================  #............#.....y...b.##.. AC: 7Str: 12  ###................###...#... EV: 15Int: 9 cggK2###......P...###....b....## SH: 0Dex: 21 #..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@y........#...... Noise: =--------  Time: 6670.3 (0.0) ####....P.y...#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#..........#.>........[. Fire: a) +2 sling {Septima}  ###..............#.....b..... Pois  ###............................ ###..#.......##.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### _Unknown command.Aiming: Warp SpacePress: ? - help, cgg2-[37mQ - select action, ( or ) - cycleShift-Dir - straight lineSpace twists violently! The rupture engulfs the killer bee!  The killer bee blinks!cgg:  ..........#...  #.........#...  ###...#..  #......  ###.... .. .. ###.... ####.cgg;4####... #..#.####.>[  ###....  ......y.....#.........[.....#.........cggcgg#J2-  Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight line  Space twists violently! The rupture engulfs the killer bee!  The killer bee blinks!  The killer bee is almost dead.cgg+/  --more--cgg s  You feel sick. The killer bee barely misses you.cgg{! oThe killer bee completely misses you. The killer bee stings you.cgg, §.........y.cggn- cgg- 56=---=======1.3 (1cgg: cgg= P _The killer bee closely misses you.cgg2lO--cggmcggsq> _Unknown command.cgg ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##.........#......y..... Health: 56/71 ==================------  ###...#......#......b.bb##... Magic: 9/9======================== cgg #............#.....y...b.##.. AC: 7Str: 12  ###................###...#... EV: 15Int: 9 ###......P...###....b....## SH: 0Dex: 21 #..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@§........#...... Noise: =======--  Time: 6671.3 (0.0) cggeu####....P.y*..#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#........**#.>........[. Fire: a) +2 sling {Septima}  ###.............*#.....b..... Pois  ###...............*y*.......... cggm###..#.......##.....***.......... yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### cgg _The killer bee closely misses you. _Unknown command.Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: a killer bee (almost dead, chance to blink: 50%)cgg ***********.....y....cggb....***.*****cgg ,.....***..*P*P*PAim: a plant (chance to blink: 50%)cgg8 ....P**P*Py*@*cggQ  P...Py*.@**y**cggl Py.@***y******cggn *.**.cgg §...*******cggī ?*#cgg ..*#.**cgg% D**ycggD6 .*.**cgg6 2***cgg S*.*cgg_ U**...cgg ***#***..ycgg( 7*#cgg7g******.cggRvx*****...cgg@**.y**.***.cggC@§.*****cgg < ###.............#....######.. SunshineJesse the Skirmisher#...............#.....##..... Coglin###..##.........#......y..... Health: 56/71 ==================------###...#......#......b.bb##... Magic: 9/9========================#............#.....y...b.##.. AC: 7Str: 12cgg ###................###...#... EV: 15Int: 9###......P...###....b....## SH: 0Dex: 21#..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7##.###..@§........#...... Noise: =======--  Time: 6671.3 (0.0)####....P.###.#.....###.... a) +2 sling {Septima j) +0 sling (elec) {#..#......###.#.>........[. Fire: a) +2 sling {Septima} ###.........###..#.....b..... Pois ###................y........... ###..#.......##cgg [40m.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### _Unknown command.Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineSpace twists violently! The rupture engulfs the killer bee.  The killer bee is heavily wounded.cggx0cggD  Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight line  Space twists violently! The rupture engulfs the killer bee.  The killer bee is heavily wounded.  You feel sick. The killer bee stings you! x2cgg3.y........y.40=-----2.3 (1cggR-----cgg0/  --more--cggY _The killer bee closely misses you. x2cgg5 ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##.........#......y..... Health: 40/71 =============-----------  ###...#......#......b.bb##... Magic: 9/9========================  #............#.....y...b.##.. AC: 7Str: 12  ###................###...#... EV: 15Int: 9 ###......P...###....b....## SH: 0Dex: 21 #..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@.........#...... Noise: =======--  Time: 6672.3 (1.0) cgg####....P.y**.#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#......***.#.>........[. Fire: a) +2 sling {Septima}  ###.........***y.#.....b..... Pois  ###............................ ###..#.......##.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### _The killer bee closely misses you. x2  Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecgg ***********y........cgg" ........PP**cgg!*********PP..cgg=.......cgg>s.**PP**cggX*****..cgg6...*P**Aim: a plant (chance to blink: 50%)cgg0 .*P*P*P@cgg"=.P**P*Py.*@*Aim: a plant (chance to blink: 50%)cgg P..P@*y*cggaP**P@.y.  Aim: a plant (chance to blink: 50%)cggQP***.Py*.@**killer bee (chance to blink: 50%)cgg\1/ ...cgg1^y*y**cggzPy**@***y***cgg y..*****cgg# y****...cgg.  ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##.........#......y..... Health: 40/71 =============-----------  ###...#......#......b.bb##... Magic: 9/9cgg ========================  #............#.....y...b.##.. AC: 7Str: 12  ###................###...#... EV: 15Int: 9 ###......P...###....b....## SH: 0Dex: 21 #..#.#P.Py........#...... XL:  9 Next: 59% Place: Dungeon:7 cgg m##.###..@.........#...... Noise: =======--  Time: 6672.3 (1.0) ####....P.y...#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#..........#.>........[. Fire: a) +2 sling {Septima}  ###............y.#.....b..... Pois  ###............................ ###..#.......##.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............#### cgg w_The killer bee closely misses you. x2  Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cyclecggW Shift-Dir - straight lineSpace twists violently! The rupture engulfs the killer bee!  The killer bee blinks!cggc  ..........#.y.  #.........#...  ###...#..  #...... cggT ###.... .. ###.... ###.... ####.####... cgg"#..#.>[  ###....  ............#.........cgg7q[.....#.........cggcgg %  Aiming: Warp Space  Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight line  Space twists violently! The rupture engulfs the killer bee!  The killer bee blinks!  The killer bee is almost dead.cgg cgg< cggcgg/  --more--cggns  You feel sick. The killer bee barely misses you.cggz.y......y...cgg{&3cggcgg؈S _The killer bee completely misses you.cgg0  ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin  ###..##........*#*.....y..... Health: 40/71 =============-----------  ###...#......#.*y*..b.bb##... Magic: 9/9========================  #............#.***.y...b.##.. AC: 7Str: 12  ###...........*....###...#... EV: 15Int: 9 ###......P..*###....b....## SH: 0Dex: 21 #..#.#P.P*........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@.........#......gg )m Noise: =======--  Time: 6673.3 (1.0) ####....P.yy..#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#..........#.>........[. Fire: a) +2 sling {Septima}  ###..............#.....b..... Pois  ###............................ ###..#.......##.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............####You feel sick. The killer bee barely misses you. _The killer bee completely misses you.Aiming: Warp SpacePress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: a killer bee (almost dead, chance to blink: 50%)cggШ] .#.#..y.....P**.*P*@*cgg5#.cggLc*******P..P.@.cgg5" ..#.....P**P*@*cgg :#.cgg1 *****P.**.P.@.cgg_g ..****cgg4& ...*****cgg[O ..**y**cgg ...@**.yy*.***cgg=y*Aim: a killer bee (almost dead, chance to blink: 50%)cggI~T y*cgg4M P****...cgg|P***@***yy**cgg&...@**.yy*.***cggr ***@***yy**...cgg#...@**.yy*.***cgg+} y*Aim: a killer bee (almost dead, chance to blink: 50%)cgg! A*@*.*yy.***.heavily wounded, chance to blink: 50%)cgg **@.P*yy***.cgg5..@*****cgg ###.............#....######.. SunshineJesse the Skirmisher  #...............#.....##..... Coglin cgg ###..##.........#......y..... Health: 40/71 =============-----------  ###...#......#..y...b.bb##... Magic: 9/9========================  #............#.....y...b.##.. AC: 7Str: 12  ###................###...#... EV: 15Int: 9 ###......P...###....b....## SH: 0Dex: 21 #..#.#P.P.........#...... XL:  9 Next: 59% Place: Dungeon:7 ##.###..@.........#...... Noise: =======--  Time: 6673.3 (1.0) cgg####....P.yy..#.....###.... a) +2 sling {Septima j) +0 sling (elec) { #..#..........#.>........[. Fire: a) +2 sling {Septima}  ###..............#.....b..... Pois cgg~ ###............................ ###..#.......##.................. yyy 3 killer bees ..#...........#..............##.. .[............#.................. ..............#..............####Aiming: Warp SpacecggaPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineSpace twists violently! The rupture engulfs the plant! The plant begins to die.cggOThe plant is lightly damaged.  The rupture engulfs the killer bee!cggv/  --more--cgg̓ [  You kill the killer bee!cgg(   ..........#...  #.........#...  ###...#..  #......  ###.... .. ..cgg˙  .. ####....###y..#... #..#....###...#.>[  ###.......###  ....... 2.....#.........[.....#.........cgg0cgg3:cgg<cggI.yP.†......  cggwJPYou feel sick. The killer bee barely misses you.cggOL39624cggYcgg[P _The killer bee closely misses you.cgg^tcgg ucggcggς> _Unknown command.cgg>cggcggucgg9> _Unknown command.cggf(((((((cgg9  You shoot a sling bullet. The sling bullet misses the killer bee.You shoot a sling bullet.cggks  The sling bullet barely misses the killer bee.cggcgg]m .yy...cggd...  You feel sick. The killer bee barely misses you.cgg8=-===----5.2 (0.9Rev cggcggC _The killer bee stings you but does no damage.cgg_V cgg1W C-----cgg_ cgga F _Unknown command.cggXd  You shoot a sling bullet. The sling bullet hits the killer bee.cgg`.   killer beecggf (((((((You kill the killer bee!cggM* .......  You shoot a sling bullet. You feel sick. The killer bee closely misses you.56.1Rev+ cggƈcgg>W _The killer bee barely misses you.cggcggmcgg2cggF _Unknown command.cgg [ ((((cgg C(((You shoot a sling bullet.cgg>E t  The sling bullet closely misses the killer bee.cgg  y......  You shoot a sling bullet. The sling bullet misses the killer bee.You feel sick.  You are no longer poisoned.7=7.0Rev+ cgg P _The killer bee misses you.cgg (((((((You shoot a sling bullet.cgg# cggG The sling bullet barely misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.cgg*cgg)cgg:K.......cggj?m79Rev* cggJcggLN _You kill the killer bee!cgg#...#.....###..##...#......y.###...#......#......b.bb##cggu%#............#.....y...b.###.....###...#.. ###......P...###....b....## #..#.#P.P.........#.......##.###..>.#.####....P.†@..#.....####..#..........#.>........[###........b.....###.......... ##..cgg]##. .#...........#.## [.....#... ......#.#####cgg!.#...##..cggWcggcgg.cggL7---8.9 (1.0cgg@cggV _A nearby plant withers and dies.cgg4cggcggxcgg!Q8Rev+ cggBcggcgg,cggGcgg9cggm9=Rev cggcgg` ,cgg cgg ,cgg cggK cgg M40=cgg cgg cggd !cggl cgg 0cggO cggz ,cggu cgg# cgg 91cgg cgg ,cgg cgg ,cgg* cggJ" i2=cgg# cgg% ,cggm' cgg) ,cgg* cggp, cgg, K3=cgg. cgg0 ,cgg1 cgg25 ,cggh6 cgg{8 O4cgg9 cgg; ,cgg< cgg> ,cgg? cggB cggiB S5=cggqC cggE ,cggxG cggQK ,cggqL cggN ,cggP cgg_R cggR K6=cggPT cggV ,cgg X cggZ ,cgg[ cgg] cgg:^ 97cgg^_ cgga ,cgg c cgg4e ,cggf cggi cggui S8=cggj cggl ,cggn cggp ,cggq cggs cggs D9=cggau cggw ,cggx cggz ,cgg| cggQ~ ,cgg cggl cggށ :50cgg cgg3 ,cggm cggň ,cgg cggR cgg݌ N51=cgg cgg ,cgg cggM ,cgg cgg cgg~ P2=cggs cgg ,cggS cggo cgg cggҟ cgg ;3cgg cgg; ,cgg cgg ,cgg cgg cgg` K4=cggð cgg| ,cgg˴ cgg cgg cggI cgg ,cgg cgg۽ cggZ U5=cgg cgg cgg cgg cgg cgg cggb cgg cgg4 %6cgg- cggO ,cgg} cgg ,cgg cgg cgg K7=cgg cggL ,cgg cgg ,cgg cgg cgg U8=cggo cgg cgg9 cggr cgg ,cggk cggq ,cgg cgg= cgg %9cgg cgg cgg cgg0 cgg ,cgg6 cgg6 cgg L60=cgg cgg* ,cgg cgg ,cgg cgg\ cgg U1=cggC cggX ,cgg cgg ,cgg cgg cgg* %2cgg cggU ,cgg cgg ,cgg cgg6 ,cgga cgg ! cgg! K3=cgg" cggK% ,cgg& cgg( ,cggJ* cgg, cgg6- U4=cggs. cggw0 ,cgg1 cgg4 ,cgg5 cgg|7 cgg7 %5cgg9 cgg; ,cgg== cgg? cgg? cgg@ cggbC cggC D6=cggE cggNG ,cggH cggK ,cggqL cggNN cggN U7=cgg,P cggqR ,cggS cggU ,cggV cggWY ,cggZ cgg+] ;8cgg)^ cgg` ,cggUb cggTd ,cgge cggh cggh K9=cggi cggk ,cggAm cggo ,cggMq cggs cggs V70=cggt cggPw ,cggx cggz ,cgg| cgg: cgg K1=cgg( cggU 1 _HP restored.cgg cggt cgg cgg cggZ ,cgg3 cgg cgg3 cgg cgg< cgg cggB cgg 9=cgg5 cgg cggh ,cgg cgg cgg ,cggI cgg) cgg ,cgg. cgg cgg' ,cgg cgg cgg cgg? cgg cgg; cgg cgg1 cgg cgg cgg ,cgg cgg cgg ,cgg cgg cgg ,cgg cgg- cggH cgg cggv cgg cgg ,cgg cgg cgg! ,cggJ# cgg& cgg) ,cgg+ cgg. cgg1 ,cggw3 cgg6 cgg9 ,cgg; cgg> cggA ,cggl   There is a stone staircase leading up here.cggx  _cgg# cgg cgg cgg cgg` cgg cggЕ cgg' cgg} cgg cgg cgg cgg cgg& P  There is a stone staircase leading up here.cgg cggy  _cgg= cggö cggD ,cgg cgg cgg cgg\ cgg| cgg cggu ,cgg cgg <  You see here a +0 club.cggJ cgg  _cggb cgg cgg Bcgg cgg ,cgg] cgg cgg ,cgg cgg cgg Bcgg F.###..........#......# ......[...##.........# ...........#...###.### ......)##..# ...........)...##.## ....##.............# ..........[........# ....#########...#### .#...##.....##..@##### ---824cgg 46.0) .###.#.......##...#..## .###.#.......####.....# .....#...≈...##.......# .##..#.......#........####.##.#.......#.#.# ..##.##.....####....####.####'###..##.......####...#......##cgg cgg cgg# T _Key pressed, stopping explore.cgg5L Icgg:\ f _cggc Xcgg=j Bcgg k cggo cggSq ,cgg s cggsv cgggx cggx cggy cgg| cgg]~ cgg~ cgg; cgg cgg ,cgg cgg cgg ,cgg cgg~ cgg ,cgg cggv cggG ,cggf cgg! cgg cgg\ cgg~ cgg cgg< ,cggC cgg cggɪ cgg' cgg cgg@ cgg ,cgg cgg cgg۹ ,cggf cgg cgg ,cgg cgg cgg cggd cggJ cggo cgg= ,cgg< cgg cgg{ cgg cgg cgg cgg cgg cgg cgg cgg ,cgg cgg cgg ,cggb cggj cgg3 ,cgg cgg cgg cggZ cgg cgg cgg cgg cggk cgg cggD cgg cgg( cggf cgg ,cgg cgg cgg_ Bcgg  cggK cgg  ,cggM cgg ,cgg cgg' cgg* cgg* cgg+ cgg'0 cgg0 ,cgg1 cgg;6 cgg7 ,cgg8 cgg?? cgg-B ,cggD cgg J cggM ,cggO cggT cggW ,cggY cggB_ cgga cggkb cgg/d cgg}i cggk cggdl cgg n cggs cggu ,cggw cgg} cggs cgg cggt cggo cgg cgg cgg3 cgg% cgg cggI cgg cgg؝ cgg ,cgg$ cgg cgg ,cggի cgg2 cgg cgg~ cgg{ cgg cggI cgg cgg* cggt cgg ,cggP cggF cgg cgg cgg2 cggs cggm cgg cgg cgg cggN ,cgg cggq cggV cgg cggc cgg cgg cggk cgg cgg cgg{ ,cggO cgg cgg^ ,cgg- cggi cgg cggV cgg cgg cgg ,cgg cgg" cgg# ,cgg cgg cgg,cggcggLcggcggcggcggcggZ cgg cgg] cgg cgg,cgg<cggcgg$cggcggNcggcgg{,cggDcggJcgg,cggcggcggb,cggX cgg#cgg%,cggt&cgg(cggT*,cgg,+cgg/cgg31,cgg%2cggo4cgg5,cgg6cggX9cgg:,cgg;cgg=cgg>cggQ?cgg?cggBcggiCcggCcggDcggFcggH,cggtIcgg KcggL,cggMcggNcgg^P,cggPcggScggTcgg+UcggUcggt  ##................#.   #...##............##   ##..##...#..........   #.................##   #....##.#.........##   #.......##..........   ###......#..........   #..................   #.@.###...........#900.9 (76.0)   #..## #...........#   #### ##.........##  ##........#  ##.#.#####  #.###  ##    cggvcggzcgg}E _Done exploring.cgg^=cggT>3cgg#.......0.0)...........cgg)[ _Done exploring.cgg=OIcgg]cggl^cggkbcggdE _Done exploring.cgg$ cgg Where to? (Tab - D:6 @ (x,y), ? - help)  D - Dungeon  T - Temple cggacggm6[?25h[?0c cggxn##................#. SunshineJesse the Skirmisher  #...##............## Coglin  ##..##...#.......... Health: 71/71 ========================  #.................## Magic: 9/9========================  #....##.#.........## AC: 7Str: 12  #.......##.......... EV: 15Int: 9  ###......#.......... SH: 0Dex: 21 cggoD #.................. XL:  9 Next: 67% Place: Dungeon:7  #.@.###...........# Noise: ---------  Time: 6900.9 (0.0)  #..## #...........# a) +2 sling {Septima j) +0 sling (elec) {  #### ##.........## Fire: a) +2 sling {Septima}  ##........#  ##.#.#####  #.###  ###  cggoU _You see here a +0 club. _Key pressed, stopping explore. _Done exploring. _Done exploring. _Done exploring.  What level of the Dungeon? (default 6, ? - help) cgg5 [?25l[?1ccgg48cggcgg8cgg}cgg?" _cggs(cgg)cgg^*cgg*cggZ2cgg3cgg24cgg4cgg<cggi>,cgg?cggEcggGcggGcggHcggeOcggPcggXQcggRcggYcggZcggK[cgg[cggacggd,cggbecggDkcggmBcggMscggtcgg"ucggucggzcgg$|cgg|cgg_}cggcgg#cggcggcggncggcggccgg(cggcggcggِcggcgg"cgg,cggcggKcggcggcggݞcggcgg,cggcggcggΩ,cggcgg3cggBcggcgg;cggYcgg+cggWcgg{cggcggcggcggA,cggcggacggEcggcggfcggcggcgg}cgg0cggcgg~Bcggcgg,cggucggcggi,cggc cggcgg6cggcggcgg,cggcgg>!cgg#Y  There is a stone staircase leading down here.cgg'cgg~+: _cgg .cgg>G8cggHcggU9  You climb downwards.cggfVcggXcgg_ _The wolf howls! x2; You hear an angry growl.  Found a scroll labelled FINEOH CYUPS.  There is a stone staircase leading up here.cggcgg   .# .. .##  .. ##.###  cgg!#....  #..# #@.#===32.7 (31.8) #.....h..  ...#..h.h  .#### ...? ..... .... hhh 3 wolves (1 wandering) .##. cgg"3#. cgg"cggY+cggK0d _There are monsters nearby!cggȁ (((((((You shoot a sling bullet.  The sling bullet barely misses the wolf.cggh  You shoot a sling bullet.  The sling bullet barely misses the wolf.The sling bullet closely misses the wolf.  You shoot a sling bullet.  The wolf howls!  The sling bullet hits the wolf. Lightning courses through the wolf!cggAcggEcggcgg͍q...h..h. 2cgg6]3.6 (0.9)Rev cggjcggcggZ/  --more--cgg- Z _The wolf is heavily wounded.cggj (((You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.  Lightning courses through the wolf!cgg  The wolf is heavily wounded.You shoot a sling bullet.  The sling bullet completely misses the wolf.cgg /  --more--cgg; ((The sling bullet hits the wolf.cgg7cggI9cgg:cgg >9The wolf is lightly wounded.cgg AMA sky beast comes into view.cggAcggAcggNY.h.h..g..g   Grum (polearm)Y   sky beasthh 2 wolvescggOd4.6 (1.0Rev+ cggZcgggt _Grum the Hunter comes into view. He is wielding a +1 glaive.cgg]cgg]cgg'gcggl> _Unknown command.cggp(((((((You shoot a sling bullet.cggL&  The sling bullet closely misses the wolf.You shoot a sling bullet. The sling bullet hits the wolf.cgg٬cggscgg cggl  The wolf is severely wounded.cggcgg .Yh.h...g......cgg&5cggcgg{ _Grum glances around and shouts, "Sparky! Here boy!"cgg cgg cggMcggF _Unknown command.cggOy (You shoot a sling bullet.cgg  The sling bullet barely misses the wolf.You shoot a sling bullet. The sling bullet hits the wolf.cgg,ag  The wolf is almost dead.cggb5  You hear a howl!cggCdcggdcggecgg]fcgg?gcggRrN.Y.hhh...hY   sky beasthhhh 4 wolves (1 wandering)cggKs-6.5 (0.9cgg<}cggR _The wolf bites you but does no damage.cggq/  --more--cggjb _A wolf comes into view.cgg3_((You shoot a sling bullet.cggxThe sling bullet closely misses the wolf.You shoot a sling bullet.cggwBcggDWThe sling bullet barely misses the wolf.cggGwThe wolf closely misses you. The wolf bites you! The sky beast hits you.cggQrhhh..h...cgg#R62----7.4Rev* cggZcgg^R _The wolf closely misses you.cggwcggmcggcggV  The wolf completely misses you. The wolf barely misses you.cggcggn gg   Grum (polearm)Y   sky beasthhh 3 wolvesThe sky beast misses you. The wolf bites you.cggs59-------8.4 (1.0cggcggb .........)..###.#.......##...#..# ............###.#.......####..... ................#...≈...##....... ..........#.##..#.......#........ .......#.....##.#.......#.#...... ......##.....##.##.....####....## ......##.........###'###..##..... ...............h..........#...#..7 cgg...............h@.#..........#### ....##.........Y.h.............#. ##.####............[.......##.... ##.###.....................####.. #..........................# #.## .##.##.............)......####... ..#.#..............)[.....[...... ...................#.....#....... ........................##....... _The wolf bites you but does no damage. The wolf barely misses you.cggA---cggcggl-9.9 (2.5Rev+ cggcgg} _You climb upwards. _There is a stone staircase leading down here.cggcgg^8-cggÚcggǝF _Unknown command.cgg$N cggN cggZ cgg2] F _Unknown command.cgg..#...###...##### )..###.#.##...#..#####.#.......####.....#......#...≈...##cgg..#.##..#.#........#.....##.#.......#.#.......##.....##.##.....####....#####.###'###..##....h.@........#...#.....h>.###### ...##..Y.h......# #.#[.##...###......####... .............# #.### ##.#cgg)......#### .#.#)[.....[#.cggPcggcgg]cggAcgg .hYhh...  The wolf attacks as it pursues you! The wolf bites you. The wolf bites you!cggOq46----==40.9 (1.0cggcggf _The wolf bites you. The wolf closely misses you.cggx #...##.....##...##### )..###.#.##...#..## ###.#.####.....# ..#...≈...##.# #.##..#.......#.##.....##.#.......#.#.##.....##.##.....####....###.###'###..##.h.#...#.cggyy VYhh#.###....#. .####..[.......##. .###..........####..........# #.###. #.##..)......####. #.#..)[.....[.#.....#.cgg~ cggс cgg{ h.YThe wolf closely misses you. The wolf barely misses you.cgg6 .-1cgg cggQ R _The wolf closely misses you.cggP~#...##.....##...##### )..###.#.......##...#..## ###.#...§§..####.....# #...≈§..##.# #.##..#....§..#.##.....##.#.......#.#.##.....##.##.....####....####.##.###'###..##.#hh.#...#.cggYh#.######. .##....#. ####....[.##. ###......####.......# #.###. .##.......)......####. .#..)[.....[.#.....#.cggcggcggDzcgg..§h>Ycgg@-2cggHcggy _The wolf attacks as it pursues you! The wolf completely misses you.cgg..#########...#### ..#...##.....##...##### cggQ)..###.#.......##...#..## ###.#.§.§§..####.....# .....#..§§§..### ..#.##..#..§.§..#........####.....##.#.......#.#.........###.....##.##.....####....######.........###@###..##.......##hhh.#...#..... ...>Y#######..cgg....#[##... ######.... .... #.### #)......#### #)[.....[#cggcggcgg&cgg:cggcggS-...##...§...§.cggD.≈.§.§§§.h.h.#hYcgg/39------=3Rev cgg<cggJAl _The wolf bites you! _There is an open door here.cggS......[...........#########...#### ...#...##.....##...##### )....#..####.#..§.§..####....≈.§.## ...#.##..#..§....#..###.#...§§§.#.#........##.##..@..####....####.##.........###'###..##.......##....h.h......#...#.... .....>.#h.........######......Y............##......[.......##.. ##.....####... 2 .........# #.### ##)......####.cgg+Xcgg*[cgg\cgg^\  The wolf attacks as it pursues you! The wolf bites you.cggo$##.....##.....≈......hhY.h 3 wolvescggYpcggpq4-----4cggzcgg~Q _The wolf barely misses you.cgg@cgg_A8-cggJcggvM^ _You are too injured to fight recklessly!cgg4cggcgg#^ _You are too injured to fight recklessly!cgg cgg cgg cgg ^ _You are too injured to fight recklessly!cggb^  You shoot a sling bullet. The sling bullet hits the wolf!cggb† 2cgg (You kill the wolf!You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cggDhY.cgg!Z--73==5.8 (0.9cgg+cgg/2 _The wolf is lightly wounded.cggk.4cgg1cgg5F _Unknown command.cgg  You shoot a sling bullet. The sling bullet hits the wolf.  Lightning courses through the wolf!!cgg †   wolfcggLF ( You kill the wolf!You shoot a sling bullet. The sling bullet hits the wolf.cgg ,cgg  #######...........§§§§§§h.YThe wolf is moderately wounded.86.8 (1.0Rev+  _The wolf barely misses you.cgg (You shoot a sling bullet.  The sling bullet closely misses the wolf.The sling bullet hits the sky beast.cggc  The sky beast is lightly wounded.  You shoot a sling bullet. The sling bullet misses the wolf.The sling bullet hits the sky beast!cggM95cgg/  --more--cggP h  The sky beast is heavily wounded.7.7 (0.9 _The wolf bites you but does no damage.cgglFVYou shoot a sling bullet. The sling bullet hits the wolf.cggY The wolf is heavily wounded.You shoot a sling bullet. The sling bullet hits the wolf!cgg`k.§The wolf is almost dead.cggag8.6Rev* cggHocggty _The wolf closely misses you. The wolf bites you but does no damage.cgg' cgg cgg cgg 0 _Unknown command.cgg cgg ^  You shoot a sling bullet. The sling bullet hits the wolf!cgg$ F†cgg (((((((You kill the wolf!You shoot a sling bullet.cgg cgg Z#######..........§§..§§≈..§§§..Y..cgg0 ....cgg 6839.6 (1.0cggw cgg) c _The sling bullet barely misses the sky beast.cgg70%  cgg0>You shoot a sling bullet. The sling bullet hits the sky beast.cgg+  The sky beast is heavily wounded.You shoot a sling bullet. The sling bullet hits the sky beast.cggS ##.....≈.§......  The sky beast is severely wounded.28--50 _The sky beast hits you. The air twists around and strikes you.cgg: (((((((You shoot a sling bullet.cgg s  The sling bullet closely misses the sky beast.cggP [ ####### ##.....## )#.......# #.§.....# #...≈...# #§......##.......##..@..####(###.(.>.#.(....(.....[(.......(.........(......# )You shoot a sling bullet. The sling bullet misses the sky beast.cggcgg^[cgg # cgg #######cgg2!# cgg!:##.....##cggD"  cgg")cgg#:#.......#cgg|#  cgg#[#.§.....#cgg^$  cgg$\#...≈...#cggG%  cgg%u#§......##.......#cgg&##..@..####(###.(.>.#.(....(.....[(.......(.....cgg,....(......# )cgg2n ..Y.cgg=3b.....  The sky beast hits you. The air twists around and strikes you!cgg 4_16------1.5 (0.9cggx;cgg,>V _* * * LOW HITPOINT WARNING * * *cggĚ (((((((You shoot a sling bullet.cgg  The sling bullet closely misses the sky beast.You shoot a sling bullet.cgg  [ ####### ##.....## )#.......# #.......# #...≈...# #.......##.......##..@..#cggR ###(###.(.>.#.(....(.....[(.......(.........(......# )The sling bullet barely misses the sky beast.cggu Q[ ####### ##.....## )#.......# #.......# #...≈...# #.......#cggp #.......##..@..####(###.(.>.#.(....(.....[(.......(.........(......# )cggQ Y......  The sky beast hits you. The air twists around and strikes you!cgg: 9/71 ------2.5 (1.0cggb cgg V _* * * LOW HITPOINT WARNING * * *cgg c  You shoot a sling bullet. The sling bullet hits the sky beast.cggn (((((((The sky beast is severely wounded.cgg(  cggd !cgg Ycggo .cgg .cgg> .cgg .cgg .cggj .  cgg JYou shoot a sling bullet. The sling bullet misses the sky beast.cggM cgg cgg0 &3.4 (0.9cgg cgg  cggD cgg 2_The sky beast barely misses you.cgg cgg1{ [ ####### ##.....## )#.......# #.......# #...≈...# #.......##.......##..@..####Y###...>.#............[.........................# )You feel much better. The sky beast hits you.cggM[ ####### ##.....## )#.......# #.......# #...≈...# #.......##.......##..@..####Y###...>.#............[.........................# )cggfK  The air twists around and strikes you!cggU~18/71===--4.4 (1.0cggy--  --more--cggK9W _* * * LOW HITPOINT WARNING * * *cggJYou feel much better. The sky beast hits you.cggp39==========5cggjcggo4 _The air twists around and strikes you!cgg cgg cgg( cgg > _Unknown command.cggwv You shoot a sling bullet. The sling bullet hits the sky beast!cgg$G  The sky beast is almost dead.You shoot a sling bullet.  The sling bullet hits the sky beast but does no damage.cggl  The sky beast is almost dead.cgg|2====---==6.3 (0.9cggcggT _The sky beast hits you. The air twists around and strikes you!cgg (((((((You shoot a sling bullet.cgg  The sling bullet barely misses the sky beast.You shoot a sling bullet.cgg  Y......  The sling bullet closely misses the sky beast.cgg o3=--7.3 (1.0cggcggV _The sky beast barely misses you.cggc  You shoot a sling bullet. The sling bullet hits the sky beast.cggjh†cggE (((((((You kill the sky beast!cgge†......cgg 2=98 _You shoot a sling bullet.cggcggi _Your Fighting skill increases to level 7!cgg{8  #########...####...##.....##...#####)..###.#.......##...#..##.##.........#...≈...##..#.##....#.####.....###...###.....####....####....###@###..##.......#....................#...#.........>.#..........######........Rev* .....#.....#...#.....)......## #..............)[.....[.........# cggC cggD S4---9 _cggN cggyU  There is an open door, spattered with blood here.  Things that are here: _a wolf corpse; a wolf corpsecgg"wcggwcggycgg|cgg,cggAcgg{cgg]cgg"cgg`J5Rev+ cggdcggcgg5cgg cgg,cggߒcgg>j6=cggcggPRev cggȢcgg,cggrcggcgg]L7=cgg,cgg 7cggѰcggԳ0cggcgg5e8cggcggcgg!cgg,cggcggi9=cggcgg ,cggcgg,cggicggnb40=cggWcgg,cggcgg,cggDcgg,cggcggP1cggcggF,cggcggfS2=cggcggYcggcggcggcgg(cggcgga3=cgg cggr ,cggcggp,cgge4cggcggcggcgg,cgg ,cgg.+5=cgg;6=cgg=,cgg>cggAcggAcggCcggFO7cggKBcggMcggXP,cggQcgg[TcggTS8=cggVcgg Z,cgg\cgg^,cgg=`cgg{cgg},cgg#cgg,cgg[cggk7=cggicgg>,cggcggɎ,cggcgg;8cggcgg ,cggcgg,cggHcggcggΣD9=cggǥcgg(,cgg+cggN,cggcggl70=cggbcgg0,cggAcggB,cgg=cggcgg!%1cgg|cggc,cgg9cggC,cggfcgg --- _You start resting.cggl3707617.0)cggAZ2=78cgggcgg" _HP restored.cgg#...##.....##...#####)..###.#.......##...#..##....###.#.......####.....#.....#...≈...##.......##.##..#.......#.####.....##.#.......#.#.........#.....##.##.....####....####..##.........###†###..##....................@......#...#.....>.#....###### .##......#..##[##....#### ...# #.### .##cggu)###... ..)[.....[.. ..#.....#.cgg cggh 18.0)cggcggcgg3 .#...##.....##...#####.)..###.#.......##...#..##.###.#.......####.....#.#...≈...##.#.#.##..#.......#..#.....##.#.......#.#.##.....##.##.....####....####.##.###†###..##..#...#.>.#.###### ..##....# .####....[.## .###......####.......# #.### #.##.......)......#### #.#..)[.....[.#.....#cggq <9cgg cgg cgg .#...##.....##...#####.)..###.#.##...#..##.###.#.####.....#...#...≈...##.#.#.##..#.......#..#.....##.#.......#.#.##.....##.##.....####.....##.###†###..##.#...#.>.#..##....# #.####cggW..[.......## #.###..........####..........# #.### ##.##..)......#### .#.#..)[.....[.#.....#cggkcgg'80cggccggcgg8)..###...##...#..#....###.#.####..........#...≈...##........#.##..#........#.....##.#.#.#......#.....##.##.....####....##.##.........###†###..##.................#...##..........######...cgg ...#. ##.####.[##.. ##....####..........# #.## .##.##cggI9)......####... ..#..)[.....[.. .....#.....#.#cgg cggB=1cggXcggc _There is a stone staircase leading down here.cgg|cgg cggcggcgg-2 _cgg$cgg (  .# .. .##  .. ##.###  #....  #..#8 #@.# #....h...  ...#.....  .#### ...? .. ... .. .. h   wolf .## . #.  You climb downwards.cgg cgg cgg cgg cgg cggy* Ch.g.g   Grum (polearm)h   wolfcggQ -3.8 (2.5cggT cgg* _Level annotation: Grum _There is a stone staircase leading up, spattered with blood here.cgg 4cggi cgg0 F _Unknown command.cgg)  You shoot a sling bullet. The sling bullet hits the wolf.cggP  The wolf is moderately wounded.You shoot a sling bullet. The sling bullet hits the wolf.cggOn  The wolf is moderately wounded.cgg[g.===4.7 (0.9Rev  _The wolf barely misses you.cggBcggIcggcggycgg#F _Unknown command.cggy (You shoot a sling bullet.cggI  The sling bullet closely misses the wolf.You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cggd  1-The wolf is moderately wounded.The wolf bites you. The wolf misses you.  --more--cgg?& h  Grum points his finger and snarls, "Attack!"cgg&56------5.6Rev+ cgg-cgg707 _Grum hits you from afar with a +1 glaive!cggIV(You shoot a sling bullet.cgg;The sling bullet barely misses the wolf.You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cgg& . h  cgg& IThe wolf is moderately wounded.cgg( (6.5cgg]1 cgg4 R _The wolf closely misses you.cggp 4cggx cgg| F _Unknown command.cgg8cgg9cggCQ7=------7.5 (1.0cggWcggIX .........)..###.#.......##...#..# ............###.#.......####..... ................#...≈...##....... ..........#.##..#.......#........ .......#.....##.#.......#.#...... ......##.....##.##.....####....## ......##.........###†###..##..... ..........................#...#..7 cggkJ................@.#..........#### ....##.........h...............#. ##.####............[.......##.... ##.###.....................####.. #..........................# #.## .##.##.............)......####... h   wolf ..#.#..............)[.....[...... ...................#.....#....... cggJ........................##....... _The wolf closely misses you. Grum misses you. The wolf completely misses you.cgglLU=--cgg\cggZd-9.0 (2.5Rev cggZcgg} _You climb upwards. _There is a stone staircase leading down here.cgguc ((((cggG(((You shoot a sling bullet.cggx  The sling bullet closely misses the wolf.You shoot a sling bullet.cgg h......  The sling bullet completely misses the wolf.cggl===9 (0.9Rev+ cgg^cggs^ _The wolf misses you. The wolf bites you.cgg+ (((((((You shoot a sling bullet.cggG  The sling bullet closely misses the wolf.You shoot a sling bullet.cgg 7 h.cgg q.....  The sling bullet closely misses the wolf.cgg )90.8cggo cgg8  cggr C_The wolf barely misses you.cgg%4 ' cgg8 $(cgg= ((cggy> O((((You shoot a sling bullet.cgg&  The sling bullet barely misses the wolf.You shoot a sling bullet. The sling bullet hits the wolf.cgg[ h......  The wolf is heavily wounded.cgg\ g1.7Rev* cggi cggk q _The wolf misses you. The wolf bites you but does no damage.cgg (((((((You shoot a sling bullet.cggqC  The sling bullet barely misses the wolf.You shoot a sling bullet.cgg h......  The sling bullet closely misses the wolf.cgg-2.7 (1.0cggcgg< _The wolf bites you but does no damage.cgg#P (((((((You shoot a sling bullet.cgg  The sling bullet closely misses the wolf.You shoot a sling bullet. The sling bullet hits the wolf.cggih? h..cgghg....  The wolf is severely wounded.cggi.83cggtcggw? _The wolf bites you but does no damage. x2cgg[ (((cgg؇O((((You shoot a sling bullet.cggA  The sling bullet barely misses the wolf.You shoot a sling bullet.cggD h......  The sling bullet closely misses the wolf.4.6 (0.9cggcggKy _The wolf bites you but does no damage. The wolf closely misses you.cggx)x  You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cgg  The wolf is severely wounded.You shoot a sling bullet. The sling bullet hits the wolf.cgg@l  The wolf is severely wounded.cggkA(5.5cgg?PcggbSQ _The wolf barely misses you.cgg8 (((((((You shoot a sling bullet.cgg  The sling bullet completely misses the wolf.You shoot a sling bullet.cggzV h......  The sling bullet completely misses the wolf.cggV V4-6.4cggb cgg%d  cggad __The wolf bites you. The wolf barely misses you.cgg (((((((You shoot a sling bullet.cggɈ  The sling bullet barely misses the wolf.You shoot a sling bullet. The sling bullet hits the wolf.cgg G h...cgg' Z...  The wolf is almost dead.cgg_ -7.4 (1.0cgg cgg R _The wolf closely misses you.cgg;x  You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cgg _The wolf closely misses you.  The sling bullet hits the wolf but does no damage.  The wolf is almost dead.cggc  You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.  The wolf is almost dead.  You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.  The wolf is almost dead.cgg-8.3 (0.9cgg"cgg-#cgg*/  --more--cgg-t _The wolf completely misses you. The wolf closely misses you.cggc9 (((((((You shoot a sling bullet.cgg1 The sling bullet barely misses the wolf.You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cggAT h......  The wolf is almost dead.cggT [5-9.3 (1.0cgg \ cgg` _The wolf misses you. The wolf barely misses you.cggE p(((((((cggLX  You shoot a sling bullet. The sling bullet misses the wolf.You shoot a sling bullet.  The sling bullet hits the wolf but does no damage.cgg h......  The wolf is almost dead.2-100.2 (0.9cggf cgg ) _The wolf bites you.cggc (((((((You shoot a sling bullet.cggn  The sling bullet closely misses the wolf.cggJ h.... ..  You shoot a sling bullet. The sling bullet misses the wolf.cgg!1.1cgg] _The wolf barely misses you. The wolf misses you.cgg~ ^  You shoot a sling bullet. The sling bullet hits the wolf.cggR \.cgg. (((((((You kill the wolf!cgg W.......cgg) K-942.0cggӭ cggR / _You shoot a sling bullet.cgg(! cgg! cgg/ cggU2 H _No target in view!cggicggcggcggNcggR<3cggcggscgg4cgg,cggxcgg.4=Rev+ cggcgg cgg. cgg? cgg,cgg cgggcggcgg95=cgg7Rev cggcgg;cggtcgg8cgg%cgg%cgg(cggN-cggd.&6cgg2cgg67cggO9cgg<0cgg>cggBcgg,CK7=cggFcggO,cggRcggeV,cggEXcggi[cgg[#8cgg[2=cgg=^cggb,cggkdcggh,cggjcggncggn%9cggqcggt,cgg|wcgg{cgg{cgg>~cggc,cgg̈́cgg҉cggL60=cggXcgg,cgg8cgg,cgg͙cgg͜cgg&U1=cggcgg),cggcggʬcggcgg;cggcgg%2cggcgg#cggYcggGcggcggcggcggcggM53=cgg~cggQcgg@cggkcggkcggcgg^cggcgg0cggqU4=cggcggjcggcggcggcggcggcggcgg%5cgg cggcgg3cggCcggmcggcggcgg5cggrK6=cggcgglcggcggXcggs cggE cgg} cggcggJ?7=cggmcggcgg,cggcggcggcgg4cggDcggvcggf!cgg5$cgg$%8cgg&cgg4*cggf*cgg,cgg/cgg/cgg2cgg6cgg7K9=cgg9cgg=cgg>cggAcggDcggDcggFcggaJcggJcggJO70=cggLcgg5P,cggQUcgg{Z,cgg]cgg_cggS`%1cgg+bcgge,cgggcggjcgg[kcgg@mcgg/w ÷--- _You start resting.cgg061.0 (59.0)cgg#2cggK=---2.0 (60cgggcgg" _HP restored.cggb cgg cgg cggE cgg 13.0 (1.0)cgg cgg   .# .. .##  .. ##.###  #....  #..#8 #@.# #  ...#.....  .#### ...? .. ... .. .. .## . #.  You climb downwards.cgg< :=cgg cggk -4.5 (2.5cgg cgg _Level annotation: Grum _There is a stone staircase leading up, spattered with blood here.cgg cggD cggš cgg* F _Unknown command.cgg?cggAcggwcggH _No target in view!cggrcggscgg/}cggH _No target in view!cggqsIcggwvcgg|cgg: _cggdcggA.#... ..## ##... ..#.##.####....#..........#..##...####<.#.......#..@...............#####.####....?... .......#... ....#.## .....g   Grum (polearm)#. ...... .....g.cggύ-5.5 (1.0cggBg.cgg+6.5 (2cggcgg5cgg (((((((You shoot a sling bullet.cgg  The sling bullet completely misses Grum.  You shoot a sling bullet. The sling bullet hits Grum.cggZcgg`u....g..cggac===7.4 (0.9Rev cgggcggfk. _Grum is lightly wounded.cggu ((((You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggS  Grum is lightly wounded.  You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggcggi...g.cgg_8.3Rev+ cgg+cgg. _Grum is lightly wounded.cgguf(((((((cgg  You shoot a sling bullet. The sling bullet closely misses Grum.  You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cgg{cggɉ`..g.cgg...cgg(9.2cggcgg. _Grum is lightly wounded.cggT  ((You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggz  Grum is lightly wounded.  You shoot a sling bullet. The sling bullet hits Grum!cggWcgg].g.cgg)70.1cgg%cgg~). _Grum is lightly wounded.cgg f(((((((cggxB  You shoot a sling bullet. The sling bullet barely misses Grum.  You shoot a sling bullet. The sling bullet hits Grum.cgg u.g.....cgg g1.0Rev* cgg cgg [ _Grum is moderately wounded.cggV f(((((((cgg  You shoot a sling bullet. The sling bullet barely misses Grum.  You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggi .g.....  Grum is moderately wounded.cggj &9cggr cggu M _Grum barely misses you.cgg (You shoot a sling bullet. The sling bullet hits Grum!cggB  Grum is heavily wounded.You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggq .  Grum is heavily wounded.cgg[57-----2.8cggcgg? _Grum hits you from afar with a +1 glaive!cggp[ ((((cggqC(((You shoot a sling bullet.cggp _Grum hits you from afar with a +1 glaive!  You shoot a sling bullet.  The sling bullet completely misses Grum.  You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggƆ .g.....  Grum is moderately wounded.3.7cggcggTM _Grum barely misses you.cggf(((((((cggM  You shoot a sling bullet. The sling bullet barely misses Grum.  You shoot a sling bullet.cgg( .g.....  The sling bullet completely misses Grum.cgg)e4------4.6cgg;2cggt6? _Grum hits you from afar with a +1 glaive.cggK (You shoot a sling bullet. The sling bullet hits Grum.cgg?G  Grum is heavily wounded.You shoot a sling bullet.  The sling bullet hits Grum but does no damage.cggq .  Grum is heavily wounded.cgg(5.5cggcggM _Grum barely misses you.cggn f(((((((cgg c  You shoot a sling bullet. The sling bullet barely misses Grum.cgg" #.g...cggW M..  You shoot a sling bullet. The sling bullet closely misses Grum.cgg p33--------6.4cgg cggj @ _Grum hits you from afar with a +1 glaive!!cgg% cgg& cgg, cgg0 ^ _You are too injured to fight recklessly!cggMcgg۟cggʤcgg&^ _You are too injured to fight recklessly!cggv4cgg~cgg^ _You are too injured to fight recklessly!cgg.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7176.4 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..cgg#Fire: a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#............... _You are too injured to fight recklessly!  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)cgg~`.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================cggVQ##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7176.4 (0.0)........#.......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* cgg#... .......#.## .......g   Grum (polearm)#...............  Fire: a) +2 sling {Septima}cggPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)  You shoot a sling bullet. The sling bullet hits Grum.cgg /  --more--cgg= (Grum is heavily wounded.cggd3K((((((cgg4cggE>.gcggu.....  You shoot a sling bullet. The sling bullet closely misses Grum.cgg-I47.3 (0.9cgg cgg*> _Grum misses you.cggs .#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9cgg #..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7177.3 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* cggS *#... .......#.## .......g   Grum (polearm)#.cgg .............. _Grum misses you.Fire: a) +2 sling {Septima}cgg Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecgg" Aim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)cgg\ .#SunshineJesse the Skirmisher...Coglincgg ..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......cgg; XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7177.3 (0.0)........#.......cggm a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} cgg t... .......Rev* cgg *#... .......#.## .......g   Grum (polearm)#.cggT "..............  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cyclecggx Shift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)  cgg You shoot a sling bullet.cggC /  --more--cgg? (The sling bullet hits Grum but does no damage.cggoGrum is heavily wounded.You shoot a sling bullet.  The sling bullet hits Grum.  Grum is heavily wounded.cggh'.cggb-8.2 (0.9cggN$cgg'/ _Grum hits you but does no damage.cgg.#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7178.2 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire:cggU a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#............... _Grum hits you but does no damage.  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)cgg`.#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================cggb##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7178.2 (0.0)........#(......cggU*a) +2 sling {Septima j) +0 sling (elec) {####.####.(..?..Fire: a) +2 sling {Septima} ... ..(....Rev* #... ...(...#.## ....(..g   Grum (polearm)#......(.cgg......( _Grum hits you but does no damage.  Fire: a) +2 sling {Septima}cggxPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  cgg5 72% to hit)cggb  Fire: a) +2 sling {Septima}  Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight line  Aim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)  You shoot a sling bullet. The sling bullet closely misses Grum.cggt/  --more--cgg?  You shoot a sling bullet.cgg.g.....  The sling bullet closely misses Grum.cgg =2-cggJ$9.2 (1cggcgg 7 _Grum hits you from afar with a +1 glaive.cgg .#SunshineJesse the Skirmisher...Coglin..## ##Health: 32/72 ==========--------------... ..#.cggا Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7179.2 (0.0)........#*......cgg Aa) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..cgg+ Fire: a) +2 sling {Septima} ... .......Rev* #... .......cggP #.## .......g   Grum (polearm)#.cggx c.............. _Grum hits you from afar with a +1 glaive.  cgg ,Fire: a) +2 sling {Septima}cgg˨ Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecgg Aim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)cgg" >.#cggh# SunshineJesse the Skirmisher...Coglin..## ##Health: 32/72 ==========--------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9cgg# ^#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7179.2 (0.0)........#.......a) +2 sling {Septima j) +0 sling (elec) {cgg$ ####.####.g..?..Fire: a) +2 sling {Septima} cgg@$ t... .......Rev* cggg$ #... .......#.## .......cgg$ g   Grum (polearm)#........cgg$ :.......  Fire: a) +2 sling {Septima}cgg$ Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecgg$ Aim: Grum, wielding a +1 glaive and wearing a +0 animal skin (heavily wounded,  72% to hit)  You shoot a sling bullet. The sling bullet hits Grum.cgg+ /  --more--cgg ( Grum is severely wounded.cggrYou shoot a sling bullet. The sling bullet hits Grum.  Grum is severely wounded.cgg.'.cgg/.80.1 (0.9cgg 6cgg8F _Grum closely misses you.cgg:-.#SunshineJesse the Skirmisher...Coglin..## ##Health: 32/72 ==========--------------... ..#.Magic: 9/9cgg========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7180.1 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} cggF... .......Rev* #... .......cggk#.## .......g   Grum (polearm)cggK#............... cggV_Grum closely misses you.Fire: a) +2 sling {Septima}cggыPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecggAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)cgg.#SunshineJesse the Skirmisher...Coglin..## ##Health: 32/72 ==========--------------... ..#.Magic: 9/9========================##.####....AC: 7cgg_Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7180.1 (0.0)........#(......a) +2 sling {Septima j) +0 sling (elec) {####.####.(..?..Fire: a) +2 sling {Septima} ... ..(....Rev* #... ...(...#.## ....(..g   Grum (polearm)#......(......cggӢ.( _Grum closely misses you.Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)cgg"@  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight line  Aim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)  You shoot a sling bullet. The sling bullet closely misses Grum.cgg(/  --more--cgg!  You shoot a sling bullet.  The sling bullet hits Grum.  Grum is severely wounded.cgg cggb .cgg gcgg? .cgg .cgg .cgg .cgg .cgg cgg 3cgg =cgg۪ $1.0 (0.9 cgg% _cgg cgg cggr.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7181.0 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire:cgg a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#............... _Grum is severely wounded.Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)cgg\.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7181.0 (0.0)........#.......cggc]?a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#...............  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)  You shoot a sling bullet.cggd/  --more--cgg (((((((The sling bullet completely misses Grum.cggMcggN.g.....  You shoot a sling bullet. The sling bullet closely misses Grum.9 (0.9cggI _Grum completely misses you.cgg'4`.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================cgg4##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7181.9 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#........cgg5f....... _Grum completely misses you.Fire: a) +2 sling {Septima}cgg6yPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,cggB672% to hit)cggeB`.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================cggB##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8cgg`C#..@.......Noise: ===------  Time: 7181.9 (0.0)........#.......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* #... .......cggC#.## .......g   Grum (polearm)#.cggC_..............  Fire: a) +2 sling {Septima}cggCPress: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight linecggDAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (severely wounded,72% to hit)  You shoot a sling bullet. The sling bullet hits Grum.cggIJ  --more--cggLcgg^ ( Grum is almost dead.cgg\a((((((cggC.g.....  You shoot a sling bullet. The sling bullet closely misses Grum.cgg -2.8 (0.9cggcggI _Grum completely misses you.cggF.#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7182.8 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire:cggF a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#............... _Grum completely misses you.Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (almost dead, 72%  to hit)cggR .#SunshineJesse the Skirmisher...Coglin..## ##Health: 33/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7182.8 (0.0)........#.......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire:cggvS  a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#...............  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (almost dead, 72%  to hit)  You shoot a sling bullet. The sling bullet hits Grum.cggX /  --more--cgg` (Grum is almost dead.cgg@c You shoot a sling bullet. The sling bullet hits Grum.  Grum is almost dead.cggP p.43.7 (0.9cgg cgg E _Grum barely misses you.cgg<3.#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12cgg3#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7183.7 (0.0)........#*......a) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* cgg64#... .......#.## .......g   Grum (polearm)#............... _Grum barely misses you.Fire: a) +2 sling {Septima}cggl4Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (almost dead, 72%  to hit)cgg`.#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================cgg%F##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 94% Place: Dungeon:8#..@.......Noise: ===------  Time: 7183.7 (0.0)........#.......cggVa) +2 sling {Septima j) +0 sling (elec) {####.####.g..?..Fire: a) +2 sling {Septima} ... .......Rev* #... .......#.## .......g   Grum (polearm)#...............  Fire: a) +2 sling {Septima}Press: ? - help, Q - select action, ( or ) - cycleShift-Dir - straight lineAim: Grum, wielding a +1 glaive and wearing a +0 animal skin (almost dead, 72%  to hit)  You shoot a sling bullet. The sling bullet hits Grum!cggՎ/  --more--cggT  You kill Grum!cggf()cgga((((((cgg&.).....  You shoot a sling bullet.cggAcgg.#SunshineJesse the Skirmisher...Coglin..## ##Health: 34/72 ===========-------------... ..#.Magic: 9/9========================##.####....AC: 7Str: 12#..........EV: 15Int: 9#..##...###SH: 0Dex: 21#<.#.......XL:  9 Next: 103% Place: Dungeon:8#..@.......Noise: ===------  Time: 7184.7 (1.0)........#.......cgg)a) +2 sling {Septima j) +0 sling (elec) {####.####.)..?..Fire: a) +2 sling {Septima} ... .......Rev* #... .......#.## .......#...............  You kill Grum! _You shoot a sling bullet.cggPYou have reached level 10!cgg%/  --more--cgg [7/7910/1010 1% cgg cgg< 6 _cgg"... ..## .##..... ..#..##.####.... #.......... #..##...#####<.#........#............#####.####.)..? ... #......#... +.#.## #.#. #. #.#.cgg)cggk*S8---5 _cgg/cgg0cgg..## .##..... ..#.. ##.####.... #.......... #..##...######<.#.........#............#.cgg/####.####.@..? ... #......#... +.#.## #.#. #. #.#.#.cggcgg3B---6cggTcgg"  Things that are here: cggO_a +1 glaive; a +0 animal skincgg,g 4cggj cgg cggr D8=cggw cgg> cggt cgg cgg\ ,cggQ" cgg$ cgg'% 99cgg' cgg) ,cggz+ cgg. cggY. cgg/ cgg2 cggG2 T50=cgg3 cgg6 cgg6 cggu8 cgg? cggA@ cggrC cggF cgg?G 51=cggdG cgg#I cggL cggUL cggGN cggDQ ,cggXS cggV cgg0W 92cgg[Y cgg[ cgg[ cgg] cggy` cgg` cggb cggVd cgge S3=cggf cgg)k ,cgg| 4=cgg0 cgg ncgg cgg7 cggx 95cgg cgg ,cgg cgg ,cgg7 cgg i6=cgg cgg` ,cgg| cgg Bcgg΢ cgg5 X57=cgg Bcgg5 cggk ,cggD cgg߲ ;8cgg cgg ,cgg cgg -9cgg L60=cgg cgg ,cgg cgg ,cgg cggF cgg U1=cgg cggf ,cgg cgg cgg@ cgg cgg ;2cgg cggu cgg cgg cgg ,cggv cgg cgg K3=cgg] cgg cgg cgg cgg ,cggP cggk4=cggcgg,cgg Bcgg cggcgg%5cggcgg(cgg)cgg+cgg.,cgg0cggv3cgg3D6=cgg15cgg-8,cgg9cgg<,cggC>cggBk7=cggDcggG,cggJcgg;N,cggaPcggS;8cggUcggX,cgg=Zcgg\,cgg[^cggRacgg'b%9cggccgg8g,cgghcggkcggkcggKmcggTpcggpE70=cggzrcggucgg ((((((Maurice is lightly wounded.cgg cgg]......fcgg'====4.1 (0.9Rev* cggcggW _You shoot a sling bullet. The sling bullet barely misses Maurice.cgg& ]  You shoot a sling bullet. The sling bullet hits Maurice.cgg (((((((Maurice is lightly wounded.cgg2; ......f===-5.0cggAA cggD W _You shoot a sling bullet. The sling bullet barely misses Maurice.cgg, is lightly wounded. _You shoot a sling bullet. The sling bullet barely misses Maurice.  hit  Maurice is lightly wounded. _You shoot a sling bullet. The sling bullet barely misses Maurice.  hitcgg_ & You shoot a sling bullet. The sling bullet hits Maurice.  Maurice is lightly wounded. _barely misses Maurice.  You shoot a sling bullet. The sling bullet hits Maurice.  Maurice is lightly wounded.cggh b6----8/10 ------  hit  Maurice is moderately wounded.hits you with a +0 dagger. Maurice steals your +0 sling {Arun}!  Maurice bites you!cgg[ /  --more--cgg]q  You feel your power leaking away.cggG^&9cggecgg3iR _Maurice drains your magic.cggE$ ^(((((((You shoot a sling bullet.cgg. The sling bullet completely misses Maurice.  You shoot a sling bullet.  The sling bullet hits Maurice but does no damage.cggY: ......fMaurice is moderately wounded.cgg? cgg cgg -6.9 (1.0cgg cgg L _Maurice zaps a wand. You resist with almost no effort.cgg cgg) cgg cgg> F _Unknown command.cgg' cgg}( #(((((((cgg( cgg  You shoot a sling bullet. The sling bullet barely misses Maurice.  You shoot a sling bullet.  The sling bullet hits Maurice but does no damage.cggF  cggH cgghH #......fcggH  cggH 2Maurice is moderately wounded.cggH cggI cgg@J &7.8 (0.9cggcQ cggKV  cggV cgg#W `_Maurice barely misses you. Maurice misses you.cggbW cgg3h 4cggl cggp F _Unknown command.cggk >(((((((cgggU  You shoot a sling bullet. The sling bullet barely misses Maurice.  You shoot a sling bullet. The sling bullet hits Maurice.  Lightning courses through Maurice!!cgg ......fMaurice is heavily wounded.Maurice looks lost in thought, consulting taken memories.cggp70=--------8.7cggcggz _Maurice completely misses you. Maurice bites you but does no damage.cggcgg<cggcgg cgg8_Unknown command.cgg̦ (((((((You shoot a sling bullet.cggz,n  The sling bullet closely misses Maurice.  You shoot a sling bullet.cgg......fYou shoot a sling bullet.  The sling bullet closely misses Mauriccgg#e.  You shoot a sling bullet.  The sling bullet closely misses Maurice.  Maurice tries to stalk through the shadows.Maurice hits you with a +0 dagger. Maurice steals 406 gold pieces!cgg $67cgg83-9.6cggcgg.cgg/  --more--cggW _You now have 183 gold pieces. Maurice bites you but does no damage.cggp You shoot a sling bullet. The sling bullet hits Maurice!cgg(((((((Maurice is severely wounded.You shoot a sling bullet.cgg_}......fThe sling bullet closely misses Maurice.cgghcggcgg<)30.5cggcggD _Maurice zaps a wand. You resist with almost no effort.cggcggcgg+cggF _Unknown command.cgg>(((((((cgg  You shoot a sling bullet. The sling bullet barely misses Maurice.  You shoot a sling bullet. The sling bullet hits Maurice!cggF I ......fcgg Maurice is severely wounded.Maurice misses you. Maurice bites you.  You feel your power leaking away.cgg U-6-----cgg !1.4cgg( cgg  cgg L_Maurice drains your magic.cgg0 cgg*1 cgg8 cgg; F _Unknown command.cgg ]  You shoot a sling bullet. The sling bullet hits Maurice.cggH (((((((Maurice is severely wounded.cgg  You shoot a sling bullet. The sling bullet barely misses Maurice.  Maurice says, "Very interesting."Maurice gestures wildly while chanting.cgg if......§cgg7 (2.3cgg9 cggG % _Maurice blinks!cgg 4cggr cgg F _Unknown command.cgg V (((cgg" J((((You shoot a sling bullet.cgg+  The sling bullet closely misses Maurice.  You shoot a sling bullet. The sling bullet hits Maurice.cgg ~ ....f)., launcher)Maurice is almost dead.Maurice unwields a +0 dagger. Maurice wields a +0 sling {Arun}.((cggI>).cgg:JW0--3.2cggOcggRO _Maurice shoots a sling bullet. The sling bullet hits you!cggacggIbcgg&hcggjF _Unknown command.cggg7(((cggh0((((cgg  You shoot a sling bullet. The sling bullet barely misses Maurice.  You shoot a sling bullet. The sling bullet hits Maurice!  Lightning courses through Maurice!cgg)cgg~....$).'cggf 1--616cggC4.1 _You kill Maurice!cggcggȏp _Your Ranged Weapons skill increases to level 10!cggcgg~cgg cgg!H _No target in view!cggcggcgg1cgg=4 cgg4@_Unknown command.cgg$cggcggcgg^ _No target in view!cggcggcggF _Unknown command.cggk ... ...###.####.... #.......... #..##...###### #<.#.cggl #  #............# ........#..$# ####.####.)#  ...####.@.......# #.......'.# #.#######.# #.#.# #.##.#cggl #.........#####.######.#cgget cggu r7==------5.1 (1.0 _cgg{ cgg} cggd6t..## .##.. ... ...#.##.####.... #.......... #..##...###### #<.#.#  #............# ........#..$# ####.####.)#  ...####..# #.......'.# #.#######.# #.#.##.##.##.........####.######cgg:cgg;B---6cggaEcggGcggI1M. ## .# ... ...#..##.####...#.......... ..##...######<.# #..............#..####) ...####.......'.#.#######.........##.........#cgg8cgg9.27cgg>cggJ _Unknown command.No target in view! _Unknown command.  You now have 601 gold pieces (gained 418).  d - a +0 sling {Arun}; E - a wand of paralysis (14)  Things that are here:cgg|K+8.1 (2cggK7Rev+ cggQcggT cggU_a +0 dagger; a +0 cloakcgg] cggב cgg cgg cgg ;==cgg cggޞ cggj #3cgg )=cgg cggX cgg cgg cgg cgg :Rev cggE cggs cggϭ r4=8===cgg cggR cgg? cgg cgg cggo ,cggj cgg <5cggϽ cgg cgg cgg( ;===cgg cgg cgg cggd cggn cgg K6=cgg cgg cggU cgg cgg cggW L9==cgg cgg cggl U7=cgg cgg cggG cgg cgg ,cgg cgg cgg X8==cggN cgg! ,cgg cgg cgg cgg cgg ,cgg cggC cgg %9cggY cgg cgg= J10/10===cgg] cgg\ 4 _Magic restored.cgg 3cgg  cgga L70=cgg$ cgg+ cggr cgg[ cgg# cgg# ;===cgg& cgg!) cggw) U1=cgg<+ cgg. ,cgg/ cgg2 cgg2 cgg4 cggN7 cgg7 %2cgg9 cggP< cgg< cgg> cgg@ ,cggB cggE cggE K3=cggG cggJ cggJ cggML cggN ,cggP cgg^S cggS U4=cggMU cggW ,cggY cgg0^ BcggHa cgga %5cgg|c cggff ,cggh cgg@k ,cggl cggo cgg4p K6=cgg/r cggt ,cggv cggy ,cgg{ cgg~ cggu cgg N7=cgg cgg cggڄ cgg cgg ,cgg cgg cggg %8cggY cgg cggL cgg cgg cgg cgg cggV cgg cggנ D9=cggc cgg cgg ,cgg cgg cgg ,cggQ cgg% cgg ,cggn cgg̺ cgg! 9=cgg ,cggk cgg, cggd cgg cgg6 Xcgg cgg ,cgg cgg cgg| ,cgg cgg cggn ,cgg cgg cgg] ,cgg cgg cgg ,cgg cgg cgg cgg cggU cgg cgg} cgg cgg cgg ,cgg cgg2 N _You now have 615 gold pieces (gained 14).cggy cgg cgg> cgg cgg8 cggw cgg cgg cgg cgg ,cgg cgg cgg cggG cgg cggy cgg cgg< cgg/ cgg cgg cgg cgg  cgg cgg cgg= cgg cgg |<. .. #. #.  .... ### .#. .... .. .....#.#######......#.# .......@####...#410.1 (72.0) .........cggE  ##.####.#### #....########.####............#########.##....##.# .###.# #.# #cgg cgg7 ,1.1 (73cgg cgg 9 _Found a stone staircase leading up.cggP cgg cgg cggk cggi cgg cggN ,cgg8 [.. ..#.# ..#<. ... #. #.# #....#cgg ####..#.#......>...  .....#@#######.2.1 (1.0) .....#.........#.........####...##..............#cgg  ###.####.####..# .. #....#cgg l #.####............cgg$ Y#########.##....#cgg cgg# +3.1 (2cgg cggi 9 _Found an escape hatch in the floor.cgg̨cgg[cgg[cggҬcggM # <..+..#. ..#<.....cggR*..# #....# ####..#.#######.......@...>... 0......#.#######. #.....#.................####...##.....###.#cggcgg+4.1 (1cggcgg; _Found an escape hatch in the ceiling.cggcggcggcggocggPcggcggBcgg#cggcggcgg  ..  ###.###cggp  ....## #.<..# .....+....###.#.##..#....#..[.cgg ..<......#  #..#@# 6.1 (2cgg : #....# ####..#.####### ...........>.........#.#######.#.....#.........##cggD x.......###.####.##cggvcggf+7.1 (3cggcgg0$ _Found a cloak.cgg> cgg cgg cggm cgg cgg} cgg3 ,cgg cgg/ cgg cgg cggt cgg cgg cgg cgg! cgg" cgg>$ cgg' cggT( cgg( cgg) cgg6: =  You see here a +0 cloak.cggw< 5 _cgg= cgg A cggqC cggC cggD cggG cgguI cggI cgg K cggL cggiX E  .# # .#  #. .#  ### .# .##  .. . >.  ####.###.#####.#  ......#.#...#.#  # #.<..#.....@.# 25.1 (8...+....###.#.#.# #..#....#..[..#.#  cggOY #..<......#.###.#  ##.#..#.#.....#.#  #....#.......#   ####..#.#######.#   ...........>......   ......#.#######. #   cggY cggib A6.1 (9cggQf cggi ; _Found a stone staircase leading down.cggf03cgg0cgg4cggq6,cggX;Xcgg;cgg>cgg@,cggAcggER  There is a stone staircase leading down here.cggcGcggG _cggHcggJcggLcggCLcggMcgg;OcggPcggQcggQcgg,ScggT,cgg`UcggNVcggWcggWcgg$XcggJZcggL[cgg[cgg[cgg9]cgg?^cgg^cgg^cgg `cggca,cggacggdcggecggecgg)fcgggcgghcgghcggicgg)jcggkcggkcggOlcggmcggocggJocggocggpcgg)r,cggrcggscgg#ucggtucggucggxcggz,cgg{cgg}cggq,cgg_cggcgg,cggcggpcggQ,cggIcggߋcgg...+....###.#.#.# #.# #..#....#..[..#.# #.# #..<......#.###.# #.# ##.#..#.#.....#.# #.# #....#.......# #.# ####..#.#######.###.# ...........>........# ......#.#######.##### cggt#.....#........@#  .........####...#  #..............##  ###.####.####..#  ...#....# #..  ######.#### #..  y   killer bee (asleep) ..........# ...   ######.##....#.y   #.# .###  cggr47.1 (21.0)8.1 (22cggH] _A killer bee comes into view.cgg$F  #.#  [..#.# #.#  #..<#.# #.#  #.# #.#  ..# #.#  ##.###.#  >........#  #######.#####  .......@#  cgg2&.####...#  .....##  ####..#   #.. #.. ....#.y #.# .###cggW U  #.#  [..#.# #.#  #..<#.# #.#  #.# #.#  ..# #.#  ##.###.#  cgg >........#  #######.#####  .......@#  .####...#  .....##  ####..#   #.. #.. ...cggY .#.y #.# .###cgg cgg[ cgg cgg a _A killer bee is nearby!cggp   #.#  [..#.# #.#  #..<#.# #.#  #.# #.# cggkq K ..# #.#  ##.###.#  >........#  #######.#####  .......@#  .####...#  .....##  ####..#   #.. #..cggq f ....#.y #.# .###cgg   #.#  [..#.# #.#  #..<#.# #.#  #.# #.#  ..# #.#  ##.###.#  >........#  #######.#####  .......@#  .####...#  .....##  ####..# cgg *  #.. #.. ....#.y #.# .###cggQ cgg cgg cgg a _A killer bee is nearby!cgg (((((y  cgg(You shoot a sling bullet. The sling bullet hits the killer bee.  The killer bee buzzes angrily.cgg2 (The killer bee is moderately wounded.You shoot a sling bullet.cgg{t  The sling bullet closely misses the killer bee.cgg|cgg .....y 2 killer bees (1 wandering)yyYou hear an angry buzzing noise.cggg===9.0 (0.9)Rev cggZcggcgg/  --more--cggث ^ _A killer bee comes into view.cggb4cggjcgg2mcgg| cgg| cgg cgg9 > _Unknown command.cggtcggcggcgg(dggdggdggzdgg> _Unknown command.dggM# #.<..#.......# #....+....###.#.#....#..[..#.# #...<......#.###.# #.##.#..##.# #. #....#.......# #.dggb####..#.#######.###.#.....>........#.#######@######.....#......  ..####...  #..............##  Rev # y   killer bee.#.ydggzdggdgg dggB!dgg*{yy 2 killer beesy.dggz*8---50.0 (1.0dgg+2dgg@5U _A killer bee comes into view.dgg ......#.#...## #.<..#......  ...+....###.##....#..[....<......#.####.#..#.# #....#.......# #.#####..#.#######.###.....>...@....#.#######.######.....#........####.................#####.####.####..#  ...#.... ######.#### #.y ..........# ...dggdggdgg dgg!dgg"dggG,yyy 3 killer bees (1 wandering).y.dggb-J---1dgg}5dgg8dggSY......#.#...#.# #.#  # #.<..#.......# #.#  ...+....###.#.#.# #.#  #..#....#..[..#.# #.#  #..<......#.###.# #.#  dgg/>##.#..#.#.....#.# #.#  #....#.......# #.#  ####..#.#.###.#  .>.#  ......#.#.#####  #.....#.........#  .####...#  #.dgg`...y##  ###.####.####.y#  dgg...#....# #..  .#### #y.  dggm# ...  dggdgg!dggdggHdggVdgg5dgguyy...ydgga&2dggdggbdgg`+ >......#.#...#.# #.#   #.<..#.......# #.#  +....###.#.#.# #.#  ..#....#..[..#.# #.#  ..<......#.###.# #.#  #.#..#.#.....#.# #.#  #....#.......# #.#  ..#.#.###.#  dggl, >.#  #.#.#####  .....#........y#  ####..y#  .....##  .####.####..#    ...#....# #..   .#### #.y   # ... dgg, S  dgg. dgg0 dgg-1 dgg9 yy.yy 2 killer beesdggy: &3dggB dggG dgg >(((((((dgg׊ ~You shoot a sling bullet. The sling bullet misses the killer bee.dgg ~You shoot a sling bullet. The sling bullet misses the killer bee.dgg t.>...yy.dgg4 a===8 (0.8Rev dgg: dgg } _Unknown command. _A killer bee comes into view.  You shoot a sling bullet. The sling bullet misses the killer bee. _The killer bee barely misses you. The killer bee misses you.dgg- d  You shoot a sling bullet. The sling bullet hits the killer bee.dgg\  The killer bee is severely wounded.You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.dgg  The killer bee is severely wounded.You hear an angry buzzing noise. x2dggS/  --more--dggg  The killer bee barely misses you.dggdggXyyyy 4 killer bees  The killer bee stings you but does no damage.dggӺ(4.6dggdggCU _A killer bee comes into view.dggYou shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.  Lightning courses through the killer bee!dggI† 3dgg (((((((You kill the killer bee!dggQdgg dggu.>...yy.dggcl75.5 (0.9Rev+ dgg dggw _You shoot a sling bullet. The sling bullet misses the killer bee.dgg4dggdggF _Unknown command.dgg (((((((You shoot a sling bullet.dgg&j  The sling bullet barely misses the killer bee. x2  You shoot a sling bullet.  The sling bullet barely misses the killer bee.dgg .>...yyThe sling bullet closely misses the killer bee.dgg(6.4dggdgg[ _The killer bee closely misses you. x2dgg3 dgg dgg7 dgg F _Unknown command.dgg d  You shoot a sling bullet. The sling bullet hits the killer bee.dgg (((((((The killer bee is lightly wounded.  You shoot a sling bullet.  The sling bullet closely misses the killer bee.dggU .>...yyThe sling bullet completely misses the killer bee.dgg  g7.3Rev* dgg$ dgg( [ _The killer bee closely misses you. x2dgg4 dgg4 dgg9 dgg< F _Unknown command.dgg$ (((((((You shoot a sling bullet. The sling bullet misses the killer bee.dgg-o  The sling bullet barely misses the killer bee.You shoot a sling bullet. The sling bullet hits the killer bee.dgg .>...yyThe killer bee is lightly wounded.dggl (8.2dggdgg! _The killer bee barely misses you. The killer bee misses you.dggdggdgg!dgg $0 _Unknown command.dggY$dggYd  You shoot a sling bullet. The sling bullet hits the killer bee.dggH( _Unknown command.  The killer bee is moderately wounded.  You shoot a sling bullet.  The sling bullet closely misses the killer bee. dggm yThe killer bee is moderately wounded.dgg{n]2---9.0 (0.8dggludggwdgg/  --more--dgg91 _The killer bee stings you!dgg (You shoot a sling bullet.  The sling bullet barely misses the killer bee.The sling bullet hits the killer bee but does no damage.dgg^The killer bee is moderately wounded.You shoot a sling bullet. The sling bullet hits the killer bee.dgg3 yThe killer bee is heavily wounded.dggV0---8dgg8 dgg!dgg+/  --more--dgg1i _The killer bee stings you. The killer bee misses you.dgg(((((((You shoot a sling bullet.  The sling bullet closely misses the killer bee.dggqmThe sling bullet misses the killer bee. You shoot a sling bullet.  The sling bullet hits the killer bee.dgg 67==-Pois Rev* The killer bee is heavily wounded.The killer bee stings you.dgg/  --more--dgg .>...yyYou are poisoned.dggBC-60.6dggdggl _The killer bee poisons you! The killer bee closely misses you.dgg\You shoot a sling bullet. The sling bullet hits the killer bee.dgg   The killer bee is heavily wounded.You shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.  Lightning courses through the killer bee!dgg:$ I† 2dgg ]  You kill the killer bee!dgg @y.dgg =691.5 (0.9dgg/ dgg dgg /  --more--dgg % _You feel sick.dggq \You shoot a sling bullet. The sling bullet hits the killer bee.dgg The killer bee is heavily wounded.You shoot a sling bullet. The sling bullet hits the killer bee.dgg~   You shoot a sling bullet. The sling bullet hits the killer bee.  The killer bee is heavily wounded.  You shoot a sling bullet. The sling bullet hits the killer bee.  The killer bee is heavily wounded.  You feel sick.  The killer bee stings you but does no damage.dgg V4-2.4dgg^ dgg 8-dgg /  --more--dgg֙ Y _The killer bee closely misses you.dgg/uYou shoot a sling bullet.  The sling bullet hits the killer bee but does no damage.dgg6  The killer bee is heavily wounded.You shoot a sling bullet. The sling bullet misses the killer bee.The sling bullet hits the killer bee.  Lightning courses through the killer bee!!dgg†(   killer beedggV3=dgg /  --more--dgg s yYou kill the killer bee!dgg59=--203.3dggR!dgg#z _You feel sick. The killer bee stings you. The killer bee closely misses you.dgg^(((((((You shoot a sling bullet.dgg^~The sling bullet closely misses the killer bee.You shoot a sling bullet.dgg'.>...†yYou shoot a sling bullet.  The sling bullet closely misses the killer bee.feel sick.  The killer bee stings you but does no damage.dggC--4.2dggdggdgg^/  --more--dggqN _The killer bee misses you.dggw You shoot a sling bullet. The sling bullet hits the killer bee.dggDThe killer bee is almost dead.You shoot a sling bullet. The sling bullet hits the killer bee!dggEg†dggGYou kill the killer bee!dgg8815.1dgg@dgg[ _You feel sick.dggbdgg%dggdggxF _Unknown command.dgg9~4dggdggH _No target in view!dgg dggL dggdgg_F _Unknown command.dgg 4dgg| dggM 7 _You feel sick.56=dgg _ _You feel sick.  You feel sick.dggm JRev* dgg dggA j _You are no longer poisoned.dgg ?Rev+ dgg dgg ,dgg2 dgg$ dggc '57dgg' dggl ,dggR dgg: PRev dgg dgg dgg &8dgg dggx ,dgg dgg 7dgg dgg ;9dgg dgg ,dgg dgg ,dggX dgg dgg L60=dggk dggs dgg dgg< dgg ,dggA dgg5 dgg U1=dgg dgg> ,dgg dgg dgg dggJ dggi dgg %2dgg dggR ,dgg[ dggs ,dgg dgg@ a3=dgg dggR ,dgg dgg ,dgg| dgg dgg` U4=dgg dgg ,dgg dgg dgg\ dgg dgg dgg %5dggl dgg ,dgg+ dgg) ,dgg= dgg a6=dgg\ dggS ,dgg dgg ,dgg dgg dggL U7=dgg dgg ,dgg dggz dgg dgg dgg1 ;8dgg dgg dgg dgg dgg ,dgg dgg dgg %9dgg dgg ,dggj dgg9 dgg dggL dgg_ dggF L70=dgg dgg ,dgg dgg dgg dgg dggF k1=dggO dggn" ,dgg# dggw% ,dgg}& dgg~( dgg( %2dgg) dgg+ ,dgg, dgg. ,dgg/ dgg0 K3=dgg_0 dgg0 dgg 2 ,dgg2 dgg3 ,dgg4 dgg85 dgg{5 N4=dgg5 dgg7 ,dggh8 dgg9 ,dgg: dgg= dgg= %5dggU> dgg? ,dgg@ dggA ,dgg6C dggD a6=dgg_E dgg6F dgghF dggTG dggM 7=dggN ,dggO dgg4Q dggQ dggJS dggT ;8dggU dggZW ,dggaX dggZ ,dgg[ dgg] 99dgg] (=dgg^ dggd dgge dggIf dgg2g dgg,j f  You see here a killer bee corpse.dggk dggl  _dggm dggo dgglq ,dgg;r dggWs dggt dggt 9=dgg}u dggv dggw ,dggOx dgg"y dggz dggXz dggz dgg} dgg~ dgg~ dgg dggf dggi ,dgg dgg- dggL dggy dgg dgg dggp dgg dgg dggɈ dggÉ dgg dggG dggy dggT dgg dgg dgg dgg dggE dgg dgg dgg dgg dggN dggW dggz dgg dgg dgg- dgg dggW dgg dgg dgg ,dgg dgg dgg dgg dggw dggT dggG dggu dggۤ dgg dgg ,dgg dgg dgg dgg1 dgg dgg dggЫ dgg dggR dgg4 dggS dgg dggخ dgg dgg ,dgg9 dggG dgg dggL dgg dgg dgg ,dggL dgg: dgg dggO dgg dgg dggͺ ,dgg dgg+ dgg ,dggW dggQ dgg ,dggx dgg dggW dgg dgg dgg dgg dgg dgg dgg= dgg ,dggW dgg dgg_ dgg dgg dgg dgg ,dgg dgg& dgg dgg5 dggk dggZ dgg5 dggp dgg dgg dgg- ,dgg dgg dgg dgg dgg* dgg; dgg> dggr dggJ dgg dgg\ ,dgg dgg dgg dgg dggI dggs dgg dgg dgg9 dgg9 dgg dgg dgg dgg dgg dggF dgg dgg dgg dggo dgg dgg dgga ,dgg dgg= dgg ,dggy dgg dgg dgg dgg> dgg. dgg@ dgg| dgg dgg dgg dgg dgg> dggS dgg###.###### #.#   .# #.#   #.#   #######.#######.   ................   #######.########   dgg#....#   ####.#   #@#  --- o........#   ##########dggI!       o   orc (asleep) dggu-  dggG2588.1 (123.0)dggH---94dggdgg`u _An orc comes into view. It is wielding a +0 falchion.dgg #.#  .# #.#  #.#  .  ..  .########  #....# dgg? ####.#  #@#  o........#  ########## dggA #.#  .# #.#  #.#  .  ..  .########  #....#  ####.#  #@#  o........#  ########## dggRHdggIdggMdgg`P[ _An orc is nearby!dgg^ #.#  .# #.#  #.#  .  ..  .######## dgg #....#  ####.#  #@#  o........#  ########## dggP3dggg #.#  .# #.#  #.#  .  ..  .########  dggTh#....#  ####.#  #@#  o........#  ########## dgg,ndggndggsdgg|u[ _An orc is nearby!dggW ((((((o  You shoot a sling bullet. The sling bullet hits the orc!  The orc shouts!dggx (The orc is almost dead.You shoot a sling bullet.dgg j o......  The sling bullet closely misses the orc.dggkh===90.0 (0.9)Rev dggaodgg#r* _You hear a shout! x2dggq]  You shoot a sling bullet. The sling bullet hits the orc.dgg)((((((dggm (You kill the orc!dgg8 A)......dggi &9dggE dgg / _You shoot a sling bullet.dggAZ .# #.#  #.# #######.#######.  ................  #######.########  #....#  ####.# ########.## o).....@..# ###########    o   orc priest (wandering)      dgg  An orc priest comes into view. It is wielding a +2 short sword of distortion.dgg /  --more--dgg Sorc priest (wandering)dgg B ---1.9 (1.0 _dgg dgg dggB ((((((oYou shoot a sling bullet.  The orc priest shouts!dggs  The sling bullet hits the orc priest but does no damage.  You shoot a sling bullet. The sling bullet hits the orc priest!dgg$IdggIdggCPo).....o   orc warriordggQn===2.8 (0.9Rev+ dggXdggg _The orc priest is heavily wounded. _An orc warrior comes into view. It is wielding a +3 long sword.dgg~ ((((((You shoot a sling bullet.dggV  The sling bullet hits the orc warrior but does no damage.  You shoot a sling bullet.dggo?).....dgg (3.7dggdggO _The sling bullet hits the orc warrior but does no damage.dgg~ ((((((You shoot a sling bullet.dgg6   The sling bullet hits the orc warrior but does no damage.  You shoot a sling bullet.dgg dggŹ dgg oo.....o   orc priestdgg g4.6Rev* dggu dgg   You shoot a sling bullet. _The sling bullet hits the orc warrior but does no damage.  You shoot a sling bullet.  The sling bullet hits the orc warrior but does no damage.  You shoot a sling bullet. _The sling bullet hits thdggZ (e orc warrior but does no damage.dgg:U ((((( You shoot a sling bullet. The sling bullet hits the orc warrior!dgg  The sling bullet hits the orc warrior!  The orc warrior is moderately wounded.  Lightning courses throughdgg!r  )o....  The orc warrior is severely wounded.dgglv dgg >5.5dgg dggM dgg /  --more-- dgg{tu _The orc priest casts a cantrip, but nothing happens. dgg(((( You shoot a sling bullet. The sling bullet hits the orc warrior. dggn(((The orc warrior is almost dead.You shoot a sling bullet.  The sling bullet barely misses the orc warrior. dgg dgg dgg"r.o.o... dgg(6.4 dgg` dggR` _The sling bullet completely misses the orc priest. dgg dgg dggF dggF _Unknown command. dgg: e  You shoot a sling bullet. The sling bullet hits the orc warrior. dggܚ  )(((  dgg$ P  You kill the orc warrior! dgg$ You shoot a sling bullet. The sling bullet hits the orc priest.  Lightning courses through the orc priest! dggW( )(( dgg  dgg \ o).)...o   orc  You kill the orc priest! dggS 057.3 dgg)  dgg s _An orc comes into view. It is wielding a +0 dagger. dgg  dggY  dgg  dggB F _Unknown command. dggZm  (((((((You shoot a sling bullet. dgg0  The sling bullet closely misses the orc.You shoot a sling bullet. The sling bullet hits the orc! dgg" S dggz ^)).)... dgg (8.2 dgg ] _You kill the orc! dggt  dgg"  dgg'  dgg F _Unknown command. dgg'* dgg* dgg0 dgg3H _No target in view! dgg dggN dgg dggGF _Unknown command. dgg dgg dgg dggH _No target in view! dggqI dggI dgg-P dggRF _Unknown command. dgg dggF dgg> dgg dgg .# #.#  #.#  #.#.  .   dgg#.########  #....#  ####.# #.## o)).)..@...# #  dgge    o   orc priest (wandering)   dgg_    dgg&0 dgg(5---9.2 (1 dgg| dggP _Unknown command.No target in view!Unknown command.No target in view!Unknown command. _An orc priest comes into view. It is wielding a +0 club. dgg~  (((((((You shoot a sling bullet. dggKo   _An orc priest comes into view. It is wielding a +0 club.  You shoot a sling bullet.  The sling bullet barely misses the orc priest.  You shoot a sling bullet.  The orc priest shouts!  The sling bullet hits the orc priest. dgg7 dgg.o).)..===600.1 (0.9 dgg dgge _The orc priest is moderately wounded. dggI3 (((((You shoot a sling bullet.  The sling bullet hits the orc priest but does no damage. dgg  The orc priest is moderately wounded.You shoot a sling bullet. The sling bullet hits the orc priest. dgg5C\).).. dggC(1.0 dggpK dgg$Ob _The orc priest is heavily wounded. dgg, (((((You shoot a sling bullet.  The sling bullet hits the orc priest but does no damage. dggr ((The orc priest is heavily wounded.You shoot a sling bullet. dgg dggv.)o.).. dgg&9 dgg dggd _The sling bullet barely misses the orc priest. dgg (((((((You shoot a sling bullet. dggg  The sling bullet barely misses the orc priest.You shoot a sling bullet. The sling bullet hits the orc priest! dggkS dgg6v.)).).. dgg062.8 dggi dggN _You kill the orc priest! dggo  dgg  dgg  dgg H _No target in view! dggƁ  dggf  dgg  dgg H _No target in view! dgg14 dgg1 dgg3 dgg46 dgg:; _ dgg? dggiA dggA dggB dggJ  .# #.#  #.#  #######.#######.  ..  #######.##  #....#  ####.# ##.## ..)).)@.....# ---##      dgg+K    dggP .# #.#  #.#  #.#.  .  #.#  #....#  ####.# #.## .)).@......# #        dggP  dggU-4.8 (2.0 dggJVG---5.8 (3 dggY dgg^  Things that are here: _a +3 long sword; a +0 plate armour; an orc corpse dggK dgg dgg dggJ dgg  dggWRev+ _ dggj .# #.#  #.#  #.#.  .  #.#  #....#  ####.# #.## .))@)......# dgg #   dggN .# #.# #.# #.#. . #.# #....# dggG ####.##.##.)@.)......## dggw!+6.8 (1 dgg"+7.8 (2 dgg& dgg- _Items here: ))) [. dggnL4 dggL dggW dggY dggk^; _ dgg`  Things that are here:  a +0 dagger; a +0 ring mail; an orc corpse dggb dggb _ dggc dggd dgge dgg/f:Rev  dgg0g dggl dggCn dggn dggo dgg"p dggq, dggAr dggs dggku dggu%  dggv dggyx dgg4z dgg^z dggT{ dgg8 dgg, dgg dgg dggڂ dgg  dggp dgg dgg, dgg dggLJ dgg  dgg; dgg dgg8 dgg dggˌ, dggu dggq, dgg dgg< dgg, dgg( dggk dgg dgg dgg dggQ dggQ .##.  #. #### #. .... #. ##### #. #.##o ....##########.@..............))#######o   Blorkula the Orcula (wand, polearm, d…) dgg~022.8 (15.0) dgg˧,3.8 (16 dggR dgg  Blorkula the Orcula comes into view. He is wielding a +0 trident and carrying a_wand of paralysis. dggS .#  #. #.  #.  #.  # #. #.##o ###....######## .......@..............)) ###############   dgg~ x .#  #. #.  #.  #.  # #. #.##o ###....######## .......@..............)) ###############  o  dgg%  dgg h _Blorkula the Orcula is nearby! dgg (o)You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula but does no damage. dgg.D  Blorkula the Orcula shouts!  You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula. dgg? { o.  Blorkula the Orcula is lightly damaged. dgg 8* dgg  dggb: n@ 2  dgg= /  --more--dgg$  Blorkula the Orcula zaps a wand. You suddenly lose the ability to move!  --more--dgg\ ====4.7 (0.9)+2 sling {Septima} Para Rev _dggddggMq1---==--5.7 (1dggxdggGV _Blorkula the Orcula hits you from afar with a +0 trident!dggt*Blorkula the Orcula casts a spell at you.dgg @.  The puff of flame hits you!dgg 60------16 ==--6.7 (2+2 sling {Septima} dggwdggJ _You can act again.dgg (You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg  Blorkula the Orcula is lightly damaged.  You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg %.  You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.  Blorkula the Orcula is lightly damaged.  You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.  Blorkula the Orcula is lightly damaged.dggY _=7.6 (0Rev dgg$ dgg& dgg0 /  --more--dgg\ S _Blorkula the Orcula misses you.dggͫ ( You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg1 (Blorkula the Orcula is moderately damaged.You shoot a sling bullet.dggJ po.  The sling bullet barely misses Blorkula the Orcula.dgg :*dggh dggt" 8@dggr# #1dgg# l---8.5Rev+ dgg , dggk0 \ _Blorkula the Orcula zaps a wand. You shrug off the repeated paralysis!dgghB dggB dggON dgg{R F _Unknown command.dgg (You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula but does no damage.dgg  Blorkula the Orcula is moderately damaged.You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg}  Blorkula the Orcula is heavily damaged.dgg/  --more--dgg .  Blorkula the Orcula says, "Everything's been so different since that missionarygave me these suspenders."dgg5(9.4dggdggCT _Blorkula the Orcula barely misses you.dgg( You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula!dgg  Blorkula the Orcula is severely damaged.You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg (& dggC(Z.  Blorkula the Orcula is severely damaged.dgg1:*dggdggCn@ 2 dggÔ/  --more--dgg>  Blorkula the Orcula zaps a wand. You suddenly lose the ability to move!  --more--dggQ 30.3+2 sling {Septima} Para Rev+ _dggZdggDedggec57---1.3 (1dggGldgguV _Blorkula the Orcula hits you from afar with a +0 trident.dggH|dgg_Blorkula the Orcula zaps a wand. You resist with almost no effort.dgg16 ---2.3 (2+2 sling {Septima} dgg0Rev+ dgg dgg( _You can act again.You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dgg  Blorkula the Orcula is severely damaged.You shoot a sling bullet.  The sling bullet hits Blorkula the Orcula.dggU3 .  Blorkula the Orcula is almost destroyed.dgg8dggZdgg5===3.2 (0dgg dggQdgg/  --more--dgg V _Blorkula the Orcula zaps a wand. You resist with almost no effort.dgg gYou shoot a sling bullet.  The sling bullet hits Blorkula the Orcula!dggx .(bbbbb 5 vampire bats (wandering)dgg9   Blorkula the Orcula avoids the killing blow by scattering into a rainbow ofbats!You shoot a sling bullet. The sling bullet hits the vampire bat.dgge z.bbbb.bdgg V8-4.1dgg" ?Rev* dgg dgg 9 _The vampire bat is lightly damaged.dgg dgg dgg< dgg F _Unknown command.dggn y (You shoot a sling bullet.dgg  The sling bullet closely misses the vampire bat.You shoot a sling bullet.dgg[~ dgg  The sling bullet closely misses the vampire bat.The vampire bat bites you.dggā dgg b.bb.bThe vampire bat draws vitality from your injuries!dgg E565.0dgg dggs dggZ /  --more--dgg _The vampire bat barely misses you. The vampire bat completely misses you.dggYou shoot a sling bullet.  The sling bullet hits the vampire bat but does no damage.  Lightning courses through the vampire bat!  You destroy the vampire bat!dggAG. 4dggB(dgg(mThat felt strangely unrewarding. You shoot a sling bullet.dggd*g  The vampire bat barely misses you.dgg*dgg*dgg0G.bdggY1+8 (0.8dgg87dgg7dgg~B/  --more--dggQA _The vampire bat bites you but does no damage.dgg e6You shoot a sling bullet.dgg(The sling bullet hits the vampire bat but does no damage.  You shoot a sling bullet.dggrdgg)u_The sling bullet closely misses the vampire bat.dgg,wThe vampire bat barely misses you. The vampire bat closely misses you.dggwdgg3@bb.dgg'-6.7 (0.9dgg܍dggQ _The vampire bat misses you.dggOdggUPdgg|Xdgg]\F _Unknown command.dgge  You shoot a sling bullet. The sling bullet hits the vampire bat!dgg~ (The vampire bat is severely damaged.You shoot a sling bullet.dggu  The sling bullet closely misses the vampire bat.dggdggdggdgg  The vampire bat misses you. The vampire bat closely misses you.dggdgg dggS.bbdggY1577.6dggdgg&C _The vampire bat bites you but does no damage.dgg .# #. #. ##. .#. ## #. #.##. ###..bb#.....bb.@.............)).# .bThe vampire bat bites you.52----8.6 (1.0 _The vampire bat draws vitality from your injuries!dgg9-- _Unknown command.dgge  You shoot a sling bullet. The sling bullet hits the vampire bat.dggU?You shoot a sling bullet. The sling bullet hits the vampire bat.  The vampire bat is moderately damaged.  You shoot a sling bullet.  The sling bullet closely misses the vampire bat.  The sling bullet hits the vampire bat.  Lightning courses through the vampire bat!  --more--dgg̢  You destroy the vampire bat!.( 3dggP85.bb==9.5 (0.9 _That felt strangely unrewarding. The vampire bat completely misses you.dgg^(((((((You shoot a sling bullet.dgg9The sling bullet closely misses the vampire bat. x2  You shoot a sling bullet. The sling bullet hits the vampire bat.dgg/l.....bbThe vampire bat is heavily damaged.dggdgg`3dgg%=-dggվ"40.4dgg<dgg dggRdgg4_The vampire bat barely misses you.dggdgg>dggM4dggNR dggRdggDS"_Unknown command.dgg{Sdgg/W' dgg X*(((((((dggX6You shoot a sling bullet.  dggJY9The sling bullet barely misses the vampire bat.dggedgg&  dggAThe sling bullet closely misses the vampire bat.dggVYou shoot a sling bullet. The sling bullet hits the vampire bat.dgg{ .....bbThe vampire bat is almost destroyed.The vampire bat misses you.1.3dggޏ3dgg/  --more--dggA _The vampire bat bites you but does no damage.dgg4 You shoot a sling bullet. The sling bullet hits the vampire bat.  You destroy the vampire bat!dgg@ G. 2dgg (((((((That felt strangely unrewarding. You shoot a sling bullet.dggM dggN dggP ^The sling bullet barely misses the vampire bat.dgg3Q dggY L......bdggZ (2.2dgga dggc T _The vampire bat completely misses you.dgg dgg dgg dgg˱ F _Unknown command.dgg e  You shoot a sling bullet. The sling bullet hits the vampire bat.dggB (((((((The vampire bat is lightly damaged.  You shoot a sling bullet.dggdgg  The sling bullet misses the vampire bat.The vampire bat bites you but does no damage.dgg_dgg%L......bdgg&V4=3.1dgg-dggS0X _The vampire bat barely misses you.dggBdggdggzdggF _Unknown command.dgge  You shoot a sling bullet. The sling bullet hits the vampire bat.dgg (((((((The vampire bat is moderately damaged.You shoot a sling bullet.dgg  The sling bullet misses the vampire bat.The vampire bat bites you.dgg8 .dggؠv.....bbThe vampire bat draws vitality from your injuries!dgg=2-dggڡ!4.0dggʨdgg dgg/  --more--dggD _The vampire bat bites you but does no damage.dgg[]You shoot a sling bullet. The sling bullet hits the vampire bat!dgg$(((((((The vampire bat is almost destroyed.You shoot a sling bullet.  The sling bullet closely misses the vampire bat.dggnn^The sling bullet barely misses the vampire bat.dggndggcodggxL.....bbdgg^y&9dggdgg _The vampire bat closely misses you. The vampire bat barely misses you.dgg½dgg\dggdgg;F _Unknown command.dgg4 (((((((You shoot a sling bullet.  The sling bullet closely misses the vampire bat.dgg  The sling bullet misses the vampire bat.You shoot a sling bullet. The sling bullet hits the vampire bat.dggGDH  The vampire bat is lightly damaged.dggDdggYEdgg.Os....b.bdggO!5.8dggUdgg6=dgg /Rev dgg dgg* ,dgg dgg Bdggu dgg Y57=dgg{ dgg dggB % dgg dggz 0dggF dgg ,dgg dgg dgg1%8dggdgg0dgg`dgg#dggndggdggZdggdgg%9dggdgg ,dggB dgg dgg dgg dgg dgg$60dggx>=dggdggdggdggdggdggdggdggdU1=dgg7dggdgg dggdgg%,dggdgghdgg%2dggdggdgg# dgg dgg",dggJ)dggX+a3=dgg,dgg-,dgg.dgg"0dggY0dggX1dgg3dggU3U4=dgg4dgg6,dggs7dgg9,dgg:dgg=;5dggHdggJdggKdggMBdggNdggOdggFPK6=dggQdggERdgg{Rdgg[SdggTdggTdgglUdggVdgg9WU7=dggXdggWYdggYdgg3Zdgg[dgg[dggn\dgg@^;8dgg^dgg_dgg#`dgg`dgg#bdggPbdggbdggBddggzd%9dgg8edggfdgggdggohdgg^idggidgg   The wight is almost destroyed.You shoot a sling bullet. The sling bullet hits the wight.  Lightning courses through the wight!)dggu j ..  You destroy the wight!dgg" [(((((dggR_....@dgg:TP---46.5 (0.8dgg\/  --more--dggb} _The centaur shoots an arrow. The arrow misses you.dggBidggk` _Your Dodging skill increases to level 7!dgg\(((( You shoot a sling bullet. The sling bullet hits the centaur.dggThe centaur is moderately wounded.You shoot a sling bullet. The sling bullet hits the centaur!dgg dgg].c....dggiI67.4 (0.9dggקdggW _The centaur is heavily wounded.dggxdggdggdgg!F _Unknown command.dggWn (((((((dggW/You shoot a sling bullet.dggl  The sling bullet barely misses the centaur.You shoot a sling bullet.dggbjdggkdggs...))c.dggt(8.3dgg|dggja _The sling bullet barely misses the centaur.dggdggDdggdggF _Unknown command.dgg< ( You shoot a sling bullet. The sling bullet hits the centaur!dggG  The centaur is almost dead.You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.dggFdgg&Gdgg;P z.cz   wightThe centaur is almost dead.dggP(9.2dggVdgg` _A wight comes into view. It is wielding a +2 great sword of freezing.dggfsdgg^tdgg{dgg F _Unknown command.dggE{  You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.dggX _Unknown command.  You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.  The centaur is almost dead.dgg  You shoot a sling bullet.  The sling bullet hits the centaur but does no damage.  The centaur is almost dead.  dggYou shoot a sling bullet.  The sling bullet hits the centaur but does no damage.  The centaur is almost dead.dgg.70.0 (0.8dgg'dggdgg2/  --more--dggz _The centaur unwields a +0 shortbow. The centaur closely misses you. x2dgg= YYou shoot a sling bullet. The sling bullet hits the centaur.dggs )z   wightdgg>> (((((((You kill the centaur!dggp dggw ...z.)).)dgg z7/80=79 (0.9dgg dgg ' _You shoot a sling bullet.dggI dgg dgg dgg > _Unknown command.dgg` (((((You shoot a sling bullet. The sling bullet hits the wight.dgg7  The wight is lightly damaged.  You shoot a sling bullet. The sling bullet hits the wight.dgg.z.).)dggفV8=1.8dgg܋dggʏ3 _The wight is lightly damaged.dgg4dggdgg;F _Unknown command.dgg (((((((You shoot a sling bullet.dgg|  The sling bullet barely misses the wight.You shoot a sling bullet. The sling bullet hits the wight!dgg6dggh ...z..)dgg (2.7dggdgg^ _The wight is almost destroyed.dgg*dggJ+dgge3dgg6 dgg!78_Unknown command.dgg[ (((((((You shoot a sling bullet.dgg+  The sling bullet barely misses the wight.You shoot a sling bullet. The sling bullet hits the wight.dggdgg....z.)dgg(3.6dggdgg7^ _The wight is almost destroyed.dgg2dggdgggdggF _Unknown command.dgg  You shoot a sling bullet. The sling bullet hits the wight.  Lightning courses through the wight!dgg)((dgg (((((You destroy the wight!dgg....).)dgg?094.5dgggdgg/ _You shoot a sling bullet.dgg dggdggdgg(F _Unknown command.dgg \ dgg\ dggd dggf H _No target in view!dgg dgg dgg dgg F _Unknown command.dgg dgg dgg: dgg H _No target in view!dgg dggZ dgg dggٍ F _Unknown command.dggdgg dgggdggdggGW9 _dggdgg[dggdgg,dggVdggdgg?50=dgg7Rev+ dgg=dggt Bdgg, dggx dgg|dgg>b1=dggdgg!dgg:Rev dgggdggidggdggdgg^"P2dggb(dgg*dgg +dgg,dggO/dgg/!dgg\1dgg(4dgg493dgg6dgg9,dggq:dgg<,dggM>dgg@dgg AS4=dgg5CdggE,dggGdggI,dggoKdggMdggMK5=dggIOdggQ,dggTdggY,dggYdgg\dgg|\96dgg]dgg`,dggU1=dggdggޝ,dggdgg>,dggעdgg;2dggedggT,dggdgg'dgg^dggdgg_R34=5=6dgg.%7=8=970=dgg&dgg&dggO(dggP*,dgg+dgg/dgg?/U1=dgg1dggB4dgg4dggg6dgg8dgg8dgg:dgg$<dggp<2dgg=dgg?,dggDBdgg?Jdgg{}#..#.#dggdggnM======6.5 (18dgg dgg _You open the door. _There is an open door here. _As you open the door, it creaks loudly! _Found 22 gold pieces.dggdgg9dggdggdggRdgg$ _dggdgg@  There is an open door here.dggGdgg _dggdggdgg6,dgghdgg*dgggdggdggdggJdggdgg/dggdgg@dggdggdggdggI,dggFdgg4N _You now have 649 gold pieces (gained 22).dggdgg dggdgg4dggdggdggIdggdggdggrdggdggdgg,dggxdggdggdgg8 dggX dggR dgg=dggtdggdggddgg,dggdggdggdggdggdgg"    #..........  dgg0#< #..........   #..........   #........# #  dggU# #........# #......  dggy# #........# #......  ####........# #......  dgg#......)@.....# #......dgg#;------  dgg#z####........#####......  dgg# .......................  dgg$O##########.######.......  dgg:$q...........# ##'#####.  dggZ$########...# #....# #.   dggz$F #...###dgg$d# #.   dgg$#.....###....# #)   dggC%#.....'.'....# #) dgg*   #.   #.  dgg*R #.   #.# #   #.# #  dgg%+  #.# #  #dggL+.# #  .@......# #  dggn+#........#####   .........dgg+o  ###.######  dgg+  .....# ##'#####  dgg+  #...# #....# #dgg+   #...### #....# #dgg ,}   #.....###....# #dgg*,}   #.....'.'....# #dggK,!dgg3.911.5 (15dgg~3K------2.5 (16dgg]8dgg!@ _You see here a +2 long sword of freezing.dggW dgg dgg dgg dggL : _dgg dgg Xdgg dgg3 dgge dggF dggJ dgg dgg dgg dgg dggM dgg dgg= dgg dgg ,dgg dggE dgg dggS! dgg! dgg# dgg$ dgg$ dgg(% dggu' dgg( dgg( dgg?) dgg* dgg+ ,dgg^, dgg. dggn/ dgg/ dgg[0 dgg1 dgg2 dgg2 dggC3 dgg%4 dgg5 dgg@5 dgg5 dggI8 dgg09 dggv9 dgg9 dgg: dgg; dgg< dggZ< dgge= dgg> ,dgg)? dggW@ dggjA ,dggA dggJD dgg1E dgggE dggE dggF dggG dggG dggRH dgg(I dgg?J dgghJ dggJ dggK dggM ,dggxM dggO dggW   #.# ...........# dgg]W Y #.# ########...#  #.# #...##  #.# # dggW D #.#   #.#   #.#  dggW F #.#   #@#   #......# dggX   ######D# #  dgg3X  D   steam dragon (asleep)dgglX s   dggX !dggh 33.5 (21DDcatching breath)A steam dragon comes into view.The steam dragon hisses angrily.dggl ****  The steam dragon breathes steam at you.dgg+ @§§..##D#=====4.5 (22dggz w _The ball of steam misses you. The steam dragon moves out of view.dgg dggj 3dgg dgg dgg_ ,dgg+ .# ########.# #...##.dgge ;.....dgg 4.##§###dgg #.@§.D.#-----#####Ddgg  .D   steam dragondgg 5.5 (1.0)dgg z ((You shoot a sling bullet.dgg4V  The sling bullet hits the steam dragon but does no damage.  You shoot a sling bullet. The sling bullet hits the steam dragon.dgg dgg J§D§dgg o===--6.4 (0.9Rev dgg dggj dgg : _The steam dragon is lightly wounded.dgg K (dggpYou shoot a sling bullet.  The sling bullet hits the steam dragon but does no damage.dgg7 ((The steam dragon is lightly wounded.  You shoot a sling bullet.dgg dgg;D.§dgg(7.3dggHdggj _The sling bullet completely misses the steam dragon.dgg{  You shoot a sling bullet. The sling bullet hits the steam dragon.  Lightning courses through the steam dragon!dgg:  The steam dragon is heavily wounded.You shoot a sling bullet.  The sling bullet hits the steam dragon but does no damage.dggCz  The steam dragon is heavily wounded.dgg/  --more--dggO ##§..#.#The steam dragon barely misses you.dggO _8.2Rev+ dggX dgg? dggA, dggB dggrD dggF, dgg.G dggH dgg1J, dggK dggL dggON, dggO dggP dgg>R dggjR dgg)S dggT dggV, dgg2W dgg[ dgg8]B dggM^ dgg^, dgg5_ dgg_ dgg`, dgg` dgga dggb dgg.b dggTb dggb dggwc dggc dggc dggpd dggd dgge dgg=e dgg f dggf, dggg dggg dgghh dggh dggh dgg|i dggj dgg5j dggj dggm dggv #........#..# .....###.####..... ....)##..........## .....##..##...##### .....##<.#.... .....##....... .....# ........#..). .....######+#######.####.).. ................@...####....---8014.6 (6 dgg]w9.0) ...........>.###.......'.... ##......... #.#######...  #.......# #.# #.........  #.......# #.# #.........  #)......# #.# #.........  #)).....# #.# #.........  #.####### #.# ####.#####  #)# #.#.# dgg-| dgg|,5.6 (70 dgg dgg; _Found a stone staircase leading down.!dgg l[?25h[?0c  Search for what [Enter for "oka", or ? for help]? "dggW [?25l[?1c"dggX"dgg "dgg""dgg$X _Can't find anything matching that."dggV "dggX 3"dggea P _"dgggf X"dggsg "dggxj "dgg2s #..####.##..# #. .... #........#..# #.# .... ##.####.....# #. .)# ..).. #..........## #.# ..... #..##...######## ...... #<.#..."dggs ### ......###............### ...........#..)......########+#######@####.).##7.6 (2.0)......####...## .."dggt l>.###.......'...## .. #.#######...## ......# #.# #...### "dggGt ......# #.# #...# ......# #.# #...# ).....# #.# #.........# "dggt ####### #.# ####.######"dgg| "dgg} +8.6 (3"dggƄ "dgg # _Found a whip."dgg"dgga"dgg"dgg"dggA ... #.##..# ##...... #..####.##..# # "dgg....... #........#..# # ...#..... ##.####.....# #)#)..) #..........## #.#. #..##...#######.#. #<.#.##.#"dgg###......##.# .......@....#..)......##0"dgg{\######+#######.####.).##..........####.##.>.###.......'.##... #.#######..# #.# #.## .# #.# #.# )"dgg ......# #.# #.# )).....# #.# #.........#"dgg"dgg+9.6 (1"dgg{"dgg "dgg_Found a quarterstaff.#dgg9y#dggy#dgg)#dgg#dgg#dgg^B#dgg#dggj#dggE#dgg:#dgg_,#dgg#dgg#dggl#dgg#dggP#dggO#dgg#dgg#dgg#dgg2#dgg#dgg#dgg>#dgg#dgg#dgg#dgg+#dgg^#dgg,#dggJ#dgg#dgg#dgg[#dgg#dgg #dggG#dgg#dgg#dgg#dggx#dgg#dgg#dgg#dggU#dgg#dgg#dgg#dgg#dgg#dgg-#dggI#dgg#dggc#dgg#dggU#dgg3#dggz#dgg#dgg#dgg#dgg#dgg#dgge#dgg#dgg#dggZ#dgg#dgg#dgg#dggy#dgg #dgg .... #. .... #. #...#dgg #. .... #. #... #. ###. #(... #.##### ##### #.@...# .......#dgg378.0) #######.########### #dgg..........  .######.######## # #dgg9........######.#... ##..###........#..###  .#dgg[  #.......#.#.....  #dgg. .........# +.......#.##.###   #.......)# #...)..)#.#..... #dgg #dgga,8.6 (19#dgg#dgg% _Found 6 stones.#dggҠ#dggW#dgg#dgg#dgg,#dggIX#dggά#dgg#dgg #dgg7#dgg#dgg;  You see here 6 stones.#dgg3#dgg _#dgg#dgg>#dgg]X#dggȿ#dgg#dgg#dgg#dggL,#dggs#dgg#dgg,#dggm#dgg#dgg,#dgg#dgg#dggx#dgg#dggF#dgg$ #dgg_You open the door.#dggQ######......#### #.<#...#.....+#...#.##..#.###...#)##dgg1#..<........#.###.##...#.# #..#...@.# ####51.6 (13#...####### ......#.#........ ......#.#.####### #.....#.#.# ...... #.#.# #..... #dggB,#.#.# ###.## #(#.. ...#. #dggp#.##### #########dggS#dgg,2.6 (14#dgg#dggym _Found a morningstar. _There is an open door here.#dgg0p #dggp #dgg r #dgg u #dggv #dgg+{ P _#dgg| #dgg4} #dggB~ #dgg< #dgg) #dggm #dggd #dgg #dgg #dgg7 #dgg #dgg #dgg< #dgg~ #dgg@ #dggF #dggؑ #dgg #dgg #dgg #dggە #dgg #dgg #dggg #dgg #dgg~ #dggt #dgg> #dgg #dggΟ #dggr #dggբ #dgg =## ###(.. . #.... ....... . #.... ...... #dgg #... ##....  ##.#... ....###  #.....#+# #...#.. #.....#.# #...#.# #....@#.###...#)# 61.6 (9.0)#dggf #.............#.# #.......###...#.# #...###.# #...'.##.## #.# #...######### #.# #.#........ #dgg #.# #.#.####### #.# #.#.##dggƫ Y #.# #.#.##dggY #dgg #2.6 (1#dgg 0.0)#dggQ #dgg % _Found 6 stones.$dgg3:3$dgg:$dgg<$dgg=$dgg>$dggAn$dggC$dggD$dggYD$dgg]E$dgg2I$dggCJ,$dggJ$dggK$dggL$dggM$dggM$dggO$dggO,$dggP$dggyQ$dggkR,$dggR$dggS$dggU$dggU$dggV$dggX$dggX,$dggnY$dggZ$dgg[,$dgg[$dgg\$dgg],$dgg]$dgg^$dggo_$dgg_$dgg`$dgga$dgg+b,$dggb$dggc$dggd$dggd$dggGe$dggnf$dggf$dgg,g,$dggg$dggKh,$dggh$dggi$dgg;j$dggj,$dggk$dggxl$dggl$dggl$dggm$dggn$dggn$dgg"o$dggcp$dggq,$dgg r$dgg/s$dgg8t$dggt$dggu$dggKv$dggv$dgg&w$dggvw$dgg,&dgg&dggs&dgg},&dgga&dgg'&dgg,&dgg&dgg &dgg,&dgg&dgg&dgg,&dgg&dgg&dgg,&dgg&dgg&dgg,&dgg&dgg &dgg; ,&dgg &dgg &dggz ,&dgg &dggV &dggQ ,&dgg &dgg &dggL ,&dggz &dgg &dgg" ,&dgg6$ &dgg& &dgg) &dggz) &dgg* &dgg?- &dgg/ ,&dgg1 &dgg3 &dgg6 ,&dgg7 &dggc: &dgg< ,&dggW> &dgg=B &dggC ,&dggE &dggI &dggK ,&dggJM &dggaO &dggQ ,&dggUS &dgg X &dggY &dggY &dggZ &dgg{^ B&dgg`_ &dgg\a &dggc ,&dggpd &dggf &dgg*i ,&dggj &dggl &dggm ,&dggn &dggo &dgg q &dggWq &dggr &dgg,v &dggw ,&dggwx &dgg} &dgg~ &dgg3 &dgg &dggǁ &dggX &dgg &dgg &dgg= &dgg_ ,&dgg& &dggC &dgg: &dggo &dggÊ &dgg &dgg &dgg= &dgg &dgg &dgg &dgg̏ &dgg0 &dggo &dgg ,&dgg" &dgg &dgg &dggD &dgg &dgg &dgg ,&dggn &dgg &dgg֠ ,&dggE &dgg &dggp ,&dgg &dgg &dgg &dgg; &dggc &dggM &dgg &dgg &dggų &dgg3 &dgg2 &dgg &dgg ,&dggv &dgg &dgg &dgg &dgg &dggq &dgg ,&dggF &dggW &dggX &dgg &dgg &dggq &dgg{ &dgg &dggl &dgg &dgg ,&dgga &dgg &dgg &dgg ,&dgg &dgg ,&dggW &dggO &dgg ,&dgg &dgg &dgg &dgg &dgga &dgg &dgg &dgg &dgg, &dgg9 &dgg ,&dgg &dgg &dgg ,&dggO &dgg@ &dgg^ &dgg &dgg &dggm &dgg ,&dgg &dgg &dgg+ B&dgg &dgg &dgg> &dgg &dgg &dgg &dgg` &dgg &dgg0 &dgg &dgg5 &dgg &dgg: &dgg ,&dgg &dgg &dgg &dggV &dgg &dggy &dgg" ,&dgg &dgg &dgg ,&dgg@ &dggK &dggo ,&dgg &dggK &dgg ,&dgg! &dgg$ &dggb& &dgg& &dgg' &dgg) &dggY+ &dgg+ &dgg5, &dgg/ P  There is a stone staircase leading up here.&dggU1 &dggB2  _&dgg2 &dggX6 &dgg7 &dggm7 &dgg7 &dgg9 &dggt: &dgg: &dgg7; &dggh> &dgg? ,&dggR@ &dggB &dggM ............... ......... .........##############.###.##### ..##......................#.#...# .......###############.<..# +###...#.. ..(.....+....###.#.# .# #...#.# #.. #..#....#..[..# .###...#)# #.. #..<......#.### .......#.# #..####.#..#.#.....# .###...#.# #..@....#....#.....99.7 (9 .# #...'.# #.#######..#.####### &dggN .# #...####### ...........>.. .# #.#........ ......#.####### .# #.#.####### #.....#....... .# #.#.#.........####. .# #.#.##............. .# #.#.####.####.####.#(#.....#....# #..&dggW &dgg$X .200.7 (94&dggd &dggg % _Found 3 stones.(dgg8 3(dgg (dgg (dgg (dgg7 (dgg X(dggg (dgg (dgg_ ,(dgg. ,(dgg ,(dgg| (dgg (dgg ,(dgg (dgg" P  There is a stone staircase leading up here.(dgg>% (dgg%  _(dgg& (dgg) (dgg* (dgg;+ (dgg, (dgg. (dggO0 (dgg0 (dgg1 (dgg3 (dgg|5 (dgg5 (dgg6 (dgg; X(dggC< (dggS= (dgg= (dgg> (dgg? (dggHA (dggA (dggB (dggD (dggE (dgg`E (dggE (dggG (dggH (dggH (dggI (dgg{K (dggL (dgg4M (dgg$N (dggvP (dggQ (dgg R (dggS (dgg,U (dggV (dggGW (dgg6X (dggwZ (dgg[\ (dgg\ (dggH^ (dggb (dgg#d ,(dgg]e (dgg h (dggEj (dggj (dggk (dggjn (dgg^r (dggr (dggt (dggv (dggx (dggy (dgg#{ (dgg ~ (dggI ,(dgge (dgg" (dgga (dgg (dgg (dggË (dgg ,(dgg (dgg (dgg' ,(dgg (dgg (dgg (dggț (dgg (dgg (dggh (dgg (dgg (dgg (dgg ,(dggª (dgg) (dggn (dgg_ (dggа (dgga (dgg (dggػ (dgg (dgg (dgg (dgg (dgg, (dgg (dgg$ (dgg` (dgg (dgga (dgg X(dgg (dgg (dgg (dgg (dgg (dgg (dgg (dggW  #....###. #.##...#............ ###.####.#.....##........ #.##..##.#..........##### #..##.#.....#+###...#..  (dggH ~###.#.#.....#.# #...#.#  ###.##.....#.###...#)#  ##.##.#.............#.#  #.#)#.#.@.....###...#.# 36.7 (36 #.##..#...###.# #...'.#  ##.####.### #.# #...##### ##_# ### #.# #.#...... ### #.# #.#.##### (dgg O#.# #.#.# #.# #.#.# #.# #.#.# #(#..(dgg_ (dgg (dgg )dgg" 3)dgg% )dgg )dgg: )dgg `)dgg X)dgg )dgg )dggV )dggZ )dgg )dgg )dgg )dgg )dgg. )dgg )dgg )dgg )dgg )dgg' )dggt )dgg  )dggk )dggC )dgg )dggx )dgg )dgg& ,)dgg  )dgg  Things that are here:  a +0 glaive; a +0 chain mail; an orc corpse)dgg )dgg  _)dgg@ )dgg )dgg% ,)dgg )dgg )dgg)! )dggs! )dgg!" )dgg# )dgg$ ,)dggj% )dggz& )dgg' ,)dgg( )dggK1  #.##..##.# #..##.#.....#+###... ###.#.#.....#.# #... ###.##.....#.###... ##.##.#............. #.#)#.#.......###... #.##..#...###.# #... ##.####.### #.# #... ##@# ### #.# #.#.61.7 (25 ### #.# #.#. #.# #.#. )dgg3 .#.# #.# #.# #.#. #(#.  #.##  #...  ###### )dgg:7 )dgg9 ] _There is an iron altar of Okawaru here.*dgg/N  You kneel at the altar of Okawaru.*dgg6/  --more--*dggf *dggh Warmaster Okawaru Okawaru is a dangerous and powerful god of battle. Followers are expected to constantly prove themselves in combat, and may channel Okawaru's might to *dggi enhance their prowess. Okawaru demands that followers prove themselves by their own strength alone, and so worshippers are forbidden from gaining allies by any means. Okawaru pays little heed to easy victories, but will reward worshippers for heroic feats against mighty foes. Favour - Okawaru is neutral towards you. Granted powers:(Cost)Okawaru requires that you fight alone, and prevents you from gaining allies. You can gain great but temporary skills.(2 MP, Piety-)You can speed up your combat.(5 MP, Piety--)You can enter into single combat with a foe.(7 MP, Piety--)*dggi Okawaru will gift you throwing weapons as you gain piety. Okawaru will grant you a choice of weapons... once. Okawaru will grant you a choice of armour... once. [!]: Overview|Powers|Wrath [J/Enter]: join religion*dgg3 *dgg *dgg #.##..##.#.......... SunshineJesse the Skirmisher#..##.#.....#+###... Coglin###.#.#.....#.# #... Health: 80/80 ========================###.##.....#.###... Magic: 10/10 ========================##.##.#............. AC: 7Str: 12#.#)#.#.......###... EV: 16Int: 9#.##..#...###.# #... SH: 0Dex: 21##.####.### #.# #... XL: 10 Next: 45% Place: Dungeon:8*dgg &##@# ### #.# #.#. Noise: ---------  Time: 8261.7 (0.0)####.# #.#. a) +2 sling {Septima j) +0 sling (elec) {#.# #.#. Fire: a) +2 sling {Septima} #.# #.#.#.# #.#.#(#. #.## #... ######  _Found 3 stones. _There is a stone staircase leading up here.  Things that are here: _a +0 glaive; a +0 chain mail; an orc corpse _There is an iron altar of Okawaru here.  You kneel at the altar of Okawaru.*dgg a  Okawaru welcomes you!*dggj/  --more--+dgg[+dgg\y  of Okawaru ......2.7 (1 _+dgg1a+dggb+dggI+dggO+dgg̲+dgg +dgg ,+dgg+dgg<+dggǸ+dgg +dggH+dgg+dgg(+dggz+dgg+dgg6+dgg+dgg.+dggM+dgg+dgg++dgg  Things that are here:  a +0 glaive; a +0 chain mail; an orc corpse+dgg+dgg  _+dgg+dgg9+dgg+dgg+dggd+dgg+dgg+dggC+dgg+dggB+dggf+dggm+dggN+dgg+dgg++dgg+dggj+dgg+dggb+dgg+dgg&,+dgg+dgg+dgg+dgg"+dggs+dgg$+dggNB+dgg!X+dgg+dgg+dgg{+dgg +dgg +dgg+dggi+dgg+dggL+dgg,+dgg8+dggx+dggv,+dggh+dgg+dgg +dgg +dgg)"+dgg$+dgg',+dgg(+dgg.B+dgg/+dgg0+dgg6+dggV6+dgg8+dggc9+dgg:+dgg;+dgg1<+dgg=+dgg=+dgg >+dggV>+dggn?+dggW@+dgg@+dggA+dggC+dggD+dgg6E+dggF+dggG+dggGI+dgg}I+dggLJ+dggRL+dggM+dggN+dgg>O+dggP+dggKQ+dggQ+dgg,R+dggT+dggU+dggU+dggV+dggX+dggY,+dggZ+dgg\+dgg^+dgg^+dgg~_+dggFa+dggb+dggb+dggc+dgg^e+dggf+dgghg+dggg+dggi+dggl,+dggm+dggo+dgg,q,+dggq+dggu+dgg~s### ###..#.# #.#.####### ....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### +dggOJ...#.# #.....# #####.....#######.######[......@...............99.7 (37.0)...###.##..######.#######. ..........###### ........+dggJ## ####..###...... ........#..##.......# ........ .........# ..+.......# +dgg......# #.......)# ###...)..) ......# #........# #.......# +dgg ......# #........# +........+dggƈ+dggA.300.7 (38+dgg+dgg) _Found a scale mail.+dggC _+dgg  ### ###..#.# #.#.# ....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.#####+dgg"  #...#.# #.....##.....#.V[..###.##..######.. #............+dgg . #######..###. #..##.. .# ..+. V   vampire (dormant).# #+dgg .)# ###...)..).# #.# #.+dgg a.# #.# ++dgg !+dgg V0.0)VA vampire comes into view.+dggf :*+dgg The vampire casts a spell.The vampire flickers and vanishes!+dggr 8{+dggs 3=1.7 (1+dgg~ +dggG _Deactivating autopickup; reactivate with Ctrl-A.+dgg+dgg1+dgg$+dgg'p _There is a strange disturbance nearby!,dgg%,dggH&,dggV-,dggj/H _No target in view!,dgg,dgge,dgg',dggH _No target in view!,dgg J ### ###..#.# #.#. ....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### #...#.# #.....##.....#..{[....@..###.##..######... #............. #######..###. #..##. .# ..+.# #.)# ###...)...# #.# #.# #.# +,dgg ,dgg !.,dgg %-,dgg 2 _,dgg& ,dgg^ -dggؖQ ### ###..#.# #.#. ....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### #...#.# #.....##.....#..[.###.##..######... #.... #... #######..### #... #..## #.. .# ..+ #.# #.)# ###...) #.# #.# # #.# #.# +-dgg-dgg-dgg@-3-dgg-dgg-dggX ### ###..#.# #.#. ....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### #...#.# #.....##.....#..[.###.##..######... #...  #... #######..###  #.... #..##  #......# ..+  #.#####.......)# ###...)  #.# #..# #  #.# #.# +-dgg-dgg-dgg$&4-dgg8-dgg ### ###..#.# #.#.#....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### #...#.# #.....# #.....#.#....[..###.##..######.#....... #...# #... #######..###. #.... #..##. #......-dgg |# ..+. #.#####.......)# ###...). #.# #..# #. #.# #.# +.-dgg} -dgg| -dggA &5-dgg  8{-dgg .dggQ>(((((((.dgg(.dggc ...[..{You shoot a sling bullet. x2; Something barely misses you..dggYd.dggd0===6.6 (0.9.dggj.dggl] _Something closely misses you..dgg.dggI.dggP  You shoot a sling bullet. x2; Something barely misses you. Something bites you..dgg W79-7.5.dgg% .dgg' l _Something draws vitality from your injuries!.dggx .dgg5% >(((((((.dggĮ l...[..{.dgg b2---8.4.dggp .dggT _You shoot a sling bullet. x2; Something hits you! Something closely misses you..dggvS >(((((((.dgg .dggff ...[..{You shoot a sling bullet. x2; Something hits you but does no damage.Something bites you!.dgg=gi64----9.2 (0.8.dggm.dgg%pl _Something draws vitality from your injuries!/dgg>(((((((/dgg}/dgg ...[..{You shoot a sling bullet. x2; Something hits you. Something bites you./dggj57----10.1 (0.9/dgg /dggl _Something draws vitality from your injuries!/dgg>(((((((/dggT/dgg...[..{8--/dgg!1.0/dgg/dgg+2 _You shoot a sling bullet. x2/dgg-u>(((((((/dggR/dgg ...[..{You shoot a sling bullet. x2; Something hits you. Something bites you!/dggĊa43-----9/dgg/dggl _Something draws vitality from your injuries!/dggY >(((((((/dgg- /dgg!o  ...[..{You shoot a sling bullet. x2; Something hits you. Something bites you./dggo n37------2.8/dggw /dggy l _Something draws vitality from your injuries!/dgg >(((((((/dgg /dggi' l...[..{/dgg( i5--3.7/dggt/ /dggo1 _You shoot a sling bullet. x2; Something hits you. Something barely misses you./dgg:>(((((((0dgg%0dggl...[..{0dggJ^6-4.60dgg _You shoot a sling bullet. x2; Something barely misses you. x20dgg5>(((((((0dgg0dggZ ...[..{You shoot a sling bullet. x2; Something hits you!0dggtJ29--5.50dgg0dggH` _Something completely misses you.0dggԗ0dgg>(((((((0dggת ...[..{You shoot a sling bullet. x2; Something barely misses you.6.3 (0.80dgg0dgg0g _Something bites you but does no damage.0dgg~>(((((((0dggm 0dggj  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....## ....... .......###.##..# ....... #......... #####...... .. # )    0dgg  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....## ....... .......###.##..# 0dgg ....... #......... #####...... .. # )    0dgg= j  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.# 0dgg   #########.....## ....... .......###.##..# ....... #......... #####...... .. # )   0dgg You shoot a sling bullet. x2; Something hits you!* * * LOW HITPOINT WARNING * * *0dgg  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....## 0dggD 4....... .......###.##..# ....... #......... #####...... .. # )    0dgg ...[..{Something bites you!* * * LOW HITPOINT WARNING * * *0dgg ]15------7.2 (0.90dggA 0dggU l _Something draws vitality from your injuries!0dgg 0dgg 0dggD0dgg#**0dggb ###   ....#.# #.#.#  .###...#.# #.#.# 0dggH ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....## ....[..{*....... .......###.##..#0dgg# ....... #......... #####...... .. # )    1dgg ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   1dggG#...#.#   #########.....## ....[..{*....... .......###.##..# ....... #......... #####1dggls...... .. #1dggS )    1dgg͎  You shoot a sling bullet. x2; Something draws life force from you!1dgg8@1dgg}3/80 --------8.11dggG1dgg9V _* * * LOW HITPOINT WARNING * * *1dgg 1dgg 1dgg 1dgg F _Unknown command.1dggh 1dggUi 1dggq 1dggOs F _Unknown command.4dgg+  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#.. 4dgg,b #....#.#   #...#.#   #########.....## ....[..{@....... .......###.##..# ....... #......... #####4dgg-...... .. # )    You feel much better. Something hits you but does no damage.4dgg f ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....## ....[..{@....... 4dgg !.......###.##..# ....... #......... #####...... .. # )    4dgg  Something bites you!* * * LOW HITPOINT WARNING * * *4dgg m18/80 =====-4dgg 9.1 (1.04dgg 4dgg9 l _Something draws vitality from your injuries!5dgg}5dggx~8-5dgg5dggF _Unknown command.6dgg&  As you read the scroll of teleportation, it crumbles to dust.  You feel strangely unstable. Something hits you but does no damage.6dggA9=====6dggW_-20Tele 6dgg6dgg\ _Something barely misses you.6dggħ 6dgg 8-6dgg 6dgg F _Unknown command.7dgg) u### ###..#.# #.#.#....#.# #.#.# .###...#.# #.#.# ......#.# #.#.# #....#.# #(#.. #....#.# #.##### #...#.# #.....# #.....#.#....[..{..###.##..######.#....... #....# ..... #######..###. ...... #..##. ...# ..+. .#####.)# ###...). .# #.# #. .# #.# +.7dgg*  ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  7dggj+ #....#.# #(#..  #....#.#   #...#.#   #########.....### ....[....@.......7dgg_,  .......###.##..## ....... #........ #####   )    7dggh \ ###   ....#.# #.#.#  .###...#.# #.#.#  ......#.# #.#.#  #....#.# #(#..  #....#.#   #...#.#   #########.....### ....[....@.......7dgg  .......###.##..## ....... #........ #####   )    7dgg4 U..barely misses you.  Something hits you!  * * * LOW HITPOINT WARNING * * *  ites you!  You die...7dggOy D-3-----7dgg /  --more--8dggt8dgg"}Inventory: 31/52 slots Hand Weapons (go to first with ))  a - a +2 sling (weapon) {Septima}  j - a +0 sling of electrocution (offhand) {Malena}d - a +0 sling {Arun} Armour (go to first with [)  k - a +0 helmet (worn)  w - a +0 cloak (worn) 8dgg}k B - +0 steam dragon scales (worn)b - a +0 leather armour Wands (go to first with /)r - a wand of polymorph (6)  A - a wand of warping (33)  E - a wand of paralysis (22) Scrolls (go to first with ?)  c - a scroll of acquirement {unknown}  f - a scroll of torment {unknown}  g - a scroll of teleportation  h - 3 scrolls of poison8dgg~i - 2 scrolls of brand weapon  m - a scroll of amnesia {unknown}  t - a scroll of vulnerability  v - 2 scrolls of immolation 8dgg@~[Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]9dgg; 89dgg? 9dggpC Goodbye, SunshineJesse.4727 SunshineJesse the Skirmisher (level 10, -3/80 HPs)Began as a Coglin Hunter on Dec 22, 2024.Was an Initiate of Okawaru.Slain by a vampire (11 damage)... on level 8 of the Dungeon.9dggD tThe game lasted 00:10:31 (8048 turns). Best Crawlers - 712. 4867 raskol OnCK-10 blasted by a vampire (D:9) 713. 4802 mikefarne GrEE-10 slain by a killer bee (D:7) 714. 4794 BaconRulez MiFi-10 slain by a basilisk (D:9) 715. 4770 SunshineJe CoFi-10 slain by a kobold brigand (Bailey) 716. 4747 warbug DrAl-10 slain by Harold (D:9) 717. 4733 xarolino MDBe-10 blasted by an oklob plant (D:8) 718. 4727 SunshineJe CoHu-10 slain by a vampire (D:8) 719. 4721 SkeffCoFw-10 slain by a blink frog (Lair:1) 9dggJD 720. 4709 relicbr NaEn-10 slain by a two-headed ogre (D:9) 721. 4613 Demonprawn DsMo-10 slain by a meliai (D:9) 722. 4609 raskol OnCK-10 slain by a sun demon (Bailey) 9dgguD y723. 4587 JanoKoBr-10 slain by Joseph (D:9) 724. 4561 SunshineJe CoGl-10 slain by a two-headed ogre (D:8)9dgg@D9dgg L9dggO? [?25h[?0c [?1051l[?1052l[?1060l[?1061l