Mgg Player: deadiverson Game: DCSS 0.32 Server: crawl.dcss.io Filename: 2024-12-21.23:22:25.ttyrec Time: (1734823345) Sat Dec 21 23:22:25 2024 Mgg$ [?1051l[?1052l[?1060l[?1061hMgg'V)0[?7h[?25l[?1cMgg{-Mgg91Mggq;Welcome, deadiverson. Please select your species. SimpleIntermediateAdvanced a - Mountain Dwarfj - Humans - Coglin b - Minotaurk - Koboldt - Vine Stalker c - Merfolkl - Demonspawnu - Vampire d - Gargoylem - Djinniv - Demigod e - Draconiann - Sprigganw - Formicid f - Trollo - Ghoulx - Naga g - Deep Elfp - Tenguy - Octopode h - Armataurq - Oniz - Felid i - Gnoll r - BarachiA - Mummy Gnolls are canine-like humanoids. They are unable to specialise in any single skill, but instead gradually become proficient in all skills at once. + - Recommended species * - Random species # - Recommended character ! - Random character % - List aptitudesSpace - Pick background first ? - Help Tab - Gnoll ArtificerMggy Mgg~ Mgg4 Welcome, deadiverson the Human. Please select your background. WarriorAdventurerMage a - FighterMggf i - Artificer  q - Hedge Wizard b - Gladiatorj - Shapeshifterr - Conjurer c - Monkk - WandererMgg s - Summoner d - Hunterl - Delvert - Necromancer e - BrigandMgg SWarrior-mageu - Fire Elementalist Mgg zZealotm - Warperv - Ice Elementalist Mggׁ Wf - Berserkern - Hexslingerw - Air Elementalist Mgg ]g - Cinder Acolyteo - EnchanterMgg Fx - Earth Elementalist h - Chaos Knightp - ReaverMgg y - Alchemist Artificers start with a few magic wands and a club. They'll need to find better Mgg9 hweapons and armour before their wands run out. + - Recommended backgroundMggQ @ * - Random background # - Recommended characterMggh T ! - Random character % - List aptitudesSpace - Change species Mgg '? - Help Tab - Gnoll ArtificerMgg  NggQ NggY Ngg[Welcome, deadiverson the Human Fighter. You have a choice of weapons.  a - rapier(+0 apt)  Ngg\ b - flail (+0 apt)  c - war axe (+0 apt)  d - trident (+0 apt)  e - long sword Ngga\(+0 apt)f - unarmed(+0 apt) + - Recommended random choice * - Random weapon % - List aptitudesBksp - Return to character menu  Ngg\? - Help Ngg# NggN+ NggD4deadiverson the Shield-Bearer HumanHealth: 18/18 ========================Magic: 1/1========================AC: 6Str: 16EV: 7Int: 8SH: 4Dex: 12XL:  1 Next:  0% Place: Dungeon:1Noise: ---------  Time: 0.0 (0.0)a) +0 long swordNothing quivered NggO9###.# ###.#.##@##©##©#.###### #..#### ##....##. ...... #... Ngg9... #.+#. #. Ngg> Ngg?Welcome, deadiverson the Human Fighter.Will you be the one to retrieve the terrific Orb of Zot from the depths? NggB NggSpPress ? for a list of commands and other information.  Found a staircase leading out of the dungeon. Ngg_t NggvB _Found a transporter. Nggj  Nggj  Ngg(n  Ngg q > _Unknown command.Ngg<Ngg@v  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting3.0   4.0   0   i - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0  NggSA             c - Short Blades   1.1   1.0   0      d + Long Blades2.0   3.0   0      NggA2        e + Armour3.0   4.0   0       f - Dodging   0.0   1.0   0      g + Shields3.0   4.0   0      NggBB h - Stealth   0.0   0.8  +1              NggB            NggB!            NggUC                The relative cost of raising each skill is in cyan.  NggCSkills enhanced by cross-training are in green.  [?] Help[=] set a skill target  NggC}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsNgg  a * Fighting   3.0NggB/ o a - Fighting   3.0Ngg1 d * Long Blades   2.0Nggo d - Long Blades   2.0Ngg  e * Armour   3.0NggL o e - Armour   3.0Nggk g * Shields   3.0Nggnp g - Shields   3.0Ngg TargetTarget--  --  --  --  --  --  --  --  --  a-z] set[-] clear selected targetcost|targetsNgg [?25h[?0cNgg~ *0 Ngg- [?25l[?1cNgg5.0 current training targets, if any.=] set aall targetsNggB a-z] setselected targetNggwC [?25h[?0cNggC10 Ngg#" NggxD [?25l[?1cNggiHo10.0 =] set aall targetsNgg a-z] setselected targetNgg9=[?25h[?0c0 Ngg" Ngg [?25l[?1cNggo7.0 =] set aall targetsNggma-z] setselected targetNgg<[?25h[?0c0 NggB2" Ngg6 [?25l[?1cNggO9o8.0 =] set aall targetsNgg a-z] setselected targetNggC=[?25h[?0c0 Ngg " Ngg z[?25l[?1c12.0 =] set aall targetsNgg/= a + Fighting 3.0Ngg Ngg Ngg deadiverson the Shield-Bearer HumanHealth: 18/18 ========================Magic: 1/1========================AC: 6Str: 16##EV: 7Int: 8#.# ##SH: 4Dex: 12#.#.#XL:  1 Next:  0% Place: Dungeon:1#@#Noise: ---------  Time: 0.0 (0.0)#©##©#.#a) +0 long sword##### #..Nothing quivered#### ##....##. ...... #...... #.+#. #.  Welcome, deadiverson the Human Fighter.Will you be the one to retrieve the terrific Orb of Zot from the depths?Press ? for a list of commands and other information.  FoNgg und a staircase leading out of the dungeon. _Found a transporter. _Unknown command.Nggc Ngg Ngg! Ngg#  NggH3 Ngg՚ Ngg Nggў Ngg _ Ngg Ngg_, Ngg Ngg Ngg0 Nggd Ngg Ngg  Nggp Ngg NggM Ngg| Ngg, Ngg Nggҷ Ngg, Ngg Nggݽ Ngg@, Ngg Nggi7 _You open the door. Ngg Ngg Ngg Ngg@  There is an open door here. Nggm Ngg _ Nggp Ngg Ngg5 Ngg, Ngg Ngg, NggY Ngg Ngg Ngg Ngg( Ngg  Ngg& NggS Ngg Ngg Ngg  Ngg7 Ngg Ngg Ngg Ngg Ngg  Nggf Ngg Ngg Ngg: NggD Ngg1 Nggx Ngg NggZ NggM Ngg Ngg Ngg* Ngg, Ngg, Ngg Ngg, Nggo Ngg Ngg  NggL Ngg Ngg Ngg NggJ Ngg Ngga Ngg, NggW Ngg{ Ngg    ######### ######## #........ .......#####.##### ##.............# #.....####@###.# 24.0 (24.0)  .. ##...## #........ ##. ##.## #####[### ... #.#  ... #.#  #.. ##'##     #.. ##...##     .#.####.....##    #.#.##.......#   Ngg Ngg,5.0 (25 Ngg) Ngg) _Found a chain mail. Ngg  NggG l  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting Ngg 13.0   4.0   0   i - Spellcasting   0.0   1.2  -1           Nggb  b - Unarmed Combat   0.0   1.0   0               c - Short Blades   1.1   1.0   0       d - Long Blades   2.0   3.0   0   Ngg              Ngg  e - Armour   3.0   4.0   0       f - Dodging   0.0   1.0   0   Ngg$      g - Shields   3.0   4.0   0       Nggn  h - Stealth   0.0   0.8  +1               Ngg              Ngg/                      Ngg         The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  Ngg [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  NggA [!] training|cost|targets!Ngg a * Fighting   3.0!NggAo a - Fighting   3.0!NggF> g + Shields 3.0"Ngg"Ngg"Ngg  deadiverson the Shield-Bearer   Human  Health: 18/18 ========================  Magic: 1/1========================#########  AC: 6Str: 16######## #........  EV: 7Int: 8.......#####.#####  SH: 4Dex: 12##.............#"Nggci  XL:  1 Next:  0% Place: Dungeon:1#.....####@###.#  Noise: ---------  Time: 25.0 (0.0)  .. ##...## #........  a) +0 long sword ##. ##.## #####[###  Nothing quivered ... #.# ... #.# #.. ##'## "Nggs  #.. ##...##   .#.####.....##   #.#.##.......#  Found a staircase leading out of the dungeon. _Found a transporter. _Unknown command. _You open the door. _There is an open door here. _Found a chain mail."Ngg0 4"Nggd"Ngg"Ngg"NggV"Ngg"Ngg "Ngg "NggB"NggP"Ngg"Nggz"Ngg7"NggA,"Ngg"Ngg"Ngg,"Ngg"Ngg<"Ngg,"Ngg"Ngg%B  You see here a +0 chain mail."Ngg6'"Ngg' _"NggH)"Ngg*"Nggo,,"Ngg-"NggH/"Ngg0,"Ngg1"NggQ4"Ngg5"Ngg6"Ngg6"Ngg+9"Ngg:,"Ngg;"Ngg="Ngg9?"Nggj?"Nggk@"Ngg,C"NggxE,"NggG,"Ngg3I,"NggWJ"Ngg2L"NggM,"NggN"NggP"NggaR"NggR"NggdS"NggV"Ngg7W"NggW"NggX"NggY"Ngg-[,"Ngg["Ngg^"Ngg*`,"Ngg`"Ngga"Nggc,"Nggc"Ngg9f"Nggg"Nggg"NggPh"Nggj"Ngg\k,"Nggl"Nggwq"NggsB"NgguwX"Ngg3x,"Nggex"Nggy"Nggz"Nggz"NggO{"Ngg|"Ngg}"Ngg ~"Ngga~"NggZ"Ngg,"NggR"Ngg*"Ngg"##...## #......# #+## ##...#.# #####.# #.#  #.#   #.#   . #.#   r...####.#  "Nggȇ .......@.#   ...#######    "Nggd    "Ngg.   r   rat (asleep) "NggV  "Ngg "Nggx 53.0 (28.0)  A rat comes into view."Nggx.rr==4.0 (29"Nggt"Ngg- _The rat squeaks loudly."Ngg4"Ngg"Ngg Z _A rat is nearby!"NggJ Y  .#  #+## .#  #####.#  #.#  #.#  #.#  . #.#  .r..####.#  .......@.#  ...####### "Ngg N"Ngg   .#  #+## .#  #####.#  #.#  #.#  #.#  . #.#  .r..####.#  .......@.#  ...####### "Ngg 4"Ngg "Ngg Z _A rat is nearby!#Nggw ##...## #......#  #+## ##...#.#  #####.#  #.#  #.# . #.# .. #.# #.r..####.# #NggSx #..# #...# #       #Ngg{#NggׁH.r#NggaA--5.0 (1.0) _#Ngg#Ngg_#NggFA ##...## #......#  #+## ##...#.#  #####.# ## #.# #$. #.# #... #.# .. #.#  #....####.#  #..r..@...#  #...#  ##       #NggM>.r#Ngg{MA--6#NggS#NggV* _Found 9 gold pieces.#NggC ##...## #......#  #+## ##...#.#  #####.#  ###### #.#  #$.... #.# #..... #.# .. #.#  #....####.#  #...r@....#  #...#  ##. #      #Ngg #Nggp.=7#Ngg'#NggC1 _You block the rat's attack.#NggZ  You hit the rat.  The rat is severely wounded.#NggdZ -8.4 (1.4#Ngg] #Ngg` ; _The rat bites you but does no damage.#NggD 5  You hit the rat.#Ngg g†#Ngg 519.7 (1.3#Ngg #Ngg  #Ngg 9_You kill the rat!#Ngg|#Nggb}#Ngg<#Ngg,H _No target in view!$Ngg3$Ngg$Ngg$NggQ$Nggx: _$Nggɸ_  You see here a rat corpse.$Ngg$Ngg _$Ngg$Ngg$Ngg%$Ngg$Ngg _You now have 9 gold pieces.$Ngg:#####.##.......## #.....## ..##.## ##.....## #......#  ... #. ##...## #......# ... #. #+## ##...#.# #. #. # #####.#  #. ####### #.#  ##.# #.....# #.# .#.#...##.....# #.# #......@......# #.# -67.7 (8.0####...###....####.#  ##.# #...†.....#  #( #...######## ##.##$Nggs/[39;49m#.#..#.#####-8.7 (9$Nggj$Ngg- _Found 3 poisoned darts.$NggIh$Nggh$Nggi$Nggm$Ngg p$NggtB$Nggu$Nggv$Ngg|w$Nggj{$Ngg}$Ngg}$Ngg5$Ngg$Ngg.$Nggi$Ngg˅$Ngg($Ngg,$Nggŋ$NggC  You see here 3 poisoned darts.$NggÑ$Ngg' _$NggX$Ngg$Ngg',$NggC$Ngg #.# #.# ####### #.# # ..###.###.....# #.# ...#.#...##.....# #.# #.............# #.# ####...###....####.# ##.## #...†.....# #(# #...####### #.# ##.##  #@# #.#  $Ngg ##.# ..#  #.# .###  #.# ## #..#.#.##. $NggO,75.7 (7$Ngg+6.7 (8$Nggg$Ngg2R _e - a brown potion$Ngg $NggO $Ngg $Ngg $Ngg? $Ngg $Nggo B$Ngg $Ngg $Ngg $Ngg ,$Nggo $Ngg] $Ngg $Ngg $Ngg $Ngg $Ngg ,$Ngg! $Ngg$ $Ngg& $Ngg& $Ngg"+ $NggN, $Ngg, ,$Ngg+- $Ngg. $Ngg/ ,$Ngg0 $Ngg0 $Ngg1 $Ngg1 $Ngg1 $Ngg2 $NggG3 ,$Ngg3 $Ngg,5 $Ngg5 ,$NggH6 $Ngg.7 $Ngg7 $Ngg 8 $NggO8 $Ngg: $Ngg; $Ngg; $Ngg; $Ngg< $Ngg6> $Nggv> $Ngg ? $Ngg@ $NggA $Ngg-B $NggB $Ngg>D $NggF $NggF $NggHG $NggJ $Ngg:K ,$Ngg|K $NgghL $NggKM $NggM $NggM $NggyN $NggSearch for what [? for help]? (Ngg [?25l[?1c(Ngg(Ngg5 1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=]  a - [D:1] 3 poisoned darts(Nggm rLevel 1 of the Dungeon<(Press ? for help)  #####.##.......## #.....## ..##.## ##.....## #......# ... #.  ##...## #......# ... #...   #+## ##...#.# #.  #....  #.######.#   #.#  #.# ####### #.# # ..###.###.....# #.# ...#.#...##.....# #.# #.............# #.#####...###....####.###.## #...†.....##(# #...########.# ##.###.#  #.##.#  ..##.#  .####.#### #..###.###.### ##...##.############......# #...............##(NggK (Nggr (NggϤ deadiverson the Shield-Bearer HumanHealth: 18/18 ========================Magic: 1/1========================AC: 6Str: 16EV: 7(Ngg* Int: 8SH: 4Dex: 12XL:  1 Next: 30% Place: Dungeon:1Time: _The giant cockroach bites you but does no damage.  You hit the giant cockroach. (Ngg _You kill the giant cockroach! _No target in view! _No target in view!  Search for what [? for help]? dart(Ngg (Ngg٦ (Ngg% (Nggí (Ngg (NggN ; _(Ngg (Ngg (Nggܷ (Ngg (Ngg (Nggؾ (Ngg (Ngg (Ngg (NggK ,(Ngg (Ngg1 (Ngg (Ngg (NggT (Ngg (Ngg (Ngg (Ngg (Ngg (Ngg (Ngg (NggF (Ngg (Ngg (Ngg (Ngg (Ngga (Ngg ,(Nggo (Ngg (Ngg@ ,(Ngg (Ngg$ (Ngg (Ngg (Nggf (Ngg (NggF ,(Ngg (Ngg, (Ngg ,(Ngg (Ngg9 (Ngg (Ngg (NggU (Ngg (Nggr ,(Ngg" (Ngg (Ngg ,(Ngg2 (Ngg (Ngg ,(Ngg (Nggk (Ngg' ,(Ngg (Ngg* (Nggf ,(Ngg (Ngg (NggZ (Ngg (Ngg (Ngg (Ngg ,(Ngg (Ngg (Ngg ,(Ngg (Ngg (Ngg ,(Ngg (Nggl (Ngg ,(Ngg (Ngg! (Ngg# ,(Ngg$ (Ngg, }... #... #+## ##...#.##. #.... #.######.##.# #.# ####### #.## ..###.###.....# #.#...#.#...##.....# #.##.............# #.#####...###....####.###.## #...†.....##@# #...#######(Ngg. Noise: --------- 150.4 (25.0)#.# ##.##a) +0 long sword#.# #.#Nothing quivered#.# ..##.# .####.#####..###.###.###(Ngg4 (Nggd6 T _You see here 3 poisoned darts.)Ngg))Nggz*1.4 (1.0)Throw: 3 darts (poison))Ngg-)Ngg0T _f - 3 poisoned darts)NggL)NggAM)NggM)NggP)Ngg=R)NggaWn)NggX)NggY)Ngg[)NggN[)Ngg[)Ngg\])Ngg^)Ngg&_)Ngg_)NggaB)Nggc)Nggd)Nggdn #©##©#.#.........+...... #####.#..........####...####.##.......## #......##.## ##.....## #....... #..# ##...## #....... #...## #+## ##...#. #....# #.# #### #.## #.# ##########@.###.###.....K.......#.#...##.....#########.............# ####...###....### ##.## #...†... #.# #...#### K   kobold (asleep) #.# ##.## #.# #.# [34)NggoMm#.# ..#)NggUu 6.4 (5  A kobold comes into view. It is wielding a +0 club.)NggV|\.KK)Nggg}4==7.4 (6)Ngg> _The kobold shouts!)Ngg  #©##© #### ####  ..##.##   ... #..#   ... #...## #+##  #. #....# #.#  #.## #.#   ####@.#  )NggZ .K......#.#  ########....  ####... ##.## #...† #.#  #.# ##.##  #.# #.#  #.# ..# )Ngg`  #©##© #### ####  ..##.##   ... #..#   ... #...## #+##  #. #....# #.#  #.## #.#   ####@.#  .K......#.#  ########....  ####... ##.## #...† #.#  #.#  #.#  #.# )Nggm )Ngg )Ngg )Ngg ] _A kobold is nearby!)Ngg #©##© #### ####  ..##.##   ... #..#   ... #...## #+##  #. #....# #.#  #.## #.#   ####@.#  .K......#.#  ########....  ####... ##.## #...† #.#  #.# ##.##  #.# #.#  #.# ..# *Ngg= #©##© #### ####  ..##.##   ... #..#   ... #...## #+##  #. #....# #.#  #.## #.#   ####@.#  .K......#.#  ########....  ####... ##.## #...† #.#  #.#  #.#  #.# *NggG4*Ngg5N*Ngg\  ####.#### #####.## ..##.## ## #. #..# ## # #...## #+## ## #. #....# #.# ### #.## #.# ####### #.######..###.###.....#*Ngg\#.K....@.#.#...##.....##########.............# ####...###....## ##.## #...†.. #.# #...### #.# ##.##  #.# #. #.# ..# #.# .### _A kobold is nearby!*Nggd*NgglB.K*Nggfm2--8.4 (1 *Nggm _*Nggs*Nggu*NggM #####.#.#### #####.##.## # ..##.## ##.....## # ... #..# ##...## # ... #...## #+## ## #. #....# #.#  #.## #.# # #.######..###.###.....# #..K..@..#.#...##.....# #.# ####...###.... ##.## #...† #.# #... #.# ##.##  #.# #.#  #.# ..#  #.# .###*NggL*Nggt>.K*NggA--9*Ngg7*Nggכ*NggT #####.#.#### #####.##.## # ..##.## ##.....## # ... #..# ##...## # ... #...## #+## ##*Ngg #. #....# #.#  #.## #.#  #.######..###.###..... #...K@...#.#...##..... #. ####...###.... ##.## #...†*Ngg* #.# #... #.# ##.##  #.# #.# *Nggx #.# ..#  #.# .###*Ngg*Ngg$/=60*Ngg*NggPS _The kobold barely misses you.*Ngg0*Ngg-1.7 (1.3*Ngg*Nggy _You barely miss the kobold. The kobold hits you but does no damage.*NggX  You barely miss the kobold. The kobold hits you with a +0 club.6---3.1 (1.4*Ngg] *Ngg` = _The kobold hits you but does no damage.*NggD :  You slash the kobold!*Ngg C)*Ngg 054.5*Ngg *Ngg} J _You kill the kobold!*Ngg$*Ngg%*Ngg+*Ngg4-H _No target in view!+Nggp3+Ngge+Nggs+Ngg7=-- _+NggE,+Ngg+Ngg+Ngg+Nggx+NggJ+Ngg9=+Nggq+Ngg&+Nggz#8+Ngg)==+NggP+Ngg31 _HP restored.+Ngg+Ngg+Ngg+Ngg|  Things that are here:  a +0 club; a kobold corpse+Ngg+Ngg _+Ngg+Ngg +NggW #####.#...#.#...#####.##.......##......##.## ##.....##  ..... #..# ##...##  ... #...## #+##  #.) #....# #.# #.. #.## #.#  #.######..###.### #.@.)....#.#...##-72.5 (8.0 ### ####...### ##.## #. #.# #. #.#   #.# #  #.# .  #.# .# +Ngg+Ngg9E-3.5 (9+Nggo+Ngg ' _Found a hand axe.+NggH3+Ngg'+Ngg8+Ngg+Nggf==+Ngg,+Ngg+Nggh+Ngg +Nggc+Ngg+Ngge+Ngg+Ngg+Ngg=,+Ngg,+Ngg+NggD+Ngg{,+Ngg%+NggH+Ngg,+Ngg"+Ngg+Ngg  ##.. ##... ## #.#.####.... #. #.#.##..... ##.### #<#....... ....##©##©#.#...... #.#..#####.#.......+Ngg` #.#...#####.##.....##......##.## ##..#..@....##..# ##.80.5 (7#.#.....##...## #+#.. ###.)..#....# #.#[~. #...## #.## #.###≈ ##.######..###.###...)....#.#...+Ngg{#########......###.. ##+Ngg +Ngg +1.5 (8+Ngg]+Ngg- _Found a leather armour.+Nggg+Nggh+NggPi+Nggm+Nggp,+Nggv,+Nggw,+Ngg x+NggQ{+Ngg|+Ngg|+Ngg}+Ngg+Ngg,+Ngg +Ngg+Ngg^,+Ngg+Ngg+Ngg~%  +NggYou enter the shallow water.+Ngg*Water +Ngg+Ngg+Ngg)N _Moving in this stuff is going to be slow.+Ngg<+Ngg+NggC+Ngg+Nggۗ+Ngg!+NggUX+Nggg+Ngg,+Nggݤ+Ngg+Ngg9,+NggU+Nggm,+NggU+NgguL _You now have 15 gold pieces (gained 6).+NggQ3+NggO+Ngg'+Ngg+Nggf+Ngg]+Ngg+Ngg,+Ngg0+Ngg+Ngg,+NggA+Ngg_X+Nggo+Ngg≈###......#..K≈≈~# ##≈##.......#r..~~..#####.~.#.#.....#...~~..#.....~...###.)...≈~..#.###[~.### #...#~..~~.~#.# ##≈## ##.##...~~..#.# #≈# #.....~.#.# #≈# ####...~~..@.# ### ...~~.?###.~~~≈..~.~~~~.~.~~.###.≈≈.r   quokka (asleep)#..≈≈~+Ngg[15;38HK   kobold (missile, asleep)..#≈≈# +Ngg9 99.1 (17.6)  A quokka and a kobold come into view.+NggM+Ngg..rKrK)+Nggm7==200.1 (18+Ngg +Ngg ( _The kobold shouts!+Nggb  ...≈≈~# .. .rK~~..###. ...~~..#.....~...###.) ...≈~..#.###[~.###  ~..~~.~#.# ##≈##  ...~~..#.# #≈#  .....~.#.# #≈#  ...~~..@.# ###  ...~~.?### .~~~≈.. ~.~~~~.+Nggc  #~.~~.# ##.≈≈. #..≈≈~ ..#≈≈#+Ngg * ...≈≈~# .. .rK~~..###. ...~~..#.....~...###.) ...≈~..#.###[~.###  ~..~~.~#.# ##≈##  ...~~..#.# #≈#  .....~.#.# #≈#  ...~~..@.# ###  ...~~.?### .~~~≈.. ~.~~~~. #~.~~.# ##.≈≈. #..≈≈~ +NggM Q..#≈≈# +Ngg4+Ngg+Nggd _There are monsters nearby!,Nggqr ...≈≈~# .. .rK~~..###. ...~~..#.....~...###.) ...≈~..#.###[~.###  ~..~~.~#.# ##≈##  ...~~..#.# #≈#  .....~.#.# #≈#  ...~~..@.# ### ,Ngg ...~~.?### .~~~≈.. ~.~~~~. #~.~~.# ##.≈≈. #..≈≈~ ..#≈≈#,Nggi ...≈≈~# .. .rK~~..###. ...~~..#.....~...###.) ,Ngg\j...≈~..#.###[~.###  ~..~~.~#.# ##≈##  ...~~..#.# #≈#  .....~.#.# #≈#  ...~~..@.# ###  ...~~.?### .~~~≈.. ~.~~~~. #~.~~.# ,Nggk##.≈≈. #..≈≈~ ..#≈≈# ,Nggs,Ngg t,Ngg?{,Nggd _There are monsters nearby!,Ngg ,Nggp ,NggU ,NggY n..Kr,Ngg A--1.1 (1.0) _,Ngg ,Nggc -NggL+-Ngg5\.r-Ngg6A--2-NggA-NggXD-Nggat-Ngg#F~K-Nggʁ&3-Ngg-Ngg-NggJ-NggT~r-Ngg&4-Ngg-Nggp-Ngg|-Ngg}-Nggd~~Kr5-Nggy-Ngg-Ngg1 -Nggʅ -Ngg] j..Kr-Ngg &6-Ngg< -NggC -Ngg -Ngg J.K-Ngg .=7-Ngg -Ngg r _The quokka barely misses you. You block the quokka's attack..Ngg :  You slash the quokka!.Ngg.Ngg0~†KK   kobold (missile).Ngg578.5 (1.4.Ngg.NggJ _You kill the quokka!.NggjL  You barely miss the kobold.The kobold hits you with a +0 short sword..NggQM^5----9.8 (1.3.NggIT.NggW4 _You block the kobold's attack..Ngg0:  You slash the kobold!.NggfC).Nggב6811.2 (1.4.Ngg.NggJ _You kill the kobold!.Ngg.NggW.NggD.NggH _No target in view!.NggG .Ngg .NggE .Ngg H _No target in view!.Ngg3.Ngg.NggM.Ngg: _.Ngg.Ngg]X6=---.NggW.Ngg,.NggJ.Ngg,.NggB.Ngg.Ngg e=.Ngg\ .Ngg K7=.Ngg.Ngg",.Ngg-.Ngg,.Ngg&.NggQ.Ngg.Ngg.Ngg.Ngg i8===.Ngg!.Ngg%.Ngg7(,.Nggc*.Ngga/\  Things that are here:  a +0 short sword; 3 stones.NggM35 _.Ngg5/NggI....≈≈~## ##≈..~~..#####.~.#.#......~~..#.....~...###.)..≈~..#.###[~.### #.!~..~~.~#.# ##≈## ##....~~..#.# #≈# #.....~†#.# #≈# ###~~.)..# ### .~~.@### -~~~≈..# .~~~~.#.#~.~~.## ##.≈≈. #..≈≈~...#≈≈#!##≈/Ngg 024.2 (13.0)/NggyF-5.2 (14/Ngg}/Ngga _g - a scroll labelled XYD YCROOMM/NggU3/NggJX/Ngg4]/Nggef==/Nggf/NggAl,/Nggn/Nggq/Nggt,/Ngg;v/Nggy/Ngg{,/Ngg?}/Ngg#/Ngg/Nggq/Ngg/Ngg/Ngg,/Ngg@/Ngg8/NggM,/Ngg/Ngg% +..... ≈##  .....###≈≈#..  ......#≈≈#.# ###  ......≈≈..# #≈##/Ngg ##.....≈≈~## ##≈# ......~~..#####.~.# #....~~..#.....~.. #....≈~..#.###[~.# ####@~..~~.~#.# ##≈## #........~~..#.# #≈#/Ngg #.#........~†#.# #≈# ##.....~~.)..# ### ........~~..### ####..~~~≈..# #.~.~~~~.# #.#~.~~.###.##.≈≈.#/Nggӣ232.2 (7.0)/Ngg?+3.2 (8/NggZ/NggQ _h - a ruby potion/Ngg!3/Ngg/Ngg/Nggx/NggKB/Ngg,/Ngg /Ngg/Ngg ......≈≈..# #≈#####.....≈≈~## ##≈##.~~..#####.~.#.#....~~..#.....~... #....≈~..#.###[~.#####.~..~~.~#.# ##≈## #........~~..#.# #≈# #.#........~†#.# #≈# /Ngg&#..@..~~.)..# ### w..~~..### ######..~~~≈..#  #.~.~~~~.# #.#~.~~.## #.##.≈≈.# w   dart slug (asleep)/NggN[#.#..≈≈~##...#≈≈##..!##/Nggh5.2 (2ww/Nggo+6.2 (3/Ngg /Ngg:\ _A dart slug comes into view./Ngg   ##.....≈≈~##  ......~~..# #....~~..# #....≈~..#.###[ #####.~..~~.~#.# ##≈##  #........~~..#.# #≈#  #.#........~†#.# #≈#  ##..@..~~.)..# ###  w.........~~..###  ######..~~~≈..#  #.~.~~~~.#  #.#~.~~.##  #.##.≈≈.#  #.#..≈≈~#  #...#≈≈##  ..!##≈ /NggA    ##.....≈≈~##  ......~~..# #....~~..# #....≈~..#.###[ #####.~..~~.~#.# ##≈##  #........~~..#.# #≈#  #.#........~†#.# #≈#  ##..@..~~.)..# ###  w.........~~..###  ######..~~~≈..#  /NggB >#.~.~~~~.# #.#~.~~.## #.##.≈≈.#  #.#..≈≈~# #...#≈≈## ..!/NggL 4/NggT /NggX ` _A dart slug is nearby!/NggW    ##.....≈≈~##  ......~~..# #....~~..# #....≈~..#.###[ #####.~..~~.~#.# ##≈##  /NggfX #........~~..#.# #≈#  #.#........~†#.# #≈#  ##..@..~~.)..# ###  w.........~~..###  ######..~~~≈..#  #.~.~~~~.#  #.#~.~~.##  #.##.≈≈.#  #.#..≈≈~#  #...#≈≈##  /NggX 1..!##≈ /Ngg    ##.....≈≈~##  ......~~..# #....~~..# #....≈~..#.###[ #####.~..~~.~#.# ##≈##  #........~~..#.# #≈#  #.#........~†#.# #≈#  ##..@..~~.)..# ###  /Ngg ]w.........~~..###  ######..~~~≈..#  #.~.~~~~.# #.#~.~~.## #.##.≈≈.#  #.#..≈≈~# #...#≈≈## ..!/Ngg /Ngg1 /Ngg| /Ngg ` _A dart slug is nearby!/NggG  ......≈≈..# #≈ ##.....≈≈~## ##≈## ......~~..#####.~.# #....~~..#.....~ #....≈~..#.###[~. #####.~..~~.~#.# ##≈## #........~~..#.# #≈# #.#........~†#.# #≈#/Ngg  ##.@...~~.)..# ###.w.~~..####..~~~≈..# #.~.~~~~.# #.#~.~~.## #.##.≈≈.# #.#..≈≈~# #...#≈≈##  ..!##≈/Ngg /NggC G.w/Ngg 27.2 (1 _/Ngg@ /Ngg 0Ngg1D ......≈≈..# #≈ ##.....≈≈~## ##≈ ......~~..#####.~. #....~~..#.....~ #....≈~..#.###[~. #####.~..~~.~#.# ##≈ #.~~..#.# #≈# #.#.~†#.# #≈# ##@....~~.)..# ###.w.~~..####..~~~≈..# #.~.~~~~.# #.#~.~~.## #.##.≈≈.# gg8E^m#.#..≈≈~# #...#≈≈##  ..!##≈.w8 _The dart slug briefly extends its eye-stalks.0Ngg r##.....≈≈~## ##≈ ......~~..#####.~ #....~~..#.....~ #....≈~..#.###[~#####.~..~~.~#.# ##≈ #........~~..#.# #≈ #.#........~†#.# #≈0Ngg###.#.##.....~~.)..# #.....w.@.....~~..### #########..~~~≈..#  #.~.~~~~.# #.#~.## #.##.≈≈. #.#..≈≈~# #...#≈≈## ..!##≈ 0Ngg0Ngg&90Nggf0Ngg0Ngg ##.....≈≈~## ## ......~~..#####. #....~~..#..... #....≈~..#.###[ #####.~..~~.~#.# ## #........~~..#.# # #.#........~†#.# ##.#.##.....~~.)..# .w0Ngg..~~..####..~~~≈..# #.~.~~~~.# #.#~.~.## #.##.≈≈.# #.#..≈≈~#  #...#≈≈##  ..!##≈0Ngg0Nggi/=400Ngg40NggwA _The dart slug bites you but does no damage.0NggN  You hit the dart slug.  The dart slug is heavily wounded.1.6 (1.40Ngg$ 0Nggu V _The dart slug barely misses you.0Nggp ;  You hit the dart slug.0Ngg^ 1.0Ngg6 0Ngg p##.....≈≈~## ## deadiverson the Shield-Bearer ......~~..#####. Human#....~~..#..... Health: 18/18 ========================#....≈~..#.###[ Magic: 1/10Ngg ========================#####.~..~~.~#.# ## AC: 6Str: 16#........~~..#.# # EV: 7Int: 8#.#........~†#.# # SH: 4Dex: 12####.#.##.....~~.)..# # XL:  1 Next: 120% Place: Dungeon:1.......@......~~..###Noise: =--------  Time: 243.0 (1.4)##########..~~~≈..#0Ngg) -a) +0 long sword#.~.~~~~.#Throw: 3 darts (poison)#.#~.~~.###.##.≈≈.##.#..≈≈~#0Nggk #...#≈≈##..!##≈ _The dart slug briefly extends its eye-stalks. _The dart slug bites you but does no damage.  0Ngg You hit the dart slug.  The dart slug is heavily wounded. _The dart slug barely misses you.You hit the dart slug.0Ngg% _You kill the dart slug!You have reached level 2!0NggT /  --more--1Ngg:Z E24/242/22 8% 1Ngga 1Nggc 4 _2NggE0I2Ngg>32Ngg42Ngg.5$ _2Ngg9,2Ngg92Ngg92Ngg2;2Ngg=2NggOA,2Ngg`C2NggE2NggrH,2NggI2NggmL2NggN,2NggO2Ngg Q2Ngg(R,2NggR2NggWT2Ngg}V2NggV2NggW2Ngg^[2Ngg],2Nggs_2Nggea2Nggsc2Nggc2Nggd2NggmG####.#.##.....~~.)..# ### ..............~~..### ##########..~~~≈..# #.~.~~~~.# #.#~.~~.## #.##.≈≈.# #.#..≈≈~# #...#≈≈## .##≈# -######..## ≈# #..# #..#..........#...#......2Nggt.52.0 (9.02NggtI-3.0 (10.0)2Nggy2Nggd|Y _i - a viscous pink potion2Ngg2Ngg/2Nggf2Ngg2Ngg2Ngg42Nggn2NggF 2Ngg 2Ngg ,2Nggg2Nggf2Ngg,,2Ngg2Nggj2Ngg2NggT2Ngg2Ngg2Ngg( m .........##≈#  ######..## ≈#  #..# 2Ngg| ;####..######.##.............###......#####......#...## ........####..) ######.@.......2Ngg 61.0 (8.0) #.#####.## #+ 2Ngg # # # #2Ngg&!  .######  2NggO!u....... ###### 2Nggw!2Ngg&2NggR'2Ngg'$2.0 (92Ngg,2Ngg.% _Found a dagger.2NggI2NggU2Ngg72NggB2Ngg(2Nggh2Ngg2NggW2Ngg12Nggp2Ngg2NggSy  ######..## ≈# #..# ####..######.# #.............2Ngg.###......#####.......#...## .........####..) ######......... #@#####.##2Ngg5.0 (3 #'#  ... 2Nggb..................... .2Ngg%+.(.......+ #.........# 2Ngg, _You open the door.2NggE _Found 7 stones.2Ngg 2NggN 2Ngg 2Ngg% 2Ngg : _2Ngg} V  There is an open door here.2Ngg6 2Ngg  _2Ngg( 2NggJ 2Ngg ,2Ngg 2Ngg 2Ngg 2NggN 2Ngg 2Ngg 2Ngg ,2NggV 2Nggd 2Ngg 2Ngg 2Ngg 2Ngg 2Ngg 2Ngg 2Ngg 2NggC 7 _You open the door.2Ngg 2Ngg 2Ngg 2Ngg~ 2Nggl ,2Ngg 2Ngg %  2Ngg There is an open door here.2Ngg 2Ngg>  _2Ngg 2NggT 2Ngg] 2Ngg 2Ngg 2Ngg 2Ngg ,2Ngg 2Ngg 2Nggu B2Ngg 2Ngg ........####..) ###### ######......... #.##..##.#####.## ..# #..+##'## ..# ### #..#2Nggf ##...## # ..# #.. #..###.....###.####..# #.# #..###.......## ......# #.# ###...2Ngg #.........####...######|###..###+.(.......'....@................2Ngg q#.........####...######.##......2Ngg ##.......≈# ##..# #.........2NggE ##.≈≈..#≈# ##.# #†......####.~≈.#~≈ .# #.##......#.#+~≈.#.. .# #.##.##.g   hobgoblin (asleep)2Ngg ## .### #≈ .# #.##.##.##. g# #.##....##.##.....2Nggh 078.0 (13.0)2Ngg Ag2Ngg 0g.2Nggj ,9.0 (142Ngg 2NggJ \ _A hobgoblin comes into view.3NggH ######......... #.# #..#  #.#####.## .+##'## ### #..###...## #..##.....###.######3NggI.......## ......####...#.........####...######|###..###+.(.......'.....................#.........####.@.######.###.≈# ##..# #... ##.≈≈..#≈# ##†3NggI##g   hobgoblin3NggId.##.# ###.#3NggL3NggQ>g.3NggiR280.0)3NggV3NggX3NggoXp #.#####.## .+##'## ### #..###...## #..##.....###.######.......## ......####...#..####...######|###..###+.(.......'.....................3NggX^#.........####...######.###≈# ##@.# #... ##.≈≈..#≈# ##†##3NggX ##.~≈.#~≈ .##.......#+~≈.#.. g##.##3Ngg Y# .### #≈ .#3NggcY #. .. . ###.#3Ngg\3NggVd>g.3Nggd&13Nggk3Nggn3Ngg!1##'## ..# ### #..# ###...## # #..# #.. #..# ###.....###.####..# #.# #..###3Ngg"3#.. ......# #.# ###.... #..###...######|###..### +.(3Ngg'"'..................... #...####...######.## #3NggD"≈# ##..# #.........#3Ngga"≈≈..#≈# ##@# #†###3Ngg}"~≈.#~≈ #g# #.##.......#.#+~≈.#.. ..# #.##.##.##3Ngg"## .### #≈ #..# #.##.##.#3Ngg"% #. ##.# #.##....# #.# #.##..... 3Ngg"#.# #.# ###.##.# #.# 3Ngg# 3Ngg-3Ngg}-%=3Ngg- 23Ngg33Ngg6V _The hobgoblin barely misses you.3Nggvc  You barely miss the hobgoblin.3Nggtv-3.3 (1.33Nggf~3Nggy@ _The hobgoblin hits you but does no damage.3Ngg  You hit the hobgoblin.  The hobgoblin is heavily wounded.3Ngg (4.63Ngg8 3Ngg @ _The hobgoblin hits you but does no damage.3Ngg;  You closely miss the hobgoblin.The hobgoblin is heavily wounded.3Ngg 62--3Ngg !5.93Ngg 3Ngg2 - _The hobgoblin hits you.4Ngg@  You hit the hobgoblin.  The hobgoblin is almost dead.The hobgoblin hits you.4Ngge19-----7.24Ngg4Ngg@ _The hobgoblin hits you but does no damage.4Ngg=  You slash the hobgoblin!4Ngg7D.4Nggʡq20=--168.6 (1.44Ngg 4NggG 4Nggp?_You kill the hobgoblin!4Ngg84Ngge94Ngg`?4Ngg@H _No target in view!4Nggb 4Nggnb 4Nggg 4Nggi 5NggXM #.#####.## #..+ ##'## # ### ##...## # . #.....###.#### #..###  ### ......# #.# ###... #..5NggY$####...######|###..###. +.('...............# #..####...######.##. 5Ngg$Yp##.......≈# ##....5NggCYx##.≈≈..#≈# ##.†......###5Ngg`YZ#.~≈.#~≈ #......5NggYy#.#+~≈.#.. ..# #.##.##.##.##.#5NggY5Ngg a5Ngga2-90 5Nggb _5Ngge5Nggg5NggM#####......... ## #.#####.## .5Ngg6n #..+ ##'## # ### ##...## # #..# #.. 5Ngg_#.....###.#### #..###  #5Ngg## ......# #.# ###... #..5Ngg.####...######|###..###. +.(5Ngg.'...............# #..####..@######.##. ##.......≈# ##..5Ngg Z..##.≈≈..#≈# ##.5NggB†......#####.~≈.#~≈ #.# #.##.......5Ngg]&##.#5Ngg5Ngg\A-905Ngg5Ngg@5Ngg݁d......####..) #######. 5Ngg####......... ##.# #..# #..#####.## ...# #..+ #.5Ngg'## #..# ### #..# #.## # #..# #.. #..# #. ####.####..# #.# #..#####.......# #.# ###.... ...5Ngg####...######|###..###.. .('......@..............## 5Nggނp..####...######.##5Ngg. #.......≈# ##..# #..5Ngg(. ##.≈≈..#≈# ##.# #†......###  5Nggq##.~≈.#~≈ #.# #.##.......##.#+~≈.#.. ..# #.##.##.##.### .### #≈ #..# #.##.##.# ##.5Ngg##.# #.##....##.# #.##.....5Ngg5NggT&15Ngg95Nggo5Nggh####..) #.#. ##.# #..# #.#.#####.## ...# #..+ #.##'## #..# ### #..# #. ##...## # #..# #.. #..# #. #.....###.####..# #.# #..###. .##.......# #.# ###.####...######|###..###. (.5Ngg4'.#####...######.##. .≈# ##..# #.# #.≈≈..#≈# ##. ##.~≈.#~≈ #. #.#+~≈.#.. .. ## .### #≈ #..#. ##. 5Ngg/5Nggq1==25Ngg5Ngg5NggY v####..) #.#. ##.# #..# #..##.#####.## ...# #..+ #..# ##'## #..# ### #..# #..# #...## # #..# #.. #..# #. .....###.####..# #.# #..###..###.......# #.# ###......#####...######|###..###...# .'.#####...######.##.≈# ##..# #.# .≈≈..#≈# #5NggY O 5Ngg` 5Ngga &35Nggf 5NggRh 5Ngg| ####..) #.# #. ##.# #..# #..#ß #.#####.## ...# #..+ #..#. #'## #..# ### #..# #..# ...## # #..# #.. #..# #.###.####..# #.# #..###..#.##.......# #.# ###......#####...######|###..###...# '.#####...######.##.≈# ##..# #.####. 5Ngg 5Ngg &45NggD 5Ngg 6Nggl+####..) #.# . ##.# #..# #..#ß .#####.## ...# 6Ngg͘#..+ #..#. '## #..# ### #..# #..##'## # #..# #.. #..# #.###.####..# #.# #..###..#.##.......# #.# ###......#####...######|###..###...# '.6Ngg{#####.####...######.##.6Ngg,≈# ##..# #...####...#≈# ##.# #†....6NggP..### ~≈.#~≈ #.# #.##.......# 6Nggr+~≈.#.. ..# #.##.##.##.# 6Ngg6Ngg.6Ngg&56Nggݧ6Nggϩ6Ngg_####..) #.#6Ngg ##.# #..# #..#ßß. #####.## ...# #..+ #..#. ## 6Nggk4#..# ### #..# #..##'# .## # #..# #.. #..# #.###.####..# #.# #..###..#.##.# #.# ###......#####...######|###..###...# '.#####. 6Ngg####...######.##.≈# ##..# #.........####. ..#≈# ##.# #†. 6Ngg≈.#~≈ #.# #.##.......# ~≈.#.. ..# #.##.##.6Ngg##.# ### #≈ #..# #.##.#6Ngg ##.# #.# 6Ngg2==66Ngg>6Ngg6Ngg5## #............. ####..) #######.###### ....... ##.# #..# #..#ßß.###.## ...# #..+ #..#... # #..# ### #..# #..##'## ## # #..# #.. #..# #......# .###.####..# #.# #..###..#...##.......# #.# ###......#########...######@###..###...# '.....................#####. ####...######.##............. 6Ngg64≈# ##..# #.........####... .#≈# ##.# #†......### .#~≈ #.# #.##.......# ≈.#.. ..# #.##.##.##.# ## #≈ #..# #.##.##.# ###.# #.##....#6NggUC6NggC&76NggH6NggLz _You see here a staff of conjuration.6Ngg1 6Ngg 6Ngg 6Ngg 6Ngg $ _6Nggo B6Ngg 6Ngg 6Ngg 9=6NggO 6Ngg 6Ngg K3=6Ngg 6Ngg ,6Ngg 6NggS ,6Ngg 6Ngg ,6Ngg 6NggL 6Ngg #46Ngg E==6Ngg 6Ngg~ 6Ngg 6Ngg 6Ngg 6NggI 6Ngg ,6Ngg 6Ngg  6Ngg^ 6Ngg 6Ngg 6Ngg 6Ngg 6Ngg. 9=6Ngg 6Ngg 6Ngg ,6Ngg 6Nggl 6Ngg ,6Ngg5 6Ngg i  You see here a staff of conjuration.6Nggp 6Ngg  _6Ngg 6Ngg 6Ngg ,6Ngg1 6Ngg 6Nggy ,6Nggi 6Ngg " 6Ngg# 6Ngg$ 6Ngg$ 6Ngg2' 6Ngg( ,6Ngg) 6NggH+ 6Ngg, 6Ngg- 6Ngg. 6Ngg/ 6Ngg1 6Ngg1 6Ngg2 6Ngg%4 6NggA5 6Ngg5 6Ngg5 6Ngg>7 6Ngg8 ,6NggB9 6Ngg; 6Ngg?< 6Nggd< 6Ngg< 6Ngg:> 6NggY? 6Ngg? 6Ngg? 6NggPA 6NggB 6NggB 6NggQC 6NggaE 6Ngg%M ..# #.........####...  ##.# #†......####  #.# #.##.......#  ..# #.##.##.##.#  #..# #.##.##.# #  ##.# #.##....##.#  #.# #.##.......# 6NggM  #.# #.#####.####  #.# #@#  #....r#  ######....##.#  #.##.# #. .. ## ### r   rat (asleep) 6NggPS y 323.6 (26.0)  A rat comes into view.6NggOY c.rr6NggY K====4.6 (276Ngg^ 6Ngg1a - _The rat squeaks loudly.6Nggl= #..  ##.# #†......####  #.# #.##.......#  ..# #.##.##.##.#  #..# #.##.##.# #  ##.# #.##....##.#  #.# #.##.......#  #.# #.#### 6Ngg #.# #@# #.....r......#  ######....##.#  #.##.#  #. ..  ## ### 7NggUg #..  ##.# #†......####  #.# #.##.......#  ..# #.##.##.##.#  #..# #.##.##.# #  ##.# #.##....##.#  #.# #.##.......#  #.# #.####  #.# #@# #.....r......#  ######....##.#  7NggV#.##.# #. .. ## ### 7Nggg\7Ngg\7Ngg\a7NggcZ _A rat is nearby!7Ngg #..  ##.# #†......####  #.# #.##.......#  ..# #.##.##.##.#  #..# #.##.##.# #  ##.# #.##....##.#  #.# #.##.......#  #.# #.####  #.# #@# #.....r......#  ######....##.#  #.##.#  #. ..  7NggoC## ### 7NggOg #..  ##.# #†......####  #.# #.##.......#  ..# #.##.##.##.#  #..# #.##.##.# #  ##.# #.##....##.#  #.# #.##.......#  #.# #.####  #.# #@# #.....r......#  ######....##.#  7Ngg)P#.##.# #. .. ## ### 7NggV7NggV7Ngg[7Ngg,]Z _A rat is nearby!7Ngg7  You slash the rat!7Nggj.7Nggo20=---5.9 (1.3)7NggH7Ngg G _You kill the rat!7NggL7NggeM:---7NggR7NggWH _No target in view!7Ngg% 7Ngg 7NggG 7Ngg 7Ngg ` ##†......####  .##........#.##.####.##.# #7NggQ !....##. ......###.####>#####.###### #......@.....#0.0#####....## 7Ngg #.##.#  ...# ####7Ngg@ I-6.9 (17Ngg 7Ngg ; _Found a stone staircase leading down.7NggJ I7NggM 7Ngg/S X7NggS ,7Ngg)T 7NggFV 7Ngg^W 7NggW 7NggW 7NggQY 7Ngg[ B7Ngg_\ 7NggR] 7Ngg] 7Ngg] 7NggF_ 7Ngg` ,7Ngga 7Nggc 7Ngg|d 7Nggd 7Ngg e 7NggCf 7Nggg ,7Nggg 7Ngg?i 7Ngg'j 7NggSj 7Nggj 7NggAo 7Nggep 7Nggp 7Nggq 7Nggr 7Nggr 7Nggs 7Nggs 7Nggt 7Nggu 7Nggv 7Ngggv 7Nggw 7Nggx ,7Nggmy 7Ngg{ 7Ngg| ,7Ngg^} 7Ngg~ 7Ngg ,7Ngg 7Ngg| 7Ngg ,7Ngg 7Ngg\ 7Ngg ,7Nggn 7Ngg 7Ngg 7Ngg 7Ngg 7Nggʌ 7Ngg 7Ngg 7Ngg 7Ngg͏ 7NggĐ 7Ngg 7Ngg_ 7Ngg 7Ngg^ 7Ngg 7NggԔ 7Nggڙ 7Ngg 7NggJ 7Ngg 7Ngg 7 _You open the door.7Nggm 37Nggc 7Nggإ @  There is an open door here.7NggQ 7Ngg  _7Ngg^ 7Ngg 7Ngg 7Nggѫ 7Nggn 7Ngg 7Ngg< ####..# #..##'## ...#..# #......#.## ).. ####..###..#...#..##.... # ###......#####...#.... ###..###...#ß..#........ ........#####..#...... 7Ngg ##..................# ........####.......# ......#### #...@.# -51.9 (25.0) ##.......# ##...## ##.##.##.# ##'## ##.##.# # #.###### 7Ngg0 ##....##.# #......# ##.......# ##.####.# #####.#### ##...###.#.# #####.#######..........# 7Ngg` k...........###...#.#.###7Ngg 7Ngg- ,2.9 (267Ngg 7Ngg & _Found a trident.8Ngg38Ngg8Nggj8NggR #..+ #..#...### ###..# #..##'### ### ..#..# #......#.## )##..###..#...#..##.  ###......#####...#....r ##..###...#ß..#... .......#####..#....... #.....####.. .....#### ##............# ##....##.##.# ##'##.##.# # #.######....##.# #......# r   rat (asleep) #.......# ##.####.#.#### ##...###.#.# ####.#######..........#8Nggt 0.0)  A rat comes into view.8Ngg7h.rr8Ngg4==3.9 (18Ngg8Ngg- _The rat squeaks loudly.8Ngg #..+  ## ###.  #.## )... #..##.....  #####...#..... #ß..#.......r. ###..#....... ..........# #.....@.# ##.....## ##...## ##'## # #.  #. 8Ngga ##    8NggUy #..+  ## ###.  #.## )... #..##.....  #####...#..... #ß..#.......r. ###..#....... ..........# #.....@.# ##.....## ##...## ##'# # #. #.  ##8Ngg\z= 8Ngg48Ngg 8NggZ _A rat is nearby!8Ngg #..# #..#ßß.#.  #..+ #..#...### .# ##..# #..##'### ###.# .#..# #......#.## #)...# ##..###..#...#..##.....##......#####...#..... #..###...#ß..#.r.. ......#####..#...............####...... ....#### ##.. .......# ##... .##.##.# ##'## .##.# # #.###### ....##.# #......# .......# ##.####.#.#### ##...###.#.#8Ngg3 8Ngg L.r8Ngg 6--4 _8NggW 8Ngg| 8Ngg_ #..# #..#ßß.#.## #..+ #..#...### .# ..# #..##'### ###.# #..# #......#.## #)...# ..###..#...#..##.....#......#####...#......# ..###...#ß..#.#####..#......r.# ####.## #### ##.....## ##.# # #.###### 8Nggb 8Nggl 8r.8Ngghm A--58Ngg/v 8Nggx 9Ngg####.######..# ..# #..#ßß.#. ..+ #..#...### .# ..# #..##'### ###.# ..# #......#.####)...# ..###..#...#..##.....## #......#####...######...#ß..#...........######..#....@r...........#...#.####..# ##### ##.. .....# ##....##.# ##'## #.# # #.########.# #.....9Ngg}.# .....# ##.####.#9Ngg9Nggߚ.=69Ngg9NggP _The rat barely misses you.9Ngg&7  You slash the rat!9Ngg,1.9Ngg60558.3 (1.49Ngg59Nggk8G _You kill the rat!9Ngg9Ngg9Ngg9NggH _No target in view!9NggUL I9NggEM 9NggO 9NggVP $ _9Ngg8U ,9NggY B9Ngg{Z 9Ngg\ ,9Ngg] 9Ngg` 9Ngga 9Ngga 9NggZf 9Nggg 9Nggj ,9Nggk 9Nggn 9Nggp 9Nggp 9Nggq 9Nggt 9Nggv ,9Nggw 9Nggy 9Ngg{ 9Ngg{ 9Ngg| 9Ngg~ 9NggҀ ,9Ngg 9Nggt 9Nggm ,9NggR 9Ngg^ 9Ngg` 9Ngg 9Ngg 9Ngg 9NggNj 9Ngg 9NggB 9Ngg 9Ngg ,9Ngg` 9Ngg 9NggT 9Ngg| 9Ngg̐ 9Ngg 9NggӒ 9Ngg 9NggA 9NggD 9Ngg 9Ngg/ 9Nggk 9Ngg 9NggM J #..#   ##.## ...   #.### ...   ##...##.# .b  ##......# ..  .....## .#  . .#  #####..# #####.#  9Ngg$ #ßß.#.## #...@.#  - #...### #.#####  ##'### ####.#  ..#.####)...#  #...#..##.....## #####...#......##  b   bat (asleep)ß..#........... ##..#......... ....##.#...#9Ngg̞ $ 9Ngg. 074.3 (16.0)9Ngg? 9Ngg 9Nggê >.bb9Ngg_ F-5.3 (179Ngg 9Ngg V _A bat comes into view.9Nggc  #..#  ##.## ...  #.### ...   ..  ..  .#  b#  #####.#  #...@.#  #.#####  ####.# )...# .## ..## ...## ........# .#...## 9Ngg #..#  ##.## ...  #.### ...   ..  ..  .#  b#  #####.#  #...@.#  #.#####  ####.# )...# .## ..## ...## ........# .#...## 9Ngg 9Ngg9Ngg\9Nggo Z _A bat is nearby!:Nggz#.#### ..# ##...## ##.## .....  .### ...:Ngg{9 ##...  # ...  ##.#  ......# #b#  ####..# #####@#  ßß.#.#.....# :Ngg|G ... #.##### #'### ####.#  ...#.####)...#  ...#..##.....##  ####...#......##  ß..#...........##  #..#............#  :Ngg3-=6.0) _The bat hits you. The bat barely misses you.:Ngg)5  You hit the bat.:Ngg/i.:Ngg?36337.7 (1.4:Ngg7:Ngg:G _You kill the bat!:Ngg:Ngg:Ngg:NggH _No target in view!:Ngg] 3:Ngg$ :NggD :Ngg+ f _:Ngg :Ngg! a4=:Ngg :Ngg :Ngg ,:Ngg :Ngg" :Ngg$ ,:NggO% :Ngg& :Ngg ( :NggG( :Ngg) :Ngg* :Ngg+ :NggX, 9=:Ngg, :Ngg. :Ngg/ :Ngg$0 :Ngg0 :Ngg2 :NggZ4 :Ngg4 :Ngg5 :Ngg 7 :Ngg8 ,:Ngg8 :Ngg : :NggI; ,:Ngg; :Ngg= :NggW> ,:Ngg> :NggB :NggC ,:Ngg5D :NggE :NggE :NggE :Ngg6F :NggG :NggH ,:Ngg"I :NggkJ :NggK ,:NggL :NggM :Ngg1O ,:NggO :NggP :NggR ,:NggR :NggS :NggsT ,:NggT :Ngg_U :Ngg&V ,:NggdV :Ngg\ :Ngg^ ,:Ngg^ :Ngg` :Nggb ,:Nggb :Nggd :Nggf ,:Nggf :Ngg=h :Nggi ,:Nggi :Nggj :Nggjk ,:Nggk :Nggl :Ngglm ,:Nggm :Nggn :Ngg_o ,:Nggo :Nggp :Ngg-q ,:Nggvq :Nggr :Ngggs ,:Nggs :Ngg=u :Nggv :Nggv :NggVw :Nggx :Nggy :Ngg+z :Nggz :Ngg{ :Ngg} :NggH} :Ngg} :Ngg~ :Ngg ,:Ngg :Ngg :NggQ ,:Ngg :Nggk :Ngg ,:NggK :Ngg :Ngg ,:Ngg :Ngg :Ngg ,:Ngg :NggĎ :Ngg6 :Nggr :NggE :Nggђ :Nggݔ ,:Nggȕ :Ngg3 :Ngg̘ ,:Ngg :Ngg :Ngg ,:Ngg5 :Ngg2 :Ngg ,:Ngg= :Nggդ :NggM ,:Ngg :Ngg :Nggݪ :Ngg* :NggT :Ngg :Ngg? ,:Ngg :Ngg :Nggܶ :Ngg+ :Ngg :Ngg :Nggb :Ngg :Ngg :NggP :Ngg :Nggп :Ngg= :Ngg :Ngg :Nggo :Ngg :Ngg" :NggG :Ngg :Ngg :Nggp :Ngg ,:Ngg :Ngg# :Ngg< ,:Ngg :Ngg 7 _You open the door.:Ngg 3:Ngg :Ngg @  There is an open door here.:Ngg :NggO  _:Ngg, :Ngg :Ngg ,:Ngg :Ngg. :Ngg :Ngg@ :NggY :Ngg :Ngg ,:Ngg :Ngg :Ngg :NggD :Ngg :Ngg :Ngg :Ngg :Ngg :Ngg :Ngg ,:Ngg :Ngg :Ngg :Ngg :Ngg :Ngg :Ngg :Ngg' :Ngg :Ngg :Ngg ,:Ngg` :NggU :Ngg ,:Ngg^ :Nggj :Ngg ,:Nggc :Nggj :Ngg ,:Ngga :Ngg :Ngg6 ,:Ngg :Ngg :Ngg6 :Ngg] :Ngg :NggP :Ngg ,:Ngg: :Nggy :Ngg ,:NggA :Ngg  :Ngg ,:Ngg[ :Ngg :Ngg ,:Nggw :Ngg_ :Ngg ,:Ngg9 :Ngg& :Ngg ,:Ngg= :Ngg :Ngg ,:Ngg :Ngg :Ngg ,:Ngg :Ngg :Ngg ,:Ngg :Ngg :NggC :Nggt :Ngg :NggY! :Ngg)" :NggU" :Ngg" :Ngg# :NggE$ :Ngg$ :Ngg$ :Ngg% :Ngg& B:Ngg' :Ngg( :Ngg@( :Nggo( :Ngg) :Ngg* ,:Ngg7+ :Ngg}, :NggO- ,:Ngg/. :Ngg. :Ngg/ ,:Nggq0 :Ngg1 :Ngg1 :Ngg1 :Ngg$2 :Ngg 3 :Ngg3 ,:Ngg3 :Ngg4 :Ngg!5 ,:Nggr5 :Ngg7 ,:NggG7 :Ngg8 L _You now have 22 gold pieces (gained 7).:Ngg9 3:Ngg9 :Ngg+; :Nggr< ,:Ngg< :Ngg0> :Ngg? :Ngg2? :Ngg? :Ngg7A :NggHB ,:NggB :NggZF :NggGG :NggG :NggG :NggJ :Ngg$K ,:Ngg}K :Ngg5M :NggcN ,:NggN :NgguP :NggQ :NggQ :NggR :NggS :NggT :Ngg U :NggU :NggW :NggX :Ngg&Y :NggY :Ngg\ B:Ngg^ X:Ngg#_ :Ngg_ :Nggc` ,:Ngg` :Ngga :Ngghb ,:Nggb :Nggmc :Ngg d ,:NggPd :Nggf :Nggh ,:Nggj :Nggl :Ngg?n :Nggn :Ngg`o :Nggp :Nggr ,:Ngg,t :Nggv :Nggx ,:NggDz :Ngge} :Ngg~ ,:Ngg :Ngg :NggD :Nggy :Ngg :Nggj ,:Nggv :Nggь l _h - 2 ruby potions (gained 1):Ngg΍ 3:Ngg[ :Ngg| :Ngg} ,:Ngg :Nggm :Ngg ,:Nggn :Nggԕ :Ngg :Ngg :Ngg :Ngg^ :NggY ,:Ngg :Ngg' :Ngg ,:Ngg :Ngg :Nggá ,:Ngg :Ngg٢ :Nggd ,:Ngg :Nggv :Ngg :Ngg; :Ngg :Ngg :Nggm ,:Ngg :Nggf :Ngg# ,:Nggf :Ngg :Ngga ,:Ngg :Ngg6 :Ngg ,:Ngg :Ngg :Nggz ,:NggDz :Ngg :Ngg ,:Ngg\ :Ngg7 :Ngg ,:Ngg :Nggݶ :Ngga ,:Ngg :NggP :NggԸ ,:Ngg :Ngg :Ngg  ##   .   ## #.   #...#.###########  .......#.......##-506.7 (129.0) #>).#.#.#.#####... # # #.#.# #..# #.## #.#####..# #..## #.#......# ##...## ##.#.###.## ##.....###........# #.......##........# ##.....###.##.##..#:Ngg :Ngg G-7.7 (130:Ngg :Ngg, J _Found a spear. Found a stone staircase leading down.:Ngg 3:Ngg :Nggg :Ngg :Ngg X:Ngg :Ngg :Ngg :Ngg7 ,:Ngg :Ngg :Nggú ,:Ngg :Ngg] :Ngg ,:Ngg :Ngg :Ngg :NggN :Ngg :Ngg :Ngg :Ngg" :Ngg :Ngg :Ngg@ :Nggl :Ngg( :Ngg :Ngg ,:Ngg :Ngg :Ngg# :NggM :Ngg :Ngg :Ngg :Ngg :Ngg] :Ngg :Ngg ,:Nggp :Ngg :Ngg ,:Ngg :Ngg :NggM :Ngg :Ngg :Ngg_ :Ngg :Ngg :Nggp :Ngg :Ngg% ,:Ngg :Ngg :Ngg ,:Ngg :Ngg5 :Ngg ,:Ngg :Nggx :Ngg ,:Ngg :Ngg[ :Ngg :Ngg :Ngg :Ngg1 :Ngg H ########## #.......#... #.#####.#.....######.#...#.### ............# $....#.####.#>).#.#.# ... ... #.#####.#.# :Ngg # #..g #.......#.####.. #########..####. ##..g   goblin (asleep) #. ##.....# #. #....... ##.....#:Ngg 27.7 (20.0)  A goblin comes into view. It is wielding a +0 dagger.:Ngg j.:NggF ,8.7 (21:Ngg :Ngg I _Found 10 gold pieces. The goblin moves out of view.;NggI;Ngg<;Ngg. #### #.......##.... #.#####.##.....######.#...#.####............##$....#.####.#>).#.#.#.....g #.#####.#.#.##.#..... #......;Nggj.#.### ##...###..## ##.## ##...# g   goblin #.# ##..... #.# # ##.....;Ngg,0.0);Nggj-g.;Ngg +9.7 (1;Ngg;Ngg4;Ngg8   ####   #....   #.....######.#.  #......@.......  #$....#g####.#>)  .........   .##.#.....   # ##...## ##.##  #.#  #.# ;Ngg2   ####   #....   #.....######.#.  #......@.......  #$....#g####.#>)  .........   .##.#.....  # ##...## ;Ngg##.##  #.#  #.# ;Nggt4;Ngg;Ngg] _A goblin is nearby!;Ngg[   ####   #....   #.....######.#.  #......@.......  #$....#g####.#>)  .........   .##.#.....   # ##...## ##.##  #.#  #.# ;Nggk   ####   #....   #.....######.#.  #......@.......  #$....#g####.#>)  .........   .##.#.....  # ##...## ##.##  #.#  #.# ;Nggx;Ngg=;Nggە;Ngg;] _A goblin is nearby!;Ngg8  You hit the goblin.;Nggf);Ngg?41=31.0 (1.3;NggV;Ngg1J _You kill the goblin!;Nggh ;NggW ;Ngg) ;Ngg} H _No target in view!;NggҘ;NggH;Nggr;Ngg;Ngg(;Nggx: _;Nggȥ;Ngg,;Nggc;Ngg;Ngg_,;Ngg;Ngg;NggE,;Ngg;Ngg;Nggq;Ngg;Nggɶ;Ngg;Ngg,;Ngg;Ngg;NggG;Ngg;NggM _You now have 32 gold pieces (gained 10).;Ngg[;Ngg;Ngg;Ngg;Ngg,;Ngg;Ngg;Ngg/;Nggm;Ngg;Ngg;Ngg,;Ngg;Ngg;Ngg;NggV;Ngg;Ngg;Ngg";NggU;Ngg;Ngg;Ngg,;Ngg);Ngg;Ngg,;Ngg=;Ngg;Ngg;Ngg,;Ngg;Ngg;Ngg;Ngg;Ngg;Ngg;Ngg|,;Nggj;Ngg';Ngg7,;Ngg;Ngg;Nggn,;Ngg;Ngg;Ngg;Ngg;NggY;Ngg$;Ngg,;Ngg;Nggq;Ngg[;Ngg;Nggq;Ngg;Ngg_;Ngg;Ngg?;Ngg9 ;Ngg- ;Ngg_ ;Ngg ;Ngg;Ngg;NggB;Ngg;Ngg\;Ngg ,;Ngg;Nggb;Ngg;Ngg;NggR;Nggy;Ngg3 ;Nggo ;Ngg!;NggR+ _You open the door.;Ngg@,,;Ngg-;Ngg.;NggZ0;Ngg0;NggT1;Ngg3;Nggv5,;Ngg5;Ngg6;Ngg8;Nggv9;Ngg:;Ngg<;Nggg=;Ngg=;Ngg->;Ngg?;Ngg,A;NggZA;NggA###...####.....###≈≈#.........## ##......#≈≈##......# ##......≈≈..#####.....≈≈~#-5.9 (4.0=Ngg #.#.##.#....~~..#.#.##.#.#####.##.#.##.#.# #....≈#.#)##.#.~..~~.~#.#.##.#.#........~~..# =Ngg X#......#.#.#........~† ###.####.#.##.....~~.). #...............~~..# =Ngg =Ngg E-6.9 (5=NggX =Ngg ; _Found a stone staircase leading down.=Nggb =Ngg B=Ngg =Ngg =Ngg/ ,=Ngg =Ngg =NggO ,=NggW =Ngg =Ngg@! =Ngg! =Nggr" =Ngg$ =Ngg& ,=Ngg' =Ngg3, =Ngg- =Ngg. =Ngg. =Ngg2 R  There is a stone staircase leading down here.=Ngg2 =Ngg3  _=Ngg?4 =Ngg5 =Ngg6 =Ngg6 =Ngg-7 =Ngg8 =Ngg9 =Ngg9 =Ngg(: =Ngge; =Nggs< =Ngg = =Ngg= =Ngg? =Ngg]@ =Ngg@ =Ngg(A =NggB =NggC =NggD =NggD =Ngg/K =NggOL =NggL =NggCM =NggO =NggP ,=NggQ =NggN^ =Ngg` B=Nggu =NggPw ,=Nggw =Ngg_z =Ngg| ,=Ngg} =Ngg_ =Ngg =Nggl =Nggq =Ngg =Ngg X=Ngg^ =Ngg =Ngg =Ngg7 =Ngg+ ,=Ngg0 =Ngg =Ngg, =Nggv =NggB =Ngg =Ngg^ =Ngg =NggP =Nggɩ =Nggj ,=Ngg =Nggܮ =Ngg =Ngg+ =Ngg =Ngg =Ngg =Ngg =NggQ =NggD X=Ngg =Ngg* =Nggr =Nggξ =NggR =Ngg =Ngg =Ngg~ =Ngg% =Ngg =Ngg6 =Ngg =Ngg =Ngg ,=NggN =NggL =NggU ,=Ngg =Ngg =NggJ =Ngg =Ngg =Ngg =Ngg) =Ngg` =Ngg =Ngg@ =Ngg} ,=Ngg =Ngg =Ngg/ ,=Nggx =Ngg =Ngg =Ngg =Ngg) =Ngg =Ngg =Ngg =Ngg =Ngg =Nggv =Ngg =Ngg=Ngg=Ngg=Ngg =Ngg:=Ngg=Ngg =Ngg =Ngg =Ngg8 =Ngg=Ngg=Ngg=Nggl=Ngg=Ngg=Ngg=Ngg=NggX=Ngg=Nggj=NggO=Ngg=Ngg%=Ngg=Ngg=Ngg,=Ngg=Ngg!=Ngg",=Ngg=#=NggU$=Ngg(%=Nggb%=Ngg%=Ngg&=Ngg'=Ngg'=Ngg"(=Ngg')=Ngg*B=Ngg,=Ngg,=Ngg,=Ngg#-=Ngg.=NggD0,=Ngg0=Ngg3=Nggo3,=Ngg3=Ngg5=Ngg7,=Ngg7=NggB9=Ngg::=Ngg:=Ngg:=Nggq<=Ngg=,=Ngg>=Ngg?=Ngg@=Ngg@=Ngg@A=NggB=NggC,=NggYD=NggrE=Ngg%K=NggL=NggN=NggN=NggN=Ngg5Q=NggR=Ngg$S=NggS=NggU=NggW=NggW=NggX=Ngg&[=Nggc #.# #..#  #.# ####..#####  #.# #..........   ###.###......#  =Nggc #.......#...##   #.#.........####   #.########.......   ###.# #.#####.   #.@.# ##'##  =Nggc" #.### ##...## #   #. .###.  =Ngg*d  .. #.......##.   ..g #.........#  =Ngged) .... +.(.......'. g   goblin (asleep)  #.... .##=Nggd  #.... ..≈# =Nggd[ ##.≈≈..#≈#=Nggo 668.9 (72.0)  A goblin comes into view. It is wielding a +0 club.=Nggu0 .=Ngg*v  The goblin shouts!=Nggv6===9.9 (73=Ngg|=Nggw3 _The goblin moves out of view.>Ngg43>NggX>Ngg >Ngg&'c  #.# #..#  #.# ####..  #.# #  ###.###...... >Ngg' #.......#...##  #.#.####  #.##  ###.# #.#####  #@..# ##'## >Ngg( #.### ##...## #  #.# ##.....###  ..g #.##  .... #>Ngg(.  ...... +.(.' g   goblin  #...... #.  #....... ##.≈#  >Ngg(O ##.≈≈..#≈#>NggJ,,0.0)>Ngg4-g.>NggK56---70.9 (1>NggZ;>Ngg>>Ngg #.# #..#  #.#  #.#    #.# ###.#  #@..# ##'##  #.###   #g#  ...  ....  ...... +.( #......  #....... >Ngg=F#.# #..# #.# #.#      #.# ###.#  #@..# ##'##  #.###   #g#  ...  ....  ...... +.( #......  #....... >Ngg>Ngg:--->Ngg>Ngg] _A goblin is nearby!>Nggp #.# #..#  #.#  #.#   >Ngg #.# ###.#  #@..# ##'##  #.###   #g#  ...  ....  ...... +.( >NggG#......  #....... >Nggs>Ngg#.# #..# #.# #.#      #.# ###.#  #@..# ##'##  #.###   #g#  ...  ....  ...... +.( #......  #.......  ####..####.........###.#####.......#...## #.........####.########......###.# #.#####..##'## ### ##...## #g# ##.....##............... #......... +.('#........ #..#>Nggw[40m#........###≈#.# ##.≈≈..# ##.~≈.#~≈ _A goblin is nearby!0----=1>Ngg>Nggn9 _The goblin hits you with a +0 club.>Ngg  You hit the goblin.  The goblin is heavily wounded.>Ngg -3.3 (1.4>Ngg >Ngg t _The goblin misses you. The goblin hits you but does no damage.>Ngg?O  You completely miss the goblin.The goblin is heavily wounded.>Ngg P j19-----4.6 (1.3>Ngg-V >NggX 9 _The goblin hits you with a +0 club.>Nggk:  You slash the goblin!>Ngg>f)>NggԿ`20=545.9>Ngg>NggJ _You kill the goblin!?Ngg5?Ngg?NggQ ?Ngg2 H _No target in view!?Ngg3?Ngg?Ngg?Ngg!?NggX"$ _?Nggt'?Ngg(?Ngg)?Ngg:*h1==?Ngg*?Nggc,?Ngg,?Ngg=-?Ngg5?Ngg{6?Ngg8?Ngg:?Ngg3;?Ngg!<?Nggh>?Ngg??Ngg?=?Ngg @?Ngg@?NggB?NggC?Ngg&D2?NggD=?NggE?Ngg.F?NggH?NggzI?NggCJ?NggK?Ngg9L?NggM?NggDN?NggN?NggS?NggU?NggV?NggW3?NggkW/==?NggW?NggX?NggY?NggtZ?Nggo[?Ngg\?Ngg2]?Ngg]?Ngg3_?Ngg_?Ngg`?Ngga?NggRb?Nggb4?Nggb/==?Nggb?Nggc?Ngge?Nggg?Nggyh?NggRi?Nggl ?Nggl  ?Ngg2mThings that are here:  ?Ngg_m$a +0 club; a goblin corpse?Nggm?NggBo?Ngg4p ?Ngg{p_?Nggq?Nggv?Ngg%x?Nggx?Nggy?NggM|?Ngg ~?Ngg~?Ngg~=?Ngg?Ngg?Ngg݁?Ngg?NggR?Ngg?Ngg?Ngg?Ngg?Nggי?Ngg0?Ngg,?Ngg+?Nggn?Ngg̣?Ngg?Ngg=?NggR?Ngg,?Ngg?Ngg!?Nggh?Nggx _j - 2 throwing nets?NggB?Ngg?Ngg4?Ngg?NggѴ,?Ngg?Ngg׶?Ngg,?Ngg?Nggg?Nggֻ?Ngg?Ngg?Ngg?NggS,?Ngg?Ngg?Nggz?Ngg?Ngg?Ngg\?Ngg?Ngg?Ngg?Nggm?Ngg,?NggB?Ngg?Ngg,?Nggt?Ngg?Nggi,?Ngg+?Ngg?Ngg,?Ngg+?Ngg?NggG,?Ngg$?Ngg?Nggd?Ngg?NggK?Ngg?Ngg,?Ngg?Ngg?Ngg?Ngg?Ngg?Ngg?Ngg,?NggB?NgghB?Ngg:n?Nggkn?Ngg,?Ngg?Nggc?Ngg?Ngg(?Ngg]?NggF ?Ngg ?Ngg ?NggM?Ngg?Ngg?Ngg?Ngg?Ngg?Ngg,?Ngg?Ngg?Ngg?Ngg?Ngg?Nggm(#........##.........####...## #........###.......≈# ##..# # ?Ngg($#........# ##.≈≈..#≈# ##.# #.......## ##.~≈.#~≈ #.# # #.......# #.#+~≈.#..≈~ ..# ?Ngg(######.## ##..### #≈≈##..# # #.# ##.###≈≈≈# ##.# ?Ngg) #.#######..#≈≈≈# #.# # #.......≈..@####### #.# -?Nggo) #######.≈≈........# #.#  #.≈...#.###.# ?Ngg) #.#..#.#..  ?Ngg)#.#.###.###?Ngg)h #.......# ?Ngg)###.##### #... ?Ngg)0#####?Ngg.1727.9 (52.0)?Ngg~/F-8.9 (53?Ngg3?Nggq5W _k - a lumpy ruby potion?Ngg?NggG3?NggT ?Ngg ?Ngg ?Nggsn?Ngg-?Ngg?Ngg:?Ngg?Nggn?Ngg|?Ngg?Ngg?Ngg_?NggU?Ngg?Ngg?Ngg?Ngg?NggE?Ngg?Ngg+?Ngg?Ngg?Ngg?Nggz?Ngg7?Nggb?Ngg?Ngg~?Ngg- ?Ngg ?Ngg ?Ngg!?Ngg"?Ngg#?NggE#?Ngg%?Nggd&?Ngg&?Ngg'?Ngg (?Ngg ),?Ngg)?Ngg]*?Ngg3+?Nggr+?Ngg+?Ngg,?Ngg-?Ngg-?Ngg.?Ngg7/?Ngg%0,?Ngg0?Ngg1?Ngg2?Ngg2?Ngg 3?Ngg84?Ngg!5?Ngga5?Ngg5?Ngg8X?Nggk9?NggT:?Ngg:?Ngg:?Ngg;?Ngg<,?NggQ=?Nggs??NggG..####...######|###..###. +.(.'..................... #..####...######.##....... ##.≈# ##..# #.........  ##.≈≈..#≈## ##.# #†......##  ##.~≈.#~≈≈b###.# #.##.......?NggH#.#+~≈.#..≈~...# #.##.##.##.##..### #≈≈##..# #.##.##.# ##.###≈≈≈# ##@# #.##....##. ####..#≈≈≈# #.# #.##....... ...≈...####### #.# #.#####.## ?NggHx##.≈≈........# #.# #>#####.###.≈...#.###.###.# #..........#.#..#.#........# ######....# b   bat (asleep)  #.#.###.###.##### #.##.##.......# #.# #.....###.#######.# ######?NggaL-48.9 (20?NggM?Ngg5N?NggS?.bb?NggZT,9.9 (21?NggY?Ngg[V _A bat comes into view.?Ngg |(.....# ##..#  ## ##.# #†  .###.#  ~...#   #≈≈##b.#    ##@#  #.# ?Ngg . #.# . #.# #>  .#.#  ........#  .#####   #.#  .# ?Ngg[ |(.....# ##..#  ## ##.# #†  .###.#  ~...#   #≈≈##b.#    ##@#  #.# . #.# . #.# #>  .#.#  ?Ngg` L........#  .#####   #.#  .# ?Ngg~c ?Nggc ?Nggi ?Ngg"l Z _A bat is nearby!?Ngg ^ |(.....# ##..#  ## ##.# #†  .###.#  ~...#   #≈≈##b.#    ##@#  #.# . #.# . #.# #>  .#.#  ........#  .#####  ?Ngg^ L #.#  .# ?Ngg K|(.....# ##..#  ## ##.# #†  .###.#  ~...#   #≈≈##b.#    ##@#  #.# . #.# . #.# #>  .#.#  ........#  .#####  ?Nggy #.#  .# ?Ngg7 4?Nggp?NggtZ _A bat is nearby!?Ngg  You hit the bat.  The bat is heavily wounded.?Ngg?NggP.b ?NggD:=51.2 (1.3)?Ngg?Ngg ?Ngg^_The bat barely misses you. You block the bat's attack.@Ngg  You hit the bat.  The bat is severely wounded.@Ngg{@Nggk@NggPb. @Ngg(2.5@Ngg@Ngg: _The bat hits you but does no damage.@NggTv  You barely miss the bat.The bat is severely wounded.@Ngg;w@Nggx@Ngg+b.@NggV(3.8@Ngg@NggՊ: _The bat hits you but does no damage.@Ngg} #.......# #.# ###.. ##..####...######|###..## .+.(.'................####...######.##...... ###.......≈# ##..# #... # ##.≈≈..#≈## ##.# #†......## # ##.~≈.#~≈≈.###.# #.##..... #.#+~≈.#..≈~b..# #.##.##.##.### #≈≈##@.# #.##.##.# @Ngg:~ ##.###≈≈≈# ##.# #.##....## #####..#≈≈≈# #.# #.##...... ....≈...####### #.# #.#####. ###.≈≈........# #.# #>#####.## #.≈...#.###.###.# #......... #.#..#.#........# ######.... #.#.###.###.##### #.## #.......# #.# #....@NggE@Ngg2%!b.@Ngg%,40@Ngg,@Ngg/ @NggG/C_The bat closely misses you.@Ngg8 x# ###.####..# #.####..# .# #.......# #.# ###.. .##..####...######|###..## ..+.(.'.............. ...####...######.## .###.......≈# ##..# #.. .# ##.≈≈..#≈## ##.# #†......# ## ##.~≈.#~≈≈.###.# #.##..... @Ngg9 ## #.#+~≈.#..≈b@..# #.##.##.# #.#####≈≈##..# #.##.##. ##.###≈≈≈# ##.# #.##....# ######..#≈≈≈# #.# #.##..... .....≈...####### #.# #.#####. ####.≈≈........# #.# #>#####.# #.≈...#.###.###.# #.... #.#..#.#........# ######.. #.#.###.###.##### #.##@NggB @Ngg~C &5@Ngg,ANgg>ANgg?ANgg@,ANgg?AANggCANggD,ANggEANggFANggtGANggGANggHANggIANggJ,ANgg!KANggLANggL,ANggVMANggGPANggER,ANggySANggW>  You see here a +0 dagger.ANggXANggX _ANggYANgg`ANggaANggbANggcANggeANggIgBANgghANggiANggiANggjANggmANggo,ANggpANggtANgg_v,ANggwANgg]yANgg{,ANgg|ANgg~ANgg,ANggANgg*ANgg,ANggANggiANgg!ANgg`ANggANgg1ANggn,ANggfANgg̒ANggo,ANggϕANggANggANgg'ANggANggoANgg^,ANggANggANgg,ANggӣANggnANggg,ANgg,ANgg,ANggANggvANgg]ANggANggANggANgg,ANggKANgg<ANggf,ANggSANgg]ANgg,ANgg:ANggANggQ,ANgg;ANggANggIANgg~ANggWANggANggzANggANggANgg7ANggANgg`ANggANggANggANggANgg/ANggANgg"ANggGANggANggANggW,ANggANggANgg,ANggANggYANggANggANggANggbANgg],ANggANggANggxANggANggANggANggANggANggANggOANggANggANggANggMANgg",ANggANggANgg,ANggANggANggv,ANggANgg ANgg ANgg ANgg ANgg 7 _You open the door.ANgg 9##.###.## ##.#####. ####...##.# .# #############  #...............## # #...............# ....# #######.######..# .##.# #..#.#..#ßß.#.## ....# #..@.#..#...### -826.0 (66.2)#..# ######..#.#..##'### ###..# #....#..#_#......#.####).ANgg ..# #.####..###..#...#..##..# #.# ###......#####...#... ...######|###..###...#ß..#....... ..................#####..# ...######.##..................## #..# #.........####.......###.ANgg ANgg F-7.0 (67ANggj ANgg  _Found a faded altar of an unknown god. _There is an open door here.ANgg IANggu ANgg2 ANgg[ : _ANggy ANgg ANgg@ ANgg ANgg ANgg/ ,ANggE ANgg ANggv ,ANgg ANgg ANgg ,ANggA ANgg ANgg ,ANggT ANggN ANgg ,ANgg ANggH ANgg2 ANggk ANgg ANgg ANgg ANgg- ANgg ANggC ANgg ,ANggb ANgg- ANgg8 ANggk ANgg ANgg^ ANgg ,ANggF ANgg ANggt ,ANgg ANgg ANgg ,ANgg ANggn ANgg  ANggD ANgg, ANggp ANgg ANgg. ANgg8 ANgg  ANgg@ ANgg ANgg ,ANgg ANgg, ANggr ANgg ANgg" ANggD" ANgg" ANgg% ANgg& ,ANgg' ANgg* ANgg+ ANgg, ANggV, ANgg0 ANgg1 ,ANggv1 ANgg4 ANgg5 ANgg6 ANgg6 ANgg9 ANgg: ,ANgg; ANgg> ANgg? ,ANgg9@ ANgg-C ANggC ANgg/D ANggD ANgg:G ANggOH ANggH ANggH ANggnK ANggqL ,ANggCM ANggtO ANggnP ANggP ANggP ANgggS ANgg;T ANggT ANggT ANggpW ANggxX ANggX ANggY ANggr] BANgg_ ANgg_ ANggca ANgga ANggzb ANggd ANgge ANgge ANgg:f ANggh ANggi ,ANggNj ANggl ANggm ,ANggOn ANggp ANggq ,ANggq ANgg4s ANgg7t ,ANggt ANgg)v ANggw ,ANggw ANggy ANggz ,ANgg{ ANgg@} ANggZ~ ,ANgg~ ANgg ANgg ,ANgg ANgg ANggs ,ANgg ANgg ANgg ,ANgg ANgg XANggs ANggَ ,ANgg ANgg ANgg) ANgg ANgg ANgg ANgg ,ANgg ANgg ANgg ANgg ANggg ANgg1 ANgg ,ANggX ANgg؟ ANgg ANggh ANgg ANgge ANgg ,ANggD ANgg ANgg ,ANggR ANgg ANgg ,ANgg1 ANgg9 ANgg< ,ANgg ANgg? ANggH ,ANggղ ANgg ANgg ,ANgg ANgg2 ANgg ANggp ANgg ANggy ANgg ,ANggc ANgg ANgg" ANggr ANgg ANgg ANgg ,ANgg ANgg ANgg( ANgg ANgg ANgg ANgg ,ANgg* ANgg a  You see here a rat skeleton.ANgg5 ANgg  _ANggT ANgg ANgg ANgge ANgg ANggw ANgg[ BANgg ANgg ,ANgg ANgg_ ANgg' ANgg ,ANggC ANgg ,ANgg ANgg ANgg ANgg ANggb ANgg ANgg ,ANgg+ ANgg ANggu ANgg ANggb ANgg4 ANggz ANgg ANgg ANgg ANgg ANgg ANggW ANgg ANgg ANggp ANggN ANggr ,ANgg ANgg ANgg@ ,ANgg ANgg ANgg ,ANggj ANgg ANgg. ANggq ANgg^ ANggQ ANgg ,ANgg ANgg< ANgg ,ANgg ANggQ ANgg ,ANgg ANgg ANggq" ,ANgg|# ANgg$ ANggL& ,ANgg`' ANgg( ANgg) ANggM* ANgg*+ ANgg, ANgg(. ,ANgg"/ ANgg2 B  You see here a +0 chain mail.ANgg4 ANgg5  _ANggh6 ANgg8 ANgg9 ,ANgg: ANggu< ANgg= ,ANgg> ANgg#@ ANgguA ,ANggyB ANggD ANggF ,ANggG ANggH ANgg5J ANggJ ANggEK ANggM ANggN ,ANggO ANggQ ANggFT BANggdg ANggj ,ANggo ANgg>s ANgg4u ANgg~u ANggv ANgg^} ANgg~ ANgg! ANgg ANggd ANgg$ ANggr ANggA ANgg\ ANgg ,ANggÑ ANgg ANgg ANggE ANggݙ ANggǟ ANgg ANgg^ ANgg7 ANggb ANggة ANgg/ ANgg? ANgg ANgg: ANggu ANgg` ANgg ANggG ANgg ANggt ANggD ANgg ANgg' ANgg ANgg ANgg ,ANggj ANgg ANgg ANggO ANgg ANgg ANgg ANggK ANggA ANggW ANggW ANgg ANgg ANgg ANggH ANgg ANgg ANgg ANgg ANgg6 ANggr ANgg ANgg ANggg ANgg ANggw ANgg ,ANgg& ANgg ANgg% ANgg[ ANgg ANgg3 ANgg ANgg5 ANgg ANgg ANgg ,ANgg ANgg ANggT ,ANgg ANgg ANgg ANggc ANgg ANgg ANgg ,ANgg1 ANgg ANgg- ANggp ANgg ANgg ANggd ,ANgg4! ANgg\$ ANgg% ,ANggS& ANgg( ANggK* ,ANgg* ANgg;- ANggu. ,ANgg/ ANgg1 ANgg2 ,ANgg{3 ANgg|5 ANgg6 ANgg6 ANgg_7 ANgg9 ANgg9= ,ANgg>> ANggQA ANggPCNggSCNgg\WCNggZCNgg8[CNgg9]CNggu`CNggDcCNggdCNggeCNgggCNggjCNggkCNgg nCNggpCNggosCNgg-tCNgguCNggwCNgg$zCNggzCNgg#|CNggK~CNgg{CNgg+CNggCNggCNggφCNggrCNggCNggG CNggӋ CNgg14There is a stone staircase leading down here.CNggCNggCNgg CNggG_CNggzCNgg2CNggCNgg9  You climb downwards.CNggCNggCNgg[  _The goblin shouts! x2; You hear a loud squeak. x4  Found an escape hatch in the ceiling.  There is a stone staircase leading up here.CNgg CNgg .# ###..##  ..#####..... .  .....##.#  ......  ......#  #......^.<.##.# ...g.....g..... #@# ====1008.4 (27.0) #.#  ..#  .#.# .##.# .. #.# gg 2 goblins .. .. #. ... CNgg!CNggCNgg/d _There are monsters nearby!CNggS _ ..# .# ###..## #..#####..... ...##.#...#.....# #......^.<.##.##...g....@g.........#.#<##.##>###.# #.#.###.# #.#.. ..##. ...CNgg% CNggf J  Found a stone staircase leading down.CNgg CNgg .grrrr 2 ratsA rat comes into view. x2CNgg#)1---==--9.4 (1.0)CNgg_3CNgg7; _The goblin hits you with a +0 dagger.DNgg8  You hit the goblin.DNggDNggDNgg!  The goblin is moderately wounded.A kobold comes into view. It is wielding a +0 whip.DNgg,&K.gr.K   kobold (wandering)rr 2 ratsDNgg-X---10.8 (1.4DNgg;7DNggG== _The goblin hits you but does no damage.DNggrT  The kobold shouts!  You slash the goblin!DNggko  You kill the goblin!DNggnDNgg#DNgg<DNgg|DNgg.KS.g.@)..   goblinS   ball python (constriction, wandering)K   koboldDNgg̢>70=2.1 (1.3DNgg^DNgg^ _A ball python comes into view.DNgg ..# .# ###K.## # ..#####..... .. .##.# .. #.# #.S....^.<.##.## ......g@.).......#.#<##.##>##. .. #.# #..# ..#.. .#.#. .##.# .. #.# .. ..#  #. ...DNgg"DNgg#DNgg3&DNgg/.K.SrS)r   ratDNgg%0n2=---30DNgg6DNgg:4 _You block the goblin's attack.DNgg..#.# ###..## #.#####.K... ...........##.# ....## S...^.<.##.##......g..)..........#.#@##.##>##. .. #.# # DNggS ..# r.# .. r#. .# .. .. .#. ... rr 2 ratsDNggDNggDNgg&DNggDNggJo.K.Sr..   rat3==-4DNggr DNgg _You block the goblin's attack. _There is a stone staircase leading up here.ENgg*ENgg#ENggXENgg[  You completely miss the goblin. You block the rat's attack.ENggENggENgg .K.Srr 2 ratsThe goblin misses you. The rat bites you but does no damage.ENgg-5.5 (1.4ENggENgg= _The goblin hits you but does no damage.ENggs:  You slash the goblin!ENggZENggENgg^Y  You kill the goblin!ENgg" @.K.S@   Sigmund (polearm, wandering)Sigmund the Dreaded comes into view. He is wielding a +0 scythe.You block the rat's attack. The ball python bites you.ENgg 2-96.8 (1.3 _The ball python completely misses you.ENggENggh _Your Shields skill increases to level 4!ENgg @@)Sigmund shouts!  You hit the rat but do no damage.ENgg ******Sigmund casts a spell at you.ENggQ ENgg_ ....^.KThe magic dart hits you. The rat barely misses you.ENggK` l19----=8.1ENggg ENggHl _The ball python closely misses you. The ball python barely misses you.ENgg  You closely miss the rat. The ball python closely misses you.ENgg  The ball python grabs you. The ball python constricts you.ENgg-  You block the kobold's attack. The rat bites you but does no damage.  A goblin comes into view. It is wielding a +0 dagger.ENgg  The ball python bites you. The ball python constricts you.ENgg+ .@The kobold hits you with a +0 whip. The rat bites you but does no damage.ENgg, 14---------2 -ENggW, I9.5 (1.4Constr ENgg4 ENgg8 2-ENggD /  --more--FNgg4 _The goblin moves out of view.FNgg FNgg 0 7 FNgg FNggؠ FNgg .@You escape the ball python's grasp. You block the rat's attack.FNgg s2-------200FNgg۸ FNgg U #.###...#### #.#  #.......######.#  ###..............#  #.......#######... FNgg  #.###.#.# ##....  #.# #...# ##....#  #.###...####.....#  #K##.......'.....#1  #@###...####.....#  #Sr.....## ##.....  ###......# ##....  #.#.##.######...  #.#.##.#........  #.#.##.#.#####.. S   ball python (constriction)  #.#.##.#.# #.. K   kobold  #.#)##.#.#####.~ r   rat #.#.##.#.#...... _The kobold hits you with a +0 whip.  You climb upwards.FNgg‡ 9--FNgg FNggj k3=-2.0 (2.5FNgg FNgge _Level annotation: 1 transporter _There is a stone staircase leading down here.GNggGNgg#8-GNggcGNgg#F _Unknown command.GNgg _Unknown command.  You hit the kobold.  The kobold is moderately wounded.  The ball python bites you but does no damage.  The ball python closely misses you. The kobold closely misses you.  The rat barely misses you. The ball python barely misses you.GNgg2--2 =3.4 (1.4Constr GNggGNggz _The ball python grabs you. The ball python constricts you.GNgg4GNggGNgg GNggP_You are too injured to fight recklessly!GNggB =  You hit the ball python.GNgg J : .K   koboldr   rat  You kill the ball python!GNggL C 7 834.8GNggCS GNggU _The rat misses you. The kobold closely misses you.GNgg x...####.............#######...###.#.# ##. #...# ##....###...####.K##.......'>###...####r.....## ##.....##......# ## #.#.##.######.#.##.#.....#.##.#.##### GNggg Y)####.~............#.#.#GNggJ GNggZ F.KGNggo b3=50GNgg GNgg1 ; _The rat bites you but does no damage.HNgge  You closely miss the kobold.The kobold is moderately wounded.The rat closely misses you. The kobold hits you but does no damage.HNgge-7.1 (1.3HNggkHNgg!ny _The rat bites you but does no damage. The kobold barely misses you.HNggS:  You slash the kobold!HNggjk >r   rat  You kill the kobold!918.4 _The rat bites you but does no damage.HNggHNgg-9.8 (1.4HNggHNgg# _You barely miss the rat. The rat barely misses you.HNgg  You closely miss the rat. The rat closely misses you.HNggk" o4==31.1 (1.3HNggZ( HNgg* ; _The rat bites you but does no damage.HNgg HNgg+ (2.4HNgg HNgg _You hit the rat but do no damage. The rat closely misses you.HNggHNggH(3.7HNggYHNgg _You barely miss the rat. The rat closely misses you.INgg  You barely miss the rat. The rat bites you but does no damage.INgg~i5==5.0INggOINgg P _The rat barely misses you.INggbINggpc(6.3INggiINggIlt _You barely miss the rat. The rat bites you but does no damage.INggINgge(7.6INggoINggk _You closely miss the rat. You block the rat's attack.INgg INgg _3--8.9INgg INgg& _You hit the rat but do no damage. The rat bites you. The rat barely misses you.INggfm (  You hit the rat..540.2 _You kill the rat!INgg5 #.######.#  ###.# #.......#...# #.###.#.# ##. #.# #...# ##....# #.###...####.....#≈ #.##.......'.....#≈ #>###...####.....# #.@.....## ##. ###......# ##. #.#.##.######. #.#.##.#. #.#.##.#.#####. #.#.##.#.# #. #.#)##.#.#####.~. #.#.##.#.#. #......#.#.#.INgg*INgg4-10INggGINgg JNgg{ #.######.#  ###.##  #.......#...# #.###.#.# ##.....# #.# #...# ##....# #.###...####.....#≈# #.##.......'.....#≈JNggL #>###...####.....# #..@....## ##......# ###......# ##. #.#.##.######. #.#.##.#. #.#.##.#.#####. #.#.##.#.# #. JNgg#.#)##.#.#####.~. #.#.##.#.#. #......#.#.#.JNggJNggu@-2JNggHJNggJNggA4=-JNgg9BJNgg~JNggܗJNgg)^5==JNggJNggF,JNggJNgg,JNggJNgg-,JNgg5JNggJNgg^6==JNgg7JNggԩ,JNggJNgge,JNgg[JNgg,JNgg2JNggJNgg^7==JNggJNggJNgg״JNggӵJNgg,JNgglJNgg,JNgg<JNggJNggjk18==JNggPJNggT,JNggJNgg),JNgg*JNgg,JNggJNggJNggh9==JNgg(JNgg,JNgg@JNgg,JNggJNgg,JNggJNggqJNgg9=JNggJNggZb20=JNggJNggi,JNggJNgg,JNggJNgg,JNggbJNgg~1==JNggJNggT,JNggqJNggt,JNggJNggJNggJNggJNggJNggh2==JNggJNggJNgg JNggJNgg,JNggJNggnJNggJNggJNggZ~3==JNggJNgg\JNgg~JNggzJNggJNggJNgg<JNgg,JNgg JNggc_ _You start resting.JNgg083.2 (41.0)JNggPw4==4.2 (42JNggjJNgg" _HP restored.JNgg JNgg Level 1 of the Dungeon<>>>_(Press ? for help)#.###...##.##...###########..## #.#......# ##...## #.........##.# #......###.####...## ##.#.###.## ##.## #####[######.###...#### #.###.....###........# #.###.##.......######.##.......##........# #.##..####..............####.....###.##.##..# ##'###.###.......#######...####...####.##.##..# ##...## #.#JNgg #.###.#.# ##.....# #####.####.....#.#.####.....## #.##.# #...# ##....### ##.###.# #..#...##.#.##.......## ##.###.###...####.....#≈######...##.###.###..###<#..........####...###.##.......'.....#≈≈≈##..............##©##©#.#.........+.......##>###...####.....###≈≈#.....######.#..#####.#..........####...###..@....## ##......#≈≈#.##.##### #.#...#####.##.......## #.....#####......# ##......≈≈..#### #≈###......##.##.##.....## #......#JNggE #.#.##.######.....≈≈~## ##≈##.......##..#####...## #......##.#.##.#..........~~..#####.~.#.#.....##...## ##'## ##...#.##.#.##.#.#####....~~..#.....~...###.)..#....# #.######.##.#.##.#.# #....≈~..#.###[~.### #...#####.## #.# ####### #.##.#)##.#.#####.~..~~.~#.# ##≈## ##.######..###.###.....# #.##.#.##.#.#........~~..#.# #≈# #...)....#.#...##.....# #.##......#.#.#........~÷#.# #≈# #########.............# #.####.####.#.##.....~~.)..# #######...###....####.##...............~~..#####.##≈#...÷.....#############..~~~≈..##.##≈#...#######JNgg G@.KNgg5..KNgg5..KNgg5..KNggڴ5.#KNgg5##KNggs5# KNgg+ 9 #KNgg 5##KNgg# 5#.KNgg 5..KNggR A..KNgg A..LNggJD..LNggw+D..LNggC..LNgged C#.LNggk C #LNggR 9  LNgg] #.......##.#.....##.......#.## #.#####..# #.....####.###.###.#LNgg +  LNggO #.####..........###.#####.#.# #.# #..####.............# #.# LNgg)Q  LNggF #......#.....#)####.#>).#.#.# #.#####.........#####.#######.##LNgg  LNgg % LNggr ########....................# #.......######### #.........#.#LNgg7 #.....######.#...#.### #####################.MNggL #.....# #.#####.#>#MNgg(} ####### #.......#.>MNgg7 :.>MNggb MNggz  #.......######.#deadiverson the Shield-Bearer  ###..............## Human #.......#######...## Health: 24/24 ======================== #.###.#.# ##.....# Magic: 2/2======================== #.# #...# ##....### AC: 6Str: 16 #.###...####.....#≈# EV: 7Int: 8 #.##.......'.....#≈≈ SH: 4Dex: 12MNgg{  MNggĆ #>###...####.....### XL:  2 Next: 95% Place: Dungeon:1 #..@....## ##......# Noise: ---------  Time: 1084.2 (0.0) ###......# ##...... a) +0 long sword #.#.##.######..... Throw: 3 darts (poison) #.#.##.#.......... #.#.##.#.#####.... #.#.##.#.# #....  #.#)##.#.#####.~..  #.#.##.#.#........  #......#.#.#......  _You closely miss the rat. You block the rat's attack. _You hit the rat but do no damage. The rat bites you. The rat barely misses you.You hit theMNgg rat. _You kill the rat! _You start resting. _HP restored.MNgg~ MNggڏ MNggA MNggH MNgg˕ MNggQ ,MNgg ,MNgg ,MNgg MNggE MNgg ,MNgg MNgg MNggt MNgg JMNgg MNgg MNggF ,MNgg MNgg MNgg MNgg: MNggG MNgg MNgg MNgg# ,MNgg( MNgg* MNggH* MNgg0 nMNgg*B nMNggcG ,MNgg@J MNggtL MNggb MNgg>f ,MNggi MNggUj ,MNggAq MNggi MNggo MNgg BMNgg MNgg BMNgg6 XMNgg-  #########  ####### #.......#  #.....# #.#####.#  #.....######.#...#.### #### ###....................# #... ..#.....#)####.#@).#.#.# #.#109.2 (25.0) #..........###.#####.#.# #.# ...##.#.....##.......#.## #.## ...##.##...###########..## #.# ......###.## ##...## ##.# ...#### #.# ##.....## ...######.# #.......##.. ..........## ##.....###.## .#######...## ##...####.##hit the rat but do no damage. The rat bites you. The rat barely misses you. You hit the rat. _You kill thMNggF e rat!You start resting.HP restored. _There is a stone staircase leading down here.NNgg4~NNgg~NNggNNgg.NNgg910.2 (1.0) _NNgg“NNgg#F  .......@.......  #...........# #......^.<.##.## ......)K.)...... ....#.#<##.##>## ..... #r# # :..#...r#  ##.# 2 #@.# .##.#  #..## .. #.#  #..## .. ..# NNgg7GH ...# #. ... #.## #. . .  You climb downwards.NNggHNNgg=QNNgg-1.0 (1.8NNgg NNgg _Level annotation: SigmundFound a book of Vapours. _There is a stone staircase leading up here.ONggd....##.# ##......#.....# #.#^.<.##.## .......)r.)...... .....#.#<##.##>###......#.# #:..#....# ##@.....#.# ONggd<.#...##.# ...#.# #..## ......#...# #. ....#.##..r   rat #..ONgghONgg'kONggwK@r.@   Sigmund (polearm)r   ratONggx320 _ONgg݂ONgg[ONgg #####..... .. ....##.###.@.........#.....# ##.#......^.<.##.##........r..)...........#.#<##.##>##......#.# # #@..#...##...... #<.#...# #..##....#. #..## ......# ...# #..#....#.##....#.....  .ONgg ONggg ONggۤ .@r)r   rat3ONgg ONgg U _You see here a book of Vapours.ONggaL W  You pick up a book of Vapours and begin reading...ONggN ONggY d@.r.ONgg [ &4ONggrd ONggh \ _You add the spells Mercury Vapours and Freezing Cloud to your library.PNggy/.........##.# ##......#....@# ##.#......^.<.##.## ......r.)..)......PNggz\ .....#.#<##.##>###......#.# # #....# ##@.....##<.#...##..##....#..## .........# #..#....#.## .... #. .....PNggPNggiPNggPNggL.@.rPNgg&5PNgg}PNgg^ _Sigmund laughs darkly.PNgg_##..... ..## ##.#^.<.##.## .....@..)..)...... ....r#.#<##.##>## #......#.# #  #...#....# #......#.# #@.#...##.#..##....#.# ......#...# #..#....#.## ... #.  ....  PNgg .r ****Sigmund points at you and mumbles some strange words.PNgg^....18PNggQ?------==6PNgg PNgg _The puff of flame hits you. _There is a stone staircase leading up here.PNggPNgg4PNgg ,PNgg*.@.rPNgg6--7 _PNggUQNggȬ ######### ####### #.......# #.....# #.#####.# #.....######.#...#.### #### ###.............. #...1 ..#.....#)####.#@).#.#.# #.## #..........###.#####.#.# #.# ...##.#.....##.......#.## #.## ...##.##...###########..## #.#. ......###.## ##...## ##.#. ...#### #.# ##.....###.... ...######.# #.......##.... ..........####.....###.##.  .#######...####...####.##. You climb upwards.--------QNggQNgg[9=8.5 (2.5QNgg QNggU _Level annotation: 1 transporter _There is a stone staircase leading down here.QNgg 3QNgg QNgg6 ,QNgg XQNgg QNggD i20==QNgg QNgg ,QNgg QNgg QNggPQNggQNggd,QNggQNggQNggj9=QNgg> QNgg QNgg K1=QNgg QNgg,QNggQNgg),QNgg5QNggQNggIQNggQQNggQNggh2==QNgg$QNgg,QNgg]QNggn ,QNgg!QNgg&,QNggZ(QNggC*93QNgg*E==QNgg+QNgg-,QNggw.QNgg]0,QNgg1QNgg2QNggO3QNgg'4QNgg=_ _You start resting.QNggXC037.5 (19.0)QNggC#4QNgg"DT==8.5 (20QNggIQNggK" _HP restored.RNggRNggŹ~Level 1 of the Dungeon<>>>_(Press ? for help)################ #.......##.....# #.#####.##.....######.#...#.### ############################....................# #.......######### #.........##......#.....#)####.#@).#.#.# #.#####.........#####.#######.##.####..........###.#####.#.# #.# #..####.............# #.##.......##.#.....##.......#.## #.#####..# #.....####.###.###.#RNggu#.###...##.##...###########..## #.#......# ##...## #.........##.# #......###.####...## ##.#.###.## ##.## #####[######.###...#### #.###.....###........# #.###.##.......######.##.......##........# #.##..####..............####.....###.##.##..# ##'###.###.......#######...####...####.##.##..# ##...## #.##.###.#.# ##.....# #####.####.....#.#.####.....## #.##.# #...# ##....### ##.###.# #..#...##.#.##.......## ##.###.###...####.....#≈######...##.###.###..###<#..........####...###.##.......'.....#≈≈≈##..............##©##©#.#.........+.......##>###...####.....###≈≈#.....######.#..#####.#..........####...##RNgg#.......## ##......#≈≈#.##.##### #.#...#####.##.......## #.....#####......# ##......≈≈..#### #≈###......##.##.##.....## #......##.#.##.######.....≈≈~## ##≈##.......##..#####...## #......##.#.##.#..........~~..#####.~.#.#.....##...## ##'## ##...#.#RNggOK@#RNggg9#.SNgg6O:.#SNgg:##SNggbD:#.SNgg:..SNgg$K:..SNgg :..SNgg!e:.#SNgg:##SNgg_:#.SNggF:..SNgg~:..SNggw:..SNgg T ..#.#.##.#.#####....~~..#.....~...###.)..#....# #.######.#SNggz ..#.#.##.#.# #....≈~..#.###[~.### #...#####.## #.# ####### #.#SNggtB& .##.#)##.#.#####.~..~~.~#.# ##≈## ##.######..###.###.....# #.#SNgg: ###.#.##.#.#........~~..#.# #≈# #...)....#.#...##.....# #.#SNggG ###......#.#.#........~÷#.# #≈# #########.............# #.#SNgg #####.####.#.##.....~~.)..# #######...###....####.#SNggh #.#...............~~..#####.##≈#...÷.....#SNgg .#############..~~~≈..##.##≈#...#######SNgg] ###.~.~~~~.##.##≈##.##SNgg # #.#~.~~.###.#.≈.#.#SNggo   #.##.≈≈.##.#.~...#SNgg  ##.#..≈≈~##.#.~.###SNggv ##########...#≈≈#####.##### #####TNgg ###..........##≈#..##..#.## ##...##TNgguh ###.######..###≈##.###.###.######.....#TNgg ###.# #..# ####.##.#####...........#TNgg[ ###.# ####..######.####...##.######.....#TNgg ###.# #.............############......## ##...##TNggT #.###.###......#####..##...............####.##TNggZ ..#.......#...## ###..#####...............##.#TNgg ..#.#.........####..)....########.######..# #####.#TNgg ..#.########..........##.##..#.#..#ßß.#.## #.....#TNggo ..###.##.#####.##....##..'.#..#...### #.#####TNgg + .##...# ##'## #.####..# ######..#.#..##'#### ####.#TNggc _ #.#.### ##...## #.# #..# #....#..#_#......#.####)...#TNggs  ..##)##### ##.....###.####..# #.####..###..#...#..##.....##TNggV .####......###.......##.......# #.# ###......#####...#......##TNgg #_.#........##.........####...######|###..###...#ß..#...........##TNgg ..#.........+.(.......'.....................#####..#............#TNgg _.##........##.........####...######.##..................##.#...##TNgg~  #.#........###.......≈# ##..# #.........####.......###.##.##TNggv \ ..#........# ##.≈≈..#≈######.# #.......#### ##.....## #.####TNggk@ _.TNggl".#.......## ##.~≈.#~≈≈.###.# #.##.......# ##...## #.#TNggNY ..#.......# #.#+~≈.#..≈†...# #.##.##.##.# ##'## #.#UNgg $# ..######.## ##..#####≈≈##..# #.##.##.##.# #.######.#UNgg! ..#.# ##.###≈≈≈####.# #.##....##.# #......#.#UNgg! .##.#######..#≈≈≈### #.# #.##.......# ##.####.#.#UNgg ###.......≈...####### #.# #.#####.#### ##...###.#.#UNggM6 _#########.≈≈........# #.# #>#####.#######..........#UNgg5 ###.≈...#.###.###.# #............###...#.#.###UNgg _###.#..#.#........# ######....##.# ##.##.#.#UNggL.T_##UNgg P_ #UNggkJ_  UNggF_# VNggAT_##VNgg1P_##VNgg;7##VNgg7.#VNgg47#.VNgg7##VNgg0/T_##VNggUP_##VNggD7##VNggC7.#VNggS _.>#.#.###.###.######.##.##.####......#VNgg+ VNgg>   deadiverson the Shield-Bearer   HumanHealth: 24/24 ========================#########Magic: 2/2========================####### #.......#AC: 6Str: 16#.....# #.#####.#EV: 7Int: 8#.....######.#...#.### #### SH: 4Dex: 12 ###....................# #... XL:  2 Next: 95% Place: Dungeon:1 ..#.....#)####.#@).#.#.# #.## Noise: ---------  Time: 1138.5 (0.0) VNgg> J#..........###.#####.#.# #.# a) +0 long sword ...##.#.....##.......#.## #.## Throw: 3 darts (poison) ...##.##...###########..## #.#. ......###.####...## ##.#. ...#### #.###.....###....  ...######.##.......##....  ..........####.....###.##.  .#######...####...####.##.  _There is a stone staircase leading up here.  You climb upwards. _Level annotation: 1 transporter _There is a stone staircase leading down here. VNgg? j_You start resting. _HP restored.VNggA VNggQ VNggS ,VNggX VNggA] VNgg` BVNggh VNggj VNggj VNggl VNggr VNggt VNggRu VNggu VNgg} VNgg ,VNgg VNgg( VNggH VNggь VNgg VNggv VNgg ,VNgg/ VNggz :  You climb upwards. _Level annotation: 1 transporter _There is a stone staircase leading down here. _You start resting. _HP restored.  You see here a +0 dagger.VNgg֡ VNgg"  _VNgg VNgg VNgg, ,VNggu VNggn VNgg ,VNgg VNgg VNgg+ VNgg VNggh VNgg VNgg ,VNgg VNgg VNggF ,VNgg6 VNgg VNgg, ,VNggR VNgg VNgg ,VNgg: VNgg VNggc VNgg VNggG VNgg XVNgg VNgg0 ,VNgg' VNgg VNgg$ ,VNgg VNgg VNggD ,VNgg VNgg/ VNgg[ ,VNgg VNgg@$ VNgg% ,VNgg& VNgg- VNgg]/ ,VNgg20 VNgg3 VNggd5 ,VNgg6 VNggO> VNgg>@ VNggCA VNggC VNggH VNggK ,VNggM VNggT VNgg V ,VNggUW VNgg] VNgg` ,VNgga VNggh VNggQj VNggj VNggsq VNgger VNggRw BVNgg| VNgg  ,VNgg VNggO VNgg ,VNgg VNgg VNgg@ ,VNgg’ VNgg VNgga ,VNgg VNgg\ VNggZ ,VNgg VNggק VNgg ,VNgg VNggw VNgg ,VNgg VNgg VNggԷ ,VNgg VNgg VNgg ,VNggm VNggr VNgg ,VNgg) VNgg VNgga ,VNgg VNgg VNgg ,VNgg VNgg- VNgg ,VNggB VNgg VNgg ,VNgg VNggy VNgg VNggd VNgg* VNgg VNggM ,VNggB VNgg VNggK ,VNggx VNgg VNgg ,VNgg; VNgg VNgg1 ,VNgg4 VNgg9 VNgg ,VNgg VNgg VNgg  ,VNgg VNgg VNgg ,VNgg VNgg VNgg ,VNgg2 VNgg VNgg ,VNgg" VNgg% VNgg' ,VNggy( VNgg+ VNgg, ,VNgg. VNgg1 VNgg 3 ,VNgg4 VNgg:7 VNgg: ,VNggl; VNgg > VNgg? ,VNgg0A VNggC VNggCL VNggN VNggO ,VNggmQ VNggS VNggT ,VNgg(V VNgg&X VNggY ,VNggZ VNgg\ VNgg)_ ,VNgg_ VNgga VNgg(c VNggc VNggAd VNgg## #####...... ...... w   ribbon worm (asleep) ##....WNggV o   orc (asleep) ####r   rat (asleep) WNgg : You climb downwards.WNgg WNggc h  Level annotation: SigmundWNgg" WNgg L  The rat squeaks loudly. The orc shouts!WNgg WNggu M .ow...Br.gwoB   giant cockroach (wandering)g   goblin (wandering)(…)A giant cockroach comes into view.WNgg L====3.3 (1.8WNgg! WNgg+ _A goblin comes into view. It is wielding a +0 dagger. _There is a stone staircase leading up here.WNggDWNggTEWNgg[V\ _Unknown command.YNgg+ (((((You throw a poisoned dart.YNgg  The poisoned dart closely misses the orc.The goblin shouts!YNggYNgg-YNgglYNgg ...o.#w..B.r.g.(catching breath)Bg  The giant cockroach waves its antennae.YNggn ``The ribbon worm expels a string of sticky webbing.The stream of webbing hits you but does no damage.YNggQYNggR ..YNggUYNggU 3 YNgg6V 0 YNggV5==--YNgg0W4YNggW 0YNggX'2 darts (poison)YNgg<^-Held YNgg6eYNggh5--YNggr/  --more--YNgg$/ _You are caught in a web!ZNggZNggZNggZNggZNggZNggk.B..w.r.g.ZNggC 7  4 -52 darts (poison)ZNggDZNgg) _You block the orc's attack.ZNgg' N-ZNgg ZNgg ZNgg/ ZNgg ZNgg ZNgg' B.w.r.g.ZNgg &6ZNggZ ZNgg7 ..≈# ##..# #.........####.... .#≈######.# #.......#### ##... .#~≈≈.###.# #.##.......# ##.. ≈.#..≈†...# #.##.##.##.# ##' ####≈≈##..# #.##.##.##.# #. ##≈≈≈####.# #.##....##.# #. ≈≈≈### #.# #.##.......# ##. ZNgg m####### #.# #o#####.#### ##..1....# #.# #@#####.#######... #.###.###.# #....###..........# ######....##.# ##. #.###.##### #.##.##.####. ..# #.# #............ #####.# ############# o   orc ......# #######  _The orc hits you but does no damage.  You climb upwards.ZNgg ZNgg ZNggu 5-7.8 (2.5ZNgg ZNgg8 _Level annotation: 1 transporter _There is a stone staircase leading down here.[Nggu[Nggv5=9.1 (1.3[Ngg|[Ngg _You barely miss the orc. The orc barely misses you. x2[Ngga  You hit the orc.  The orc is moderately wounded.[Ngg[NggU)20.4[NggH[Ngg1 _You block the orc's attack.[Nggg  You hit the orc but do no damage.The orc is moderately wounded.[Ngg3-1.8 (1.4[NggF[NggT _The orc completely misses you.[Ngg  You hit the orc.  The orc is heavily wounded.[Ngg~ (3.2[Nggo [Ngg l _You block the orc's attack. The orc barely misses you.[NggC 7  You slash the orc![Ngg3I e)[NggI [NggP ..≈# ##..# #.........####.... deadiverson the Shield-Bearer .#≈######.# #.......#### ##... Human .#~≈≈.###.# #.##.......# ##.. Health: 24/24 ======================== [NggQ ≈.#..≈†...# #.##.##.##.# ##' Magic: 2/2======================== ####≈≈##..# #.##.##.##.# #. AC: 6Str: 16 ##≈≈≈####.# #.##....##.# #. EV: 7Int: 8 ≈≈≈### #.# #.##.......# ##. SH: 4Dex: 12 ####### #.# #)#####.#### ##.. XL:  2 Next: 108% Place: Dungeon:1 [NggR ......# #.# #@#####.#######... Noise: =--------  Time: 1224.5 (1.3) #.###.###.# #............###.. a) +0 long sword [NggHR %.#........# ######....##.# ##. Throw: 2 darts (poison) #.###.######.##.##.####. [NggR ..# #.##............ #####.##############  ......# #######[NggR x  The orc is moderately wounded. [NggS _The orc completely misses you.You hit the orc.  The orc is heavily wounded. [Ngg9S _You block the orc's attack. The orc barely misses you.You slash the orc![NggT _You kill the orc!You have reached level 3![Ngg^ /  --more--\Ngg6  Your experience leads to an increase in your attributes!Increase (S)trength, (I)ntelligence, or (D)exterity? _NggiM9/293/3103 4% _Ngg!r_NggrS _You feel clever. x2_Ngg 4_Ngg0"_Nggq$F _Unknown command.`Nggt `Nggv `Ngg## #####...... ...... B   giant cockroach ##....g   hobgoblin (wandering) ####g   goblin r   ratYou climb downwards.`Ngg58 8-`Ngg$: `Nggw; `Ngg= `Ngg;B h  Level annotation: Sigmund`NggiC `NggK rg..g..The giant cockroach closely misses you. The rat bites you.`Ngg c8-=7.0 (2.5`Ngg `Nggӟ _The giant cockroach bites you but does no damage. _There is a stone staircase leading up, spattered with blood here.`Ngg `Nggc`Ngg `Ngg F _Unknown command.aNggĢ ##### #.(.# #...# # # #...# #  .. ###.###...# ... #.#.......@..#..... ...##...##.<r...... # aNgg<#.. #B.g...... #.## # #......... .... ......g... #>#######...... ......##....####aNggaNggS  The giant cockroach attacks as it pursues you!aNggWo  You block the giant cockroach's attack. The rat attacks as it pursues you!aNggXaNggAurBg.....g.aNgg[9=8.0 (1.0aNggaNgg; _The rat bites you but does no damage.aNgg}y  ##### #.(.# # #...## # #...# # . .. .###.###...# ... ##.#.r.#...... .##...##Bg. .# #... #. ##.## #.. #... ... .....g.. ##>## ## #####...... # ...... ##.... ####aNgg~  The giant cockroach waves its antennae.aNgg,r  You block the giant cockroach's attack. The goblin attacks as it pursues you!aNggo  The goblin hits you but does no damage. The rat attacks as it pursues you!aNggؕzrg.<g.aNgg&9aNggaNgg ; _The rat bites you but does no damage.aNgg  ##### #.(.# .# #...# aNggʮ .## ## #...# # .. .. ..###.###r..# ... .##.#.g..#...... ..##...##B<. ..# #.... #.. aNgg .##.## #..$. #...... ...... ....g... .##>## ###...######...... aNggP  ##### ...... ##....aNgg B ####aNgg aNggl aNgg e B.gaNggg 2.  Found 8 gold pieces.aNgg /-30aNggC aNgg f _The rat twitches its whiskers.aNggK I  You hit the giant cockroach.  aNgg QThe giant cockroach is heavily wounded.aNgg g. The giant cockroach barely misses you.aNgg 5=1.4 (1.4aNgg* aNgg G _The giant cockroach bites you but does no damage.bNggj  You closely miss the giant cockroach.bNgg(v  The giant cockroach is heavily wounded.bNgg{bNgg'{  A bat comes into view.bNgge2g<...w.bw   ribbon wormB   giant cockroachg   hobgobling   goblin(…)bNggI=2.7 (1.3bNggbNgg\ _The giant cockroach barely misses you.bNggL  You slash the giant cockroach!bNgg8b  You kill the giant cockroach!bNgg-.grw...g   hobgobling   r   ratbNgg *K84.1 (1.4bNgg1 bNgg@2bNgg2/_The goblin hits you but does no damage.bNggRbNggSbNggKUbNggXbNggf#b.bNgggw.b   b(…)bNggh\7--5.4 (1.3bNggsbNggxp _You miss the goblin. The goblin hits you with a +0 dagger.bNggbNgg6w.bNggʭd4-----6.7bNggbNggWx _You closely miss the goblin. The goblin hits you with a +0 dagger.bNgg bNgg g5=--8.1 (1.4bNgg bNgg  bNgg n_You barely miss the goblin. The goblin hits you but does no damage. x2bNggz C9.4 (1.3bNgg bNgg _You closely miss the goblin. The goblin completely misses you.cNgg/8  You hit the goblin.cNggcNggY  You kill the goblin!cNgg#,cNggcNgg@  You block the bat's attack.cNgg[O  The hobgoblin hits you but does no damage.cNgg1%rgr.wb   batrr 2 ratscNgg6)71240.8 (1.4cNggH3cNggo7V _A rat comes into view.cNggɶ  You hit the hobgoblin.  The hobgoblin is almost dead.cNggv^.r cNggrs6==2.2cNggncNggW _The hobgoblin closely misses you.cNgg7L  You hit the hobgoblin but do no damage.The hobgoblin is almost dead.cNggyXG.rcNgg## ###...######...... # #### ......##.... dNggl dNgg U--60dNggedNggin _Items here: ) †††.eNgg.###### #.(.#  #...#  # # #...# #  .. ..###.###...# ... .# ......†.)@..#.....  ..##...##.<. # #.... #. .## #..$. #.. ...... ...>## ###...######...... #### ......##.... eNggeNggG-7 _eNggeNggeNggQM###(  # # #  #  .. ..###.###@..# #.#....†.)...#.... ... ..##...##.<...... ##.... #.............###...eNggVeNggW&8eNgg [eNgg\eNggM###(  # # #  #  .. ..###.###...# #.#....†.)...#.. ... ..##...##.<.......#.....#....#.....eNggeNggt21==9eNggeNgg6 M###(  # # #  #  .. ..###.###...# #.# ......†.)...#.....##.<.......####.....eNggQ eNgg '60eNggE eNgg eNggi ##### #.@.#  #...# # # #...# #  .. ..###.###...# ...# ......†.)...#..... .. ..##...##.<....... #.... #.........## #..$. #......... ... ...... ....eNgg eNgg] &1eNgg eNgg eNgg [2.3 (23eNgg< eNggC _ _f - 3 poisoned darts (gained 1)fNgge3fNggfNgg[fNggj2==fNggsXfNgg,fNggfNgg,fNggfNggXfNggh3==fNggfNgg,fNggfNggfNgg8fNggfNggH",fNgg#fNgg%fNggO&U4=fNgg&fNgg),fNgg}*fNgg-,fNgg-fNggc0,fNggB1fNgg4fNggM5a5=fNgg7,fNgg8fNgg:fNgg9;fNgg;fNgg>,fNgg?fNggAfNggmB9=fNggCfNggrI6=fNggIfNggJfNggMfNggXNfNggNfNgg;TfNggTfNggVfNggXYfNggYh7==fNggZfNggw],fNggi^fNggOa,fNgg2bfNggd,fNggefNgg0hfNgghh8==fNggiifNgglfNgg mfNggmfNggpfNgg^pfNggpfNggsfNgg>tfNggtfNggwfNggxh9==fNggxfNgg{1 _HP restored.fNgg=~fNgg~fNggWfNggfNggfNggdfNgg"fNggfNgg#fNggjfNggfNgg`fNggQfNgg̎9=fNggfNggx]  Items here: ) †††.fNggfNggj _fNggfNgg:fNggɝfNggfNggfNgg%  fNggԢ:You see here a rat corpse.fNggfNgg _fNgg+fNgg-fNgg*fNggfNggfNggfNggӴfNgg/fNggfNgg>,fNggfNggL _You now have 40 gold pieces (gained 8).fNgg3fNgg=fNggfNggL,fNggfNggfNgg,fNggfNggfNggfNgggfNggfNggfNggV#...##...#######... ######....##... #...#..# #........# #...####..##.###..:.. #.# #...# # ###..... ).......###.###...# ... .......##.#.....@....†.)...#.....306.3 (44.0) fNgg............#....##...##.<....... ........# #....#....##......... ...^.<.##.###....#....##......... ..)..)........................... #.#<##.##>###..###...######......  ..#.# # #.. ##### ......  ....# ... ##.... #.##### fNgg fNggW ,7.3 (45fNggfNgg#% _Found a glaive.fNgg"3fNgg$fNgg'fNgg*fNggP+fNggG0,fNgg11fNggo1fNgg2fNgg;  #...  ##...  #######....##### #....##....#...#  ..# #........# #...#  ###..##.###..@..##.# #...# fNgg<r####).......###.###...# #.#..........†.)...#..........#....##...##.<.......#.# #....#....## ....^.<.##.###....#....##...)..).................... .#.#<##.##>###..###...######..#.# # #.. ##### .....You pick up a book of Wicked Creation and begin reading...fNggJB19.3 (2.0)fNggB,10.3 (3fNgg1J  You add the spells Sculpt Simulacrum, Death Channel and Rimeblight to your _library.fNgg,3fNggofNgg fNggg #...#...#######....##### #....##....#...#..# #........# #...####..##g###.....##.# #...# #####......)..#.###...# . .........##.#..........†.)...#.......#....##...##.<.fNgg6 :#.# #....#....##.^.<.##.###....#....##)..).................g   goblin (wandering) @.#.#<##.##>###..###...######.......#.# # #..# ##### #....# ... ##..fNggz &0fNgg _.ggfNggA 5===1.3 (1fNgg-% fNgg( ( _The goblin shouts!|Ngg #... ##... #######....#####|Nggg #....##....#...# ..# #.# #...# # ###..##.###.....##.# #...# .#####......)g..@...###.###...# .##.#.†.)...#......#....##...##.<.#.###....#....##.^.<.##.###....#....##.)..)............ .@.#.#<##.##>###..###...######.#.# # #..# ##### r.#....# ... ##|Ngg|NggL.g.---2|Ngg|Ngg|Nggd( n #... ##... #######....##### #....##....#...# ..# #.# #...# .# ###..##.###.....##.# #...# .|Ngg) X.#####......).g@....###.###...#.##.#.†.)...#.....#....##...##.< #...#.###....#....## #......^.<.##.###....#....##.)..)..............@.#.#<##.##>###..###...######.#.# # #..# ##### .r.#....# ... ##|Ngg.1 |Ngg1 P=--3|Ngg7 |Ngg9 4 _You block the goblin's attack.|NggqS :  You slash the goblin!|Ngg] e)|Nggb 574.6 (1.3|Nggf |Ngg6h J _You kill the goblin!}Ngg  #... ##... #######....##### #....##....#...# ..## #..# #...# }NggB l .# ###..##.###.....##.# #...#  ..#####......).@.....###.###...#  .##.#.†.)...# #.....#....##...##.< .#...#.###....#....## .#......^.<.##.###....#....##.)..)..............@.#.#<##.##>###..###...###### #......#.# # #..# ##### #.r.#....# ... }Ngg<}Ngg4-50}Ngg}NggO _You see here a +0 dagger.}NggD _}Ngg P _}Ngge }Nggݫ }Ngg" }Ngg }Ngg >  You see here a +0 glaive.}Ngg }Ngg  _}NggF }Ngg4 }Ngg }Ngg] }Ngg }Ngg }Ngg }Ngg4 }NggJ }Ngg }Ngg ,}Ngg }Ngg }Ngg ,}Ngg }Ngg4 }Ngg }Ngg3 }Nggd }Ngg }Ngg ,}Ngg }Ngg }Ngg ,}Ngg }Ngg }Ngg B}Ngg: }Ngg ,}Ngg }Ngg }Ngg ,}Ngg }Ngg! }Ngg }Ngg }Ngg }Ngg= }Ngg ,}Ngg }Ngg }Ngg }Ngg }Ngg }Ngg }Ngg~ }Ngg }Ngg }Ngg! }Nggs$ ,}Ngg$ }Ngg% }Ngg& ,}Ngg?' }Ngg( }Ngg) ,}Ngg|) }Ngg(* }Ngg4+ ,}Ngg+ }Ngg. }Ngg?0 }Ngg}0 }Ngg1 }Ngg2 }Ngg4 ,}NggQ5 }Ngg_6 }Ngg7 ,}Ngg7 }Nggy8 }Ngg9 ,}Ngg: }Ngg: }Ngg; }Ngg; }Ngg; }Ngg*@ }NggB }NggKB }NggB }NggD }NggE }NggE }Ngg3F }Ngg%H }NggJ }NggK }NggK }NggpN }NggzQ ,}NggR }NggT }Ngg/V ,}NggV }NggY }Nggw[ }Ngg[ }Ngg ] }Ngg_ }Nggfb }Nggb }Nggc }Nggd }Nggf }Nggg }Ngg>h }Nggj }Nggn ,}NggHp }Nggt }Nggv }Nggw }Nggx }Ngg{ }Ngg~ }Ngg }NggQ }NggZ }Nggc }Ngg }Nggه }Nggv }Ngg. ,}Ngg }Ngg }Ngg1 ,}Ngg }Ngg }Ngg ,}Ngg }NggK }Ngg ,}Ngg }NggȤ }Ngg ,}Ngg} }Ngg }NggX ,}Ngg }Ngg }Ngg6 ,}NggS ,}Ngg ,}Nggz }Ngg }Ngg_ ,}Ngg0 }Ngg }Ngg2 ,}Ngg }NggS }Ngg" ,}Ngg }NggP }Ngg ,}Ngg }Ngg }Ngg ,}Ngg }Ngg }Ngg ,}Ngg }Ngg }Ngg ,}NggP }Ngg }Ngg ......#.# #.#..# .#...##.# # #.#.## . ##....#.# #.#.#.####.## # ......# #...........#  #..#.... #..#........# }Ngg ~.... ......#........# .... .....##.####.###  .#..##.# .#  #....@# # - ##.#..# # ##.. ...r}Ngg7 \ .##.# .. .#r   rat (asleep) .. .. #.. .. }Ngg2 x 68.6 (53.0)  A rat comes into view.}Ngg zr.r}Nggw K====9.6 (54}Ngg }Nggp - _The rat squeaks loudly.}NggO { #.#..#  # #.#.## .  #.#.#.# #  #......   #..#..  .... ......#..  .... .....##.#  .#..##.# .#  #....@# #  ##.#..# }Ngg # ##.r .... .##.#  .. .#  .. ..  #.. .. }Ngg - #.#..#  # #.#.## . }Nggɪ  #.#.#.#   #......   #..#..  .... ......#..  .... .....##.#  .#..##.# .#  #....@# #  ##.#..# }Ngg r# ##.r .... .##.# .. .#  .. .. #.. .. }Ngg 4}Ngg_ }Ngg Z _A rat is nearby!~Ngg #.#..#  # #.#.## .  #.#.#.# #  #......   #..#..  .... ......#..~NggI   .... .....##.#  .#..##.# .#  #....@# #  ##.#..# # ##.r .... .##.#  ~Ngg{.. .#  .. ..  #.. .. ~Nggn) #.#..#  # #.#.## .  #.#.#.#   #......   #..#..  .... ......#..  .... .....##.#  .#..##.# .#  #....@# #  ##.#..# # ##.r ....~Ngg* .##.# .. .#  .. .. #.. .. ~Nggm0~Ngg51~Ngg5~Ngg7Z _A rat is nearby!~Ngg]R#...## #.#.## . ##.....#.#.####.## # ......## #...........  #..#...... #..#... .... ......#......##.####.## .#..##.# .#  #.....# ##.#  # ##.r#~Ngg) ....#..##.##.. #.. ..#.. ..###~Ngg~Nggcg=---70.6 (1.0)~Ngg~Ngg; _The rat bites you but does no damage.~Nggl~NggInI---1.9 (1.3~Nggr~Nggt _You hit the rat but do no damage. The rat barely misses you. x2~Nggq~NggW gg   hobgoblin (wandering)r   ratYou barely miss the rat. The rat misses you.~Ngg(3.2~Ngg}~Ngg\ _A hobgoblin comes into view.~Ngg T  The hobgoblin shouts!  You slash the rat!~Nggߗ ~Ngg {.g†g~Ngg =9=4.6 (1.4~NggR ~NggM G _You kill the rat!~NggX #......#.# #.#..# <.#...##.# # #.#.## . .##....#.# #.#.#.####.## ## ......## #...........##..#...... #..#........# ....#.g....#........#.... .....##.####.###.#..##.# .# #...@.# ###.#..# ##.† ....# ..##.# #.. .# #.. .~Ngg$  #.. ..#.. ###~Ngg ~Ngg ~Nggƛ r.gr   rat (wandering)~Ngg 5--50~Ngg ~Ngg Ngg?#......#.# #.#..# #<.#...##.# #.#.#.## . ..##....#.## #.#.#.####.## .## ......##. #...........# # #..#......##..#........# ....#r.g...#..# .... .....##.####.### .#..##.# .# #..@..# # ##.#..#Nggn #.##.†##. ....###..##.# #.. .# #.. .. #.. ..  #.. ###NggNggNgg...r.grNgg<0===6NggNgg- _The rat squeaks loudly.NggZTm[?25h[?0c  Search for what [Enter for "dart", or ? for help]? Nggk [?25l[?1cNggNggX5 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle) Ngga] a - [carried] b - a +0 scale mail (worn)  b - [carried] c - a +0 buckler (worn) Results elsewhere ([,] to cycle)  c - [D:1] a +0 chain maild - [D:1] a +0 scale mail  e - [D:1] a leather armourNgg/Ngg7Ngg=*##......#.# #.#..#deadiverson the Shield-Bearer #<.#...##.# #.#.#.## .Human ..##....#.## #.#.#.####.##Health: 29/29 ======================== .## ......##. #...........#Magic: 3/3======================== # #..#......##..#........#AC: 6Ngg=Str: 16....#......#........#EV: 7Int: 10.... .r.g.##.####.###SH: 4Dex: 12.#..##.# .#XL:  3 Next: 39% Place: Dungeon:2#..@..# #Noise: ===------  Time: 1376.6 (0.0)##.#..#a) +0 long sword#.##.†#Throw: 3 darts (poison)Ngg:>W#. ....###..##.##.. .#g   hobgoblin#.. ..r   rat#.. ..#.. ### Ngg>_A hobgoblin comes into view.The hobgoblin shouts!  You slash the rat! _You kill the rat! _The rat squeaks loudly.  Ngg>XSearch for what [Enter for "dart", or ? for help]? armorNggFNggYGNggNNggP. _Ngg4NggFNgg[F _Unknown command.NggG n[?25h[?0c  Search for what [Enter for "armor", or ? for help]? Ngg [?25l[?1cNggU Ngg7 J1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position  a - [carried] a - a +0 long sword (weapon)NggQ NggZ##......#.# #.#..#deadiverson the Shield-Bearer #<.#...##.# #.#.#.## .Human ..##....#.## #.#.#.####.##Health: 29/29 ======================== .## ......##. #...........#Magic: 3/3======================== # #..#......##..#........#AC: 6Str: 16....#......#........#EV: 7Int: 10.... .r.g.##.####.###SH: 4Ngg[BDex: 12.#..##.# .#XL:  3 Next: 39% Place: Dungeon:2#..@..# #Noise: ===------  Time: 1376.6 (0.0)##.#..#a) +0 long sword#.##.†#Throw: 3 darts (poison)#. ....###..##.##.. .#g   hobgoblin#.. ..r   rat#.. ..#.. ###You slash the rat! _You kill the rat! _The rat squeaks loudly. _Search for what [Enter for "dart", or ? for help]? armor _Unknown command.Search for what [Enter for "armor", or ? for help]? long bNggbNgghcNgg|jNgg.m. _NggNggÜNgg}NggEF _Unknown command.Ngg{ 2 #.r.#....# #....#  ##......#.# #.#.#..#  #<.#...##.# #.#.#.## . #..##....#.## #.#.#.####.## ..## ......##. #....# .# #..#......##..#.# # ....#......#........#......r.g.##.####.###.#.@##.# .#Ngg  #.....# ##.#.. #.##.† #......###..##.# #.. .# #.. #.. ..Nggq! Ngg) E.rNgg* 4--7.6 (1Ngg&1 NggK4 @ _The hobgoblin hits you but does no damage.Ngg=  You slash the hobgoblin!NggNggW .†rr   rat  You kill the hobgoblin!Ngg_43--9.0 (1.4Ngg Ngg Q _The rat closely misses you.NggU5  You hit the rat.Ngg^E†Nggb6580.3 (1.3NgghNggoG _You kill the rat!Ngg4Ngg^ _No target in view!Ngg  _No target in view!Ngg3; _  You see here a hobgoblin corpse. _Ngg%qNgg}D #......#.# ##.###..# ##### #.r.#....##.# .#....# ##......#.##.##.#.#..# #<.#...##.##.##.#.#.## .  #..##....#.##.##.#.#.####.##  #..## ......##.##...........#  ...# #.@#......##..#........##.## Ngg~C#......#........##........@..†.##.####.###-4.3 (4.0  ........#.#†.##.# .# .......##.#.....# #...... #.##.#..#..... #.##.##.†##.... #.##......#@   Sigmund (polearm, wandering)#### #.###..##.#..# #.. .# NggO#.. ..Ngg68-NggŊNggΎ\ _Sigmund is nearby!Nggme    .#   ##....#  #<.#...##.##.# .  #..##....#.##.##.#.#  #..## ......##.##....  ...# #.@#......##..#  #.## ......#......#  #. .......@..†.#  . .......#.#†.##.# .# . ......##.#.....# #  ...... #.##.#..#  ..... #.##.##.†#  #.... #.#  #### #.#  ..# #.. .#  #.. .. Ngg    .#   ##....#  #<.#...##.##.# .  #..##....#.##.##.#.#  #..## ......##.##....  ...# #.@#......##..#  #.## ......#......# Ngg #. .......@..†.#  . .......#.#†.##.# .#  ......##.#.....# #  ...... #.##.#.. ..... #.##.##.† #.... #.#  #### #.# ..# #..  NggE4#.. NggNggNggNgg$\ _Sigmund is nearby!Ngg` Nggc You aren't carrying any items that you can evoke.NggNgg. _NggZ OInventory: 11/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  f - 3 poisoned darts (quivered)  j - 2 throwing nets Armour (go to first with [)  b - a +0 scale mail (worn)  c - a +0 buckler (worn) Scrolls (go to first with ?)  g - a scroll labelled XYD YCROOMM Potions (go to first with !)d - a potion of might  e - a brown potion  h - 2 ruby potions  i - a viscous pink potion  k - a lumpy ruby potionNgg Ngg#......#.# ##.###..# ##### deadiverson the Shield-Bearer #.r.#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## .Magic: 3/3========================#..##....#.##.##.#.#.####.## AC: 6Str: 16#..## ......##.##...........# EV: 7NggInt: 10...# #.@#......##..#........# SH: 4Dex: 12  #.## ......#......#........# XL:  3 Next: 45% Place: Dungeon:2  #........@..†.##.####.### Noise: ---------  Time: 1384.3 (0.0)  ........#.#†.##.# .#a) +0 long sword .......##.#.....# #Throw: 3 darts (poison)...... #.##.#..#..... #.##.##.†#Nggl#.... #.##......#@   Sigmund (polearm, wandering)#### #.###..##.#..# #.. .##.. .. _No target in view! _No target in view! _You see here a hobgoblin corpse. _Sigmund is nearby! _Sigmund is nearby! _You aren't carrying any items that you can evoke.NggyNggNggTNggNgg (((((@poisoned)You throw a poisoned dart. The poisoned dart hits Sigmund. Sigmund is poisoned.Nggӡ Ngg[ W(@.... Nggl d==5.3 (12Ngg Ngg' % _Sigmund shouts!Ngg]A((((Nggo ....  You throw a poisoned dart. The poisoned dart hits Sigmund.Ngg  Sigmund points at you and mumbles some strange words.NggVNgg5n--6dart (poison) NggNgg&9 _You resist with significant effort.Ngg"8 (((( very poisoned)You throw a poisoned dart. The poisoned dart hits Sigmund.Ngg?  Sigmund looks even sicker.Nggx(..@...Ngg--7.4 (1.1Nothing quiveredNggNggj _Sigmund says, "Look into my eyes."Ngg #......#.# ##.###..#  #...#....##.# .#....# ##......#.##.##.#.#..# #<.#...##.##.##.#.#.## . #..##....#.##.##.#.#.####.## #..###......##.##...# ...# #.(#......##..#.# #.## ...(...#......#.# #..@..@...†.##.####.### ..#.#†.##.# .#  ..##.#.....# #Ngg&[12;16H. #.##.#..#.. #.##.##.†#.#..... #.##......# #####. #.###..##.##. ..# #.. .#  #.. ..NggmNgg3H.@Ngg,80Ngg#Ngg7&Ngg #......#.# ##.###..#  #...#....##.# .#....# ##......#.##.##.#.#..# #<.#...##.##.##.#.#.## . #..##....#.##.##.#.#.####. #..###......##.##... ...# ##.(#......##..#. #.## ....(...#......#. #..@@....†.##.####. ..#.#†.##.# .# ..##.#.....# #.##.##.#..#.##.##.##.†#gg=14;11H.#.....##.##......## #####..#.###..##.# #....# #.. .#  #.. ..NggNgg**Nggv  Sigmund gestures at you while chanting.Nggw@ 0 ==Nggy69Conf NggNgg҄Q _You are confused.Nggէ Ngg Drink which item? Potions  d - a potion of might  e - a brown potion  h - 2 ruby potions  i - a viscous pink potion Ngg: k - a lumpy ruby potion [!] read|quaff[?] describe selectedNgg=NggLNggR#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH:  0  Dex: 12#.## ....(...#......#........ XL: ggS0m 3 Next: 45% Place: Dungeon:2#. ......@@....†.##.####.## Noise: ==-------  Time: 1389.4 (0.0). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#Conf ........##.##.##.†#..#.....##.##......#@   Sigmund (polearm, very poisoned)# #####..#.###..##.##....# #.. .##.. .. _You resist with significant effort.  You throw a poisoned dart. The poisoned dart hits Sigmund.  Sigmund looks even sicker. _Sigmund says, "Look into my eyes."Sigmund gestures at you while chanting. _You are confused.Nggqe It was a potion of curing. You feel better.Nggm  Sigmund points at you and mumbles some strange words.Ngg] 4 90.4 (1NggNgg9 _You resist with significant effort.Ngg)Ngg*Drink which item? Potions  d - a potion of might  e - a brown potion  h - a potion of curing Ngg_+( i - a viscous pink potion  k - a lumpy ruby potion [!] read|quaff[?] describe selectedNggNggzNgg#......#.# ##.###..# ### deadiverson the Shield-Bearer NggV#...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2NggR#. ......@@....†.##.####.## Noise: ==-------  Time: 1390.4 (0.0). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......#@   Sigmund (polearm, poisoned)# #####..#.###..##.##....# #.. .##.. .. Ngg@_Sigmund says, "Look into my eyes."Sigmund gestures at you while chanting. _You are confused.It was a potion of curing. You feel better.  Sigmund points at you and mumbles some strange words. _You resist with significant effort.Ngg4Ngg]NggS _You have no ailments to cure.NggNgg*Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  j - 2 throwing netsNgg&#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: ggzk;49m45% Place: Dungeon:2#. ......@@....†.##.####.## Noise: ==-------  Time: 1390.4 (0.0). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......#@   Sigmund (polearm, poisoned)# #####..#.###..##.##....# #.. .##.. .. _You resist with significant effort. _You have no ailments to cure.  Throw: 2 throwing netsPress: ? - help, Shift-Dir - straight line, f/p - SigmundAim: Sigmund, wielding a +0 scythe and wearing a +0 robe (lightly wounded,  poisoned, 50% to hit)Ngg|#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16Ngg#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2#. ......@@....†.##.####.## Noise: ==-------  Time: 1390.4 (0.0). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......#@   Sigmund (Nggpolearm, caught, poisoned)# #####..#.###..##.##....# #.. .##.. ..Throw: 2 throwing netsPress: ? - help, Shift-Dir - straight line, f/p - SigmundAim: Sigmund, wielding a +0 scythe and wearing a +0 robe (lightly wounded,  poisoned, 50% to hit)  You throw a throwing net. The throwing net hits Sigmund.  Sigmund is caught in the net!NggRNggX/  --more--Ngg> @ Sigmund is lightly wounded.-1.4 (1Ngg' Ngg 0 _Sigmund struggles against the net.NggYou hit Sigmund.  Sigmund is moderately wounded.Sigmund says, "Don't worry, I'll kill you fast."Nggñ8*Ngg   Sigmund mumbles some strange words.Sigmund flickers and vanishes!Ngg& {Deactivating autopickup; reactivate with Ctrl-A.NggHL====2.7 (1.3NggNgg%Ngg '/  --more--NggH2 _Something wriggles in the net.Nggt{Ngg})Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  j - a throwing netNgg Nggz #......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#NggP Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2Ngg #. ......{@....†.##.####.## Noise: ====-----  Time: 1392.7 (0.0). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. .. _Something wriggles in the net.  Throw: throwing netPress: ? - help, Shift-Dir - straight line, f - youNggіG{@Ngg#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================Ngg #<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2#. (((((((@....†.##.####.## Noise: ====-----  Time: 1392.7 (0.0). .........#.#†.##.# .# a) +0 long swordNgg!a.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. .. _Something wriggles in the net.  Throw: throwing netPress: ? - help, Shift-Dir - straight lineNggc.....{You throw a throwing net.Nggc`=---3.7 (1NggNggڴ, _Something wriggles in the net.NggYou aren't carrying any items that you can evoke.---NggNggj. _Ngg]hNggVlInventory: 9/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Armour (go to first with [)  b - a +0 scale mail (worn)  c - a +0 buckler (worn) Scrolls (go to first with ?)  g - a scroll labelled XYD YCROOMM Potions (go to first with !)d - a potion of might  e - a brown potion  h - a potion of curing  i - a viscous pink potion  k - a lumpy ruby potionNggB Ngg2L NggV #......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6NggCW Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2#. (.....{@....†.##.####.## Noise: =--------  Time: 1393.7 (0.0). .........#.#†.##.# .# a) +0 long swordNggW !.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......## #####..#.###..##.#Ngg@X #....# #.. .##.. .. _Something wriggles in the net.  Throw: throwing netPress: ? - help, Shift-Dir - straight lineYou throw a throwing net. _Something wriggles in the net. _You aren't carrying any items that you can evoke.Ngg+` Ngg` Nggsg Nggh Ngg# Ngg Drink which item? Potions  d - a potion of might  e - a brown potion  h - a potion of curing  i - a viscous pink potion  k - a lumpy ruby potion [!] read|quaff[?] describe selectedNgga NggVi#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================NggOj#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 4Dex: 12#.## ....(...#......#........ XL:  3 Next: 45% Place: Dungeon:2#. (.....{@....†.##.####.## Noise: =--------  Time: 1393.7 (0.0)Nggjg. .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. .. _Something wriggles in the net.  Throw: throwing netPress: ? - help, Shift-Dir - straight lineNggZkYou throw a throwing net. _Something wriggles in the net. _You aren't carrying any items that you can evoke.Nggzt  You feel very mighty all of a sudden.Ngg{k-4.7 (1Might Ngg˂Ngg4 _Something wriggles in the net.Ngg9  You slash something!Nggz )Reactivating autopickup.Ngg591%==6.1 (1.4  You slash something!  Reactivating autopickup. _You feel a bit more experienced.  Training target 5.0 for Shields reached!  Your Shields skill increases to level 5!You need to enable at least one skill for training.Ngg/  --more--Ngg4$Ngg)  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting   3.0   4.0   0   i - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0               c - Short Blades   1.1   1.0   0      Ngg*m d - Long Blades   2.0   3.0   0               e - Armour   3.0   4.0   0       f - Dodging   0.0   1.0   0       g - Shields   5.0   6.0   0       h - Stealth   0.0   0.8  +1              NggI+@                        Ngg+                You need to enable at least one skill.[?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  NggZ,[!] training|cost|targetsNgg= a + Fighting 3.0Nggr Ngg. #......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 29/29 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 5Dex: 12#.## ....(...#......#........ XL:  3 Next: gg m491% Place: Dungeon:2#. (.....)@....†.##.####.## Noise: ==-------  Time: 1396.1 (1.4). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#Might ........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. ..You slash something!  Reactivating autopickup. _You feel a bit more experienced.  Training target 5.0 for Shields reached!  Your Shields skill increases to level 5!You need to enable at least one skill for training.#......#.# ##.###..# ### deadiverson the Shield-Bearer #Ngg [39;49m...#....##.# .#....#Human##......#.##.##.#.#..#Health: 31/31 ========================#<.#...##.##.##.#.#.## . Magic: 3/3========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 10...# ##.(#......##..#........ SH: 5Dex: 12#.## ....(...#......#........ XL:  3 Next: 491% Place: Dungeon:2#. (.....)@....†.##.####.##Ngg/  Noise: ==-------  Time: 1396.1 (1.4). .........#.#†.##.# .# a) +0 long sword.........##.#.....# # Nothing quivered........##.##.#..#Might ........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. ..You slash something!  Reactivating autopickup. _You feel a bit more experienced.  Training target 5.0 for Shields reached!  Your Shields skill increases to level 5!You need to enable at least one skill for training.  Your Fighting skill increases to level 4!You have reached level 4!  --more--Ngg?NggH#......#.# ##.###..# ### deadiverson the Shield-Bearer #...#....##.# .#....#Human##......#.##.##.#.#..#Health: 38/38 ========================Ngg,J#<.#...##.##.##.#.#.## . Magic: 4/4========================#..##....#.##.##.#.#.####.# AC: 6Str: 16#..###......##.##........... EV: 7Int: 11...# ##.(#......##..#........ SH: 5Dex: 12#.## ....(...#......#........ XL:  4 Next: 226% Place: Dungeon:2#. (.....)@....†.##.####.## Noise: ==-------  Time: 1396.1 (1.4). .........#.#†.##.# .# a) +0 long sworNgg K\d.........##.#.....# # Nothing quivered........##.##.#..#Might ........##.##.##.†#..#.....##.##......## #####..#.###..##.##....# #.. .##.. .. _You feel a bit more experienced.  Training target 5.0 for Shields reached!  Your Shields skill increases to level 5!You need to enable at least one skill for training.  Your Fighting skill increases to level 4!You have reached level 4!NggK}  You feel clever.You have reached level 5!NggV/  --more--Ngg= E43/435/5568% NggDC NggD 4 _Ngg9 #......#.# ##.###..#  #...#....##.# .#....# ##......#.##.##.#.#..# #<.#...##.##.##.#.#.##  #..##....#.##.##.#.#.####. #..###......##.## ...####.(#......##..# #.## .....(...#......# #. .(.....@.....†.##.####. ..#.#†.##.# .# ..##.#.....# #.##.##.#..#.##.##.##.†#...NggN;#.....##.##......########..#.###..##.# #....# #.. .#  #.. ..NggBNgglC<--70 _NggJNggPi  Things that are here: _a +0 scythe; a +0 robeNggNggm!Ngg"Ngg+'Ngg00 ...@.#.#<##.##>###..# #..r...#.# ##.###..# # #...#....##.# .#....# ##......#.##.##.#.#..# #<.#...##.##.##.#.#.## Ngg1d #..##....#.##.##.#.#.#### #..###......##.##.. ...####.(#......##..# #.###.....(@..#......#......-- #. ..(.....).....†.##.####. ...#.#†.##.# ...##.#.....#.##.##.#.........##.##.##.†r   rat (wandering)....#.....##.##......##########..#.###..##.##....# #.. .#Ngg8n 0  A rat comes into view.NggBg.rrNggD4==8.1 (1Ngg2LNggO- _The rat squeaks loudly.NgguX <##.##> #......#.#   Nggyv3#..r#....##.#   ##......#.#  #<.#...##.#  #..##....#.# #..###......##.# ...####.(#......# #.###.....(@..# #. ..(.....).....† . ...........#.#†.##.# Nggw . ..........##  ..........#  ..........#†#  ....#.....#  #########..   #.. .# Ngg g <##.##>Ngg\  #......#.#   #..r#....##.#   ##......#.#  #<.#...##.#  #..##....#.# Ngg #..###......##.# ...####.(#......# #.###.....(@..# #. ..(.....).....† . ...........#.#†.##.#  . ..........##  ..........# ..........#†# Ngg  ....#.....# #########..  #.. Ngg Ngg Ngg- NggE1 Z _A rat is nearby!Ngg ........)..).................#.#<##.##>##......#.# ##.###..# # #..r#....##.# .#..#......#.. #<.#...#  #..##....#.##.##.#.#.#### #..###......##.##... ...####.(#@.....#####.....(...#......#.....#. ..(.....).....### ..#.#†.##.# ..#.#.....# .##.†#....#.....##.##.....#########..#.###..##.rNgg 6--9 _Ngg NggM Ngg##.#......^.<.##.###...)..)........... .....#S#<##.##>###..# #......#.# ##.###..# #...#....##.# .#....# ##..r...#.##.##.#.#..# #<.#...##.##.##.#.#.##  #..##....#.##.##.#.#.### #..###..@...##.##.. ...####.(#......##..# #.###.....(...#......#.... #. #..(.....).....†.##.#### ......#.#†.##.#.Ngg8....##.#.....#S   ball python (constriction, wandering)....##.##.#..r   rat#..........##.##.##.† ....#.....##.##......#Ngg --A ball python comes into view.A malevolent force fills the Dungeon...Nggh/  --more--Ngg. S  You fall into a shaft and drop 1 floor!Ngg2 /  --more--Ngg. .# .# ## .#  +. .##  #. ..  #.#.#  #...#3 #.@.# #...# .....# #.....## .. ######... #### NggNgg?<+8 (0.7NggVANggC7 _The shaft crumbles and collapses.NggNgg4Ngg/NggǢNgg,NggߧNggS.:.# ..# # ..# .. ..# .#####.# ....Ngg+.#.##...###.#..<....b#.#@# #...# #...#  #...#  .....# #.....##b   bat (asleep)........######...Ngg"####Nggw 400.8 (1.0  A bat comes into view.NggNggNggZb...bNgg +1.8 (2Ngg NggQ _Found a book of Dreams. Found a stone staircase leading up.Ngg##.... ...:.# ....# ##...# ..  ..# .######.# .....+.#.##...####.#.@<.b....#.#.#########...# #...# #...# .....# #.....##........######...Ngg3,Nggib..=2.8 (1Ngg1 _You block the bat's attack.Ngg^6 Ngge7 -4.1 (1.3Ngg= Ngg@ _You miss the bat. The bat barely misses you. You block the bat's attack.Ngg7  You slash the bat!NggM<Ngg>(5.4NggNggdG _You kill the bat!Nggb4NggfNggh NggNi:_No target in view!Ngg_p###.... ...:.# #....# .## ...# ... ..# ##.####.# ..+.#.##...##.#..@.#.#.##...# #...# #...#.....##.....##........ NggtQ-60 _NggvNggya _There is a stone staircase leading up here.Ngg N-Ngg Nggl Ngg -7 _Ngg Ngg֬ #.....##.##......# #####..#.###..##.##....# #.. .# #.. .. . #.. .. #.#..# ### #.....### #......# Ngg 2#.....@# #.g.....# #.........###########  g   goblin (asleep) Ngg5 ?  You climb upwards.Ngg Ngg bg.gNgg 7===8.1 (1.7NggNgg} _The goblin shouts! _There is a stone staircase leading down here.Ngg, Ngg  #.. .# #.. .. . #.. .. #.#..# ###  #.....### #......# #..g..@# #.......# #.........  ########### Ngg}   #.. .# #.. .. . #.. .. #.#..# ###  #.....### #......# #..g..@# #.......#Ngg #.........  ###########  Ngg4NggNgg] _A goblin is nearby!Ngg! .#.....##.##......##..#.###..##.# #....# #.. .#. #.. ... #.. .. #.#..# ### #.....### #......# #..g.@># #.# #.. ##Ngg)Ngg.gNgg=---90 _NggNggNgg 0--=--10.4 (1.3Ngg Ngg w _You barely miss the goblin. The goblin hits you with a +0 dagger.Ngg9 8  You hit the goblin.Nggg A) Ngg8 `1--701.7Ngg0 Nggf J _You kill the goblin!Ngg|4NggNggH _No target in view!Ngg+ _Ngg"BNgg#Ngg|%Ngg&L2=Ngg&Ngg)Ngg.*Ngg*Ngg-Ngg4.Ngg/Ngg1Ngg 2Ngg3Ngg73==Ngg8Ngg;1 _HP restored.Ngg'>Ngg>Ngg?NggANggDNggBENgg!FNggVINggKNggKNggMNggQNggSNggVT:=Ngg#UNggTWNggYNggCZNgg[Ngg]NggI_Ngg_Ngg`NggeNgggNggngNgg\hNgglNggnnNggnNggoNggyrNggtNggGuNggCvNggxNggz,Ngg{Ngg~Ngg_,Ngg)Ngg,NggˆNggGNgg/Ngg9NggڑNgg%NggNggKNggNgg8.Ngg2R #.#.##.##.#.#.####. #..###......##r##.............####.(#......##..#.......#.###.....(...#......#.......#. #..(.....[.....†.##.####.#. ............#.#†.##.# .#. ...........##.#.....# #.....#.##.#..##........@.##.##.##.†#-31.7 (20.0)....#.....##.##......##########..#.###..##.# #....# #..# .##....###..# ..#......#..# ..r   rat (wandering)#....#.#..## ###ggTV;17H#....#.....##########......#- _A rat is nearby!Ngg #..###......##r# ...####.(#......#  #.###.....(...#..  #. #..(.....[.....†  . ............#.#†.##.#  . ...........#  ...........#NggS  #........@.#†#  ....#.....#  #########..#  #....# #..# .#  #....###..# ..  #......#..# ..  #....#.#..## ###  #....#.....###  ...# Nggh #..###......##r# ...####.(#......#  #.###.....(...#.. Nggd #. #..(.....[.....†  . ............#.#†.##.#  . ...........#  ...........#  #........@.#†#  ....#.....#  #########..#  #....# #..# .#  Ngg?#....###..#  #......#..# ..  #....#.#..##  #....#..... .NggϲNggNggNggNZ _A rat is nearby!Ngg< #..###......##r# ...####.(#......#  #.###.....(...#..  #. #..(.....[.....†  . ............#.#†.##.#  . ...........#  ...........#  #........@.#Ngg†#  ....#.....#  #########..#  #....# #..# .#  #....###..# ..  #......#..# ..  #....#.#..## ###  #....#.....###  ...# Nggkx  #..###......##r# ...####.(#......#  #.###.....(...#..  #. #..(.....[.....†  . ............#.#†.##.#  . ...........#  ...........#  #........@.#†#  Nggy ....#.....#  #########..#  #....# #..# .#  #....###..#  #......#..# ..  #....#.#..##  #....#..... .Ngg  _A rat is nearby!Ngg9+ <.#...##.##.##.#.#.## #....#.##.##.#.#.####.##..###......##r##.......####.(#......##..#.#.###.....(...#......#........Ngg, ;#. #..(.....[.....†.##.####.#.#.#†.##.# .# . .##.#.....# #..##.##.#..# #..........##.##.##.†# ....#.....##.##......# #########..#.###..##.# #....# #..# .##....###..# .. #......#..# ..#....#.#..## ####....#.....##Nggf, !#Ngg<2 q  You feel a little less mighty now.Ngg< g.rrNgg= B==2.7 (1.0)Ngg\E NggH  NggH _The rat squeaks loudly.Nggm?#..r....#  #<.#...# . #..#.##.##.#.#.####.# #..###......##.##... ...####.(#.....r##..###.....(...#......#........#. #..(.....[.....###.## ..#.#†.##.# .....#...# #.....##.†# ....#.....##.##.....#########..#.###..##..# #..###..# .....#..# ..#..## ###NgglpNgg$|{.r--3NggNggrNggo...#....##.# .#....# ##......#.##.##.#.#..# <.#...##.##.##.#.#.## . #....#.##.##.#.#.####.###..###......##.##....#...####.(#......##..#.##.###.....(...#r.....#........#. #..(.....[.....†.##.####.###..#†.##.# .#  Ngg~. .##.#.....# #..##.##.#..# #..........##.##.##.†#....#.....##.##......##########..#.###..##.# #....# #..# .##....###..# ..#......#..# ..NggNggJ.rNggA--4NggNggaNgg8m7  You slash the rat!Nggw1.Nggz5=6.0 (1.3NggxNgg Ngg9_You kill the rat!NggW4NggNggtH _No target in view!Ngg Ngg Ngg Ngg Ngg< Ngg _Ngg Nggq ,Ngg\ Ngg Ngg Ngg NggQ Ngg Nggc Ngg Ngg $ Ngg ?_f - 2 poisoned dartsNgg  ........)..).......... .S...#.#<##.##>###..# #......#.# ##.###..# #...#....##.# .#.... Ngg 5##......#.##.##.#.# #<.#...##.##.##.#.#.# #..##....#.##.##.#.#.# #..###......##.##....... ...####.@#......##..#....- #.###.........#......#.... #. #..(.....[.....†.##.### Throw: 2 darts (poison)Ngg  . #......#.#.##.# #...........##.#.....# #...........##.##.#..#S   ball python (constriction, wandering)##..........##.##.##.†#.....#.....##.##......###########..#.###..##.#Ngg .41.0 (5.0Nggq Nggo j.SS)Ngg E-2.0 (6Ngg Ngg z _The ball python hisses angrily. _You see here a poisoned dart.Nggl ! )..) .....#.#<##.##> #......#.#  #.S.#....##.#  ##...... #<.#...## #..##....#.# #..###......# #.@# #.###.........# #. #..(.....[.....† . #............#.#†.##.#  . #...........##  #...........#  ##..........#†#  .....#.....#Ngg. )..) .....#.#<##.##> #......#.#  #.S.#....##.#  ##...... #<.#...## #..##....#.# #..###......# #.@# #.###.........# #. #..(.....[.....† . #............#.#† . #...........## #...........#  ##..........#† .....#.....#Ngg7Ngg{8Ngg@ANggDb _A ball python is nearby!Ngg )..) .....#.#<##.##> #......#.#  #.S.#....##.#  ##...... #<.#...## #..##....#.# #..###......#Nggk8 #.@# #.###.........# #. #..(.....[.....† . #............#.#†.##.#  . #...........##  #...........#  ##..........#†#  .....#.....#Nggо )..) .....#.#<##.##> #......#.#  #.S.#....##.#  ##...... #<.#...## #..##....#.# #..###......# #.@# #.###.........# #. #..(.....[.....† . #............#.#† . #...........## #...........#  ##..........#† .....#.....#Ngg9NggNggLNgg.b _A ball python is nearby!Ngg8cNgg gF.SNggg[3.0 (13NggsNggv_ _f - 3 poisoned darts (gained 1)Nggn ##.#......^.<.##.###........)..)..........Nggo +.....#.#<##.##>#......#.# ##.### #...#....##.# .#..#..S...#. #<.#...##.# #..##.#.## #..###.@....##.##... ...####..#......#####.........#......#....#. #..(.....[.....Ngg"p ### ...#.#†.##.##.#......###.....##.†#.....#.....##.##.....NggGs NggȀ l.S4Ngg NggV Ngg,  ......##.#......^.<.##.###........)..)...............#.#<##.##>#......#.# ##.### #...#....##.# .#..#....... #<.#.S.##.# #..#.##.##.#.#.## #..###......##.##... ...####..#......#####.........#......#....#. #..(.....[.....### . #...#.#†.##. #...##.#...#...###.....##.†#gg} ;49mNgg Ngg .=5Nggէ Ngga [ _The ball python barely misses you. x2Ngg=  You hit the ball python.Ngg,E†Ngg516.3 (1.3NggNggO _You kill the ball python!NggNggNggNggRH _No target in view!Ngg!3NggNggNggNgg: _NggNggNggNggNggCNggc,NggNggNggNggrNggYNgg1NggNggBa _j - a throwing netNggk4NggNggNgg^NggNggbNggINggy,Ngg? Ngg Ngg: Ngg Ngg NggNggNggxNggNggNggc,NggNggNgg+'Ngg(,Ngg+Ngg-XNgg/,Ngg0Ngg1Ngg43,Ngg3Ngg5Ngg6,Nggo7Ngg8Ngg&:,Ngg:Ngg;Ngg<Nggm=,Nggv?Ngg@NggANggANggBNgg'D,Ngg ENgg]JXNgg|KNgg(L,NggLNggMNggONggO,NggQNgg RNggR,NggOWnNggJXNggY,Ngg6ZNgg-[Ngg[,Ngg\Ngg ^Ngg^Ngg^Ngg`Ngg*a,NggaNggScNgg^dNggdNggD] _An adder is nearby!Ngg]M # .# ######## . ##S ##. ..#....#.#......^.<Nggf)..# #........)..)..@##[.......#.#<##[........#.# ### #...#...  #...# ##......#.##S   adder#.#.NggBNggɤT.SNgg -5 _NggNggNgg%M ## . .# .# ######### . ##. ##.S# .....#.#......^.<).@# #..)..)...##[.......#.#<##[.....# #......#.#  #...#### #...#....##S   adder.#.#Ngg'Ngg/P.SNgg0&6Ngg=8NggF:Ngg  You completely miss the adder. The adder bites you.  You are poisoned.Ngg r1==--=Ngg G7.6 (1.3Pois Ngg NggǸ J _The adder poisons you! You block the adder's attack.Nggi=   You slash the adder!  The adder is almost dead.You feel sick. The adder barely misses you.Nggl> _0--=8.9NggG NggdJ = _The adder bites you but does no damage.Ngg7  You hit the adder.Ngg% .You kill the adder!Ngg3)h39-9-90.2Ngg0Ngg4$ _You feel sick.NggM  ## #.# ###. .###### .# ##. ##..# ....NggY.#.#......^.<)..# #..)..)...##[.......#.#<##[........#.#  #...#### #...#....##...##Ngg)Ngg*8---10Ngg4Ngg#7$ _You feel sick.Ngg4NggNgg^7--Nggo 0  You start resting. You feel sick.NggM-2.2 (1NggNggB[ _You are no longer poisoned.Ngg 3Ngg Ngg Nggٵ K8=Nggػ XNggu Ngg. Ngg Ngg Ngg_ U9=Ngg Ngg NggT Ngg Ngg Ngg9 Ngg` NggH BNgga x40=Ngg BNgg nNgg Nggh Ngg U1=NggA Ngg} Ngg Nggl Ngg ,Ngg NggA Ngg K2=Ngg} Ngg Ngg Ngg` Ngg Ngg! Ngg NggJ Ngg Ngg Ngg _ _You start resting.Ngg 15108.0)Ngg w3==1.2 (19NggD# Ngg% " _HP restored.Ngg&3NggNgg`NggNggUNggP",Ngg#Ngg#Ngg%Ngg*Ngg,Nggq-Ngg.Ngg1Ngg2NggY39=Ngg3Ngg;Ngg=Ngg4>Nggh?NggBNgg>E,NggFNggHNggKNggLNgg}ONggUBNggVNggYNgg],Ngg_Ngg(eNggqW #...S.K...# #...$.....# #.........# #......!..# ##.........# ##.........# #...# #Nggro# #.....# .# ###.##.# ..#####.... #.### .....##...###..........#...##....#......... S   ball python (constriction, asleep)#...#####.#......^.< K   kobold (asleep) #)..# #........)..) #...##[.......#.#<Ngg 20.2 (9.0)  A kobold and a ball python come into view.NggԁW  The kobold shouts! The ball python hisses angrily.Ngg NggNggG ...S.KS)KA bat comes into view.Ngg%8==1.2 (10.0)Ngg}Ngg:0 _The bat moves out of view.Ngg #.........#  #...S.K...#  #.........#  #......!..#  Ngg'p#.........#  #.........#  #......#  #..@##  #....# .#  #.##.#  #. #.###  #.##... #...##. #...###^.< #)..# )..) [<NggF #.........#  #...S.K...#  #.........#  #......!..#  #.........#  #.........#  #......#  #..@##  #....# .#  #.##.#  #. #.###  #.##... #...##. #...###^.< #)..# )..) [<Nggj,Ngg͔ NggNgg@_There are monsters nearby!Ngg*NggB #.........#  #...S.K...#  #.........#  #......!..#  NggDp#.........#  #.........#  #......#  #..@##  #....# .#  #.##.#  #. #.###  #.##... #...##. #...###^.< #)..# )..) [<NggtS #.........#  #...S.K...#  #.........#  #......!..#  #.........#  #.........#  #......# Ngg #..@##  #....# .#  #.##.#  #. #.###  #.##... #...##. #...###^.< #)..# )..) [<NggSNgguNggNggd _There are monsters nearby!NggM".b...S.K. ! ##...#...#.##..... ...# ##.# ###  #.##.# ..#####...NggW..##...b   bat (wandering)#...##..###NggFNggNggKNggNgg,Ngg.$..bS.KbNggV--2Ngg.0)NggVNgg%` _Found a dented zirconium amulet.Ngg + |   #).$......#  #".#  #.........#Ngg+ J  #...$.....#  #..bS.K...#   #!..#   #.#  #...# #  ###......##  #  Ngg,   #...##..... #   #....# .##.# ###   #.##.# ..#####   #. #.###   #.##...##   #...##....#........   #...#####.#......^.Ngg-1 Ngg2 Ngg3 Ngg5 Ngg6 NggjA ^....KSbNggcB ^2-=-Ngg C 3NggL NggP L _Found 10 gold pieces and a hand axe. The bat hits you.Nggz =  You hit the ball python.Ngg} ^  You kill the ball python!Nggv~ Nggy Ngg> Ngg4 b..KK   koboldNggȑ P-804.5 (1.3Ngg Ngg% : _The bat hits you but does no damage.NggP  You slash the kobold!NggqY  You kill the kobold!Ngg|Ngg5\b.)NggS3=1Nggb 5.8Ngg4Ngg 1 _You block the bat's attack.Ngg...).$"..$b.......! ...###......## ##..... ...# .##.# #####.# .#..##### #.### .Nggd##...###.....Nggn!,Ngg(".bNggn)Q2-6Ngg* 0Ngg-6NggE _The bat hits you.  Things that are here: _a +0 dagger; a kobold corpseNgg#########...).$".$b...NggE!) ...###......## ##..... ...#!.##.# #####.# ..#..##### #.###..##...###.Ngg:NggNgg%.bNggT3=7NggNggݜ _Found a brown potion. The bat barely misses you.Ngg^5  You hit the bat.Ngg f)Ngg Q=39.1 (1.3Ngg*NggG _You kill the bat!Ngg'W Ngg!X Ngg] Ngg_ H _No target in view!Ngg$ Ngg- Ngg Ngg H _No target in view!Ngg2MNgg9NNggiVNggYH _No target in view!NggT7     ###########  #...#  #).$......#  #".#  #.........#  #...$.....#Ngg8   #..@......#  #......!..#  #...).....#   #...# ###......##  #...##.....   #....#!.##.# ##  #.##.# ..#..#####  #. #.###.NggANggcB<-300 _Ngg{INggKNggcM #########...).$".$....!  #...).....##.##.# ..NggNggu@-1NggHNggNggZ       ###########  #...#  #).$......#  #".#  #.@.......#  #...$.....#  #.........#  #......!..#  #...).....#  #...# ###......##   #...##.....   #....#!.##.# #NggNggΛ&2NggENgg¢Ngg8         ###########  #..Ngg: .#  #).$......#  #.#  #.........#  #...$.....#  #.........#  #......!.#  #...).....#  #...# ###......## Ngg: L #...##.....NggD Ngg}E &3NggN Ngg+U NggU +4.1 (2Ngg8Z Ngg_ , _d - an amulet of faithNgg&NggPut on which piece of jewellery? Jewellery (go to first with "=)  d - an amulet of faithNgg c[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip Nggm1Ngg8Ngg@A deadiverson the Shield-Bearer  Human Health: 43/43 ========================Ngg\A> Magic: 5/5======================== AC: 6Str: 16 ###########EV: 7Int: 11 #.........#SH: 5Dex: 12 #).$......#XL:  5 Next: 83% Place: Dungeon:2Ngg #@........#Noise: ---------  Time: 1534.1 (0.0) #.........#a) +0 long sword #...$.....#Throw: 3 darts (poison) #.........# #......!..# #...).....# #.........#NggX ###......## #...##.....You hit the bat. _You kill the bat! _No target in view! _No target in view! _No target in view! _d - an amulet of faithNgg%  Ngg1 +Okay, then.Ngg NggD _Ngg/NggmNggiNgg9NggNggp$ _Ngg)NggbBNggNgg@M  You now have 50 gold pieces (gained 10).Ngg NggNgg< _You see here a +0 robe.Ngg&NggNggNggXNggNggNggNggaNggNggNggNggD,Ngg>NggL _You now have 54 gold pieces (gained 4).Ngg3NggCNggNggE,NggNgg9Ngg0,NggNgg ,NggJ Nggq _h - 2 potions of curing (gained 1)NggN3NggANggNggQ ,Ngg"Ngg$Nggv&Ngg&Ngg'Ngg;*NggR,Ngg,Ngg.Ngg3Ngg5NggA6NggA7NggF:,Ngg;NggBm _e - 2 brown potions (gained 1)NggqENggENgglGNggJNggLNggvMNggONggQNggT,NggVNggYNgg>[,Ngg\NggeNggh,Ngg5jNgglNggo,NggTqNggsNgguNggyvNgg?wNggyNgg{,Ngg9}NggNggNggNgg˃NgguNggNggNggNggNgg,Ngg(NggNgg,Ngg[NggޟNgg0,NggNggyNggNggaNggNggrNggNggNggNgg NgguJ There is a stone staircase leading up here.NggNgg _Ngg4NggNggBNggNgg$Ngg NggNggUXNggNgg,NggNggNgg?,NggNggNgg,NggxNggP  There is a stone staircase leading up here.NggNgg+ _NggNggNgg\NggNggLNgg Ngg+,NggiNggkNgg ,Ngg+Ngg5NggHNggNggNgg!Ngg#,Ngg5%Ngg'Nggz*Ngg*Nggl-Ngg3  Things that are here:  a +0 dagger; a goblin skeletonNggY7Ngg?8 _Ngg9NggS<Ngg>Ngg@?Nggv@Ngg&CNgg~ENggENggKGNggL&  NggMZThings that are here:  a +0 dagger; a goblin skeletonNggQNggeR _NggSNggZNgg\,Nggl^Ngg aNgg/cNggcNggdNggxgNggi,NggtkNggt  Things that are here: _a +0 dagger; a goblin skeleton  Things that are here: _a +0 dagger; a goblin skeleton  There is a stone staircase leading down here.NggwNggVx _NggzNgg{}NggNgg.NggMNggNggˆNgg3NggNgg Nggw,NggNggNgg$NggNggXNgg]Ngg?NggˬNgguNggNgg7NggNggܴNggNgg8NggNggNggNggNgg~NggNggkNgg,Ngg,Ngg,NggNggSNggO,NggNggNggNgg)NggNggNggNggNggYNggNgg,NggNggNgg;NggNgg NggpNggJ,NggNggNgg,NggpNggNgg,NggNgg>Ngg3,NggNgg>Ngg.,NggNgg%Ngg1NggNggNggNgg,NggNggNgg,NggNgg$Ngg ,NggNggNgg,NggNgg Ngg ,NggI Ngg Ngg,NggNggNggNgg,NggNggn,NggNggNgg,Ngg2NggRNgg:,NggNggNgg,NggNggNgg~,Ngg*Ngg!Ngg#,Ngg#Ngg&Ngg'Ngg;(Ngg(Ngg*Ngg+Nggm,Ngg,Ngg.Nggn0,Ngg1Nggx3Ngg4NggW5Ngg6Ngg8Ngg:,Ngg;NggWg...##.# #...# # ..###.###...##.....#.... ......†.)...#........... ..##...##.<............. ..#....##.............$> ..#....##............... ................ ###...######............ # ##### #...... 628.1 (94.0) # ##.###.....#.... # #######..# ####### # # #.......## ###.####### .....# .....# .....# ##.###9.1 (95Ngg[Ngg]; _Found a stone staircase leading down.Ngg!x_Nggy ..###...# .# #...################.###...##...†.)...###...##.<..#....##.$>#....## ............#...######.....0.0)  ##### #........... ##.###.....#....>  #######..# ####### ####  #....... Nggz##.####### ....#...# ....#Ngg}Nggk~,30.1 (1Ngg2O _Found an escape hatch in the floor.Ngg*NggB+Ngg+Nggq/Ngge1Ngg{2Ngg6,Ngg6Ngg6NggP7Ngg{9Ngg7;Ngg;Ngg]<Ngg>Ngg@,Ngg@NggANggBNggBNgg6CNggDNgg3ENggENggLL _You now have 62 gold pieces (gained 8).NggN3NggONgg[RNggSNgglSNggTNggqVNggW,NggXNgg+\Ngg^Ngg^Ngg}_NggnbNggd,Ngg#eNgghNggiNgg jNggjNggmNggo,NggmpNggqNggr,NggzsNggtNgguNgguNgg\vNggxNggzNgg'{Ngg|NggV~Ngg,NggNggNggNggNgg0NggbNggmNggNggoNgg[NggvNggNggFNggfNggeNgg,Ngg7Ngg8NggNggNggޑNggNggDNggNggNggNggNggNggNggNgg"NggNggNggF,NggNggNggNgg[NggNgg Ngg,NggNgg˥Ngg NggNggTNggCNggĪNggLNggNggNgg,Ngg=Ngg Nggݰ,NggdNggNNggnNgg޳NggsNgg&Nggҷ,NggҸNggԺNgg4NggNggNggNggw,NggNgg&NggNgg!NggNgg)Ngg,Nggr _k - 3 lumpy ruby potions (gained 2)Ngg*Ngg3NggNggvNgg,NggNggl,NggNggNggyNggNggGNggNggNgg~NggNgg5NggcNggNggKNggpNggNggNggNgg Ngg",NggNggNggNgg,Ngg0NggNggNggMNgg$NggNggNggjNggNggNgg?NggNggPNggNgg/NggNgg<NggNggNggrNgg~Ngg=,NggNggiNgg Nggk Ngg Ngg a  You see here a rat skeleton.Ngg Ngg  _Ngg Ngg Ngg ,Ngg/ Ngg Ngg  ,Ngg Ngg NggX Ngg Ngg} Ngg Ngg Ngg Ngg Ngg1 Ngg Ngg? Ngg Ngg} Ngg! Nggn" Ngg" Ngg$ Ngg>& Ngg& Ngg)' Ngg( Ngg* ,Ngg* Ngg+ Nggm, Ngg, Ngg- Ngg. Ngg. ,Ngg/ Ngg\0 Ngg+1 ,Ngg2 ,Ngg=3 BNgg3 NggR4 ,Ngg4 Ngg^5 Ngg6 Ngg6 Nggb7 Ngg8 NggG: Ngg: ,Ngg[< Nggk= Ngg= Ngg?> Ngg? NggA ,NggA NggC Ngg E ,NggF NggG Ngg!I ,NggI NggJ NggL BNggL Ngg,Ngg?NggF  Things that are here:  a +0 dagger; a goblin skeletonNggINggOJ _NggKNggTMNggNNggONggONggqQNgg3S,Ngg2UNggzZ  Things that are here:  a +0 dagger; a goblin skeletonNggH\Ngg\ _Nggu]Ngg^Ngg_,Ngg`NggbNgg6dNggdNgg fNgghNggj,Ngg*lNgglY  There is a stone staircase leading down here.NggmNggpNggp$ _NggrNgg';3Ngg,NggNgg*  .##########  #......@.[# 77.9 (23.8) #.#########  _You climb downwards.  Found a kite shield.NggNggENgg a _There is a stone staircase leading up here.Ngg Ngg NggK NggNggNgg%P _Ngg1>..## #....@.<.[#8.9 (1.0) #.Ngg*##Ngg%Nggj+9.9 (2Ngg5oNgg5q; _Found a stone staircase leading down.NggF>..# #.....@<.[# #.# NggΘNgg,80.9 (1NggNggNggf>..# #..[# NgggS#.# NggqNggDr&1NggvNgg\xa _There is a stone staircase leading up here.Ngg *>..# #......<@[# #.# Ngg} Ngg -2 _Ngg Ngg Ngg +>..# #......<.@# #.# Ngg> &3Ngg Ngg T _You see here a +0 kite shield.Ngg<4NggNggL NggЍ_l - a +0 kite shieldNggNggWear which item? Armour (go to first with [)  b - a +0 scale mail (worn)  c - a +0 buckler (worn)l - a +0 kite shield[?] describe selected Ngg [!] equip|wield|wear|put on[tab] equip|unequip Ngg Ngg Ngg ?deadiverson the Shield-Bearer HumanHealth: 43/43 ========================Magic: 5/5========================AC: 6Str: 16EV: 7Int: 11SH: 5Ngg Dex: 12>..##########XL:  5 Next: 83% Place: Dungeon:3#......<.@#Noise: ---------  Time: 1784.9 (0.0)#.#########a) +0 long swordThrow: 3 darts (poison)Found a kite shield. _There is a stone staircase leading up here. _Found a stone staircase leading down. _There is a stone staircase leading up here. _You see here a +0 kite shield. _l - a +0 kite shieldNggx Ngg3 +5.9 (1Ngg NggNgg+6.9 (2Ngg Ngg] Ngg+7.9 (3NggNggNggB+8.9 (4NggSNggPNgg+9.9 (5Ngg^"NggD$ 80 _You start removing your armour. You continue removing your +0 buckler. x4Ngg$Ngg'Ngg/  You finish removing your +0 buckler.  You start putting on your armour.Ngg0,90.9 (6Nggh3Ngg8Ngg9+1.9 (7Ngg<NggANggB+2.9 (8Ngg;ENggKNggL+3.9 (9Ngg&ONggTNggT/4.9 (10.0)NggWNggY3 69 NggYX_You continue putting on your +0 kite shield. x5NggZNgg ]Nggi_` _You finish putting on your +0 kite shield.Ngg*  Your movement speed is average.  Your attack delay is about 1.4 (and is slowed by your shield). Ngg Your damage rating with your +0 long sword is about 11 (Base 10 x 105% (Dex) x _112% (Skill)).Ngg/Drop what?12/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 long sword (weapon) Missiles (select all with ()  f - 3 poisoned darts (quivered)  j - a throwing net Armour (select all with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)c - a +0 buckler Jewellery (select all with "=)d - an amulet of faith Scrolls (select all with ?)  g - a scroll labelled XYD YCROOMM Potions (select all with !)  e - 2 brown potions  h - 2 potions of curing  i - a viscous pink potion  k - 3 lumpy ruby potions [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]Ngg)e(1 turn)  a - a +0 long sword (weapon)  c + a +0 buckler[Enter] accept (1 chosen)NggYNgggdeadiverson the Shield-Bearer HumanHealth: 43/43 ========================Magic: 5/5========================AC: 6Str: 16EV: 6Int: 11SH: 9Dex: 12>..##########XL:  5 Next: 83% Place: Dungeon:3#......<.@#Noise: ---------  Time: 1794.9 (0.0)Ngg4iL#.#########a) +0 long swordThrow: 3 darts (poison) _You continue putting on your +0 kite shield. x5 _You finish putting on your +0 kite shield.  Your movement speed is average.  Your attack delay is about 1.4 (and is slowed by your shield).  Your damage rating with your +0 long sword is about 11 (Base 10 x 105% (Dex) x _112% (Skill)).Nggi+5.9 (1NggmNggnq, _You drop a +0 buckler.Ngg^f >..#Ngg_ #......<@[# #.#NggeNggf&6Ngg2jNgglNgg@b >..# #......@.[# #.#NggENggVF&7Ngg2HNggcJa _There is a stone staircase leading up here.Ngg^ NggXa J  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting4.8   5.0   0   j - Spellcasting   0.0   1.2  -1      Ngg c      b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0               d - Short Blades   1.1   1.0   0       e - Long Blades   2.0   3.0   0               f - Armour   3.0   4.0   0       g - Dodging   0.0 ggc 39;49m  1.0   0       h - Shields   5.0   6.0   0       i - Stealth   0.0   0.8  +1                                              Ngg_d The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsNgg  a * Fighting   4.8Nggo a - Fighting   4.8Nggc> h + Shields 5.0NggKTargetTarget10.0 --  --  --  --  --  8.0  12.0 --  7.0  a-z] set[-] clear selected targetcost|targetsNgg<=[?25h[?0c0 Ngg" Ngg- [?25l[?1cNggW210.0   0 current training targets, if any.=] set aall targetsNgg deadiverson the Shield-Bearer HumanHealth: 43/43 ========================Magic: 5/5========================AC: 6Str: 16EV: 6Int: 11SH: 9Dex: 12>..##########XL:  5 Next: 83% Place: Dungeon:3#......@.[#Noise: ---------  Time: 1797.9 (0.0)#.#########a) +0 long swordThrow: 3 darts (poison)Your movement speed is average.  Your attack delay is about 1.4 (and is slowed by your shield).  Your damage rating with your +0 long sword is about 11 (Base 10 x 105% (Dex) x _112% (Skill)). _You drop a +0 buckler. _There is a stone staircase leading up here.Nggf _Nggsi NggWj $ _Ngg}o BNgg9p ,Nggq Nggu ,Nggv Nggw Ngg| ,Ngg} ,Nggw ,Ngg Ngg Ngg] .######....... #.>..########## #@.....<.[# #.#########...#Ngg A#.#..## ........BB   giant cockroach (asleep)#.....#......Ngg -802.9 (5Ngg }B.BNgg/ +3.9 (6Ngg Ngg? b _A giant cockroach comes into view.Ngg .###### ....... #.>..##########  #@.....<.[#  #.#########  ...# #.#..# # ..B. ..... #..... #......Nggs .###### ....... #.>..##########  #@.....<.[#  #.#########  ...# #.#..# # ..B. ..... #.....Ngg ? #...... Ngg&Ngg'Ngg-Ngg1f _A giant cockroach is nearby!NggWN.######....... #.>..########## #......<.[Nggc#########....# #.## ..B. ....#......#.......NgglNgg:B.Ngg24.9 (1 _NggNggjNgg){.######...... #.>..###########.. #......<.[#!..#.#########...@# #.B#.....#........h   jackal (wandering)#.........B   giant cockroach#.........hNgg4Z  A jackal comes into view.NggB5TFound a puce potion.NggZ6Ngg:>  The jackal barks!  Ngg;CA jackal comes into view.NggFhhh 2 jackals (1 wandering)NggsG/==5NggPNggU= _You block the giant cockroach's attack.Ngg \  The jackal barks!  You slash the giant cockroach!Nggr b  You kill the giant cockroach!Ngg2 Ngg Nggκ 5  You hear a bark!Ngg߻ Ngg Ngg> ,Ngg  ..h.J   endoplasm (h   jackalJ.  A jackal comes into view. An endoplasm comes into view.Ngg 547.4 (1.5NggQ Ngg 3 _The jackal moves out of view.NggF .######....... #.>..##########..#......<.[!..#.########NggH  #....# #.#..........#.....h.......h........h.J..hh 3 jackals (1 wandering)...NggN Ngg~O NggR 6  The jackal barks!NggR NggS Ngg^ Lh.h.hJ..hJ.hh 4 jackalsNgg_ ,80Ngg j Ngg]p Y _A jackal comes into view.Ngg.######....... >..#########...#......<.[#!..#.##########..#..# #....h......h.........h..J..h   jackal.#...........NggNgg^NgglJh...J.Ngg.-9Ngg/Ngg> _The jackal bites you but does no damage.Nggt! }######....... #.>..##########...#......<.[#!..#@#########...#.#.h# .......#......h...h   jackal.Jh.....hNgg# Nggt$ Ngg% Ngg. ihh 2 jackalsNggN0 A-10Ngg7 Ngg@ y _The jackal attacks as it pursues you! The jackal barely misses you.Nggpn .###### ....... #.>..########## #...#.@....<.[# #!..#.##########...h# #.#.h##...........#......h.... #...........#.......Jh..#.hNggXq Nggs Ngg} :h.Ngg~ &1Ngg Ngg> y _The jackal attacks as it pursues you! The jackal barely misses you.Ngg .###### ....... #.>..# #...#..@...<.[# #!..#h# #...h# #.#..##....#......h....    jackal#....#.... Ngg3 Ngg Nggh.h 2 jackalsNgg_.-2Ngg9Ngg\ NggC.###### ....... #.>..# #...#.h.@..<.[# #!..#h# #....# #.#Ngg..###......h.... Ngg՘NggěNggNgg- hh 3 jackalsThe jackal attacks as it pursues you! The jackal barely misses you.NggE.=3Ngg Nggܺ> _The jackal bites you but does no damage.Ngg .###### ....... #.>..# #...#.hh.@.<.[# #!..#h# Ngg#....# #......h.... Ngg`NggCNgg)Ngg`h.hh.Ngg|&4NggCNggy _The jackal attacks as it pursues you! The jackal barely misses you.NggN;V.###### . #.>..# #...#h.hh.@<.[# #!..#.# #....# Ngg<P#......h.... Ngg?Ngg&@Ngg ANggANggBNggCNggM{.hhhhh 4 jackalsNggN.-5NgglVNggYNgg5# :  You slash the jackal!Ngg% Ngg& Ngg' NggW( %  Ngg) 4You kill the jackal!Ngg2 .JJ   endoplasmhhh 3 jackalsNggo7 =5=6.9 (1.5Ngg? NggxC 4 _You block the jackal's attack.Ngg Ngg NggF Ngg\ Jhh.  You closely miss the jackal. The jackal barely misses you.Ngg (8.4Ngg Ngg" > _The jackal bites you but does no damage.NggNgg*Ngg Ngg -9.8 (1.4Ngg%NggOQ _You barely miss the jackal.Ngg$  You miss the jackal.The jackal bites you but does no damage.Nggݒ.21.3 (1.5NggtNggT _The jackal closely misses you.Ngg0  You hit the jackal.  The jackal is moderately wounded.The jackal bites you but does no damage.Ngg1(2.8NggP9Ngg=4 _You block the jackal's attack.Ngg:  You slash the jackal!NggKNggkNgg{ . 2You kill the jackal!Ngg074.3NgglNggv4 _You block the jackal's attack.NggC Ngg .J  You hit the jackal but do no damage. You block the jackal's attack.Ngg -5.7 (1.4Ngg7 Ngg/ S _The jackal barely misses you.Nggp :  You slash the jackal!Ngg=s Nggru Y  You kill the jackal!Nggc~ {.J   jackalNgg 587.2 (1.5NggL Ngg 4 _You block the jackal's attack.Ngg(  You closely miss the jackal.The jackal bites you but does no damage.Ngg~-8.6 (1.4NggNggS _The jackal barely misses you.Nggs  You hit the jackal.  The jackal is moderately wounded.Nggu.30.1 (1.5Ngg@NggoA _The jackal bites you but does no damage. x2Ngg  You closely miss the jackal.The jackal is moderately wounded.Ngg^39---1.5 (1.4NggNgg˾. _The jackal bites you. x2NggK  You hit the jackal.  The jackal is severely wounded.NggM (2.9NggS Ngg>W 7 _You block the jackal's attack. x2Ngg K  You barely miss the jackal.The jackal is severely wounded.40=--4.3 _You block the jackal's attack. x2Ngg_8  You hit the jackal.NggNggn .J  You kill the jackal!Ngg595.8 (1.5NggNggxV _The endoplasm barely misses you.Ngg|Ngg=e1=7.2 (1.4Ngg|NggT _You hit the endoplasm but do no damage. The endoplasm barely misses you.Ngg  You hit the endoplasm.  The endoplasm is severely wounded.Nggl-8.7 (1.5Ngg$Ngg2(C _The endoplasm hits you but does no damage. x2Ngg  You hit the endoplasm but do no damage.The endoplasm is severely wounded.NggU)40.2Ngg^Ngg@ _The endoplasm hits you but does no damage.Ngg  The endoplasm is severely wounded. _The endoplasm hits you but does no damage.  You hit the endoplasm.  The endoplasm is almost dead.  The endoplasm barely misses you.  The endoplasm freezes you.Ngg X37--1.7Ngg Ngg % _You are frozen.Nggl ;  You hit the endoplasm.Ngg'w E†Ngg8{ 1903.2Ngg@ NggX M _You kill the endoplasm!Ngg .###### . #.>..# #...#....@.<.[# #!..#.# #....#  #.#..#  #Ngg.  #......h....  #.  #.Jh..  #.hNggNggm8=--40NggNgg  Things that are here: _a jackal corpse; a jackal corpse; a jackal corpseNgg .###### ....... #.>..# #...#...@†.<.[# #!..#.# #....#  #.#..#  #.  #......h....  #.  #.Jh..  #.hNggNggGG-5 _NggNggNggE3NggFNgg]HNggFMnNgg?ONggOU9=NggPNggR,NggSNggU,NggVNggY,NggZNgg\b40=Ngg]Ngg~_,Ngg cNgge,NggYfNggh,NgghNggmjNggkU1=NggkNggym,NggnNggp,NggqNggrNggsK2=NggsNggu,NggvNggNx,Ngg?yNggz,NggU{Ngg_ _You start resting.Nggފ0627.0)Nggw3==3.2 (18NggǐNgg-" _HP restored.Ngg3NggjNggZNggNggXNgg,Ngg: ,Ngg Nggd,Ngg/,Ngg#0Ngg_2Ngg5Ngg59=Nggs6NggX9NggX;Ngg;Ngg}<Ngg>Ngg@NggPANggANgg]DNgg/FNggFNggaGNggN....######### ......... #.>..########## #...#....†.<.[# NggzO#@..#.######### ##....#  #.#..# #........... #........... #........... #........... #..........h #...........NggU270.2 (7.0)NggW+1.2 (8Ngg[Ngg/_Q _c - a puce potionNgg]wNggx3NggzNgg|,NggnNgglNggԓ`Ngg,NggNggCNggNgg(NggNggۛNggߞ,Ngg}NgglNggXNggtNggL,NggNgg #...#  #...#   #...##########   #.............   #...##.>..#########  Ngg ##.###...#....†.<.[  .# #...#.########  ###.####....#  #..@..##.#..#  #.....##...........  #.....##...........  #.....##...........  #.....##........... Nggaf #.....##..........h w   dart slug (asleep)  #.....##........... g   goblin (asleep)  #.w.g.##...........  NggL 82.2 (11.0)  A goblin and a dart slug come into view.Ngg: wNggrggw..  The goblin shouts!Ngg? ``Nggm````The dart slug launches a dart at you.NggalK......Nggm5==3.2 (12NggvNgg|z@ _The slug dart hits you but does no damage.Ngg\4 #...# #...# #...  #......  #...##.> ##.###.†.<.[ #.# #. ###.###  #..@..#  #.....#  #.....#  #.....#  #.....#  #.....#  #...g.#  #.w...# Ngg Y  #...# #...# #...  #......  #...##.> ##.###.†.<.[ #.# #. ###.###  #..@..#  #.....#  #.....#  #.....# #.....# #.....#  #...g.# NggZ #.w...#NggJc 4Nggm Nggo d _There are monsters nearby!Ngg 4 #...# #...# #...  #......  #...##.> ##.###.†.<.[ #.# #. ###.###  #..@..#  #.....#  #.....#  #.....#  #.....#  #.....#  #...g.#  #.w...# Ngge < #...# #...# #...  #......  #...##.> ##.###.†.<.[ #.# #. ###.###  #..@..#  #.....#  #.....#  #.....# #.....#Nggg l #.....#  #...g.#  #.w...#Ngg)p Ngg0q Nggy Ngg} d _There are monsters nearby!Ngg #...##########...........##.>..##########.###...#....†.<.[ #.# #...#.###########.####....# .....##.#..........hg.w.....Ngg^ Ngg( (g.Ngg/ `````The dart slug launches a dart at you.Ngg D.....Nggv 9-4.0)Nggb Ngg . _You block the slug dart.Ngg;#########..........##.>..##########.###...#....†.<.[ #.# ###########.####....# .....##.#..........gh..w......# ##Ngg@NggxI(g.NggJO--5NggFRNgg[UNggD$..........##.>..##########.###...#....†.<.[ #.# ###########.####....# .....##.#..........g.h.w......# ## #..?NggNggè:w.Ngg.=6NggNggе _Found a scroll labelled JUDAXY DOSHAXE. You block the goblin's attack.Ngg8  You hit the goblin.Ngg , )  You kill the goblin!Ngg2 ``The dart slug launches a dart at you.NggA).NggQf39---27.7 (1.5NggxNgg- _The slug dart hits you.Nggc##.>..##########.###...#....†.<.[ #.# ###########.####....# .....##.#...........hw...## #..?#####NggoNggu `The dart slug launches a dart at you.Ngg'.Nggg41=--80NggTNgg6  _The slug dart hits you but does no damage.  Things that are here: _a +0 club; a goblin corpseNggT #.###...#....†.<.[ #.# ###########.####....# .....##.#..........)hw....### #..?#####Ngg@ Ngg &9Ngg Ngg0 7 _You block the dart slug's attack.Ngg,&  You hit the dart slug.  The dart slug is severely wounded.Ngg' .91.1 (1.4Ngg- Ngg0 7 _You block the dart slug's attack.Ngg!  You hit the dart slug..2==42.6 (1.5NggNggC7 _You kill the dart slug!NggNgg4Ngg6NggٌH _No target in view!Ngg3NggNggNggDf _NggNggNggNgg)Ngg93NggxE==NggVNggNgg,Ngg>NggNggD,NggNgg3Ngg,NggNggNggNgg9=NggVNggNgg;,NggrNgg#.....##........... #.....##........... ..)............##..........h.#####.............# #####.....#  -######  Ngg /901.6 (9.0NggI-2.6 (10.0)Ngg Ngg#d _m - a scroll labelled JUDAXY DOSHAXENggNgg,3NggNggNNggNgg},Ngg-NggNggƌNggNgg,NggNggLNgg4,NggNggNgg,NggfNgg Ngg,NggiNgg;Ngg,NggNggRNgg,Ngg,Ngg_,Ngg NggNgge,Ngg NggɡBNgg,Ngg>,NggۣNggNggCBNggNgg֦,NggyNgg#Ngg,NggJNgg|Ngg,Ngg̭NggNgg#,Ngg ,Ngg,NggNggONgg,NggNggNgg,NggNggPNggN,NggNggNgg0,NggNgg?Ngg_,NggNgg  #.# #.....#   #.# #######   #.#  #.########   #......... Ngg  #.########   #........#  #.####.###.##  #.# #.@.....#  #.# ..#  #.##  #.#  #.#  #.   Ngg9-25.6 (23Ngg,6.6 (24NggNgga _n - a scroll labelled DEGEUR JITSNggv" INggI$ Ngg% Ngg& ,Ngg* BNgg+ Ngg, NggY. Ngg. ,NggF0 Ngg1 Ngg\2 ,Ngg4 Ngg7 ,Ngg{8 Ngg: Ngg< Nggd= Ngg > NggB NggD NggnE NggPF NggI Ngg7K NggK NggL NggO Ngg,R NggR NggS NggV NggY ,Ngg{[ Ngga #.#####.....# #.# #.....##.......... #.# ########.......... #.# #.......... #.######## ###.......... #......... ............ #.############.......... #........#.............. #.####.###.##..... #.# #.......#........... #.# ######..#........... #.# #..#........... #.# #..#........... #.# #..#........... #. #..#........... Nggc #..#.#######.## ..#NggKh -36.6 (10Ngg#i ,7.6 (11Nggm Nggt - _o - a wand of acid (15)Ngg: Ngg"< 3Ngg0? Ngg@ NggA NggE ,Ngg)G ,Ngg;H NggK Ngg|M NggM NggvN NggP Ngg:S ,Ngg+T Ngg4V NggX ,NggY Ngg[ Ngg\ Nggh^ Ngg^ Ngg^` Nggb Nggg XNggk XNggn ,Nggbo Nggr Nggu ,Nggbv Ngg5y Ngg{ NggC} Ngg~ Ngg Ngg5 NggĂ Ngg Ngg/ Ngg ,Ngg Ngg8 Ngg ,Ngg Nggk Nggg .##.................... .##...........$# .##........... .##...........##..............$  #...........##............ ................##............. .............#........... .#........... .#........... .#...........h   Natasha (asleep) .#...........#. NggΞ .#...............h......... .#...........####Ngg -51.6 (14Nggʬ vhh.Ngg ,2.6 (15Ngg Ngg _Natasha, Servant of Life and Death comes into view. _You see here 10 gold pieces.NggeB{Evoke which item? Wands  o - a wand of acid (15) [!] read|quaff|evoke[?] describe selectedNggNggmNggf.##....................deadiverson the Shield-Bearer .##...................$.# Human .##.....................Health: 43/43 ======================== .##.....................Magic: 5/5======================== ###..............$......AC: 6Str: 16#.....................EV: 6NggߟCInt: 11 ###.....................SH: 9Dex: 12 ........................XL:  5 Next: 94% Place: Dungeon:3 ###.............@.......Noise: ---------  Time: 1952.6 (0.0) ........................a) +0 long sword ##......................Throw: 3 darts (poison) .#...................... .#...................... .#......................h   Natasha .#..............h.......#. .#......................... .#...........#### _No target in view! NggX_m - a scroll labelled JUDAXY DOSHAXE _n - a scroll labelled DEGEUR JITS _o - a wand of acid (15) _Natasha, Servant of Life and Death comes into view. _You see here 10 gold pieces.Ngg$Ngg.##....................  deadiverson the Shield-Bearer .##...................$. # Human .##.....................  Health: 43/43 ======================== .##.....................  Magic: 5/5======================== ###..............$......  AC: 6Str: 16  #.....................  EV: 6Int: 11 ###.....................  SH: 9Dex: 12 ........................  XL:  5 Next: 94% Place: Dungeon:3 ###.............@.......  Noise: ---------  Time: 1952.6 (0.0) ........................  a) +0 long sword ggm##......................  Throw: 3 darts (poison) .#...................... .#...................... .#......................  h   Natasha .#..............h....... #. .#...................... ... .#...........#### _o - a wand of acid (15) _Natasha, Servant of Life and Death comes into view. _You see here 10 gold pieces.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - youNggr h.##....................deadiverson the Shield-Bearer .##...................$.# Human .##.....................Health: 43/43 ======================== .##.....................Ngg Magic: 5/5======================== ###..............$......AC: 6Str: 16#.....................EV: 6Int: 11 ###.....................SH: 9Dex: 12 ........................XL:  5 Next: 94% Place: Dungeon:3 ###.............@.......Noise: ---------  Time: 1952.6 (0.0) ........................a) +0 long sword ##......................Throw: 3 darts (poison) .#...................... .#...................... .#......................h   Natasha .#..............h.......#. .#......................... .#...........Nggv v#### _o - a wand of acid (15) _Natasha, Servant of Life and Death comes into view. _You see here 10 gold pieces.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - youOkay, then.Ngg. Ngg Ngg . _Ngg p$.#. .. #.........$  #............... ###..... ....... ###...$ .... ##... .#....h#....###########.##Ngg Ngg **Ngg l  Natasha casts a spell at you.Nggy8@NggzX3.6 (1Slow NgggNgg2 _You feel yourself slow down.NggNggEvoke which item? Wands  o - a wand of acid (15) Ngg[!] read|quaff|evoke[?] describe selectedNggيNggNgg{O.##...................$.# deadiverson the Shield-Bearer .##.....................Human .##.....................Health: 43/43 ======================== ###..............$......Magic: 5/5========================#.....................AC: 6Str: 16 ###.....................EV: 6Int: 11 ........................SH: 9Dex: 12 ###.............$.......XL:  5 Next: 94% Place: Dungeon:3 ................@.......Noise: ---------  Time: 1953.6 (0.0) ##......................a) +0 long sword .#......................Throw: 3 darts (poison) Nggw.#......................Slow .#...................... .#..............h.......#. h   Natasha .#......................... .#...................... #### .#.#######.## _You see here 10 gold pieces.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - you _Okay, then.Natasha casts a spell at you. _You feel yourself slow down.Ngg}.##...................$. # deadiverson the Shield-Bearer .##.....................  Human .##.....................  Health: 43/43 ======================== ###..............$......  Magic: 5/5========================  #.....................  AC: 6Str: 16 ###.....................  EV: 6Int: 11 ........................  SH: 9Dex: 12 ###.............$.......  XL:  5 Next: 94% Place: Dungeon:3 ................@.......  Noise: ---------  Time: 1953.6 (0.0) ##..............*.......  a) +0 long sword .#.........Ngg[m.....*.......  Throw: 3 darts (poison) .#..............*.......  Slow .#..............*....... .#..............h....... #. h   Natasha .#...................... ... .#...................... #### .#.#######.## _Okay, then.Natasha casts a spell at you. _You feel yourself slow down.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - NatashaAim: Natasha (64% to hit)Ngg@.##...................$.# deadiverson the Shield-Bearer .##.....................Human .##.....................Health: 43/43 ======================== ###..............$......Magic: 5/5========================#.....................AC: 6Str: 16 ###.....................EV: 6Int: 11 ........................SH: 9Dex: 12 ###.............$.......Ngg,XL:  5 Next: 94% Place: Dungeon:3 ................@.......Noise: ---------  Time: 1953.6 (0.0) ##..............*.......a) +0 long sword .#..............*.......Throw: 3 darts (poison) .#..............*.......Slow .#..............*....... .#..............*.......#. h   Natasha .#......................... .#...................... #### .#.#######.##Natasha casts a spell at you. _You feel yourself slow down.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - NatashaAim: Natasha (64% to hit)  The bolt of acid hits Natasha!Ngg_ _You feel yourself slow down.  Aiming: Corrosive Bolt  Press: ? - help, Shift-Dir - straight line, f - NatashaAim: Natasha (64% to hit)  The bolt of acid hits Natasha!  Natasha is almost dead.Nggh...h5.5   cerulean imp (polearm, summoned)====5.1 (1.5Ngg Ngg&c _Natasha mumbles some strange words.Ngg4NggNgg,F _Unknown command.NggG NggI rEvoke which item? Wands NggJ  o - a wand of acid (14) [!] read|quaff|evoke[?] describe selectedNgggNgg Ngg.##...................$.# deadiverson the Shield-Bearer .##.....................Human .##.....................Health: 43/43 ======================== ###..............$......Magic: 5/5========================#.....................AC: 6Str: 16 ###.....................EV: 6Int: 11 ........................SH: 9Dex: 12 ###.............$.......XL:  5 Next: 94% Place: Dungeon:3 ................@.......Noise: ====-----  Time: 1955.1 (0.0) ##......................a) +0 long sword .#......................Throw: 3 darts (poison) .#......................Slow .#..............gg\0mh....... .#.............5........#. h   Natasha .#......................... 5   cerulean imp (polearm, summoned) .#...................... #### .#.#######.##Press: ? - help, Shift-Dir - straight line, f - NatashaAim: Natasha (64% to hit)  The bolt of acid hits Natasha!  Natasha is almost dead. _Natasha mumbles some strange words. _Unknown command.NggJ:.##...................$. # deadiverson the Shield-Bearer .##.....................  Human .##.....................  Health: 43/43 ======================== Ngg<###..............$......  Magic: 5/5========================  #.....................  AC: 6Str: 16 ###.....................  EV: 6Int: 11 ........................  SH: 9Dex: 12 ###.............$.......  XL:  5 Next: 94% Place: Dungeon:3 ................@.......  Noise: ====-----  Time: 1955.1 (0.0) ##..............*.......  a) +0 long sword .#..............*.......  Throw: 3 darts (poison) .#..............*.......  Slow .#..............hgg0=m....... .#.............5........ #. h   Natasha .#...................... ... 5   cerulean imp (polearm, summoned) .#...................... #### .#.#######.##Natasha is almost dead. _Natasha mumbles some strange words. _Unknown command.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - NatashaAim: Natasha (almost dead, 64% to hit)Ngg.##...................$. # deadiverson the Shield-Bearer .##.....................  Human .##.....................  Health: 43/43 ======================== ###..............$......  Magic: 5/5========================  #.....................  AC: 6Str: 16 ###.....................  EV: 6Int: 11 ........................  SH: 9Dex: 12 ###.............$.......  XL:  5 Next: 94% Place: Dungeon:3 NggE................@.......  Noise: ====-----  Time: 1955.1 (0.0) ##......................  a) +0 long sword .#......................  Throw: 3 darts (poison) .#......................  Slow .#..............h....... .#.............5........ #. h   Natasha .#...................... ... 5   cerulean imp (polearm, summoned) .#...................... #### .#.#######.##Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - NatashaAim: Natasha (almost dead, 64% to hit)  The bolt of acid hits Natasha!! The acid corrodes Natasha!  You kill Natasha!Natasha screams in pain as she dies!Ngg$. ............... ............... ....  .... .... .... .... .... .......*....... .......*....... .......*....... .......*.............§*....... ............... ............... Nggl...§...§Nggr.##...................$.# deadiverson the Shield-Bearer .##.....................Human .##.....................Health: 43/43 ======================== ###..............$......Magic: 5/5========================#.....................AC: 6Str: 16 ###.....................EV: 6Int: 11 ........................SH: 9Dex: 12 ###.............$.......XL:  5 Next: 117% Place: Dungeon:3 ................@.......Noise: ====-----  Time: 1956.6 (1.5) ##......................a) +0 long sword .#......................Throw: 3 darts (poison) .#......................Slow .#.............Nggs$§........ .#......................#. .#..............§.......... .#...................... #### .#.#######.##Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - NatashaAim: Natasha (almost dead, 64% to hit)  The bolt of acid hits Natasha!! The acid corrodes Natasha!  You kill Natasha!Natasha screams in pain as she dies!Nggy/  --more--Ngg _The cerulean imp disappears in a puff of smoke!You have reached level 6!Nggׇ /  --more--NggtE50/506/66 9% Ngg{Ngg#~6 _Ngg2 M.  $# .. ##$  ### .... ### .. #.#......................Ngg ............... Ngg b.§§§.Ngg N----8.1 _NggR Ngg )...Ngg J----9.6 (3.0NggN Ngg 6 _You now have 84 gold pieces (gained 10).Ngg^M . $# .. ##$  ### ... ### .. #.#.....................................NggaNgg.61.1 (1.5NggNggNggM . $# .. ##$  ### ... Ngg### .. ##.....................................NggNgg(2.6NggNgg˨Ngg"o##. ##.# ##.# ##..# ##.$## ##.... ##.Ngg$$  #. ## ... ## .. #. #.# #.# #.  NggM*Ngg*(4.1Ngg.Nggz/Nggt M ....# $##.. # ## .. ##....................................#Ngg}{ Nggp| (5.6Nggρ Ngg Nggx -7.1 (3.0Nggi Nggސ 6 _You now have 99 gold pieces (gained 15).Nggj. .# .# .# .#.$.##. #.. #.. #. #..#+ #.##NggDl0  .#  .##  .# # NggRtNggRu-8.6 (1.5NggzNgg|Ngg^. .# .# .# .# .Ngg$.##. .. .. .. ..#+. .#.b#. b   bat (asleep)#.##+#.# #.NggNgg Ngg, Ngg| Ngg=`b.bNgg8)70.1Ngg@Ngg N _A bat comes into view.Ngg2 # # # #$.Nggm44##....:...#b.+.##.##.##.##+##.# #.Ngg<6Ngg7Ngg9Ngg>,NggFb.rr   rat (wandering)The bat hits you.NggG_49-=1.6NggrONggRV _A rat comes into view.NggL # # # # .####. $##.......:.....b ..###.. +.#.r#.#.= #.#.... #.##+##.NggSNgg  Found a large glass ring. The bat attacks as it pursues you!NggNggqb.r.rNggW50=3.1Ngg Ngg x _The bat barely misses you. The bat hits you but does no damage. x2Ngg$ NggF " Ngg (# Nggu (# Ngg! (# Ngg (# Ngg| -# Ngg< W.####.# Ngg $Nggo Y# ##.... Ngg& # ...:.#.# ....#b# ...## ..## ###.#..# +.#.#r..# #.#.=# #.#.#.... #...#Ngg` Ngg NggC Ngg_ Ngg Ngg Ngg ab.r.Ngg (4.6Ngg Ngg Q _The bat closely misses you.Nggw E#  ..! ..####.# ##.... ....:b... .r##+.#.#..=##Ngg NggQ Ngg^ Ngg= NggQ ].b..r.Nggp (6.1Nggї Ngg _Found a fuming silvery potion. The bat barely misses you. _You see here 8 gold pieces.Ngg{M  You now have 107 gold pieces (gained 8).NggNgg-%  Ngg͕EYou feel yourself speed up.NggNggҗNgg!NggZb.r....Ngg07.6Ngg7NggܰP _The bat barely misses you.Ngg*H........ ..!......#.....#.#.#.#.#Nggu.####.#......# ##.....# ...:.b.r......# ........# ....# ...# ###..# +.#..# #.#.=# #.#.. #...NggYNggkNggNgg[48-80NggNggM _The bat hits you but does no damage. The rat bites you.NggT p ..!......# # # # # # ####.# # ##.... # ...:.#b.r......# ....## ...## ..## ###.## +.#.## #.#.=# #.#.# #...#Ngg Ngg NggM 'b..Nggi &9Ngg Ngg ` _The bat hits you but does no damage. The rat bites you but does no damage.Ngg  ..!......# # # # # # ####.# b.# ##.... Ngg D# ...:.# r......# ....# # ...# # +.#.## #.#..<=# #.#.# Ngg  Ngg( Ngg4 '.b.Ngg5 U9-80NggN? NggrC m _You block the bat's attack. The rat closely misses you.Ngg' ..!......# # # # NggS# # #####.# # ##.... # ...:.# br......# ....# # ...# # ..# ## ###.# .# +.#.##.# #.#..<.=# #.#.# NggNggNgg*NggͤNggI8r..bNggG.-1NggǵNggmNgg` ..!......# ..# ..# .# .# # # ####.# # ##.... r.@...# ...:.# b.....# ....# # ...# # ..# ## ###.# .# +.#.##.# #.#..<.Nggx=# #.#.# NggNggNgg\'F.b.rNggk(.=2Ngg0Ngg*2V _You block the bat's attack. The bat hits you but does no damage.NggNr ..!......# .....# Nggs....# ...# ..# #.# .# ####.# # ##.... b.@..# ...:.# r....# ....# # ...# .# ..# ##.# ###.# .# +.#.##.# #.#..<.=# #.#.# Ngg\wNggoxNggyNggzNggF.r.bNgg.-3Ngg@NggNgg<g ..!# .#....# .#....# .#....# .# ....# .# ...# .# ####.# .@.# ##.... r...# ...:.# b...# ....# # ...# .# ..# ##.#Ngg>g# ###.# .# +.#.##...## #.#..<....=# #.#.######Ngg-ANggBNggCNggK8r.NggL]50==4NggRNggT: _The bat hits you but does no damage.Ngg S #.#  ..!# #.# # #.# # #.# # #.# Ngg n...# #.# ...# #.# ...####@# r..# ##.... ...# ...:.# #b...# ....# .## ...# ...# ..# ##.### ###.# .....# +.#.##...### #.#..<.....Ngg5 Ngg Ngg Nggާ Ngg P.rb.Ngga .-5Ngg Ngg NggF ####. ..! ...####.# ......rb# ##.... ........: ..... .#......# ..... ..# ##.##.Ngg [###.# .....+.#.##...##Ngg Ngg{ ,Ngg. hr.=6NggO Nggl : _The bat hits you but does no damage.Ngg <.[ #####. ..! #.####r# ..b# ##.........: ... .#......# ...... ..# ##.#####.# .....NggNgg(NggNgg:r.NggZ.-7Ngg;Ngg NggI M### <.[g #####. ..!. #r ............####.#g   goblin (asleep).....#NggNgg.Ngg&  A goblin comes into view. It is wielding a +0 club.Ngg3-.gr.b.gNgg1.J==8Ngg6Ngg^9^ _The rat attacks as it pursues you! The rat bites you but does no damage.Ngg:NggyNgg\d.gb.90.0 (1.4Ngg~Nggxk _You closely miss the rat. You block the rat's attack.NggZn5  You hit the rat.NggpNggr%  Ngg)s1You kill the rat!Ngg(tNggOuNgg}n.g†.bNgg(1.4NggNgg: _The bat hits you but does no damage.Ngg.]<.[. ##### ..#g .. ..!......# #.....Ngg0.###b.....# ##.... ...:.# #. ..... .... ..# ##.#####.# .....NggrNggNggn..gbNgg:).2Ngg: 0NggNggV _The bat completely misses you. The bat closely misses you. _You see here a rat corpse.Ngg 7  You slash the bat!Ngg\ Ngg Ngg% @.g†Ngg, -3.8 (1.4Ngg4 Ngg7 G _You kill the bat!Ngg> ~##### ..# .. ..!......#....g.†###......# ##.......# ...:.# #.. ......Ngg ...... ..# ##.##...###.# .....+.#.##...##Ngg Ngg` &.gNgg1 4-40Ngg\ Ngg p _You see here a bat corpse.Ngg~<.[ #####. ..!.g #†####.# ...# ##....Ngg{.....: ... .#......# ...... ..# ##.#####.# .....NggyNgga.=5NggNggc _The goblin barely misses you. _You see here a rat corpse.Ngg:  You slash the goblin!Ngg'e)Ngg'6107.3 (1.5NggDNggJ _You kill the goblin!NgguNggvNggN}Ngg5H _No target in view!NggNgg'Ngg NggH _No target in view!NggR s ##### ..Ngg'T &# .. ..!......#....)†###......# ##.................# .................# +.#.##...## NggE[ Ngg[ 2-80 Ngg[ _Ngg{` Nggc  Nggc b_You see here a bat corpse.Ngg x  ..# .. ..!......#....)††##........# ##....Ngg ........# ...:.# #..................# .................# #.#..<..... Ngg Ngg !-Ngg &9 _Ngg9 NggF Ngg # .. ..!......#....)†Ngg.†...####........@# ##.... ...:.# # ...Ngg;.........# ................=# #.#.####### Ngg&?2000Ngg+Ngg-Nggg .. ..!......#....)†.†...####......# ##.... ...:.# # .... ..........=# ................. #...#NggNgg&1NggpNggNggV ....).†...# #†Ngg,Wm..####......# ##....NggUW ...:.# # ....NggZ ... ..# ##.## .................# #...###+# NggaNgga&2Ngg;gNggiNggɻH ).†..# #†.####......# ##....Nggt ...:.# # .... ... ..# ##.#####.# ..... ............##+#.# #...# NggQNgg&3NggNgg~Nggu )...# #†..# #†.####......# ##.... ...:.# #Ngg .... ... ..# ##.#####.# .....+.#.##...##Ngg...# #.# .................#NggNgg)&4Ngg*&Ngg'Nggw  †.# #†####......# ##.... ...:.# # ...NggXw . ... ..# ##.#####.# .....+.#.##...###.#..<..... ............ #.. .....##.....#Ngg Nggi &5Ngg Ngg~ Ngga  †####......# ##.... ...:.# # .... ... ..# ##.#####.# .....+.#.##...###.#..<.....=#######..### ....................Ngg Ngg2 &6NggZ Ngg NggS ###......# ##.... ...:.# # .... Ngg<... ..# ##.#####.# .....+.#.##...###.#..<.....=#######...# ............ ######...NggK"Ngg#&7Ngg(Ngg+Ngg3 .....# ##.... ...:.# # .... ... ..# ##.#####.# .....+.#.##...###.#..<.....#######...# ##+#.. #####Nggh>Ngg>&8NggCNggJNgg[K+9.3 (2Ngg;PNggR. _p - a +5 ring of evasionNggg|Put on which piece of jewellery? Jewellery (go to first with "=)  d - an amulet of faithp - a +5 ring of evasion[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip Nggw .................# ##....deadiverson the Shield-Bearer .................# ...:.# # Human .................# ....# .# Health: 50/50 ======================== .................# ...# ... Magic: 6/6======================== .................#..# ##.## AC: 6Str: 16 .................# ###.# ..... EV: 6Int: 11 .................# +.#.##...## SH: 9Dex: 12 NggҖ .................# #.#..<..... XL:  6 Next: 10% Place: Dungeon:3 ................@# #.#.####### Noise: ---------  Time: 2009.3 (0.0) .................# #...#a) +0 long sword ............##+#.# #...#Throw: 3 darts (poison) ............# #.# #...# ............ #.. .....# ............ ### #.....## .................... ............ ######... #####You slash the goblin! _You kill the goblin! _No target in view! _No target in view! _You see here a bat corpse. _p - a +5 ring of evasionNgg[ Ngg &11Ngg 8 (0.5Ngg Ngg( : _p - a +5 ring of evasion (left hand)Ngga-Ngg-Ngg-NggR5XNggt8.# ...:.#.# ....# ..# ...# ...# ..# ##.#.# ###.# .....# +.#.##...#.# #.#..<.....# #.#.######.# #...# ##+#.# #...#...# #.# #...#.... #.. .....#. #######. ......... ######... ###### Nggx;10.8 (1.0'#.#.Ngg;w#......>NggjBNgg CL======1.8 (2NggGNggK _As you open the door, it creaks loudly! _Found a stone staircase leading down.Ngg.iINggriNggkNgg#pP _Ngg}pNggpNggUqNggrNggtNggtNggtuNggyNgg\zNggzNggr{Nggn}Ngg~,NggNggՀNgg=,Ngg Ngg3NggNgg΅NggNggXNggpNggNggmNggdNggÍ,NggkNggNggב,NggnNggNgg0,Ngg@NggNgg>NggiNggךNggWNgg,NggNggNggrNggNggaNggR  There is a stone staircase leading down here.Ngg¨Ngg _NggNggիNggNNggNgg NggݰNgghNggNggSNggŴNgg,NggNggNNgg,NggNggpNggNggNggNgg[Ngg],Ngg\Ngg9NggNggNggrNggNggd,NggNggNgg,NggNggjNgg##.#.######...#........##.#..........# ........##.#####.....## ........#.......................#....######. ###.## ########...>### ##### #.#.## NggR #.#.#  #@#.# ------ #K.....# Ngg #......#  #......#Ngg8= #....... Nggh5#.....### K   kobold (missile, asleep) #.....#NggW ####.##Ngg 354.0)KK)A kobold comes into view. It is wielding a +0 club.The kobold shouts!NggB(((NggB@..NggI_====--6.8 (25NggNggn _The kobold throws a stone. The stone closely misses you.Ngg$.##.#..........#....##.######...#.................#....###### ####.## ########...>### ##### #.#.##  #.#.####.#.##K.@...# #......# #......# #........ #.###.. #.....# . ###### .Ngg&NggG-:.KNgg-B----7.8 (1Ngg..0)Ngg3Ngg6Ngg\n  You hit the kobold.  The kobold is moderately wounded.NggAo2=---Nggo&9.2 (1.4Ngg$wNgg{4 _You block the kobold's attack.Ngg[R  You barely miss the kobold.NggKThe kobold is moderately wounded.Ngg|)40.6NggNggkr _The kobold barely misses you. You block the kobold's attack.Ngg  You closely miss the kobold.The kobold is moderately wounded.Ngg"W48-2.0NggTNggg9 _The kobold hits you with a +0 club.Nggy  You barely miss the kobold.The kobold is moderately wounded.Ngg]y Nggy Nggz &3.5 (1.5Nggv Ngg  Ngg n_The kobold closely misses you. The kobold hits you but does no damage.Ngg.  You barely miss the kobold.The kobold is moderately wounded.Ngg 59-Ngg &4.9 (1.4Ngg Ngg = _The kobold hits you but does no damage.Ngg$m  You closely miss the kobold.The kobold is moderately wounded.6.3NggnNggqW _The kobold completely misses you.NggO:  You slash the kobold!NggC)NggR517.8 (1.5NggNgg>J _You kill the kobold!NggNggNggNgg޼H _No target in view!Ngg Ngg3 C  Skill  Level Cost  Apt Skill  Level Cost  Apt Ngg ] a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1          Ngg , b - Unarmed Combat   0.0   1.0   0      Ngg  c - Throwing   0.0   1.0   0   k - Evocations   0.0   1.0   0      Ngg @     d - Short Blades   1.1   1.0   0  NggM ,     e - Long Blades   2.0   3.0   0  Nggv         Ngg .     f - Armour   3.0   4.0   0  Ngg .     g - Dodging   0.0   1.0   0  Ngg +    h + Shields5.3   6.0   0  Ngg .     i - Stealth   0.0   0.8  +1  Ngg                 Ngg         Ngg         Ngg(         NggS a    Ngg The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] HelpNgg G[=] set a skill target  Ngg [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  Ngg [!] training|cost|targetsNgg Ngg~ Ngg -..................##.#..........# deadiverson the Shield-Bearer ..................##.#####.....## Human ..................#.............. Health: 49/50 =======================- NggN ..................#....######.... Magic: 6/6======================== ####.## ########...>### ##### AC: 6Str: 16Nggh #.#.##EV: 11Int: 11Ngg #.#.#SH: 9Dex: 12Ngg Y####.#.#Ngg XL:  6 Next: 11% Place: Dungeon:3#.)@...#Ngg qNoise: =--------  Time: 2047.8 (0.0)#......#a) +0 long sword#......#Throw: 3 darts (poison)Ngg #........#.....###..#.....# .Ngg7 b####.##.#NggO -You closely miss the kobold.Ngge ;The kobold is moderately wounded. Nggw I_The kobold completely misses you.Ngg 1You slash the kobold! Ngg X_You kill the kobold! _No target in view!Ngg Ngg| Ngg NggK Nggr3NggINgg_Ngg50= _NggNggNggLNgg Ngg4#Ngg#Ngg$Ngg&Nggz(Ngg(Ngg)Ngg+NggQ.Ngg.#=Ngg.Ngg0Ngg3Ngg5,Ngg 7Ngg-9Ngg<,Ngg>Ngg?Ngg1ANggYANggANggNggNggNgg8NggNgg,Ngg2 Ngg NggT Ngg Ngg, NggNggNggNggNggNggQNggNggzNggNggrNggNgg.NggNgg,NgggNgg Ngg>",Ngg"Nggf%Ngg'BNggE1Nggl3,Ngg3Ngg:9Ngg:Ngg;Ngg2=Ngg}?NggyFXNggGNgg7HNgg|INggLNggqNNggNNgg@ONggSNggU,NggVNggZNgg\Ngg\Ngg]NggBaNggc,NggdNgghNggiNggjNggkNggknNggp,NggqNggtNggKw,NggOxNggzNgg|,Ngg}Ngg4Ngg&,NggNggNgg.Ngg`NggANggNgg]NggNggNggNgg,NggNggNgg,NggSNggNgg͜,NggNggNgg,NggNggNgg,NggçNgg NggNggڪNggeNggNgg,NggNggNgg`,NggNgg^Ngg ,NggNggNggNggNggNggSNggQ,NggNgg)NggP,NggͿNggNgg~,NggNggNgg~1#..... #.###.##.........................#................##' #####..#......................##  #..#......................##.#..#......................##.#..#......................#..#..#......................#..#..#.#######@############...>-..# #.# #.#.# #.# #.#.# #.# ####.#.# #.# #.)....#Ngg ... #......# l   frilled lizard (asleep) ... #......#..l #.......#.....##Ngg8 92.8 (45.0)  NggKA frilled lizard comes into view.Ngggll.Ngg,F-3.8 (46Ngg9Ngg8 _The frilled lizard hisses angrily.Ngg,.............................................  #..#................  #..#................  #..#................  #..#.....................  #@#...> ..# #.# #.Ngg #.# #. #.# ####. #.# #.).. ... #..... .l. #...... ... ..NggX!Nggu.............................................  #..#................  #..#................  #..#................  #..#.....................  #@#...> ..# #.# #. #.# #. #.# ####.Nggv #.# #.).. ... #..... .l. #...... ... ..Ngg#~NggNgg<NggJe _A frilled lizard is nearby!Ngghv.............................................  #..#................ Ngg #..#................  #..#................  #..#.....................  #@#...>Nggc ..# #.# #. #.# #. #.# ####. Ngg9#.# #.).. ... #..... Ngg02.l. #...... NggL... ..Ngg!NggDNgg,...............Ngg9...............Nggv............... Ngg= #..#................ Ngg= #..#................ Ngg7= #..#................ NggV #..#..................... Ngg! Ngg(#@#Ngg9;...>Nggn Ngg..# #.# #.Ngg Ngg6k#.# #.Nggs Nggk#.# ####.Ngg Ngg&u#.# #.)..Ngg^ Ngg,... #.....Ngg Ngg-M.l. #......Ngg_ Ngg... Nggڞ..Ngg!NggDNgglNggҬNggNgg:e _A frilled lizard is nearby!Nggu #.###.## .......#...##' #####..#......  #..#..............................................#######.############...>NggIv  ..# #@# #.#.# .####..).........l......Ngguv S.....## Nggy Ngg~ :l.Ngg@ /4.8 (1.0) Nggs _NggW Ngg Ngg/W .......##' #####..#.........  .................................#######.############...> ..# #.# #.#.####.)....l..NggW ............##......#####.#NggZ Nggga :l.Nggb &5Nggg Nggi Ngg`~L#####.  ..................#######.############...> ..# #.# #.#.####l.)..................#........###........##...###.# #.#=6NggM< _You block the frilled lizard's attack.NggX h  You barely miss the frilled lizard.Ngg -8.2 (1.4NggNggfF _The frilled lizard bites you but does no damage.NggHNgg(9.6NggaNggC _You closely miss the frilled lizard. You block the frilled lizard's attack. x2Nggj101.0 _You miss the frilled lizard. You block the frilled lizard's attack.NggQZ  You barely miss the frilled lizard.The frilled lizard bites you but does no damage.Ngg?\ -2.5 (1.5Ngga Nggc < _You block the frilled lizard's attack.Ngg @  You hit the frilled lizard.NggF†NggR (4.0Ngg NggR _You kill the frilled lizard!NggNgg~Ngg8NggH _No target in view!NggCJ3NggJNggNNggw ......#######.############...> ..# #.# #.#.#.###.)...#.........#.#.r.......##.........#.#...###.. r   rat (asleep)#.###.## ### 0.0  A rat comes into view..rr==5.0 (1 _The rat squeaks loudly. _You see here a frilled lizard corpse.Nggs  ...  ...  ...  #.#>Ngg5% ..# #.#  #.#  #.#  #@# #.) #.........#  #..r......#  #.........#  #.........#  #.........#  NggR #.........#   #.........# #.# NggәNgg1   ...  ...  ...  #.#Ngg1 > ..# #.#  #.#  #.#  #@# #.) #.........#  #..r......#  #.........# Ngg2  #.........#  #.........#  Nggc2  #.........#  #.........# Ngg2 Ngg: Nggr; NggC NggE Z _A rat is nearby!Ngg^  #..#.## #..#..... #..#.....# #..#.#######.############. ..# #.# #.#. #.# #.#. #.#Ngg Y####.#.#######†### #.)....#.....@...# #...... #..r......# #...... #...# #...... #.# #.....# #.# #..... #.# ####.## #.# #. #NggC .# #.## #...NggW Ngg/ :r.Ngg 7---6 _Ngg NggK Ngg5pt #..#. #..#...#Nggp& #..#...# #..#.#.# ..# #.# #.# #.# #.# #.# ####.# #†### #.)Nggp #...r@....# # #.# #Nggq #.# # #Ngg$q.# #..... #Ngg:q.# #..... #NggOq.# ####.  #NggeqS.# #.#NggzqQ #.#Nggqj #. #NggR{Ngg{P=--7NggNggn; _The rat bites you but does no damage.Ngg5  You hit the rat.Ngge6†Ngg1Ngg-8.4 (1.4NggaNgg NggA_You kill the rat!Ngg4Ngg5Ngg ;Ngg=H _No target in view!Ngg!NggNggLNggůNggޱNgg: _NggNggNggHNggNggNggONggNggANggfNggNggJNgg+NggNggNggNggNgguNgg,Ngg_NggNggNggNggNgg!NggfNggNggVNggNgg,Ngg0Ngg7 _You open the door.NggNggX3Ngg@  There is an open door here.NggNgg _NggNggZNggNggQNggNgg,NggNgg|NggNgg,Ngg&NggNggNggNggNggNggYNgg9NggNggRNggNgg!NggNggNggNggNgg5NggzNggNgg Nggt #...#  #######'###  Nggy#.#  #.#  #.#  #.#  #.# Nggj####. <......@.... -28.4 (20.0)############  NggNggNgg,NggNggqF-9.4 (21NggjNggb9 _Found a stone staircase leading up.Nggu NggA Ngg Ngg Ngg Ngg Ngg Ngg Ngg Ngg( Nggo Ngg NggB Nggy Ngg; Ngg NggM Ngg Ngg Ngg NggL Ngg Ngg Ngg2 NggP Ngg Ngg Ngg Ngg Ngg Ngg Ngg NggV ,Ngg NggY NggG ,Ngg Ngg Ngg Ngg0 Ngg Ngg XNggq XNgg %  Ngg> There is an open door here.Ngg Nggs  _Ngg0 Ngg Ngg ,Ngg Ngg? Ngg Ngg/ Ngg Ngg Ngg Ngg Ngg Nggs NggQ ,Ngg Ngg Ngg ,Ngg, Ngg Ngg Ngg* Ngg Ngg" Ngg$ ,Ngg$ Nggj& NggM' ,Ngg' Ngg ) Ngg) ,Ngg}* Ngg|1 j  You see here a frilled lizard corpse.Ngg(3 Ngg3  _Ngg4 NggT5 Ngg6 BNgg7 Ngg8 ,Ngg*9 Ngg_; Ngg>= Nggw= Ngg7> Nggm@ Ngg5B NggqB NggbC NggD NggE ,Ngg\F NggcG Ngg?H ,NggH NggCJ NggL ,NggL NggN NggoP NggP NggQ NggS NggT Ngg/T NggT NggU NggV ,NggV NggW NggX NggY NggY Ngg\ Ngg^ NggX^ Ngg^ Ngg` NggRb ,Nggb Nggc NggDd ,Ngge Ngge Nggf Nggf Nggg NggRh Nggi ,Ngg j Nggk Nggl ,Ngg[m Nggu A  #.##................   #.#..#................   #.##..#................   #.#..#................  #..#.#######.#######  ..#.# #.#  Ngguu U#.# #.#   ##.# #.#   +@.#######†###   ####...†.....#  #.........#  #.........#  #.........#  Nggu #.........#  #.........#  #.........#Nggu J#.........#Ngg^y ######.........'69.4 (40###...###Ngg~ Ngg~ (======Ngg~ &70.4 (41Ngg Ngg = _As you open the door, it creaks loudly!NggM NggaN NggN NggP NggQR Ngg>V ,NggV @  There is an open door here.NggY NggY  _NggXZ Ngg] Ngg^ Ngg&_ Ngg` Ngga Nggc ,Nggd Nggf Ngg?h ,Nggh Ngg%j Nggk Nggk Ngg?l Nggm NggGo Nggto Nggo Nggq Ngg9t ,Nggt Ngg6v Ngg8w ,Nggw Nggy Ngg%   #.# #..#  #.# #..# Ngg|  #.# #..#  #. #..#  #. #..#.  #. #..#.# Ngg  #b ###..#.#  ##.######...##.# Ngg  #..@........'..#####------ Ngg  #########...####...†  ##### #.... NggD } #....  #.... Nggu  #.... b   bat (asleep) Ngg } #....  #.... Ngg؀ R #....Ngg 19.4 (9.0)Nggdž e  A bat comes into view.NggT WbbNgg ]=-----80.4 (10.0)Ngg% Ngg Q _The bat closely misses you.OggOOggOgg #.#  #.#  #.#  #.  #.  #.   #b  Oggg ##.######...##.#  #..@........'. #########..† ##### OggOggRO j #.#  #.#  #.#  #.  #.  #.   #b   ##.######...##.#  #..@........'. #########..† ##### Ogg8P OggV OggIW Ogg[ Ogg^ Z _A bat is nearby!Ogg M  #.# ######..#  #.# #..#  #.# #..#  #.# #..#  #.# #..#.....  #.# #..#.####  #.# #..#.#Ogg^   #b# ###..#.#  ##@######...##.#   #...........'..####  #########...#### ##### #  #  #  #  #  #Oggq Ogg 11.0)Ogg Ogg V _You block the bat's attack. The bat hits you but does no damage.Ogg  You closely miss the bat. The bat hits you but does no damage.Ogg-2.8 (1.4Ogg!Oggl _The bat barely misses you. You block the bat's attack.Ogg  You miss the bat. You block the bat's attack. The bat hits you.Ogg,b.OggW49-4.2Ogg$Ogg1 _You block the bat's attack.OggU.....#####.....###b#  #@# ###..##.######...##.# #...........'..#############...########50Ogg _The bat closely misses you. The bat misses you.Ogg2  You hit the bat.†26.7 (1.5 _You kill the bat!OggOggzOgg OggH _No target in view!Ogg{` Oggb C  Skill  Level Cost  Apt Skill  Level Cost  Apt Oggc  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Evocations   0.0   1.0   0           d - Short Blades   1.1   1.0   0  Ogg9c =     e - Long Blades   2.0   3.0   0              Oggc  f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0      h + Shields5.4   6.0   0       i - Stealth   0.0   0.8  +1      Oggc         Ogg#d         OggId _    Oggnd         Oggd         Oggd T    Oggd The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  Ogg e [?] Help[=] set a skill target  OggMe }[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsOgg  h * Shields   5.4Oggcp h - Shields   5.4Ogg@= e + Long Blades 2.0Ogg Ogg Ogg;   #.# #.......#..... deadiverson the Shield-Bearer   #.# ######..#..... Human  #.##..#..... Health: 49/50 =======================-  #.##..#..... Magic: 6/6======================== Ogg  #.##..#..... AC: 6Str: 16  #.##..#..... EV: 11Int: 11  #.##..#.#### SH: 9Dex: 12  #†##..#.#XL:  6 Next: 12% Place: Dungeon:3Ogg.   #@# ###..#.#Noise: =--------  Time: 2186.7 (0.0) Ogg  ##.######...##.#a) +0 long sword  #...........'..#### Throw: 3 darts (poison)  #########...####... ##### #... #...Ogg֬   #...  #... Ogg ? #... OggG _You miss the bat. You block the bat's attack. The bat hits you. _You block the bat's attack. _The bat closely misses you. The bat misses you.You hit the bat. _You kill the bat! _No target in view!Ogg Oggj Oggɵ Oggз OggxOggOggHOggpOggS50= _OggpOggSOgggOggOggOgg_  You see here a bat corpse.OggOgg~ _OggOggOggOggOggi Ogg OggcOgg9=Ogg$OggOgg,OggsOggCOgg,Ogg>Ogg"Ogg$,Ogg$Oggm(Oggi)Ogg)Ogg*Ogg-Ogg.,Ogg%/OggY3Ogg4Ogg 5Oggd5OggO9Ogg6;BOgg=OggW?,Ogg?OggCOgg[E,OggEOggRJOggKOggKOggQLOggkOOgg Q,OggTQOggkTOgg{UOggUOggXVOggCZOggA[,Ogg\OggX_Ogg&a,OgguaOggdOggbf,Ogg+gOggjOgglOggHlOgg mOggpOgg#rOggJrOggsOgguOggwOggwOggxOgg|OggOggCOggcOggOggBOgg1OggɊOggOggOggOggm,OggՒOggJOgg,OggOggnOgg,OggpOggVOgg,OggOggOggu,OggOggOggΧ,OggOggޫOggaOggOgg\OggOggc,Ogg+nOggWOgg,Ogg?OggWOgg\,OggOgg ######### .........  #.>..############  #...#....†.<.[#..  . #...#.#########.### ## .## ##....#.... .....# .. ..# ##.#..##...####.#.#.#### #.# ##..............@......# #.# - ##.....................# #.# ##.....................# #.# ##.....................# #) ##.....................# #†# ##..............Ogg.......# #†# ##.....................####.# ##..........................# ## ##..........................# Ogg1223.7 (37.0)OggkF-4.7 (38Ogg%Ogg[ _q - a fuming silvery potionOggOgg OggOggOggOggOggNnOggkOggH ###### ...... ..############  .#....†.<.[#.. .. Ogg6A.#.#########.#######..r.## ...#.... .....#.........# ..##...####.#.#@#### #.# .........# #.# ..Ogg!u......# #.# ...# #.# ...# #)# ...# #†# r   rat (asleep) ...# #† ...####.# ...Ogg`I# ##...Oggy 6.7 (2.0)  A rat comes into view.Oggtr.rOggp4==7.7 (3Ogg? Ogg- _The rat squeaks loudly.Ogg †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# #.# ...........# #)# ...........# #†# ...........# #†# ...........####.#  OggS{†.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# ...........# #)...........# #†# ...........# #†OggTB...........# Oggc]Ogg]OggnfOgghZ _A rat is nearby!Ogg †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# #.# ...........# #)# ...........# #†# ...........# #†# ...........####.#  Ogg2 †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# ...........# #)...........# #†# ...........# #†...........# Ogg9 Ogg : Ogg>A Ogg:D Z _A rat is nearby!Ogg †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# #.# ...........# #)# ...........# #†# ...........# #†# ...........####.#  OggXF%OggF†.<.[#.. .. #####.r..##  .....#.........# #@#### #.# Ogg@G...........# #.# ...........# #.# ...........# ...........# #)...........# #†# OggxG...........# #†...........# OggNOggEOOggUOggSYZ _A rat is nearby!Oggq †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# #.# ...........# #)# ...........# #†# ...........# #†# ...........####.#  Ogg †.<.[#.. .. #####.r..##  .....#.........# #@#### #.# ...........# #.# ...........# #.# ...........# ...........# #)...........# #†# ...........# #†...........# Ogg>% 4Ogg, Ogg/ Z _A rat is nearby!Ogg  ##### ... ###########  # #....†.<.[#.. ..# #.#########.#######.r..## ..#.... .....#.@.......# ##...####.#.#.#######.# ..........# #.# ..........# #.#...# #.#...# #)# ...# #†#...# #†#####.#Ogg .r--8.7 (1 _Ogg Ogg Ogg? ## ... # ..# ....†.<.[#.. ...# .#.#######....## #.... .....#..@.r....# ##...####.#.#.#.# ......# #.# ...............# #)# ........... Ogg*BOggUI0r.OggJA--9OggSOggg5  You hit the rat.Ogg,oE†Oggr6=31.2 (1.5OggsxOgg-{G _You kill the rat!OggOgg%Ogg~OggH _No target in view!Ogg3Ogg;OggVOggOgg5$ _Ogg4u  You see here a rat corpse.OggOgg _OggاOggeOggDOggOggEOggOgg,Ogg&Ogg"Ogg8,OggOggZOggOggOggOggOggOgg˷OggnOggúOgg˼OggOggOggmOgg-,OggOggOggs,Ogg,OggOgg,Ogg"OggOggOgg9OggOggOgg+Ogg\OggOggOgg,OggOggjOgg$,OggOggOgg,OggqOggOgg,OggNOggOgg,Ogg3OggOgg1Y ###+######  #........#  #........#  #........# ######.#######...............@......>-49.2 (18.0) #####....#####.###..........# #.# ####. #####....#Ogg #...†. #.#######.# #.## #.# #.## #.# # #.#OggOgguG-50.2 (19Ogg[Ogg; _Found a stone staircase leading down.Ogg 3Oggw Oggc Ogga Ogg nOggM Ogg Ogg< ,Ogg OggϾ Ogg ,OggD OggC Ogg ,Ogg Ogg Ogg ,Ogg Ogg Ogg ,Ogg Ogg Ogg Ogg Ogg4 Ogg Ogg Ogg Ogg Ogg Ogg ,Ogg Ogg< Ogg ,Ogg@ Ogg2 Ogg Ogg Ogg- Ogg Ogg ,Ogg? Oggz s#........# #.# ######.#########.# ...............>.###### .#####.###............. Ogg .# #.# #.####..###### .## #.# #.# #.......# ..# #.# #.# #...###.# #.# #.# #.# #...# Ogga ^#.# #.# #.# #.@.# .# ... ..# #...# #.# ..# #...# )# #...#†# #....†# ...##. OggJ #.# #..# .# ##.... #..# ## ...:.# #Ogg -63.2 (13Ogg ,4.2 (14Oggn Ogg b _r - a scroll labelled KIJ GOLAOPLUOggT Ogg Ogg>!Ogg#Ogg&Ogg)BOgg*Ogg-+Ogg+Ogg-Ogg0,Ogg0Ogg2Ogg4Ogg4Ogg5Ogg47Ogg8,Ogg9Ogg;Ogg0=Ogg=Ogg=Ogg@OggA,Ogg&BOggCOggF,OggFOggIOggKOggGKOgg&LOggMOggPOggAPOggQOggROggX,OggYOggE]Oggfw....## #.# #.# #.......# .....# #.# #.#. #...###.# ####.# #.# #.#. #...# # #.# #.# #.#S #...# # #.# ... ..#. #...# Oggg# #.# ..#. #...# # #)# #. #...### #†# #.##.....# #†# #.@...##.# ####.# #.##..##.# .....# ##....#. #..##.# .....# ...:.#. #..##.# .....# ....#. #..##.# .....# ...#. #.....#S   ball python (constriction, asleep) .....#Oggh..#.##.#####...# ###.#...........# +.#.##...####Ogggn} 75.2 (11  A ball python comes into view.OgguX .  The ball python hisses angrily.Oggv,6.2 (12Ogg|Ogg~8 _The ball python moves out of view.Ogg-Ogga.Ogg.Oggw1Ogg85#....## #.# #.# #.# †.....# #.# #.#..#...###.##.# #.# #.#..#...# .# #.# #.# #.#..#...# .# #.# ... ..#.S#...# Ogg]9.# #.# ..#..#...# .# #)# #..#...### .# #†# #.##.....# .# #†# #@....##.# .####.# #.##..##.#.# ##....#.##..##.#.# ...:.#.##..##.#.# ....#.Ogg:-##..##.#.# ...#.##.....#S   ball python (constriction).# ..#.##.#####.# ###.#........ ......# +.#.##...####Ogg <,0.0)Ogg&=OggCM.SOggG+7.2 (1OggJOgg*MOggHT #.# #.#  † #.# #.#..#  #.# #.#..#...#  #.# #.# #.#..#...#  #.# ... ..#..#...#  #.# ..#..#...#  #)# #S.#...###  #†# #.##.....#  #†# #@....##.#  #.##..##.# OggT #.##..##.#  ...:.#.#  ....#.#  ...#.#  ..#.#  ###.#..   Oggv #.# #.#  † #.# #.#..#  #.# #.#..#...#  #.# #.# #.#..#...# Ogg #.# ... ..#..#...#  #.# ..#..#...#  #)# #S.#...###  #†# #.##.....#  #†# #@....##.#  #.##..##.#  #.##..##.# Ogg ...:.#.# ....#.# ...#.#  ..#.#OggJD ###.#..Ogg Ogg4OggOggb _A ball python is nearby!Oggr .....# ###..##### #....#... †....##.# #####.# #......#..#...# )S.#...##†##.... #†..Oggs ####.# #.##..##....#...:#.##..... ..#.##.########.#........Ogg~ Oggt .=8Ogg OggLj | _You block the ball python's attack. The ball python barely misses you.Ogg9 (  You hit the ball python but do no damage.The ball python closely misses you. The ball python grabs you.  The ball python constricts you. You block the ball python's attack.Oggh: 48- 1 9.7 (1.5Constr Ogg A Ogg Ogg OggC Ogg OggV Ogg@ ,Ogg% Oggܟ OggӠ ,Ogg7 Ogg Ogg ,Ogg Ogg/ Ogg ,Ogg= Ogg OggĮ ,Oggʯ Ogg° Ogga ,Ogg Ogg Ogg ,OggF Ogg Ogg ,Oggռ Ogg 7 _You open the door.Oggo 3Ogg% Ogg @  There is an open door here.Ogg% Ogg  _Oggu Ogg Ogga Ogg Ogg Ogg Ogg ,Ogg ,OggX ,Ogg Ogg Ogg Ogg Ogg% Ogg Ogg Ogg Ogg Ogg6 Oggg Ogg Ogg Ogg> Ogg ,Ogg Oggs Ogg Ogg] Ogg Ogg Oggb ,Ogg OggX Ogg ,Ogg8 Ogg Ogg, ,Ogg Ogg Ogg ,Ogg Ogg Ogg5 Oggi Ogg Ogg Ogg. ,Ogg Ogg1 Ogg ,Ogg OggOgg/,OggOggOggT,OggOggOggd Ogg Ogg} Ogg= OggOgg?OggOggOgg,OggOggGOggOgg!OggOggOggOggOggOgg>Ogg,OggfOgg!Oggp"Ogg"Ogg#Ogg$OggS&Ogg&Ogg&Ogga(Ogg *,Ogg*Ogg,Ogg-,Ogg-Ogg/Ogg0BOgg1Ogg2Ogg+3Ogg^3OggZ4OggQ5,Ogg5Ogg6Ogg7Ogg7Ogg'8Ogg8Ogg*:,Ogg:Ogg~;OggS<Ogg<Ogg=Ogg/HvOggH,OgglIOggJOggK,OggKOggJMOggMOggMOggNOggNOggO,Ogg(POgg&QOggQOggQOggQOggSOggSOggSOgg_TOggSUOggVOggMVOggVOggWOgg~XBOggYOggjZ,OggZOgg[OggV\Ogg\Ogg\OggB^Ogg^,Ogg9_Ogg3`Ogg`,OggaOgg-cOgg'e,OggfOggLgOggh,OggiOgg1lOggl,Ogg nOggSpOggw##.#  ##.#  ##.#  ### #.#  Ogg xj #.#  .##.# #.#  .##.# #.#  .##.# #########.##  .##.# ....?..@...#  .##.# r###########  # #####OggOx5  #####  r   rat (asleep)Ogg} #####   Oggg~x 84.7 (79.0)  A rat comes into view.OggDž{r.rOggO5==5.7 (80OggӋOgg- _The rat squeaks loudly.Ogg#.# #.# #.#  #.#  #.#  #.#  #.#  #########.##  .r..?..@...# Ogg y .########### Ogg93#.# #.# #.#  #.#  #.#  #.#  #.#  #########.##  .r..?..@...# Ogg}4 .########### Ogg9Ogg:Ogg>OggAZ _A rat is nearby!Ogg-Z#.# #.# #.#  #.#  #.#  #.#  #.#  #########.##  .r..?..@...#  .########### OggR.8Ogg#.# #.# #.#  #.#  #.#  #.#  #.#  #########.##  .r..?..@...#  .########### OggOgg$Ogg]OggZ _A rat is nearby!Oggp.# #.# .# #.# .# #.# .### #.# .# #.# .##.# #.# .##.# #.# Ogg|.##.##.## .##.# #.r..?.@....# .##.# #.# .# .##### . .##### . #  OggOggB.rOggy8--6.7 (1.0) Ogg _OggOggwOggnz 5#...# #.# #...# #.# #...# #.# #...### #.# #.....# #.# .##.# #.# #..##.# #.# #..##.# #.## #..##.# #..r.?@.....# #..##.# #.# #.....# #.##### . .##### .Ogg{ V #  Ogg~ Oggf >.rOgg A--7Ogg OggǏ Ogg Y.#...# #.# .#...# #.# .#...# #.# .#...### #.# #.....# #.# .##.# #.# #..##.# #.# #..##.# #.## #..##.# #...r.# #..##.# #.# #.....# #.##### . .##### . #  Ogg OggJ .=8Ogg Ogg _You block the rat's attack. _You see here a scroll labelled EDWEOS VEXA.Ogg7  You slash the rat!Oggi.Oggh.90.2 (1.5OggOggG _You kill the rat! Ogg! Ogg Ogg Ogg\   Ogg B_No target in view! Ogg Ogg Ogg Ogg Ogg(0.0 Ogg=3-1.2 (1 Ogg  Oggfa _s - a scroll labelled EDWEOS VEXA Ogg6y Oggy3 Oggz Oggm| Ogg|, OggX Ogg Ogg. Ogg^ Ogg Ogg Ogg, Ogg OggG Ogg Ogg̉ OggG Ogg΋ Ogg, OggP Ogg Ogg: Oggv Ogg OggM Ogg/, Oggו Ogg Oggԙ, Ogg? Ogg| Oggr, Ogg Ogg OggR, Ogg Ogg Ogg, Ogg Ogg| Ogg, Ogg5 Ogg Ogg Ogg Ogg& Ogg Ogg, Ogg Ogg Ogg Ogg Ogg Oggpn Ogg, Ogg OggO Oggm Ogg Ogg OggC Ogg Ogg˵ Ogg OggZ OggZ Ogg Oggi OggK Oggл Ogg Ogge Ogg- Ogg, Ogg7 Ogg OggA, Ogg Ogg= Oggx, OggO Ogg Ogg Ogg6 Oggu Ogg Ogg, Ogg( Ogg Oggo Ogg Ogg! Oggx Oggr Ogg Ogg3 Ogg Ogg, Ogg Ogg Ogg, Ogg OggC Ogg..#..#...### #.# ..#.##.....# #.#  Ogg<..#.....##.# #.# ..#.##..##.# #.# ...#.##..##.# ##########.##  Ogg##.##..##.# #...........# ...#.##..##.# #.###########  Oggh...#.##.....# ###.#.........# ...#.##.##### #.@...#.####.## -422.2 (31.0) Ogg#......... #.#.#.#..# #.#  OggQ.#.##...##### #.#.#.##.###.# .#..<........ #[#.#.##.....# #.########## #.#.#.########  #.#.#.# #  Ogg#.#.#.. ...#  Ogg#.#.### ...#  Ogg Ogga,3.2 (32 Ogg Ogg- _Found a leather armour. OggT'  Ogg'  Ogg(  Ogg,  Ogg.  Ogg1 B Oggi3 , Oggf4  Ogg+6  Ogg8  Ogga8  Ogg9  Ogg;  Ogg[=  Ogg=  Oggo>  Oggi@  OggB , OggB  OggD  OggF , OggG  OggI  Ogg&K , OggL  OggON  OggiP , OggDQ  OggZS  OggAU , Ogg\V  OggX  OggY  Ogg5Z  Oggc[  Ogg]]  Oggi_  Ogg_  Ogga  Oggc  Oggd  Oggd  Ogge  Ogg8g  Oggh , Oggi  Oggk  Oggl  Oggm  Oggm  Oggn  Ogg5p  Oggkp  Oggp  Ogg-r  Oggs , OggRt  Oggv  Oggw , Ogg)x  Oggy  Oggz , Ogg {  Ogg{  OggN| , Ogg|  Ogg}  OggC  Ogg  Ogg  OggY  Oggt  Ogg  Ogg  OggɄ  Ogg  Ogg  Ogg  Oggj  Ogg  Ogg  Ogg  Ogg  Ogg? , Ogg  Ogg  Ogg  Ogg , Ogg6  Ogg  Ogg  Ogg  Ogg  Ogg  Ogg  Ogge  Ogg  OggX  Ogg  Ogg  Ogg  Ogg , Ogg  Ogg  Ogg , Oggx  Oggz  Ogg , Ogg  Ogg  Oggj  Ogg  Ogg5  Oggħ  Ogg  Ogg  Oggp  OggL  Ogg  Oggݫ  Oggf  Ogg  Ogg  Ogg  Ogg  Ogg̰  Oggf , Ogg$  OggE  Oggŵ , Ogg  Ogg  OggS , Ogg  Ogg  Ogg , Ogg  Ogg  Oggu  Ogg  Ogg  Ogg  Ogg , Ogg  Ogg  Ogg  Ogg"  Ogg3  OggP  Ogg#  Oggl  Ogg:  Oggc  OggZ  Ogg  Ogg  Ogg  Ogg , Ogg  Ogg  Ogg , Ogg  Oggi s#....+.#.##...##### #.#.#.##.####...#.#..<........ #[#.#.##...##...#.#.########## #.#.#.###########...#  Ogg #.#.#.##### #.# #...# #.#.#...... #.######...# #.#.#######  Ogg C#..........# #.# # #####.....###############.# #.............@.........####### ..######......................... ### ########################## # OggJ l######### #.......#  Ogg f#.......# #.......# Oggr -69.2 (46 Ogg -70.2 (47 OggM  Ogg b _t - a scroll labelled MEYCSO REZEI Ogg  Ogg0  Ogg  OggX  OggT , Ogg= , Ogg , Ogg$  Ogg  Ogg  Ogg  Ogg  Ogg&  Ogg4  Oggl  OggX  Ogg  Ogg , Ogg  Ogg  Ogg}  Ogg  OggR  Ogg  OggX , Ogg(  Ogg5  Ogg , Ogg  Ogg  OggA , Ogg  Ogg  Ogg  Ogg  Ogg\  Ogg  Ogg  Ogg  OggH  Ogg  Ogg , Ogg@  Ogg-  Oggh! , Ogg"  Ogg$  Oggj&  Ogg&  Ogg'  Ogg* P  There is a stone staircase leading up here. Ogg,  Ogg[-  _ Ogg.  Ogg/  Ogg1 , Ogge2  Ogg4  Ogg6 , Ogg7  Ogg:  OggV= , Ogg>  OggA  Ogg4C , OggMD  OggNF  Ogg8  Ogg9  Ogg=  OggW?  Ogg?  Ogg@  Ogg.D  OggE  OggF  OggF  OggJ  OggKL  OggL  Ogg?M  Ogg*Q  Ogg5S  OggS  OggT  OggMW  Ogg$Y  Ogg\Y  Ogg0Z  Ogg~]  Ogg_  Ogg_  Ogg`  Oggc  Ogg(e  Ogghe  Oggf  Oggh  Oggj  Oggj  OggYk  Ogg7n  Oggo  Oggp  Oggp  Oggs  Oggt  Oggt  Ogg{u  Oggw  OggHy  Oggy  Ogg z  OggC|  Ogg}  OggA~  Ogg~  OggC  OggH  Ogg{  OggJ  Ogg  Ogg6 , Ogg7  Ogg0  Ogg  Ogg  Ogg  Ogg  Ogg  OggD  Oggے  Oggߔ  Ogg_  Ogg  Ogg)  Ogg  Ogg  Ogg  Oggm  Oggj  Ogg , Ogg  Oggʡ  Oggc  Ogg  OggI  OggC  Ogg  Ogg&  Ogg˨  Ogg  OggT  Ogg  Ogg(  Oggݮ  Ogg  Ogg  Ogg  Ogg  Ogg. , Ogg  Ogg{  Ogg4  Ogg  Ogg  Ogg  OggX  Ogg  Ogg%  Ogg  Ogg  Ogg  Ogg?  Ogg  Ogg5  Ogg  Ogg  Oggx  Ogg  Ogg  Ogg  Ogg8  Ogg  Ogg:  Ogg  Ogg#  Ogg  OggR  Ogg  Ogg  Oggn  Ogg  Ogg8  Ogg  Ogg  Ogg  Ogg  Ogg,  Ogg+  Ogg{  Ogg  Oggt  Ogg , Ogg~  Ogg  Ogg?  Ogg  Ogg  Ogg  Ogg@ , Ogg  Ogg#  Ogg"  Oggr  Oggo  Ogg  Ogg Ogg Ogg Ogg Ogg, Ogg7 Ogg  Ogg@  Ogg  Ogg  Ogg6 Ogg Ogg  OggV Ogg Oggc Ogg Ogg  Ogg Ogg7 Oggi Ogg Ogg Ogg9 Oggs Ogg Ogg <M## ## ##.. #  #.. ################################# .................................#.>..##################....####...#....†.<.[#............#  Ogg< #...#.#########@#######....## 571.2 (101.0) ###....#...÷.....# # .##.#..##...####.#.#.#######.# .##.....................# #.#### .##.....................# #.#... .##.....................# #.##.#  .##.....................# #)##.#   Oggx=L.##.....................# #†##..  .##.....................# #†#...  OggF> Ogg-E OggLHE _Done exploring.!Ogg g!Oggg!Oggg!Ogg݂k........................0.0)!Oggj!Ogg!OggE _Done exploring.!OggK!Ogg !Ogg!Oggk!OggE!OggW!OggE _Done exploring."Oggx"OggxWhere to? (Tab - D:3, ? - help)  D - Dungeon "Ogg< "Ogg %#### deadiverson the Shield-Bearer ##.. Human ##.. Health: 50/50 ======================== ##.. Magic: 6/6======================== ################################# AC: 6Str: 16 ................................. EV: 11Int: 11 ##.>..##################....##### SH: 9Dex: 12 ##...#....†.<.[#............# # XL:  6 Next: 13% Place: Dungeon:3  #...#.#########@#######....## # Noise: ---------  Time: 2571.2 (0.0) ###....#...........#...÷.....# # a) +0 long sword .##.#..##...####.#."Ogg|&v[40m#.#######.# # Throw: 3 darts (poison) .##.....................# #.#### .##.....................# #.#... .##.....................# #.##.#  .##.....................# #)##.#  .##.....................# #†##..  .##.....................# #†#...  _Found a leather armour. _t - a scroll labelled MEYCSO REZEI _There is a stone staircase leading up here. _Done exploring. _Done exploring. _Done exploring."Ogg'"Oggr'"OggV0"OggF2"Ogg$6P _"Ogg7"Ogg7"Oggg8"OggP:"Oggq<,"Ogg<"Ogg>"Ogg@"Ogg@"OggA"OggC"Ogg1E"OggE"Ogg _The jackal bites you but does no damage.%Ogg  You hit the jackal but do no damage.The jackal is severely wounded.%OggS(1.7%Ogg %Oggx  _The jackal barely misses you. The jackal closely misses you.%Oggk  You barely miss the jackal.The jackal is severely wounded.%OggW49-3.2%Ogg:%OggTJ _You block the jackal's attack. The jackal bites you.%Ogge5  You barely miss the jackal.The jackal is severely wounded.%Ogg6 -4.6 (1.4%Ogg< %Ogg? A _The jackal bites you but does no damage. x2%Oggfq8  You hit the jackal.%OggyE†%Ogg|d50=56.1 (1.5%Ogg߁%Ogg΄J _You kill the jackal!&OggT4&Ogg&OggH _No target in view!&Ogg&Oggf&Ogg&OggN&Ogg&OggP _&Ogg &Ogg &Ogg &Ogg &OggQ,&Ogg{=&Ogg\&Oggk&Ogg&Ogg&Oggs&Ogg,&OggY&OggA$ &OggyY_t - 2 scrolls labelled MEYCSO REZEI (gained 1)&Ogg I&Ogg!&Oggi",&Ogg"&Ogg#&Ogg$,&Oggl%&OggB&&Ogga',&Ogg'&Ogg*b  You see here a jackal corpse.&Oggj,&Ogg, _&OggB-&Ogg,.&Ogg /,&Ogg~/&Oggh0&Ogg51,&Ogg1&Ogg3&OggU5,&Ogg5&OggN7&Ogg<  #..########  #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#......#  #....###...##  #.<..#######  #...@.# -  #.....# &Ogg<  #......#   #......#  #.......#  #.......#J   endoplasm (asleep)  #........  .......J## &Ogg)A 20.1 (14.0)  An endoplasm comes into view.&Ogg3GbJJ.&Ogg HF-1.1 (15&OggM&Ogg0Q^ _The endoplasm quivers.&Ogg>+   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......#  #.......#  #.......#  #......J.  ........## &Ogg>!&Oggp   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......# #....... #.......#  #......J. ........##&Ogg&Ogg&Oggr&Ogga _An endoplasm is nearby!&Ogg    #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......#  #.......#  #.......#  #......J. &Oggq @ ........## &Ogg p   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......# #....... #.......#  #......J. ........##&Ogg &Ogg &Ogg &Ogg) a _An endoplasm is nearby!&Ogg    #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......#  #.......# &Oggd #.......#  #......J.  ........## &Oggb}p   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......# #....... #.......#  #......J. ........##&Ogg;4&Ogg&Ogg a _An endoplasm is nearby!'OggL   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......#  #.......#  #.......#  #......J.  ........## 'Ogg)p   #..##.....##  #..##......##  #...........#  #...#.†.....#  #....#  #....#  #.<..#######  #...@.# #.....# #......#  #......# #....... #.......#  #......J. ........##'Ogg<.'Ogg.'Ogg"4'Ogg6a _An endoplasm is nearby!'Ogg} #..##..... #..##... #...........#  #...#.†.....#  #....#......#  #....###...##  #.<..#######  #.....#  #....@#  #.'Ogg" #......#  #.# #.# #......J.  ..## ### 'Ogg'Ogg-J.'Ogg82.0) _'Ogg'Oggt'Ogg #..##. #.....  #...#.†.....#  #....#......#  #....###...##  #.<..#######  #.....#  #.....# #. #......#  #.# #......J# #.. #..## ###  'Ogg#'OggW(J.[9d'OggΎ&3'Ogg''Oggϖ'Ogg7 C...#.†.#.##...#<..####### ....# ##.'Ogg J.#..#.#.###  'Ogg[ 'Ogg .=4'Ogg. 'Ogg V _The endoplasm barely misses you.'Ogg5" C5.6 (1.5'Oggc& 'Ogg(  _You hit the endoplasm but do no damage. You block the endoplasm's attack.'Oggd  You hit the endoplasm.  The endoplasm is lightly wounded.'Ogg-7.0 (1.4'Ogg'OggL _The endoplasm closely misses you. The endoplasm misses you.(Ogg[]  You barely miss the endoplasm.The endoplasm freezes you.(Ogg^]46--8.5 (1.5(Ogg6d(Oggg% _You are frozen.(Ogg@q The endoplasm is heavily wounded.  The endoplasm freezes you.  You are frozen.  The endoplasm jiggles.  The endoplasm freezes you.(Ogg e1-----30.0(Oggo(OggQ (Ogg'/  --more--(Ogg& _You are frozen.)Ogg3You hit the endoplasm.)Ogg2.)Ogg=(1.5)Ogg)OggCE _You kill the endoplasm!)Ogg\)Ogga)Ogg)Ogg @ _No target in view!)Ogge Your movement speed is average.  Your attack delay is about 1.4 (and is slowed by your shield).)Ogg )Ogg )Ogg  Your damage rating with your +0 long sword is about 11 (Base 10 x 105% (Dex) x _112% (Skill)).*OggJ4*OggzN*Ogg QF _Unknown command.*Ogg&< *Ogg< *Ogg7= *Ogg ? *OggC f _*OggD *OggF *OggF W2=--*OggCG *OggI ,*OggI *OggK *OggIK *Ogg L *OggM *OggM U3=*OggN *OggP ,*OggnQ *OggR ,*OggS *OggU ,*OggxV *OggX a4=*OggY *Ogg.\ B*OggR^ ,*Oggd *Ogge *Ogge #5*Ogg2f 2=*Oggf *Oggh *Oggi *Oggi *Oggk *Oggk *Oggl *Oggn ,*OggSo *Oggp *Oggq *OggTq D6=*OggTr *Ogg,t ,*Oggx X*OggEz *Oggz U7=*Ogg`{ *Ogg| ,*Ogg} *Ogg *Ogg *OggȀ *Ogg *Ogg| *Ogg# *Ogg a8=*Ogg *Ogg@ ,*Ogg= *OggJ *Ogg *Ogg6 *Ogg$ ,*Ogg *Ogg *Ogg U9=*Ogg *Ogg ,*Ogg *Ogg ,*Ogg *Ogg *Ogg L50=*Ogg *Ogg 1 _HP restored.*OggC ( #.†.#.##...#<..####### ....# ##*Ogg ..##.#-.S#S   ball python (constriction, asleep)#.......#*Ogg 062.5 (31.0)*Oggh *Ogg7 S.S)*Ogg F-3.5 (32*Oggֹ *Ogg ^ _A ball python comes into view.*Ogg  †  #....  #....  #.<..#  #.....# #.....## #......#*Oggb & #......## #.....@.# #......S# #.........  #........###  ##.......# #.......# #.......# #.......#*Ogg *Ogg †  #....  #....  #.<..#  #.....# #.....## #......# #......## #.....@.# #......S# #.........  #........### ##.......# #.......# #.......# #.......#*Oggx _A ball python is nearby!+OggP †  #....  #....  #.<..#  #.....# #.....## #......# #......## #.....@.# #......S# #.........  #........###  ##.......# #.......# #.......# #.......#+Ogg* †  #....  #....  #.<..#  #.....# #.....## #......# #......## #.....@.# #......S# #.........  #........### ##.......#+Ogg* #.......# #.......# #.......#+Ogg64+Ogg;+Oggg?b _A ball python is nearby!+Ogg+Ogg`9=4.9 (1.4)+Ogg#+Oggu _You barely miss the ball python. The ball python closely misses you. x2+Ogg9?  You slash the ball python!+Ogg@F†+Ogg,D566.4 (1.5+Ogg6Ne _You kill the ball python!+Ogg+Oggn+Ogg/+OggH _No target in view!+OggP +OggT   Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1          +Ogg0U , b - Unarmed Combat   0.0   1.0   0      +OggU  c - Throwing   0.0   1.0   0   k - Evocations   0.0   1.0   0           d - Short Blades   1.1   1.0   0      +OggU e + Long Blades2.1   3.0   0  +OggU         +OggU T    +Ogg!V . f - Armour   3.0   4.0   0      +OggHV . g - Dodging   0.0   1.0   0      +OggnV . h - Shields   5.4   6.0   0      +OggV i - Stealth   0.0   0.8  +1  +OggV                 +OggW a    +OgguW                         The relative cost of raising each skill is in cyan.  +OggW Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  +OggW [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  +OggX [!] training|cost|targets,Ogg,Ogg,Ogg1,Ogg n  #...#.†.....#deadiverson the Shield-Bearer   #....#......#Human ,OggK #....###...##Health: 50/50 ========================  #.<..#######Magic: 6/6,Oggx========================  #.....#AC: 6,OggStr: 16  #.....##EV: 11,OggInt: 11  #......#SH: 9,OggDex: 12  #......##,Ogg$XL:  6 Next: 16% Place: Dungeon:4 ,OggJ #.....@.#Noise: =--------  Time: 2666.4 (0.0) ,Oggp #......†#a) +0 long sword ,Ogg #.........Throw: 3 darts (poison) ,Ogg #........###  ##.......# ,Ogg+ #.......#  #.......#  #.......# _A ball python is nearby! _A ball python is nearby! ,OggR_You barely miss the ball python. The ball python closely misses you. x2  You slash the ball python! ,Ogg]_You kill the ball python! _No target in view!,Ogg=,Ogg,Ogg,OggS ,Oggð,Ogg6,Ogg\,Ogg,OggƷ ,Ogg _,Ogg),Ogg g  You see here a ball python corpse.,Ogg,Ogg~ _,Ogg,Ogg9,Ogg],Ogg,Ogg,,Ogg*,Ogga,Ogg,OggZ,Ogg1,Oggf,Ogg,OggW,Ogg,,Ogg[,Ogg,Ogg,,Ogg],Ogg,Ogg,OggL,Ogg ,Ogg,Ogg,Ogg,Ogg,Ogg,Ogg,,Ogg,OggL,Ogg,Ogg,Ogg,Ogg,Oggt,Ogg,Ogg@,Ogg_,Ogg,,OggZ,Ogg,Ogg,Ogg\,,Ogg*,Ogg,Ogg,,Oggh,Ogg,Ogg ,Ogg ,Oggf ,Ogg ,OggN ,Ogg ,Ogga ,Ogg ,Ogg. ,Ogg\ ,OggY ,Ogg ,Ogg ,,Ogg ,Ogg ,Oggl # ##..# ## ######..# #... .# #......## ..# .## #.......## ..# ..###........##g.## .†##..........##..# ....###........#..# ,Ogg p..### ###......... ..# ##......- ..# ###.###.. ..# ### ###.# ..#.. ..#... ..##...g   hobgoblin (asleep) #... ### ,OggE !,Ogg! 085.4 (19.0),Ogg* i.gg,Ogg* F-6.4 (20,Ogg1 ,Ogg5 \ _A hobgoblin comes into view.,Ogg  ##..# ######..# #... #......## ..# #.......## ..# ..###........##..## .†##..........##g.# ....###........#..# ###.........# ##......@.# ###.###..# ### ###.# ..# ... #...  #...  ,Ogg 3### ,Ogg' 9 ##..# ######..# #... #......## ..# #.......## ..# ..###........##..##†##..........##g.#...###........#..# ###.........# ##......@.# ###.###..# ### ###.# ..#...#...  ,Ogg' j#... ### ,Ogg6. ,Ogg. ,Oggo5 ,Ogg19 ` _A hobgoblin is nearby!,OggI ##..# ######..# #... #......## ..# #.......## ..# ..###........##..## .†##..........##g.# ....###........#..# ###.........# ##......@.# ###.###..# ### ###.# ..# ,OggJ... #...  #...  ### -OggѢ ##..# ######..# #... #......## ..# #.......## ..# ..###........##..##†##..........##g.#...###........#..# ###.........# ##......@.# ###.###..# ### ###.# ..#...#...  #... ### -Ogg4-Ogg-Ogg` _A hobgoblin is nearby!-Ogg1 ##..# ######..# #... #......## ..# #.......## ..# ..###........##..## .†##..........##g.# ....###........#..# ###.........# ##......@.# ###.###..# ### ###.# ..# ... #...  #...  ### -Oggi ##..# ######..# #... #......## ..# #.......## ..# ..###........##..##-Ogg@j#†##..........##g.#...###........#..# ###.........# ##......@.# ###.###..# ### ###.# -Oggj..#...#...  #... ### -Ogg2r-Oggr-OggCy-Oggd ##### #... # ##..# -Ogg8## ######..# #... ## # .## #.## ..# .###........##..#†##..........##g..###........### ###.......##......###.###..# ### ###.#..#-Ogg݇6#... ..##...#...### _A hobgoblin is nearby!-Ogg%-Ogg_F.g-Ogg87.4 (1.0) _-Ogg-Ogg-Oggn;  You hit the hobgoblin.-OggxuC.-Oggy5=8.8 (1.4-Ogg-Ogg<M _You kill the hobgoblin!-Oggt4-Ogg-OggzH _No target in view!-Ogg+ -Ogge, -Ogg- -OggG0 -Ogg*3 -OggB8 f _-Ogg8 -Ogg,9 -Ogg: -Oggj< ,-OggK= -Ogg~? -OggA ,-OggA -OggC -OggdE -OggE -Ogg9F -OggG -OggI ,-OggIJ -OggL -OggsO ,-OggcP -OggS -OggJU -OggU -OggXV -OggX -Ogg![ ,-Ogg_ ,-Ogg/` ,-Ogga -Oggtc -Ogg3e -Oggle -Oggf -Oggi -Oggk ,-Oggk -Oggam -Oggeo ,-Oggp -Oggr -OggPt -Oggt -OggTu -Ogg;} c ....  .#..  #. ##..  #. #..####  #..###.....####  #....####  ##..##.....##### ##..# #................#.## #..#####..@.......-..###..# ######........##..## #......##..#.....#..# #.........# ##........#  -Ogg} ###.###..#### ###.#-Oggw 1702.8 (14.0)-Ogg F-3.8 (15-Ogg -Ogg4 Z _u - a metallic pink potion-Ogg-Ogg/-Oggջ-Oggb-Ogg-Ogg@-Ogg X-Oggd-Ogg-Ogg,-Ogg-Ogg-Ogg#..  ##..  #..#### .###.....#### ............#### .##.# # #.... # #..#####...... ###..# ######.6.8 (3.0)##..## ####.##..# -Ogg.##.>#..# ..# .. ......# .. .###..# . ## ###.# ..#-Oggy-Ogg+7.8 (4-Ogg-OggP -Oggz-_Found a stone staircase leading down..Oggkb.Oggb.Oggd.OggCh.OggsJ#.. ##.. #..#### ###.....#### #### ##.#####  #.#####  #..#####.......#..# ######.. ##..## ####.##..# ..##.>.#..# .Oggt.... ## .....# .l...l   iguana (asleep) ###..# ...... ###.# ....... .OggI}r 0  An iguana comes into view..Ogg2l.l.Ogg+8.8 (1.OggC.Oggl0 _The iguana hisses angrily..Oggw #..  ##..  ###..####.....#####  .........#####  .............##  ######..@.......  ####....... .OggXw ..##.>.  .... #  .l...  .......  ....... # ###.# ....... .Oggww* ..#.Ogg #..  ##..  ###..####.....#####  .........#####  .............##  ######..@.......  ####.......  ..##.>.  .... # .l... .......  ....... ###.# ....... ..#.Ogg.Ogg*.Oggx.Ogg!^ _An iguana is nearby!.Oggob #..  ##..  ###..####.....#####  .........#####  .............##  ######..@.......  ####.......  ..##.>.  .... # .OggAp .l...  .......  ....... # ###.# .......  ..#.Ogg  #..  ##..  ###..####.....#####  .........#####  .............##  ######..@.......  ####.......  ..##.>.  .... # .l... .......  ........Ogg s ###.# ....... ..#.OggP .Ogg .OggN .Ogg 5  ##..  #..#### ##.....#### ..........#### #..#####....##### #..#####...### #..# ######....## #### .Ogg! #.....##.>..# #......... #..# #......l## #............. ##..# #.......  ###.# ........  ..# ............###.OggI! Z#... _An iguana is nearby!.Ogg$ .Oggi* :l..Ogg* -9 _.Ogg. .Ogg-1 .Oggz N..#### ##.....#### ..........#### #....#####........##########.............### ######.....# #####..#...@.##.>.. .#.....l....##. .......# #.... ##.  ###.# .  ..#####...!##  #....Ogg{ .Ogg .Ogg҅ /=10.Oggh .Ogg _Found a potion of curing. The iguana barely misses you./Oggij  You hit the iguana.  /OggwjKThe iguana is moderately wounded./Oggj-2.2 (1.4/Oggr/Ogg.ur _The iguana barely misses you. You block the iguana's attack./Oggi-  You closely miss the iguana.The iguana is moderately wounded.3.7 (1.5 _The iguana misses you./Ogg"  You hit the iguana but do no damage.The iguana is moderately wounded./Ogg#Z43----5.2/Oggp)/Ogg,-J _The iguana bites you! You block the iguana's attack./Ogg  You hit the iguana.  The iguana is moderately wounded./Oggh4=---6.6 (1.4/Ogg/Ogg 4 _You block the iguana's attack./Ogg  You hit the iguana.  The iguana is moderately wounded.8.1 (1.5/Ogg /Ogg 7 _You block the iguana's attack. x2/Ogg9e  You hit the iguana but do no damage.The iguana is lightly wounded./Oggf `5=9.6/Oggmn /Oggq 4 _You block the iguana's attack.0OggҶ  You hit the iguana.  The iguana is moderately wounded.0Ogg2d g g   goblin (wandering)The iguana closely misses you.A goblin comes into view. It is wielding a +0 dagger.21.10Ogg0Ogga4 _You block the iguana's attack.0Ogg0I  The iguana closely misses you.A goblin comes into view. It is wielding a +0 dagger. _You block the iguana's attack.  The goblin shouts!  You hit the iguana but do no damage.  The iguana is moderately wounded.0OggR[g.g0OggYSq33------=2.5 (1.40OggZ0Ogg]+ _The iguana bites you!0OggLS  You closely miss the iguana.0OggKThe iguana is moderately wounded.0OggT  The iguana barely misses you.0Ogg<OThe iguana hisses menacingly.0OggX (g..0Ogg z4=------4.0 (1.50Ogg(0Ogg,> _The iguana bites you but does no damage.0Ogg  You closely miss the iguana.The iguana is moderately wounded.0Ogg!'g.0OggG-5.4 (1.40Ogg 0Ogg > _The iguana bites you but does no damage.0Ogg  _The iguana bites you but does no damage.  You closely miss the iguana.  The iguana is moderately wounded. _The iguana bites you but does no damage.  You closely miss the iguana.  The iguana is moderately wounded.0Ogg. 'g.0Ogg V5=6.80Ogg 0Ogg   You closely miss the iguana.  The iguana is moderately wounded. _The iguana bites you but does no damage.  You closely miss the iguana.  The iguana is moderately wounded. _You block the iguana's attack.1Ogg#..  #..#### ##.....#### ..#### ....##### ..............##### ####.......### ######........#####@.g..... # #.....##.>..#l....##. ## ... ##..# ####.# .....# .....####... .......!...##1Ogg,1OggPg.l.1OggH4-701Ogg1Oggd #.. ##..  #..#### ###.....#### .#### ######  #......##### 1Ogge< #..#####....### ##..# ######..@..# ####.g......#..# #...l.##.>..#..# #..........##..# #..........# .....# #....... ###..# #....... # ###.# ............... ..# ......###1Oggj1Oggl1Oggtpgl..1Ogguu.=81OggU|1Oggy _The iguana attacks as it pursues you! The iguana barely misses you.1Ogg˪ #.. ##.. #..#### .###.....####1OggZ.#### .##.##### # #.##### # #..#####.####..# ######.@.g. .##..##1OggH ####l. ..##..#1OggQ #.....##.>...#..# #..........##..# #..........#1Ogg.# #.............. .###..# #.............. ## ###.# .......1Ogg/|..  ..# .###1Oggj1Ogg1OggJgl.1Oggm.1Ogg.-91Ogg<1Ogg,  #.. ##.. . #..#### ..###.....#### #.#### ..##.##### .# #.##### ## #..#####.g.....### .###..# ######@.l. ..##..## ####1Ogg \..##..# #.....##.>...#..# #....##..# #...#.# #..... #.###..# #.... ### ###.# .  ..# .###1Ogg 1Ogg 1Ogg Ig.l.1Oggm `36==301Ogg 1Ogg 4 _You block the iguana's attack.2OggBI .... #.. ##.. #. #..#### ###.....####  #..#### #..####### ..# #..........#####  #..#####....@.g####..# ######.l.#2Oggx ####........#..# #.....##.>..#..# #.##..# ## ........# #..###..# #.### ###.# ....2Ogg2Ogg2OggBJg.l.2Ogg(&12Ogg2Oggy _The goblin attacks as it pursues you! The goblin barely misses you.2Ogg} .... . #.. #. ##..  #. #..####  #..###.....#### #2Ogg.#####..##.##### #..# #.##### ..## #..#####...@.g.###.###..# ######l..##..## ####..##..# #.....#.>.. ......#..# #2OggH.##..# #.# #2Oggt.# #. ###.###..# #. 2OggB ### ###.# .2Oggi2Ogg!g.2Ogg ".-22Ogg'2Ogg]*2OggL0 .... 2OggMb . #..  #. ##.. #. #..#### #..###.....#### #.####  ##..##.######..# #2OggXM .#####.## #..#####..@.g.###.###..# ######l.2OggM.##..## ####..##..# #.....##.>.. 2OggMJ.#..# #.##. #2OggM?.# #.# ##2Ogg1N.# #.  ###.###..# #2OggmN.  ### ###.# .2Ogg:S2OggS2Ogga]g.l.34-=32OggLc2Ogg3ga _The goblin attacks as it pursues you! The goblin hits you with a +0 dagger.2Ogg % .... . #.. #. ##.. #. #..#### #..###.....#### #.#### ##..##.######..# #.#####.## #..#####.@.g.l.###.###..# ######..##..## ####. .##..# #.....##.>.. .#..# #.##. ##.# #.#  ##.# #.  ###.###..# #.  ### ###.# .2Ogg 2OggB 2Ogg Bg.l.2Ogg .-42Oggn 2Ogg 2Ogg.  #  .... # . #.. # ##.. 2Ogg W# #. #..#### ####.....####  #..####  ##..####### ####..# #.......@........#####  #..#####..g.l####..# ######...# ####........2Ogg2 #..# #.....##.>.. #.#..# #.##. 2Ogge #.# ## ........# #2Ogg ].###.###..# #.2Ogg 2Ogg: 2Ogg Ig.l.2Ogg !-2Ogg 52Ogg, 2Ogg 3Ogg,## .... .# . #.. .# #. ##.. .# #. #..#### #3Ogg-i# #..###.....#### # #.#### ##..##.######..# #.g.#####.## #..#####...l.###.###..# ######.3Ogg-O.##..## ####. .##..#3Ogg- #.....##.>.. ##.#..# #3Ogg.n.##.  ###.# #.# 3Ogg;.` ##.# #. 3Ogg^.y ###.###..# #.3Oggt33Oggr93Ogg:3OggBKgl.3Ogg4C&63OggSI3OggL3Ogg/# .## .... ..# . #.. ..# #. ##.. ..# #. #..#### .## #..###.....##### #.#### ##..##.#####3Oggj#..# #.gl.##### #......## #..#####. #.###..# ###### #.##..## ####.##..# #.....##.>#.#..# #.## # ###.# #.#3Ogg2 ##.# # ###.###..# #3Ogg3Ogg3OggP@gl.3Oggd5-=73Ogg3Oggܞz _The goblin attacks as it pursues you! The goblin closely misses you.3OggA.##.## .....# . #...# #. ##...# #. #..####.## #..###.....##### #.#### ##..##.##### 3OggA ######..# #....@.gl.#####  #......## #..#####.  #.###..# #######.##..## #### #3OggA.##..# #.....##.> .###.#..# #. #3OggJB)# ###.# #.# ##.# # ###.###..# #3OggcG3OggQg.3OggQ\3-83OggV3Ogg0Ya _The goblin attacks as it pursues you! The goblin hits you with a +0 dagger.3Ogg).##.## .....# . #...# #. ##...# #. #..####.## #..###.....##### #.#### ##..##.##### ######..# #...@.g.l3Ogg9. #......## #..#####. # #.###..# #######.##..## #### ##.##..# #.....##. ..###.#..# #.# ###3Ogg.# #. # ##.# # # ###.###..# #3Ogg3Oggo,3OggBgl..3Ogg\.-93Ogg3OggD3Ogg <.##.## .....# . #...# #. ##...# #. #..#### #...## #..###.....####3OggK # #.#### ##..##.##### # ######..# #..@.gl. # #......## #..###### #3Oggs i.###..# ###### .###3Ogg .##..## #### †##3Ogg n.##..# #.....##.###3Ogg |.#..# # .### ###3Ogg +...# # .# ##........# # .# ###.###..# #3Oggy 3Ogg@ 3Ogg* 3Oggl @gl.3Ogg& O4=-3OggR 403OggP 3Ogg 3Ogg~n ..##......# . #.. †.....# #. ##...# #. #..#### ##...## #..###.....#### ###### #............#### # ##..##....##### ## ######..# #...gl.....## .# #......## #.@#####..... .## #.......###..# ###### 3Oggn ..###..##..## #### .†..##..# #.....# 3Oggo W....###..#..# #........### ###.........# # ..# ##........#.# ###.###..# # ..# ### ###.# 3Oggts 3Ogg| %g.3Ogg} .=13Ogg 3Ogga c _The goblin attacks as it pursues you! The goblin hits you but does no damage.3Oggl .# .#.. †#. ## . #. #..#### ##...#.###.....######## #............#### #3Ogg`m ##..##............##### ## ######..# #..g.l...........## .# #......## #..#####....#.###.@# ###### ..##.##..## #### .†##..##.......# ....###3OggmG.#..# #........### ###...####. ..#..# ..........3Ogg-q3Oggy*.g3Oggz&23Ogg3Ogg!c _The goblin attacks as it pursues you! The goblin hits you but does no damage.4Oggh†#. # . #. #..#### ##...#.###.....######## #............#### # ##..##............##### ## ######..# #....l4Ogg....## .# #......## #.g#####..#.###..# ###### ..##.##.@## #### .4Ogg6Z†##..##..#4OggP".....# ....###4Oggi.#..# #........### ###4Ogg8.. ##4OggC#. ###.###4Ogg ### ###.# . ..#4Ogg͸>#...!4Ogg4Ogg׽4Oggl.gl   iguana4Oggjg   goblin4Ogg&34OggD4OggZ _The goblin attacks as it pursues you! You block the goblin's attack.4Ogg6z. #. #..#### ##...#4Oggs.###.....######## #............#### # ##..##............##### ## ######..# #..l.l4Ogg....## .# #......## #..#####..#.###.g# ###### ..##.##..## #### .†##..##@.#4OggGX.....# ....###.#.#........4Oggh### ###.. ##.....4Ogg#. ###.### ### ###.# .4Ogg ..##...!4OggE #...4Ogg4Ogg4OggV.l.g4OggV55=4Ogg'-44Ogg4Ogg4Ogg@ x##...#.###.....######## #............#### # ##..##...##### ## ######..# #....l....## .# #......## #.l#####..#.###..# ###### ..##4Ogg6A h.##.g## #### .†##..##.......# ....###.#........### ###........ ##.....4OgglA #. ###.### ### ###.# . ..##...! #.4OggA G.. #...4OggA 4OggE 4OggF 4OggN R.l.g4OggwO @-54OggV 4Ogg&Z 4Ogg #### #............#### # ##..##...##### ## ######..# #....l....## .# #......## #..#####4Ogg ]..#...###.l# ###### ..###........##..## #### .†##..........##g......# ....###........#.#........### ###....... ##4Ogg #. ###.### ### ###.# .4Oggّ  ..##...!4Ogg  #...  #...4Ogg A ###4Ogg 4Ogg' 4Ogg R.l.g4Ogg &64OggЦ 4Ogg 4OgguA ##..##...##### ## ######..# #....l....## .# #......## #..#####..#.###..# ###### ..##4Ogg[v.##.l## #### .†##..##.......# ....###.#g#........### ###..4Oggv ###. ###.###4Oggv ### ###.# . ..##...4Oggvo! #...  4Oggw`#... ### 4Oggr{4Ogg&|4Ogg\.l.g4Ogga.=74Ogg74Ogg̑Z _The goblin attacks as it pursues you! You block the goblin's attack.4Oggn######..# #....l...### # #......## #..#####.. ## #.#..# #######...## #### 4OggL†##..#l.# #.....## ...###..# #......... .### ###g.# #. .# .# #.. .# ##.###.@# #. .#  ### ###.# .. .4Oggp}#  ..# . .# 4Ogg#... .!# 4Ogg1#4Ogg˸< #...#4Ogg)### 4Ogg4Ogg4OggR.l.g4Ogg|836=4Ogg'-84Ogg 4Ogg}5Ogg[ 5Ogg 8-5Ogg5Oggc5Oggu #......## #..#####...#.#..# #######...## #### ##..#..# #.....## ..###l.# #.......... ### ###..# #. 5Ogg3 # ##.......g# #.. # #.###..## #. #  ### ###@# .. #  #..# . # ##... .!...# # .5Oggj i #...#### 5Ogg%5Ogg&5Ogg},N.l.g5Ogg7-T8==5OggZ-95Ogg15Ogg35OggP 8  You hit the goblin.5OggS 5OggT 5Ogg ] U.l 5Ogg7=51.2 (1.45Ogg?m 5Oggp J _You kill the goblin!5OggA  You hit the iguana.  The iguana is moderately wounded.5Ogg@32---5Ogg&2.7 (1.55Ogg=5Oggj+ _The iguana bites you!6Ogg|  You hit the iguana.  The iguana is heavily wounded.23-------=4.1 (1.4 _The iguana bites you! The iguana misses you.6Ogg:  You slash the iguana!6Ogg$C)6Oggw4----29-5.6 (1.56Ogg6OggJ _You kill the iguana!6Oggכ!# ######..# #....l.### # #..#####.... ##..# ######.. .####..## ####... †##..#..# #.....## ...###.#..# # .### ###.........# # .#........# # .####.###.@## # .#6OggB### ###.# .# #..# ..... .###... .......!... .#....#6Oggk!####6Oggţ6Ogg~0--6Ogg%606Ogg6OggŮO _You see here a +0 dagger.6Ogg 36Ogg6Ogg,6OggX6Ogg i5=6Ogg!6Oggz#,6OggQ$6Ogg%6Ogg&6Ogg'6Ogg(6Ogg.)K6=6Oggd*6Ogg,,6Ogg,6Oggq.,6OggZ/6Ogg06Ogg06Ogg16Ogg26Ogg!3976Ogg46Ogg5,6Ogg~66OggW8,6Ogg96Ogg:6Ogg;#86Ogg;0=6Ogg<6OggX>,6OggB?6Ogg@,6OggB6OggC6OggC6OggD6OggF6OggIF6OgghFD9=6OggG6OggH6OggI6OggI6OggvK6OggK6OggL6OggM6OggRNT30=6Ogg$O6OggP6OggP6OggQ6OggS6OggPS6OggT6OggU6OggU6OggV6OggX6OggX51=6OggY6Ogg6Z6Ogg\6Ogg\6Ogg^6OggH`6Oggw`6Ogga6Oggc6Oggc6Oggd6Oggif6Oggf=2=6Oggf6Oggg6Oggl,6Oggn6Oggvo6Oggo6Ogg{p6Oggq6OggrK3=6Oggr6OggGt6Oggnt6Ogg(u6Oggv6Oggv6Oggw6Oggx6Oggy6Oggy6Ogga{6Ogg{S4=6Ogg|6Ogg}6Ogg}6Ogg~6Ogg6Ogg6Ogg؀6Ogg%6Oggr55=6Ogg6Ogg=6Ogg6Ogg6OggJ6Ogg96Oggr6Ogg6Ogg,6Ogg6Oggp6OggN36=6Ogg6OggX6Ogg6Oggc6Ogg,6Ogg6Ogg6Ogg՗W7=6Ogg6Ogg,6Ogg͚6OggЛ6Ogg6Oggz6Oggn6Ogg6Ogg)6Ogg6Ogg;58=6Ogg^6Oggٟ6Ogg6Oggǡ6OggS6OggQ6Oggt6Ogg6Ogg6Ogg/6Ogg6Ogg6OggU9=6Ogg6Ogg,6OggZ6Oggz,6Ogg 6Ogg!6OggQE40=6Oggլ6Oggѭ,6Ogg_6OggK6Oggx6Ogg6Ogg6Ogg6Ogg6Oggs6Ogg#16Oggɲ2=6Ogg=6Ogg]6Ogg6Ogg$6Ogg+6OggN6Ogg!6Ogg6OggD2=6Ogg6Ogg,6Ogg6Ogg,6Ogg6Ogg,6Ogg*6Ogg6OggU3=6Ogg6Ogg,6Ogg6Ogg,6Ogg`6Ogg6OggK4=6Ogg6Oggo6Ogg6Oggl6OggW6Ogg6OggR6Ogg,6Ogg6Ogg6Ogg?5=6Ogg6Ogg6Ogg@,6OggR6Ogg>,6Oggk6Ogg=6Oggt6Oggo6Ogg6OggK6=6Ogg6Ogg,6Ogg6Ogg&6Ogg^6Ogg6Ogg6Ogg#76Ogg2=6Ogg6Ogg,6Ogg6Ogg;6Oggv6Ogg6Ogg,6Ogg6Ogg+6Ogg{#86Ogg(=6Ogg$6OggG6Ogg6Ogg6Ogg,6Ogg,6OggU9=6Ogg 6Ogg 6Ogg 6Ogg 6Ogg6Ogg46Ogg6Ogg6Ogg6Ogg6Oggr - _You start resting.6Ogg6Ogg"1847.6 (91.0)6Ogg$[50=8.6 (926Ogg)6Ogg," _HP restored.7OggI7Ogg/7Ogg7Ogg͠7Ogg,7Oggd7Ogg7Ogg7Ogg+7Oggv,7Ogg7Oggt7Ogg87Ogg9=7Oggx7Oggʮ7Ogg7Ogg"7Ogg7Ogg7Ogg,7Ogg7Ogg 7Ogg7Ogg#7Ogg7Ogg|7Ogg7Ogg7Ogg7Ogg7Ogg;,7Ogg7Ogg7Ogg',7Ogg7Oggq7Ogg,7Ogg7Ogg7Ogg$,7Ogg7Ogg'7Ogg,7Ogg7Ogg-7OggG7Oggp7Ogg7Oggl7Ogg,7Ogg7Ogg7Ogg7Oggx7Oggq _h - 3 potions of curing (gained 1)7Ogg37Ogg7Ogg7Ogg,7Ogg7Ogg7Ogg#,7Ogg7Ogg7Ogg7Ogg7Oggo7Ogg7Oggn7Ogg7Ogg+7Ogg7Ogg@,7Ogg7Ogg7Ogg7Ogg7Ogg37Ogg7Oggk7Ogg7Ogg7Ogg7Ogg7Ogg7Ogg,7Ogg7Ogg7Ogg7Oggw7Ogg7Ogg3X7Ogg ..##### ......##### .... ....###..## 7Ogg ##......#######.  ####........... ##.....##.>............# .........##..........# .........#....#.. ...............@....... 75.6 (27...............##...... ............#### ..... .........#### .... .........## .). .........# .. ########## .7Ogg 7Ogg ,6.6 (287OggN 7Ogg & _Found a war axe.7Ogg 7Ogg< C  Skill  Level Cost  Apt Skill  Level Cost  Apt 7Ogg  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0      7Ogg  c - Throwing   0.0   1.0   0   k - Evocations   0.0   1.0   0           d - Short Blades   1.3   1.0   0      7Ogg4 *e + Long Blades2.4   3.0   0      7Ogg[         7Ogg . f - Armour   3.0   4.0   0      7Ogg \ g - Dodging   0.0   1.0   0       h - Shields   5.4   6.0   0      7Oggު ; i - Stealth   0.0   0.8  +1      7Ogg         7Ogg*         7OggQ         7Ogg             7Oggë     The relative cost of raising each skill is in cyan.  7Ogg Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  7Ogg% [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  7OggU [!] training|cost|targets8OggHH8OggM8OggST..#####deadiverson the Shield-Bearer ......##### ....Human ..........###..##Health: 50/50 ======================== ##..............#######.Magic: 6/68OggS========================####...................AC: 6Str: 16 ##.....##.>............#EV: 11Int: 11 ..........##..........#8OggSSH: 9Dex: 12 ..........#..........#..8OggTXL:  6 Next: 29% Place: Dungeon:4 ................@.......Noise: ---------  Time: 2876.6 (0.0) ................##......8Ogg9Ta) +0 long sword .............#### .....Throw: 3 darts (poison) 8OggST..........####.... .........##8OggmT.). .........#.. ##########8OggT. _You kill the iguana! _You see here a +0 dagger. 8OggT_You start resting. _HP restored. _h - 3 potions of curing (gained 1) _Found a war axe.8OggZ8Ogg@[8Oggv`8Ogg\b8Ogg 8Oggg8Ogg8Oggm8Ogg?##### ##### .... ###..## ..#. ####.#.....##.>.# ##.# #.#.....##......).....#### .....#### ... ........## .?..).# ..?.. ###...####8OggzA7.6 (18Ogg8Ogg$ _Found a sling.8Ogg38OggI8OggH8Ogg͋,8OggH8Ogg8Ogg,8OggH8Ogg8Ogg8Ogg8OggN8Ogg8Ogg,8Oggd8Ogg8Oggf8Ogg8OggƮ8Ogg##...................####.>............#.####..........#...# .#..........#....# ................. .............##......)...#####.........8Ogg#### #.......## #..@..)# #...?...... ####### #.### ## ######   8OggǶN   8Ogg&E 8Ogg,82.6 (58Ogg3+3.6 (68Ogg98Oggia _v - a scroll labelled EMPIFE WENU8Ogg 38Ogg 8Ogg 8Ogg> 8Ogg ,8Oggs ,8Ogg 8Ogg | _g - 2 scrolls labelled XYD YCROOMM (gained 1)8Ogg( 38Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogga 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Oggp 8OggX ,8Oggr 8Ogg 8Ogg ,8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Oggy 8Ogg ,8Ogg 8Ogg 8Ogg# ,8Ogg 8OggH 8Ogg ,8Ogg 8Ogg 8Ogg 8Ogg 8Oggy 8Ogg 8Ogg ,8Ogg 8Ogg 8Ogg ,8Ogg 8Ogg! 8Ogg# ,8Ogg$ 8Ogg% 8Ogg' ,8Ogg( 8Ogg%, 8Ogg- 8Ogg. 8Ogg4/ 8Ogg4 X8Ogg7 8OggT: 8Ogg: 8Ogg< 8Ogg? 8OggBB 8OggB 8OggD 8Ogg^F 8OggH 8OggH 8OggJ 8OggVM 8OggO ,8OggP 8OggQ 8Ogg'V X8OggV 8Ogg%W 8OggW 8OggY 8Oggz[ ,8Ogg[] 8Ogg] 8OggMa 8Oggua 8Oggb 8Ogg#c 8OggUd 8Ogg|d 8Ogge 8Oggf 8Oggg 8Oggg 8Oggei $ 8Oggi M_h - 4 potions of curing (gained 1)8Ogg}j 8Oggj 8Ogg'k 8Oggol 8Oggrm 8Oggm 8Oggn 8OggDo 8Oggvq 8Oggq 8Oggr 8Ogg!u 8Oggv 8Ogg#w 8Oggx 8Ogg(z 8Ogg | 8Ogg9| 8Ogg+} 8OggH 8Ogg? 8Oggk 8Oggр 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8OggÅ 8Ogg_ 8Ogg m _e - 3 brown potions (gained 1)8Ogg͊ 8Ogg! 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8OggӐ 8Oggg 8Ogg` 8Ogg` 8Ogg 8Ogg 8Ogg 8Ogg1 8Ogga 8Ogg 8Ogg 8Ogg 8Ogg: 8OggK 8Ogg] 8Ogg 8Ogg 8OggӠ 8Ogg 8Ogg 8OggY 8Ogg 8OggY 8Oggp ,8Ogg 8Ogg4 8Oggڲ 8Ogg 8Ogg̳ 8Ogg 8Ogg 8Ogga 8Oggۻ 8Oggt 8Ogg8 8Oggy 8Ogg< 8Ogg( 8OggK 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg, 8Ogg 8Ogg 8Ogg8 8Ogg} 8Ogg 8OggA 8Ogg> 8Oggb 8Ogg 8Ogg& 8Ogg8 8OggZ 8Ogg 8OggP 8Ogg? 8Oggb 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg* 8Ogg! 8OggX 8Oggv 8Ogg 8Oggl 8OggY 8Ogg_ 8Ogg 8Ogg 8Ogg? 8OggY ,8Ogg 8Oggl 8Ogg_ 8Ogg 8Ogg~ 8Ogg 8OggJ 8Ogg ,8Ogg 8Ogg 8Ogg 8OggH 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8Oggy 8Ogg 8Ogg 8Ogg 8OggZ 8Ogg 8Ogg 8Ogg 8Ogg| 8Ogg 8Ogg_ 8OggK 8Ogg 8Ogg6 8Ogg 8Ogg 8Ogg 8Ogg 8OggJ 8Ogg 8Oggd 8Ogg 8Ogg2 8Ogg 8Ogg 8Ogg 8Ogg 8Ogg 8OggC 8Oggm 8Ogg 8Ogg 8Ogg=' {   ##..   .#.#   .# ...# 8Ogg(   ..# ...   ..## ..##   #..# ##...####  #..##...(..[  #....@#  955.6 (72.0) #.....#   #....##  ##....#  8Oggz( #.....# #.....# #....##  ##....# . ##.....#8Ogg. 8Ogg]/ ,6.6 (738Ogg5 8OggI8 % _Found 6 stones.9Ogg&9OggH'9Ogg(9Ogg+9Ogg/,9Oggt4,9Ogg6,9Ogg89Ogg@;9OggB ##### ..#  .<..##..   .?..#.#  .# .....# 9OggBd ..# ....#  ..## #..##  #..# ##...######  #..##..@(..[..#  8.6 (2.0)#.....#########  #.....#  #....## 9OggCQ ##....#  #.....#  #.....#  #....## 9Ogg5C  ##....#  9OggZHA9.6 (39OggtM9OggDP9 _Found a stone staircase leading up.9OggX9Ogg9Ogg9Ogg H _No target in view!9Ogg : ##### ..#  #.<..##..  ...?..#.#  .# ......#  ..# .....#  ..## #..##  #..# ##...######  #..##...@..[..#  #.....#  #.....#  #....##  ##....#  #.....#  #.....#  #....##  ##....#  9Ogg 9Ogg 9Ogg ,60.6 (1 _9Ogg| 9Ogg L _You see here 6 stones.9Oggdp ##### ..# 9Ogge #.<..##..  ...?..#.#  .# .......#  ..# .....#  9OggHe..## #..##  #..# ##...######  9Oggze#..##...(@.[..#  #.....#9Ogge  #.....#  #....## 9Oggep ##....#  #.....# 9Ogg=f #.....#  #....##  ##....#  9Oggcf9Oggn9Ogg/p-1 _9Oggs9Oggu:Oggg ##### ..#  #.<..##..  ...?..#.#  .# .......#  ..# .....#  ..## #..##  #..# ##...######  #..##...(.@[..#  #.....#  #.....#  #....##  ##....#  #.....#  #.....#  #....##  ##....#  2:OggS  :OggT##### ..#  #.<..##..  ...?..#.#  .# .......#  ..# .....#  ..## #..##  #..# ##...######  #..##...(..@..#  #.....#  #.....#  #....##  ##....#  #.....#  #.....#  #....## :OggFU` ##....#  :OggPb:OggZc&3:Oggh:OggBly _You see here a +2 cloak of stealth.:Ogg<:OggO=&4:OggA:OggsDO _w - a +2 cloak of stealth:Ogg:OggwWear which item? Armour (go to first with [) :Ogg} b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth[?] describe selected [!] equip|wield|wear|put on:Oggy[tab] equip|unequip ;Ogg%  deadiverson the Shield-Bearer ##### ..#  Human#.<..##..  Health: 50/50 ========================...?..#.#  Magic: 6/6========================.# .......#  AC: 6Str: 16..# .....#  EV: 11Int: 11..## #..##  SH: 9Dex: 12#..# ##...######   XL:  6 Next: 29% Place: Dungeon:4#..##...(..@..#   Noise: ---------  Time: 2964.6 (0.0)#.....#########   ;Ogg'W a) +0 long sword#.....#  Throw: 3 darts (poison)#....## ##....# #.....#  #.....#  #....##  ##....#   _Found 6 stones. _Found a stone staircase leading up. _No target in view! _You see here 6 stones. _You see here a +2 cloak of stealth. _w - a +2 cloak of stealth;Ogg 5.6 (1  You start putting on your armour.6.6 (27.6 (38.6 (49.6 (5 9 _You continue putting on your +2 cloak of stealth. x4  You finish putting on your +2 cloak of stealth.;OggH _You feel stealthy.;OggbP Drop what?23/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 long sword (weapon) Missiles (select all with ()  f - 3 poisoned darts (quivered)  j - a throwing net Armour (select all with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn) Jewellery (select all with "=)  p - a +5 ring of evasion (left hand)d - an amulet of faith Wands (select all with /)o - a wand of acid (13) Scrolls (select all with ?)  g - 2 scrolls labelled XYD YCROOMM  m - a scroll labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 2 scrolls labelled MEYCSO REZEI [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[;Ogg}X -top]=Ogg  deadiverson the Shield-Bearer ##### ..#  Human#.<..##..  Health: 50/50 ========================...?..#.#  Magic: 6/6========================.# .......#  AC: 9Str: 16..# .....#  EV: 11Int: 11..## #..##  SH: 9Dex: 12#..# ##...######   XL:  6 Next: 29% Place: Dungeon:4#..##...(..@..#   Noise: ---------  Time: 2969.6 (0.0)#.....#########   [3=Oggl3ma) +0 long sword#.....#  Throw: 3 darts (poison)#....## ##....# #.....#  #.....#  #....##  ##....#   _w - a +2 cloak of stealthYou start putting on your armour. _You continue putting on your +2 cloak of stealth. x4  You finish putting on your +2 cloak of stealth. _You feel stealthy.  Okay, then. _=Ogg=3=Ogg\>=OggA=OggD=OggH: _=Ogg%I=OggZK,=OgguL=OggN=OggQ,=OggZR=OggU=OggKW,=OggX=Ogg9^=Ogg4`=Oggq`=Ogga=Oggc=Ogge=Oggf=OggNg=Oggi=Oggnk,=Oggl=Oggo,=Oggp=Oggt You start putting on your armour. _You continue putting on your +2 cloak of stealth. x4  You finish putting on your +2 cloak of stealth. _You feel stealthy. _t - 3 scrolls labelled MEYCSO REZEI (gained 1)=Ogg(v=Oggmv=OggLw=Ogg"y=Oggz=Oggz=Ogg{=Ogg}=Ogg=Ogg=Ogg=OggԂ=Ogg,=Ogg#=Ogg=Oggm,=OggI=Ogg=Ogg,=Ogg =Oggɑ=Ogg,=Oggq=Ogg̕=Ogg',=Oggu=Ogg=Ogg=Ogg=Ogg=Ogg=Ogg8  o.  .  #.  .#  ##.#  =Ogg1}#..  #.#  ##@#  #..#  ##.## =OggZ #######..#  ##.<..##..#=Ogg{  #......#.## =Oggo   orc (asleep).# #........#=Ogg ..###.......# =OggV ..####.#..## =Ogg =Ogg 86.6 (17.0)  An orc comes into view. It is wielding a +0 hand axe.=Ogg)=Ogg% oooo 2 orcs (1 wandering)The orc shouts! You hear a shout!=Ogg5==7.6 (18=Ogg=Ogg'r _An orc comes into view. It is wielding a +0 flail.=Ogg ' o.  o  #.  .#  ##.#  #..  #.#  ##@#  #..#  ##.##  ..#  ##.<..##..#  #......#.##  .# #........#  ...#  .## =OggA e o.  o  #.  .#  ##.#  #..  #.#  ##@#  #..#  ##.##  ..#  ##.<..##..#  #......#.##  .# #........#  ...#  .## =Ogg =Ogg =Ogg% =Ogg* d _There are monsters nearby!>OggJl>Ogg]m>Oggu{.oo>Oggv18.0)>Ogg&~>Ogg% _The orc shouts!>Ogg >Ogg, >Ogg >Ogg+ Eo..oo   orc wizardo   orc>Oggx, /--9>Ogg 4 >Ogg? z _An orc wizard comes into view. It is wielding a +0 dagger.>Oggzp >Ogg} T.o>Ogg 9*>Ogg] . o   orc  The orc wizard mumbles some strange words.The orc wizard flickers and vanishes!>Ogg[ >Ogg {oo 2 orcs>Ogg: B--90>Ogg >OggC _Deactivating autopickup; reactivate with Ctrl-A.>Ogg >Ogg >Ogg >Ogg..o.o>Ogg:&1>Ogg 8{>Ogg ?Ogg?Ogg!?Ogg"?Ogg+.{.o.o?Ogg,&2?Ogg/3?Ogg6?OggZ  You hit the orc.  The orc is heavily wounded.?Ogg?OggS?Ogg^..o?Oggg5=3.9 (1.3?Ogg?OggYm _You block the orc's attack. The orc closely misses you.?Ogg5  You hit the orc.?Ogg?Ogg$?OggZ%w.   orc?Oggt)1305.2?Ogg/?Ogg2G _You kill the orc!@OggqI  You hit the orc.  The orc is heavily wounded.@OggI-6.7 (1.5@Ogg:P8{@Ogg%S1 _You block the orc's attack.@Ogg&jK  You hit the orc.@Ogg,r .{You kill the orc!@Ogg(v518.1 (1.4@Ogg{@Ogg%~f _Something hits you but does no damage.@Ogg ?  You barely miss something.@Ogg J  You hear some strange, mumbled words.@Ogg} @Ogg! 5=9.6 (1.5@Oggc @Ogg n _Something tries to affect you, but you resist.@Ogg= @Ogg> 8-3001.0 (1.4@OggC @Ogg&G _You hit something but do no damage. Something hits you but does no damage. x2@Ogg&@Ogg'B-2.4@Ogg,@Ogg/z _You miss something. Something hits you but does no damage.AOgg{7  You hit something.AOgg|  You hear some strange, mumbled words.  A magic dart appears from out of thin air!AOgg"zAOgg{Y44---3.8AOgg@AOgg. _The magic dart hits you.AOggR(  You closely miss something. Something hits you but does no damage.AOgg)]5---5.3 (1.5AOgg.AOgg03 _You block something's attack.AOgg@ r1--6.7 (1.4AOggB AOgge/  --more--COgg_d _Something hits you but does no damage.DOgg7You barely miss something.DOgg,sYou hear some strange, mumbled words.  A magic dart appears from out of thin air!DOggBDOggYC31----=---7.8DOggeHDOgg5K& _The magic dart hits you!DOgg /You hit something.DOggz )Reactivating autopickup.DOgg[43---9.3DOggDOgg6 _You feel a bit more experienced.DOgg }M.. ..#. #.#..# ##. #..##.## .. ...#.......DOggDOgg/x4==---200DOggDOgg i _Items here: ))) [[.DOggEkDOgg mInnate Abilities, Weirdness & Mutationsa - You regain HP and MP as you explore.FOggExplore regen You are invigorated by the discovery of the unknown. As you explore the dungeon,your wounds will heal and your magic will replenish.GOggsG Innate Abilities, Weirdness & Mutations  a - You regain HP and MP as you explore.GOgg GOgg+! GOgg`' ;  deadiverson the Shield-Bearer ...   Human..   Health: 34/50 ================--------..   Magic: 6/6========================#.  AC: 9Str: 16GOgg( t.#  EV: 11Int: 11##.#  SH: 9Dex: 12#..#  XL:  6 Next: 43% Place: Dungeon:4#@#  Noise: ---------  Time: 3020.3 (0.0)##.#  a) +0 long sword#..#  Throw: 3 darts (poison)##.## #######..# ##.<..##..#  GOgg( }#......#.##  GOggA) .# #........#  ..###.......#  GOgg) BA magic dart appears from out of thin air! _The magic dart hits you!  You hit something.  Reactivating autopickup. _You feel a bit more experienced. _Items here: ))) [[.GOgg. GOgg./ GOgg2 GOgg4 IOgg>IOgg?IOgg?IOggBIOgg7G| _IOgg^HIOggH95IOggIIOggK,IOggLIOggN,IOgg V36=IOggu7=8=9=IOggvIOggw,IOggyIOggzb40=IOgg{IOgg|IOgg}IOgg}IOggf,IOggIOgg,IOggIOgg݄k1=IOgg^IOggIOggBIOgg<IOggɊ,IOggGIOgg<a2=IOgg<IOgg IOggWIOggIOgg@,IOggIOgg6,IOgg}IOggjIOggU3=IOgg6IOgg5,IOgg&IOggh,IOggIOggjIOggѤK4=IOggǥIOgghIOggIOggIOggX,IOggIOgg,IOggJIOggIOgg)#5IOgga2=IOggTIOgg,IOggIOgg,IOggIOggYIOggK6=IOggIOgge,IOggTIOgg,IOgg-IOgg,IOggIOggIOggU7=IOggIOgg,IOggIOggO,IOgg(IOgg,IOggIOggIOggD8=IOggIOgg,IOggIOgg,IOgglIOggIOggWU9=IOggAIOgg7,IOggIOggIOggIOgg}IOgg ,IOggIOggb50=IOgg=IOggCIOgg,IOggIOggEIOgg,,IOggsIOggIOggj,IOggIOggyIOggIOgg69=IOgg@IOggIOggV IOgg IOggA IOggIOgg&,IOggIOggIOggIOggIOggIOgg!IOgg5&,IOgg'IOgg4       #  ###.  ##..##  ##....##  #?....@#  #......#  IOgg+5w###...##  ##..##   #.###   ##.#   #..#   IOggk5#)##   ##.#  IOgg;085.3 (65.0)IOgg?<,6.3 (66IOggbAIOggCa _x - a scroll labelled CUTHEJ YHIBIOgg IOgg@ IOgg IOggq IOgg IOggL IOgg ,IOgg IOgg IOgg IOgg IOgg ,IOgg= IOgg IOgg IOggV IOggy IOgg_ IOgg IOggA IOggI IOgg ,IOgg IOggo  _m - 2 scrolls labelled JUDAXY DOSHAXE (gained 1)IOgg IOgg IOggm IOgg IOgg* IOgg[ IOgg IOgg IOgg  IOgg3 IOgg IOgg IOgg IOgg# IOggM IOgg! IOgg" IOgg" IOgg3# IOgg% IOgg>' IOggz' IOgg' IOgg* IOgg, IOgg, IOgg- IOgg@0 IOgg1 IOgg"2 IOgg2 IOgg55 IOggq6 IOgg6 IOgg7 IOgg9 IOggN; IOgg; IOgg< IOgg> IOgg)@ ,IOgg@ IOggB IOggqD IOggD IOggeE IOgg?G IOggH IOggI IOggI IOggK IOggM IOggPM IOggN IOggT X  Items here: ))) [[.IOggU IOggqV  _IOggW IOggX IOgg[ ,IOgg ` XIOgg` IOggc IOgge IOgg,f IOgg]g IOggi IOggk ,IOgg.m IOgg o IOgg q IOggTq IOggGr IOgg[t IOgg(v IOggav IOggw IOggy IOgg| BIOggV~ IOgg+ ,IOggV IOgga IOggP IOggÅ IOgg IOgg IOgga IOgg IOgg IOgg XIOgg IOgg ,IOgg9 IOgg? IOgg IOggU IOgg0 IOggş IOggz IOggġ IOggt IOgg IOgg IOgg= IOgg IOgg* IOgg ,IOgg* IOggɬ IOgg ,IOgg IOgg IOgg1 IOggw IOgg± IOgg߳ IOgg IOggK IOgg~ IOgg IOgg IOgg: IOgg IOggл IOgg IOgg\ IOggֽ IOgg] IOgg IOgg IOggB IOggY IOgg IOgg IOgg\ IOgg IOgg IOgg IOggh IOgg! IOggo IOgg IOgg IOggL IOgg IOgg IOggD IOgg IOgg" IOgg[ IOgg IOgg1 IOgga IOgg IOgg IOgg1 IOggS IOgg IOgg IOgg IOgg IOgg IOgg IOggt IOgg .#..#.#.##..# #.# ###.#######....## IOgg )/.....@..## 137.3 (51...######..## ###### ##..### ##.<..# ###..## #...... ##..###...... ##..###.....IOggI  ##..####.#. ###..####. ##..##..IOgg IOgg ,8.3 (52IOgg& IOgg % _Found a dagger.IOgg,)IOgg)IOgg*IOgg-IOgg/IOgg/IOgg74,IOgg5IOgg5IOgg6IOgg 9IOgg;IOgg;IOgg =IOgg>?IOggA,JOggJOggJOggO,JOgg|JOggJOgg ,JOgg JOgg .# .. #. JOgg#.## ..# #.# ###.## ######....## #)@........##......######..## ..######## ##..###  ###..## # ##..### ##..##JOgg ##..# ###. ##JOggTJOgg 244.3 (6.0)JOgg+5.3 (7JOgg %JOgg./ _y - a wand of digging (6)JOggJOggiJOgg!JOggKJOggwJOggJOggnJOgg{!JOggh' .. #. #.## ..# #.#JOgg' ###.########....#########).........###....@....######..##o....######## ##..######JOggR(Y###.. ##.. ##. o   orc (asleep) # JOggF2 7.3 (2  An orc comes into view. It is wielding a +0 flail.JOggn;u.ooJOgg(<4==8.3 (3JOggBJOgg2P7 _The orc shouts! You hear a shout!JOgg  ..  #.  #.##  ..#  #.# JOgg 1   ######....##  #######).....  #....@....#  .o...########  ###    JOgg  ..  #.  #.##  ..#  #.#    ######....##  #######).....  #....@....#  JOgg/ .o...########  ###    JOggw JOgg- JOgg JOgg [ _An orc is nearby!JOgg2B' .. #. #.## ..# #.# ###.## ######....## #).## #...@.....######..##JOggC[.o...# ##...#### ###.. ## ## JOggUGJOggOQ.oJOggP;--9.3 (1 _JOggVJOggZKOgg .. #. #.## ..# #.# ###.## ######....## #).## #.######..###...o..# ##..KOggl#.##### ### ## KOggKOgg5KOggo.KK   koboldKOggӼB--50KOggXKOgg[~ _A kobold comes into view. It is wielding a +2 dagger of venom.KOgg/ .. #. #.## ..# #.# ###.## ######....## #).## #oKOgg%02.######.. #......# ##.. #K###### ### KOgg4KOgg=@K.KOgg$>845---KOggO>'=1KOgg;FKOggI7 _The orc hits you with a +0 flail.KOggOrKOgg{N.KKOgg|`6=--2.7 (1.4KOgg0KOggj _You barely miss the orc. You block the orc's attack.KOgg^KOggKOgg D..KKOggJ (4.1KOgg KOgg v _You hit the orc but do no damage. You block the orc's attack. x2KOggͣ 7  You slash the orc!KOggA  )You kill the orc!The kobold hits you but does no damage.KOgg 7====45.5Pois KOgg KOgg4 Q _You are poisoned.KOggsG  You miss the kobold.You feel very sick.KOgg`H#4KOggH3-6.9KOggzPKOggS7 _You block the kobold's attack. x2LOgg:  You slash the kobold!LOgg~ )  You kill the kobold!LOgg1f2--8.4 (1.5LOggLOgg$ _You feel sick.LOggD  #. #.## ..# #.####.########....### #######).........##..##)........######..#....@.######## ##. #.###### ##LOgg U....LOgg LOgg_ N--90LOgg¦ LOgg֫ _You feel sick. _You see here a +2 dagger of venom.LOgg$ LOgg$ LOgg& LOgg* LOgg* #1LOgg/ ?-LOgg*L 0-=- 61.4 (2 _You start resting. You feel sick. x32.4 (3  _You are no longer poisoned.MOggSx3MOggyMOgg|MOgg|MOggXMOggGMOgg~MOgg„MOggMOgga%1MOggɈMOgg)MOgg\MOggMOggu,MOggMOggWMOgg#2MOgg(=MOggCMOgg֗MOggMOggWMOggޛMOgg MOggQMOggMOggMOgg+MOggMOggKMOggnN3=MOgg{MOgghMOggMOgg_MOggMOggMOggMOggOMOggwMOggϴMOggMOggT#4MOgg(=MOggMOgg5MOggdMOggMOggMOggMOggzMOggMOggMOggN5=MOgg'MOggMOgg'MOggdMOggMOggMOggMOggMOggMOggMOgg`MOggGK6=MOggMOggeMOggMOggMOggMOggMOggTMOggMOggMOggN7=MOggMMOgg,MOggMOgg,MOggMOggV,MOgg0MOggmMOggK8=MOgg9MOggMOggMOgg:MOggn,MOggAMOggk9=MOggMOgg,MOggMOgg,MOggTMOgg,MOggMOgg_ _You start resting.MOgg0975.0)MOggm[50=8.4 (36MOgg MOggt" _HP restored.MOgg 3MOgg# MOgg5 MOgg MOgg. MOgg MOgg MOgg MOgg MOggY MOggO MOgg 9=MOgg$ MOgg MOgg ,MOgg MOgg MOgg ,MOgg MOgg MOgg MOgg* MOggb MOgg MOgg0 T#s .# ... .#. ##.## ..# #.# #@## ## #..######.##.#########).....#..##)........####....).#########.######s   scorpion (asleep)#..##..## #.#MOgg7 3206.4 (8.0)MOgg< j.ssMOggr= +7.4 (9MOggC MOggXF [ _A scorpion comes into view.MOggH  #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....)  #.######  #..# #..## #.#MOggh  #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....) #.######  #..# #..## #.#MOgg _A scorpion is nearby!MOgg #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....)  #.######  #..# #..## #.#NOgg:x #. s# .. #. #.## ..#NOggG; #.# #@##  NOggz;#..#  ##.#)NOgg;l #..##) NOgg;.#....) #.######  #..# NOgg<l#..## #.#NOggCNOgg=DNOgg@KNOggkN_ _A scorpion is nearby!NOgg!^ #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....)  #.######  #..# #..## #.#NOgg #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....) #.######  #..# #..## #.#NOgg4NOggNOgg_ _A scorpion is nearby!OOggc  #. s# .. #. #.## OOggd ..# #.# #@##  #..#  ##.#) #..##) #....)  #.######  #..# OOggd <#..## #.#OOgg  #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) OOgge #..##) #....) #.######  #..# #..## #.#OOgg OOggZ OOgg-OOgg_ _A scorpion is nearby!POggk #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....)  #.######  #..# #..## #.#POgg #. s# .. #. #.## ..# #.# #@##  #..#  ##.#) #..##) #....) #.######  #..# #..## #.#POggPOggPOggPOggk_ _A scorpion is nearby!POggc.#.  #s#.. #.###.  .## ##..# ########.#########)......##)........###...).######## #.###### #...##POggfPOggpP.sPOggp28.4 (1 _POgg POggPOggG @#..  #.#.s. ###.#....#.#  ##.. #.# #### #..# ########.#########).....##)........###...).######## #.###### #..POggN P.sPOggN &9POggU POgg(X POgg . .# .. #. #.##  ..#  #s  #@## #..# #....#.# ##...#.## ###..#..# ###########.#########).... #..##)........## #....).######## #.######POgg2 ~ _is nearby! _ The scorpion stings you.POgg T49-=POgg 10POgg POggH A _The scorpion stings you but does no damage.QOgg  You hit the scorpion.  The scorpion is moderately wounded.QOgg3-1.8 (1.4QOggQOgg!6 _You block the scorpion's attack.QOgg   The scorpion is moderately wounded. _You block the scorpion's attack.  You closely miss the scorpion.  The scorpion is moderately wounded.The scorpion stings you. x2  You are poisoned.QOgg %6QOgg( =======--3.3 (1.5Pois QOgg2 QOgg / _The scorpion poisons you!QOgg>  You barely miss the scorpion.The scorpion is moderately wounded.You feel very sick.QOgg h1----4.7 (1.4QOgg8 QOgg v _The scorpion barely misses you. You block the scorpion's attack.QOggfeel very sick.The scorpion barely misses you. You block the scorpion's attack.closely miss the scorpion. QOgglC39----QOgg!6.1QOggFQOgg.A _The scorpion stings you but does no damage.ROgg  You hit the scorpion.  The scorpion is heavily wounded.ROggROgg<Z7--7.5ROggROgg%E _You feel sick. You block the scorpion's attack.ROgg!  You hit the scorpion.  The scorpion is almost dead.35--8.8 (1.3ROggߛROgg̟~ _You feel sick. You block the scorpion's attack. The scorpion misses you.ROgg)?  You barely miss the scorpion.The scorpion is almost dead.You feel sick.ROgg?H-20.3 (1.5ROgg:SOggo:SOgga;SOggU<,SOgg<SOgg=SOgg@>K8=SOgg>SOgg?SOgg?SOgg]@SOggA,SOggBSOggDk9=SOggESOggG,SOggHSOggJ,SOggKSOgg?PBSOggWh - _You start resting.SOgg]090.3 (63.0)SOgg3^H50=-SOgg\^%1.3 (64SOgg9cSOgge" _HP restored.TOggS3TOggSTOgg(TOggTOgg@BTOggqTOggTOgg-TOgg[TOgg{TOggTOgg TOggTOggTOgg_ 9=TOgg TOgg*"TOggV#TOgg#TOgg$TOgg/%TOgg&TOgg,'TOgg'TOgg2)TOggx*TOgg*TOgg+TOgg,TOggl.TOgg.TOgg&/TOgg4TOgg"9 o ###... #.....TOgg9H..### #...........####.......#..............#....@.......####.#####... #..#  ##.# #.## #..#o   orc (asleep)##.TOgg:##.###..#TOgg@ 9.3 (8.0)  An orc comes into view. It is wielding a +0 short sword.TOggYGz.ooTOggEH6==300.3 (9TOggNTOgg}X% _The orc shouts!TOgg#a  .  ###o.  . #.....  ..### #......  .....####.......  #..............  #....@.......  ####.#####...  #..# ##.# #.## TOgga x#..# ##.# #.##  #..# TOgg  .  ###o.  . #.....  ..### #......  .....####.......  #..............  #....@.......  ####.#####...  #..# ##.# #.## #..# ##.# #.## #..#TOgg) TOgg TOgg TOgg [ _An orc is nearby!TOgg  .  ###o.  . #.....  TOgg ..### #......  .....####.......  #..............  #....@.......  ####.#####...  #..# ##.# TOgg `#.## #..# ##.# #.##  TOgg .#..# TOggr @ .  ###o.  . #.....  ..### #......  .....####.......  #..............  #....@.......  ####.#####...  #..# TOgg ##.# #.## #..# ##.# #.## #..#TOggߵ 4TOgg TOgg [ _An orc is nearby!TOgg4L# . ###o. ..### .....#####...##..........####.#####...##..# #####.#TOgg#.## #..###.##.##TOgg TOgg$V.oTOgg]%;--1.3 (1 _TOgg+TOgg-UOggD8#  ###.. o..### .....#####...##..............####.#####...#..# ######.# #.## .#..# .##.# #UOggGUOggOV.oUOgg&PA--2UOggUUOggXUOggu###.#.####....#. ##...### ##..o......####.#.##.####.#####...##.UOgg##.# #.## .##..# .##.# #.UOgg,UOgg^46--=3UOgg|UOgge= _The orc hits you with a +0 short sword.UOgg!=UOgg=g5---4.6 (1.3UOggCUOggFw _You closely miss the orc. The orc hits you with a +0 short sword.UOggǭ  You closely miss the orc. The orc barely misses you.UOggn[6=6.0 (1.4UOggUOgg1 _You block the orc's attack.UOgg UOgg (7.4UOgg UOgg _You closely miss the orc. The orc barely misses you.UOggp  You hit the orc.  The orc is severely wounded.UOggS `7=8.8UOgg UOgg 1 _You block the orc's attack.VOgg7  You slash the orc!VOgg%e)VOgg6210.1 (1.3VOggU VOgg G _You kill the orc!VOgg4VOggVOggH _No target in view!VOggv _VOgg8w8=VOggT,VOggBVOggVOggrk9=VOggVOggl,VOggQVOgg,VOggdVOgg,VOgg VOgg_b50=VOgg^VOggzVOgg,VOgg&VOggcVOgg4VOggVOggsVOggVOggFVOggVOggYVOggVOgg|VOgg9=VOggnVOgg;VOggVOggVOggVOggVOgg&VOggbVOggVOggVOgg,VOggVOgg;VOggVOggVOggVOggxVOgg9VOgg~VOggbVOggVOgg,VOggVOggVOgg,VOggVOggVOgg,VOggB VOggv VOgg,VOggqVOggnVOgg,VOggVOggYVOggS,VOggVOggVOggVOggVOgg VOgg"VOgg$,VOgg&VOgg)VOgg+VOgg+VOgg<-VOgg0VOgg65BVOgg9VOgg9VOgg;VOgg_?} _t - 4 scrolls labelled MEYCSO REZEI (gained 1)VOggAVOggAVOggBVOgg_EVOggG,VOggHVOggdLVOggM,VOgg_NVOgg9PVOggQVOggQVOggkRVOgg>TVOggmUVOggUVOggFVVOgg-XVOggEYVOggYVOggYVOgg[VOgg\,VOgg]VOgg^VOgg_,VOgg`VOggbVOggCc,VOggdVOggdVOggf,VOggufVOgg9hVOgghVOgghVOgg_iVOgg mVOggm,VOggnVOggpVOggq,VOggqVOggsVOggt,VOgg vVOgg0xVOggx,VOggyVOgg{VOgg|,VOggw}VOgg-VOggk,VOggQVOggڂVOggVOgg4VOggƄVOggVOgg,VOggVOggVOggVOggiVOgg!VOggVOgg,VOgg˔VOggVOgg ,VOggVOggoVOgg&,VOggXVOggwVOggڥVOgg!BVOggBVOggjVOggVOggʮ,VOgg˯VOggVOgg,VOgg|VOggVOggA,VOggVOggXVOggtVOggO,VOggVOggԽVOgggVOggVOggVOggDXVOggVOggVOggVOggPVOggVOgg,BVOggVOggVOgg2VOggqVOgg'VOgg,VOggVOggGVOggUVOggVOggVOgg6VOgg<VOggmVOggVOggcVOggXVOgg$VOggVOggVOgg-,VOggVOggVOgg,VOggXVOggVOggVOggVOggVOggVOggVOggVOggVOgglVOggVOggVOggVVOggVOgg,VOggVOggEBVOggVOggvVOgg*BVOggVOggVOgg_VOggVOggVOgg76.....## #..# ......###..#..> ......##...#.... .####..#..###.. ## ###....##.... ##......## #...# ###....##..## ###...# ........##..###...# .).......##..#..@# -94.1 (84.0) ..........##....## ..........###..## .........## ##.# ##...##### #.#VOgg7  ##### #.. ##.# .# ..-5.1 (85 _Found a stone staircase leading down.VOgg*g3VOgggVOggjVOgglVOgglVOggpnVOggrVOggtVOggtVOggtVOggMvVOgg xVOggkxVOggPyVOgg{VOgg|,VOggV}VOggVOgg,VOggVOggVOggV,VOggVOggVOgg ##..#  #..## .. ###  #..# ..##? VOgg$ ##..# ##.#....r #..## ##.......J ## #..# #......... .###..# #...>.....##...# #..........#..## ##.@....... #....# ##..........VOgg4}....## ##...#.......##..## ###...####...?. ...##..###...### ####. ....##..#...## J   endoplasm (asleep) .....##....## r   quokka (asleep) .....###..## ....## ##.# #VOgg 402.1 (7.0)  A quokka and an endoplasm come into view.VOggVOggr..JJrVOgg+3.1 (8VOggVOgg^ _The endoplasm quivers.VOggb@  ##..#  #..## .. ###  #..# ..##?..  ##..# ##.#...r. # #..## ##........  #..# #.......J.  #...>.....  #.........  ##.@.......  ##..........  ##...#.......  ###...####...?. ...### ####. ...##..##.## ##.#VOgg  ##..#  #..## .. ###  #..# ..##?..  ##..# ##.#...r.  #..## ##........  #..# #.......J.  #...>.....  #.........  ##.@.......  ##..........  ##...#.......  ###...####...?....### ####....##VOgg ..##.## ##.#VOgg 4VOggk VOgg d _There are monsters nearby!VOggh  ##..#  #..## .. ###  #..# ..##?..  ##..# ##.#...r. # #..## ##........  #..# #.......J.  #...>.....  #.........  ##.@.......  ##..........  ##...#.......  ###...####...?. ...### ####. ...##..##.## ##.#WOggM ##..#  #..## .. ###  #..# ..##?..  ##..# ##.#...r.  #..## ##........  #..# #.......J.  #...>.....  #.........  ##.@.......  ##..........  ##...#.......  ###...####...?....### ####....##..##.## ##.#WOgg&XWOggXWOggaWOgg3ed _There are monsters nearby!WOgg ..# ##..# #.. #..##.. ####..# ..##?..  ##..# #...r  #..##. WOgg # #..# #.......J ###..# #...> ##...# #. .#..#..# .....## ##...#.......##..## ###...####...?.##..###...### ####..##..####..#..#WOgg WOgg؉ WOgg Jr.J.WOgg 24.1 (1 _WOgg̚ WOgg WOgga #..# ..# #. ##..# #.. #..##.. #####..# ..##?...###..# #..r...#  #..##.  #..# #......J# #. #...# #. WOggw #..## ...## ....... ##..## ###...####...?.##..###...### ####...##..######....##WOggs WOgga WOgg f.r.JWOgg= &5WOgg WOgga c _There is a stone staircase leading down here.XOgg1##.# #..# #..# #..  ##..# #..  #..##.. ##### ..# ..##?...# ##..# #......## #..###....r.....#..# XOgg#....@..# #...>.J ...# #.## . ..## ....... #..## ###...####...?. ##..###...### #####....##..#...###XOgg  You block the quokka's attack.  The endoplasm freezes you.XOggE]49-=6XOggMXOgg% _You are frozen.XOgg`  You hit the quokka.  The quokka is moderately wounded.The quokka bites you but does no damage.XOggia-7.5 (1.4XOggjXOggYmy _You block the endoplasm's attack. The quokka completely misses you.XOgg  You closely miss the quokka.The quokka is moderately wounded.You block the quokka's attack. The endoplasm barely misses you.XOgg7f7--8.8 (1.3XOggpXOgg+ _The quokka bites you.XOggBq 8  You hit the quokka.XOgg  †  You kill the quokka!The endoplasm barely misses you.The endoplasm freezes you.XOgg k3---310.1XOgg: XOggi % _You are frozen.XOgg>  You hit the endoplasm.  The endoplasm is almost dead.The endoplasm freezes you.XOgg d38----1.4XOggA XOgg! % _You are frozen.XOggnThe endoplasm is almost dead.  The endoplasm freezes you. _You are frozen.  You hit the endoplasm but do no damage.The endoplasm is almost dead.  The endoplasm freezes you.XOggC--2.7XOgg$XOggƚ% _You are frozen.YOgg;  You hit the endoplasm.YOggf2.YOgg544.1 (1.4YOggYOggM _You kill the endoplasm!YOggYOgg@YOgglYOgg#H _No target in view!YOggL3YOgggYOgg׿YOgg2: _YOgg~YOgg%9YOgg]YOggQ,YOggYOgg,YOggNYOgg,YOggYOggYOgg2E40=YOggYOggYOgg YOggvYOgg,YOggYOggYOgg#U1=YOgg=YOggYOggYOgg}YOgg,YOggYOgg,YOgg6YOgg~YOgg K2=YOggYOgg,YOggYOgg8YOggYOggYOggr93YOgg2=YOgg:YOggYOgg7YOggQYOgg YOgg YOggK YOgg,YOggYOgga4=YOgg`YOggYOggYOggGYOggzYOggYOggYOgg'"YOggX"YOgg#YOgg\&k5=YOgg'YOgg *,YOggh+YOgg-,YOggM/YOgg{1YOgg1K6=YOgg3YOgg5,YOgg87YOgg9,YOgg_;YOgg=,YOgg?YOggAYOgg:BU7=YOggDYOggDF,YOggHYOgg7J,YOggKYOggMYOgg:NK8=YOggOYOggR,YOggSYOggU,YOggVWYOggZ,YOgg\YOgg_YOgg_U9=YOgg^bYOgge,YOggkgYOggj,YOggkYOggnYOggnE50=YOgg2pYOggsYOgg5u,YOggvYOggVzb  You see here a quokka corpse.YOgg5|YOgg8} _YOgg}YOggYOggT,YOggYOggm  ###  ##.#  #..# ##. #..# #.. ..# #.. ..## #.. ###### ..# #..##@...# - ..# ##.#......## YOggS## ##....†.....# # #.....## #...>## #....## ##.............# ##........... ## ##...#............YOgg058.1 (44.0)YOggb=-9.1 (45YOggIYOggb _z - a scroll labelled USSITH RYUGYYOgg: YOgg YOgg9 YOggŴ YOgg2 YOggy ,YOggB YOgg ,YOgg YOgg YOgg YOgg~ YOgg YOggf YOggT ,YOgg YOgg YOgg# ,YOgg? YOgg YOgg YOgg: YOgg) YOggD YOgg YOgg YOgg YOgg YOgg YOgg5 YOgg< YOggg YOgg. ,YOgg YOggq ,YOggC YOgg | _x - 2 scrolls labelled CUTHEJ YHIB (gained 1)YOgg] 3YOgg_ YOgg* YOggJ YOgg YOgg! YOgg YOgg ,YOgg YOgg! YOgg# YOgg^$ YOgg$ YOgg' YOgg( YOgg>) YOgg) YOgg), YOgg- ,YOgg. YOgg0 YOggE2 YOgg~2 YOggF3 YOgg86 YOggD8 ,YOgg8 YOgg5< YOggD I#.. ###### #..##....#......#  ##.#......## ......#  #YOggE ....†.....## .w....#  ............# ......#  ...>........## ......#  .............# .....#  YOggLE 3...........####.....#  ..............@.....#  .YOggyE #...................##  ####..........########  YOggE # #####....###   ######  YOggE  ###   w   dart slug (asleep) YOggF ###.#   ##..##   ##....##  YOggP -77.1 (18YOgg+Q ,8.1 (19YOggW YOgg[ \ _A dart slug comes into view.YOggs  #..   #..##....# ......# ...## ......# †.....## .w....# .....# ......# >.... ......# ......# .....# ......####.....# .........@.....# ..............## .......######## # ...###  ######  ###  ###.#     YOggM #..  YOgg7 #..##....# ......# ...## ......# †.....## .w....# .....# ......# YOgg>.... ......# ......# .....# ......####.....# .........@.....# ..............## YOgga.......########  YOggn)...###  ######  ###  ###.#     YOggYOggYOggYOgg` _A dart slug is nearby!YOgg# #..   #..##....# ......# ...## ......# †.....## .w....# .....# ......# >.... ......# ......# .....# ......####.....# .........@.....# ..............## .......######## # ...###  ######  ###  ###.#     ZOggXz #..   #..##....# ......# ...## ......# †.....## .w....# .....# ......# >.... ......# ......# .....# ......####.....# .........@.....# ..............## .......########  ...###  ###### ZOgg{ ###  ###.#     ZOggZOggXZOgg ZOgg` _A dart slug is nearby!ZOgg] #..  #.. ###### ##..S.....#  #..##....# .........#  #......## #........#  †.....## ...w....#  ........# #.......#  >........## .. .....# #.....#  ZOgg ?.....####@....#  ...............  #...................##  ###..........########  #####....### ######   ###  S   ball python (constriction, asleep)#.#  ##  ZOggȘ UwwZOgg[ 19.0)ZOggܡ ZOggA ^ _A ball python comes into view.ZOgg5  #.......# ###### ##..S.##....# . #.#......## #....†.....## ...w. #>ZOggƵ ## #.......# ...#### ..........................## ###..........#############....#########  ##ZOgg B ###.ZOgg ZOgg ZOgg# /.SZOgg n.wS)ZOggy '80ZOgg ZOggy [OggN##  # ###### ##....##....# ...S #.#......## #†.....## #.... #.w>[Ogg]## #.@.....# ###### .................## ###..........#############....#########  ##[Ogge[Ogg F.S[Ogg!.=1[OggV'[Ogg*A _The dart slug bites you but does no damage.[OggƇ=  You slash the dart slug![OggU[OggB .S The dart slug is severely wounded.[Ogg(-2.4 (1.3[Ogg[Ogg<A _The dart slug bites you but does no damage.[Ogg$  You hit the dart slug.  The dart slug is almost dead.You block the ball python's attack. The ball python misses you.[Ogg@W49-3.7[Ogg[OggT _The ball python bites you. You block the ball python's attack.[Ogg=  You slash the dart slug![Oggb †S   ball python (constriction)  You kill the dart slug![Ogg555.1 (1.4[Ogg[Ogg"| _You block the ball python's attack. The ball python barely misses you.[Oggr*  You kill the dart slug! _ barely misses you.  You hit the ball python.  The ball python is moderately wounded.The ball python closely misses you. The ball python barely misses you.  The ball python bites you but does no damage.[Ogg+  1 6.6 (1.5Constr [Ogg2 [Ogg]6 z _The ball python grabs you. The ball python constricts you.[Ogg  The ball python grabs you. The ball python constricts you.  You barely miss the ball python.The ball python bites you but does no damage.  The ball python constricts you.  bites you but does no damage.[OggӞ \50=8.0 (1.4[OggF [Ogg _ _The ball python constricts you.[Oggx  You closely miss the ball python. You block the ball python's attack.49-9.3 (1.3[Ogg| [Ogg _ _The ball python constricts you.\Ogg^Dt_The ball python constricts you.You closely miss the ball python. You block the ball python's attack. _The ball python constricts you.You closely miss the ball python. You block \OggD!the ball python's attack.\OggE@6--\OggE"90.6\OggM\OggP_ _The ball python constricts you.\Oggnb=  You hit the ball python.\Oggii.\Ogg nm7-11 2.0 (1.4\Oggv\OggxO _You kill the ball python!\Ogg\Ogg{\Ogg\OggH _No target in view!\Ogg:T \OggnW   Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1  \OggW          b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Evocations   0.0   1.0   0  \OggX t    \OgghX      d - Short Blades   2.1   1.0   0      e + Long Blades3.6   4.0   0          \OggX `    \OggX  f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0  \OggX      h - Shields   5.4   6.0   0      \OggY ; i - Stealth   0.0   0.8  +1      \OggAY         \OggbY         \OggY l    \OggY a    \OggY _    \OggY         \OggY a    \Ogg+Z The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help\OggIZ G[=] set a skill target  \OggZ }[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets]Ogg]Ogg]OggX##.  deadiverson the Shield-Bearer #..##......#   Human #..#.......##   Health: 47/50 ======================-- ]Ogg޶#.. ###### ##........#   Magic: 6/6======================== #..##....# .........#   AC: 9Str: 16 #.#......## #........#   EV: 11]Ogg .Int: 11 ....†.....## #........#   SH: 9]Ogg/,Dex: 12 ]Ogg...........# #.†.....#   XL:  6 Next: 75% Place: Dungeon:4 ..>........## #.@.....#   Noise: =--------  Time: 3492.0 (0.0) ............# ##.....##   a) +0 long sword ]OggηP............####.....#   Throw: 3 darts (poison) .....................#  ]Ogg#...................##  ###..........########   #####....###]OggD  ######]Ogg@  ###   ]Ogg¸OThe ball python constricts you.The ball python bites you but does no damage. _The ball python constricts you.You hit the ball python. _You kill the ball python! _No target in view!]Ogg]Ogg]Ogg]Ogg7]Ogg_W]Ogg)X]Ogg?Y]Ogg[]Ogg\$ _]Ogg-aX]Ogga]OggtbK8=]Oggc]OggPe]Ogge]Oggf]Ogg+i,]OggIj]Oggk]Oggl]OggAlN9=]Ogggm]Oggo,]Oggo]Oggq]Oggr]Oggr]Oggt,]Oggu]Oggw]OggJxL50=]Oggy]Ogg{]Ogg}]Ogg}]Ogg)]OggO]Ogg]OggJ]Ogg5]Ogg4]Ogg]OggZ]Ogg>]Ogg]Ogg]Ogg9=]Ogg ]Oggܑ]Ogg]Ogg]Ogg̕]Ogg1]OggҘ,]Oggz]Ogg]Ogg,]Oggv]Ogg4]Ogg ,]OggĦ]Ogg ]Oggê,]Ogg]Ogg]Ogg,]Ogg̰]Oggd]Ogg״]Ogg]Ogg]Oggߺe  You see here a dart slug corpse.]Ogg]Oggɼ _]Ogg]Ogg]Ogg|]Ogg]Ogg]Ogg]Ogg,]Ogg]Ogg{]Ogge,]Ogg$]Ogg]OggX]Ogg]Ogg0]OggK]Ogg]Ogg]Ogg]Ogg]Ogg]Ogg,]Ogg]Ogg7]Ogg,]Ogg<]Ogg]Ogg,]Ogg]Ogg+]Ogg ,]Ogg]Oggq]Ogg,]Ogg|]Ogg\]Ogg]Ogg]Ogg]Ogg_]Ogg7,]Ogg]Ogg]Ogg]Ogg]Ogg]Ogg ]Ogg]Ogg]Ogg]Ogg ]Ogg ,]Ogg ]Oggv]Ogg]Ogg]Ogg]Ogg]Ogg]Ogg]Ogg]Ogg]OggI,]Ogg]OggH]OggB]Oggx]Ogg]Ogg ]Ogg1 ]Ogg%]Oggq',]Ogg(]Ogg*]Ogg,]OggR,]Ogg,]Ogg/]Ogg1,]Ogg1]Ogg5]Ogg}6]Ogg6]OggP7]Oggl:]Ogg>B]Ogg?]Ogg#A]OggkA]Ogg\B]Ogg)E]OggF]OggG]OggG]Ogg(J]OggK]OggK]OggL]OggEO]OggZQ]OggJR,]Ogg;T]OggU,]OggV]OggX]OggZ,]Ogg>[]Ogg]]OggR^,]Ogg^]Ogg`]Ogg:b,]Oggb]Ogg d]OggCe,]Oggf]Oggg]Oggh]Oggh]Ogg:i]Oggj]Oggl,]Oggl]Oggn]Oggjo]Oggo]Oggp]Oggq]Oggr,]OggRs]Oggu]Oggv]Oggav]Oggv]OggQx]Oggey]Oggy]Oggz]Ogg{]Ogg },]Oggc}]Ogg]OggЀ,]Ogg]Ogg]Ogg ]Oggd]Oggτ]OggB]Ogg]Ogg]Ogg},]Ogg]Ogg̚]Ogg]Ogg]Ogg%]Ogg]Oggh]Ogg]Oggi]Ogg1]Ogg6,]Ogg/]Ogg_]Ogg]Ogg(]Ogg ]Ogg]Oggj,]OggS]Ogga]Ogg ,]Ogg]Ogg]Ogg,]Ogg]Ogg]Ogg,]Oggln]Ogg]Ogg,]Ogg(]Ogg]Ogg,]Ogg]Ogg]Ogg,]Ogg]Ogg]Ogg,]Ogg3]OggW]Ogg:,]Ogg]Ogg]OggW]Ogg]OggE]Ogg]Ogg,]OggH]Ogg]Ogg]OggG]Ogg]Ogg2]Oggy,]Ogg]Ogghg  You see here a +2 dagger of venom.]Ogg ]Ogg  _]Ogg]Oggk]Ogg,]Oggc]Ogg]Ogg,]Ogg9]Ogg,]OggF,]Ogg]Ogg!]Ogg#]Ogg $]Ogg%]OggS']OggN)]Ogg)]Ogg*]Ogg2]Ogg4]Ogg#5]Ogg[6]Ogg}8]Ogg;:]Ogg:]Ogg;]Ogga?]Ogg^A]OggA]OggB]OggD]OggG]OggOG]OggH]OggL]OggN]OggN]Ogg P]OggQ]Ogg|S]OggS]OggpT]Ogg1X]OggY]OggY]OggZ]Oggc^]Ogg_]Ogg;`]Ogg`]Oggd]Oggyf,]Oggg]Oggxk]Oggl,]Oggm]OggYo]Oggp,]Oggq]Ogg]OggV,]Ogg]Ogg.]Ogg=,]Oggժ]Ogg]Ogg,]Oggp]Ogge]Ogg   #    ....# ##    #....   ]Ogg\ .... .  ... #.  ##..#####.  #.[#.   ]Ogg ##........#.    #.@# ]Ogg##57.0 (18.0) ###..###   #.## ##....##..#   #...####.......# #...#........... #..####....... .   #..########... ..### #  ]OggM ##....## ### .....####   #......### #.......]OggB8.0 (19]Ogg&]Ogg# _Found a robe.]Oggr 3]Ogg ]Ogg^ ]Ogg B]Ogg ,]Ogg ]Ogg ]Ogg' ]Ogg  #. ...>. #.. ]Oggo ##.... # #....##### ##....##.. #....# #..]Ogg  #...# #.. ##..###### #..]Ogg  ]Ogg #..@....[##...60.0 (2.0) ]Ogg v##.......... #... ]Ogg #..#........ ##..  # ##..##.......#..  #.## ##....##......###  #...####.......#.....  #...#..............  ]OggD #..####..........  #..########......### ##]Ogg ]Ogg +1.0 (3]Ogg ]Ogg ; _Found a stone staircase leading down.]Ogg ]Oggi ]Ogg ]Ogg ]Ogg ]Ogg& ]Oggs ,]Ogg ,]Ogg ]Ogg! ]Ogg ]OggB ]Oggh ]Ogg1 ]Ogg% ]Oggg ]Ogg ]OggD ]Ogg' ]Oggi ]OggC ]Ogg ]OggҴ ,]Ogg} ]Oggɶ ]Ogg ,]OggZ ]Oggn ]Ogg ,]Ogg ]Ogg R  There is a stone staircase leading down here.]Ogg[ ]Ogg  _]Ogg ]Ogg> ]Ogge ,]OggP ]Oggu ]Ogg6 ,]Ogga ]Ogg X]Ogg ]Ogg ,]Ogg ]Ogg ]Ogg ]Ogg ]Ogg. ]Ogg ]Ogg+ ,]Ogg ]Ogg ]Ogg ]Ogg ]OggQ ]Ogg ]Ogg ,]Ogg ]Oggi ]Ogg ,]Ogg ]Ogg1 ]Ogg ,]OggL ]Ogg ]Ogg1 ,]Ogg. ]Ogg  ]Ogg ,]Ogg% ]Ogg ]Ogge ]Ogg ]OggV ]Ogg ]Oggo ,]OggL ]Ogg ]Ogg ]OggH ]Ogg ]Ogg ]Ogg ,]Ogg ]OggG ]Ogg! ]Ogg" ]Ogg" ]OggY& ]Ogg' ]Ogg( ]Ogg( ]Ogg* ]Ogg+ ]Ogg(, ]Ogg, ]Ogg2/ ]OggO0 ,]Ogg0 ]Ogg7 ]Ogg#9 ]Ogg9 ]Ogg9 ]Ogg; ]Ogg:= ,]Ogg!> ]Oggj@ ]OggB ,]OggC ]OggE ]OggG ,]OggrI ]OggK ]OggNN ,]OggO ]Ogg9Q ]OggR ,]OggdS ]Ogg1T ]OggfU B]Ogg)V ]Ogg_W ,]OggX ]OggJY ]OggZ ,]OggL[ ]Ogg] ]Ogg^ ,]Ogg_ ]Ogga ]Ogg]c ,]Ogg d ]OggRe ]Ogg9g ,]Ogg}h ]Oggk ]Oggm ,]Oggq ]Oggv ]Oggx ,]Oggy ]Ogg| ,]Ogg} ]OggՇ } _t - 5 scrolls labelled MEYCSO REZEI (gained 1)]Ogg ]OggX ]Ogg ]OggB ]Ogg ,]Ogg ]Oggē ]Oggɕ ,]Ogg ]OggN ]Ogg ]Oggٚ ]OggÛ ]Oggt ]Ogg ]Ogg ]Ogg ]Oggv ,]Oggm ]Ogg ]Ogg+ ,]Ogg ]Ogg ]Ogg[ ,]Oggm ]OggH ]Ogg0 ,]OggC ]Ogg- ]Ogg ,]Ogg ]Ogg> ]Ogg ]Ogg ]OggS ]Ogg ]Ogg ]Ogg ]Ogg ]Ogg ]Ogg[ ]Ogg ]OggU ]Ogg ]Ogg ,]Ogg ]Oggj ]Ogg: ,]Ogg} ]Ogg ]Ogg~ ]Ogg ]Ogg' ]Ogg ]Ogg0 ]Ogg ]Ogg ]OggM ]Ogg} ,]Ogg( ]Ogg ]Ogg ,]Ogg ]Ogg ]Ogg< ,]Ogg ]Ogg ]Ogg ,]Ogg>]Ogg]Ogg%,]Ogg]Oggo ]Ogg ,]Ogg) ]Ogg]OggO]Ogg,]Ogg]Ogg,]Ogg]Ogg]OggI,]OggR]Ogg0]Ogg,]Ogg]Ogg]OggB]Oggl]OggB]Ogg B]Ogg[!]Ogg{"]Ogg#]Ogg#]Ogg#]Oggh%]OggS&]Ogg&]Ogg ']Ogg+)]Ogg$*]Ogg^*]Ogg*]Ogg+]Ogg,,]Ogg,]OggL/]Ogg/,]Ogg/]Ogg0]Ogg1,]Ogg1]OggB3]Ogg4,]Ogg5]Ogg6]Ogg7]Ogg,7]Oggs7]Ogg8]Ogg:,]Ogg;]Ogg =]Ogg>]Ogg>]Oggd?]OggsA]OggB]OggGC]OggC]OggE]Ogg9G]OggG]OggH]OggI]OggK,]OggqL]Ogg*N]OggO]OggO]OggP]Ogg-R]OggS,]OggXT]OggU]OggZW,]Ogg X]OggiY]OggZ,]OggZ]Oggb\]Ogg\]Ogg0]]Ogg]]Ogg1`]Oggip #......###   #........##   ##.........###   ##.#..........#   ##............##   ##............##   #...#.......###   #...##....###   #.@.##..###   #...###..#   #...# ##.## ]Ogg k.  #...# #..#  #...# ##.##  #...# ##.##o   orc (asleep)  #...# #..#  ##.o# ##.## ###  ##.## #..]Ogg@r 754.0 (93.0)  An orc comes into view. It is wielding a +0 short sword.]Oggyoo.==5.0 (94]OggB~]Ogg% _The orc shouts!^Ogg 6 #.  #....  ##...  ##.#.  ##...  ##...  #...#  #...#  #.@.#  #...###..#  #...# ##.##  #...# #..#  #...# ##.##  #...# ##.##  #..o# #..#  ##..# ##.##  ##.## ^Ogg  #.  #....  ##...  ##.#.  ##...  ##...  #...#  #...#  #.@.#  #...###..#  #...# ##.##  #...#  #...#  #...# ##.##  #..o# ^OggZ ##..# ##.##  ##.## ^Ogg%^Ogg^Ogg^Ogg[ _An orc is nearby!^Oggs6 #.  #....  ##...  ##.#.  ##...  ##...  #...#  #...#  #.@.#  #...###..#  #...# ##.##  #...# #..#  #...# ##.##  #...# ##.##  #..o# #..#  ##..# ##.##  ##.## ^Ogg  #.  #....  ##...  ##.#.  ##...  ##...  #...#  #...#  #.@.#  #...###..#  #...# ##.##  #...#  #...#  #...# ##.##  #..o# ^Ogg  ##..# ##.##  ##.## ^OggT^Ogg^Ogg^Oggb[ _An orc is nearby!^Oggu@I........## ##.........#####.#....##....###....## ...#### ..##....### ..##..### #..#  ##.## #..#.## ##.##o# #..#..#.## ###  ##.## #.. #..# ##^Ogg _Ogg> _OggA _OggC ,_OggD _OgghH _Ogg J _Ogg8J _OggkK _OggM _OggO _OggO _OggP _OggR _OggT _OggT _OggU _OggW _Ogg?Y _OggpY _OggZ _Ogg[ _Ogg-] _OggX] _Ogg ^ _Ogg_ _OggEa _Oggsa _Oggb _Oggc _Ogg\e ,_Oggf _Oggh _Oggi _Oggi _Oggj _Oggl _Oggn _Oggn _Oggo _Oggq _Oggss _Oggs _Oggdt _Oggv _Ogg;x _Oggjx _Oggy _Ogg:{ _Oggn| _Ogg| _OggZ} _Ogg _Ogg _Ogg; _Oggb _Ogg _Ogg^ _Ogg _Ogg _Ogg _Ogg _OggJ _Oggy _Oggȏ _Ogg ,_Ogg! _OggM _Ogg _Ogg _Ogg _Ogg _Ogg' .###.. ## .....K......... #.. # ................ #.. _Ogg\ # ................ #.. # #............... ##.. _Ogg # #.............. #... #### #............. #... _Ogg 6...#### #............ #... ......##### #..@........ ##...-- _Ogg ..........######......## ##.... #.............###..#### ##..#.. ######..............#######..###._Ogg& z ####...................## #  ###.....##.>............#.#K   kobold (asleep) _OggP  #..........##..........#...###  ##..........#..........#....###  #............................##_Oggs !_Ogg 828.3 (68.0)  A kobold comes into view. It is wielding a +0 club._Ogg i.KK_Oggĵ &==_Ogg 9.3 (69_OggU _Ogg : _The kobold shouts! You hear a shout!_OggÈ C ............... #_Ogg ......K......... # ................ # #............... # #..............  #.............  #............ _Ogg5 I #..@........ .###......## #_Oggj O.....##..#### ..............# ....._Ogg ,  >........  _Ogg C.......  .......  _OggE!  ...............  ......K.........  ................  #...............  #..............  #.............  #............  #..@........ .###......## .....##..#### _Ogge" ..............# .....  >........  .......  .......  _Ogg* _OggI+ _Ogg2 _Ogg4 ] _A kobold is nearby!_Oggg Q ............... # ......K......... # ................ # #............... # #..............  #.............  #............  #..@........ ._Oggg ###......## #.....##..#### ..............# .....  >........  ....... _Oggg .......  _Ogg2h _Ogg ...............  ......K.........  ................  #...............  #..............  #.............  #............  #..@........ .###......## .....##..#### ..............# .....  >........  .......  .......  _Ogg _OggP _OggB_Ogg|] _A kobold is nearby!`Ogg####..# .## ##. K. #.# # #. #### #.#### #. ......##### ##........... ## ..........######......## ##.. #`Ogg,.............###..#### ##..#. ######...#######..## ####.............## ##.....##.>......#.###. #...####....#`OggS`Ogg4F.K`Ogg9--30.3 (1.0) `Ogg _`Ogg`Ogg`Oggz#.####..########..# .## ## .......K #.# # #. #### #.#### ##. ##### ##..... ## .######......## ##.. #.....###..#### ##..#. ######...#######..## ####.............## ##.....##.>......#.###. #.#`OggF.K`OggCA--1`Ogg,`Ogġ`OggM.####..###. #.## ##....o...[.. ##..########..# .## ## `OggT.. #......K# # #. #### ##.#### ##. `Ogg'......##### ##........... ##...o   orc (wandering).....`Oggu ooAn orc comes into view. It is wielding a +0 hand axe.Found a pair of boots.  The orc shouts!`Ogg&==`Ogg* 2`Ogg`OggT _The kobold closely misses you.`Ogg1 :  You slash the kobold!`Ogg `Ogg `Ogg x oo)o   orc wizard (wandering)o   orcYou kill the kobold!`Oggt =7-3.8 (1.5`Ogg `Ogg z _An orc wizard comes into view. It is wielding a +0 dagger.`Ogg/ %#..##..###..## ###...o....# ##..###. #.## ##....o...[.. ##..#####....o###..# .## ## .. #.# # ##. #### ##.`Ogg70 >#### ##. ##### ##..... ## .######......## ##.. #.....###..#### ##..#.o 2 orcs (1 polearm, 1 wandering) ######...#######..##`Oggc0 U ####.......## `OggB  An orc comes into view. It is wielding a +0 trident.`Ogg1C `OggD `OggP ..o.oooo)`OggQ 4=40`Ogg] `Oggc k _The orc wizard shouts! _You see here a +0 club.`Ogg ##.#########..## #.. #####..###..## ###........# ##..###. #.## ##.....o..[.. ##..###`Ogg##.....o###..# .#o# ## . ......)# # ##. #### ##.#### ##. `Ogg##### ##..... ## .######......## ##.. #.....###..#### ##..#. ######...#######..##`Ogg`Ogg`OggF`Ogg..ooo`Ogg6--5 _`Ogg2 `OggaOgg##..# ###......###..## #..####.. ##..##### ##..[.. ##..### .## ###......o..... ###.. ......o.. ##.. #.o  ..###....... #### ## ...#### ##...##### ###....######## ##. #....###..#### ##..# ######......#######..### ####........## aOggDaOggaOggaOggHaOgg...oooaOggA--6aOggaOggM _You see here a +0 club.bOgg]..####.. ##..##### ##..[.. ##..### .## ###.... ###.. bOggQ..o ##.. #.o..  ..obOggr#)###. #### ## ...#### ##...##### ###....######## ##. bOgg#....###..#### ##..# ######......#######..### ####........## ###.....##.>#.##bOggbOgg U.obOgg 4*bOggb! oo 2 orcs (1 polearm)  The orc wizard gestures wildly while chanting.The orc wizard flickers and vanishes!bOgg+ubOgg {.oDeactivating autopickup; reactivate with Ctrl-A.bOgg$46bOgg2--==bOgg 7bOgg܋bOgg] _The orc attacks as it pursues you! The orc hits you with a +0 hand axe.bOgg-## ##..[.. ##..### .## ###.... ###.. .. ##.. #.{.o  .........#o###....... #### ## ...#### ##...##### ###bOggR.....######## ##. #....###..#### ##..# ######......#######..### ####........## ###.....##.>......#.##..........##bOgg.$#...###bOgg2bOggN3bOgg<`...{obOgg\=/--8bOggBbOggDbOggKa.## ###.... ###.. .. ##.. #.  {o...#o###....... #### ## ...#### ##...##### ###....######## ##. #....###..#### ##..# ######bOgg......#######..### ####........## ###.....##.>......#.##..........##....#...####.#.bOggčbOggobOggQbOggH<..obOggL)obOggA--9bOggbOggJbOgg[  .. ##.. #.  .o#).#bOgg##.....o. #### ##..... ...#### ##...##### ###....######## ##. bOgg|#....###..#### ##..# ######bOgg ......#######..### ####........## bOggJy###.....##.>......#.##..........##bOggpl....#...####...#.bOgg5........bOggbOggbOggbOgg.o.obOggd67--bOgg 40bOgg bOgg9 bOgg6 c#.  .#)o###........ #### ##....o bOgg6 ...#### ##.......##### ###....######## ##. #....###..#### ##..# ######......#######..###bOggp7 O ####........## ###.....##.>.....#.##..........##...#...####.#...bOgg7 ;......###)bOggi< ,bOgg> bOggG .o.obOggH &1bOggV bOgg=Y bOggu p .#. . #. #) ##. #o #.. ###bOggv . #. ..####o #...##### ##.... ##....######## ##.....###@.#### ##..# #####..............#######..###.#  ####...................## #.###.....##.>............#.###.#..........##..#..##..........#...#....###.#................. ##...........##)..# #..#####.bOggw ..#bOgg$z bOggG{ bOgg| bOgg .o.obOggY ,*bOggbbOgg7*@bOgg 0 2Confused throw: 3 darts (poison)Conf bOggbOggQ _You are confused.cOggcOgg<cOgg¨cOggh.o.ocOgg"&3cOgg8{cOgg2 _You bump into the rock wall.cOgg ##  # # . # #cOgg~! .. # # ). ## # . # #### ... ##### ##...{o. #cOgg!##### ##........... ########@o....## ##. #cOgg!F.............###..#### ##..#.. ######..............#######..### ####...................## #cOgg"o ###.....##.>....#cOgg*"} #..........##...#...### ##..........#..cOggS"5##  #cOgg"f................  ##cOgg"+....##)..cOgg&'cOggw2F.{cOgg%3S8==cOgg\3 4cOgg;cOgg>n _The orc misses you. The orc hits you but does no damage.cOgg  You closely miss something. The orc hits you but does no damage.  The orc hits you from afar with a +0 trident.  Something hits you. The orc barely misses you.cOgg73---cOgg=&6.2 (1.4cOggcOgg : _The orc hits you but does no damage.cOgg  You closely miss something. Something hits you. The orc barely misses you.cOgg c1----7.6cOggY cOgg] ; _The orc closely misses you.cOgg dOgg{2  You miss something. Something hits you. The orc hits you but does no damage.  The orc completely misses you. Something hits you but does no damage.dOggf|c36---9.0dOggdOgg_ _The orc hits you but does no damage. The orc hits you with a +0 hand axe.dOggsi   The orc completely misses you. Something hits you but does no damage. _The orc hits you but does no damage. The orc hits you with a +0 hand axe.  You hit the orc.  The orc is heavily wounded.  You feel less confused.  Something hits you. The orc closely misses you.31----- 9 50.3 (1.3Throw: 3 darts (poison) dOggIpdOgg>s dOggXs4_The orc hits you with a +0 hand axe.dOgg7?  You hit something. Something hits you but does no damage.The orc hits you but does no damage. You block the orc's attack.2=--1.8 (1.5dOgg@dOgg}Cf _Something hits you but does no damage.dOgg3'dOgg*QDrink which item? Potions  c - a puce potion  e - 3 brown potions  h - 4 potions of curing  i - a viscous pink potion  k - 3 lumpy ruby potions  q - a fuming silvery potion dOgg* u - a metallic pink potion [!] read|quaff|evoke[?] describe selectedfOggD fOggS##...............#.. deadiverson the Shield-Bearer #................ #.. Human fOgg#................ #.. Health: 32/50 ===============--------- ##......)........ ##.. Magic: 6/6======================== #fOgg##.............. #... AC: 9Str: 16 ######............. #... EV: 11Int: 11 ...#### ##....o....... #... SH: 9Dex: 12 ......##### ##..{........ ##... XL:  6 Next: 77% Place: Dungeon:4 ..........######@o....## ##.... Noise: =--------  Time: 3851.8 (0.0) fOggX#.............###..#### ##..#.. a) +0 long sword ######..............#######..###. Throw: 3 darts (poison)####...................## #.###.....##.>............#.###.#..........##..........#...### oo 2 orcs (1 polearm)##..........#..........#....####............................####.................##......)..##You feel less confused.Something hits you. The orc closely misses you. fOgg!C_The orc hits you with a +0 hand axe.  You hit something. Something hits you but does no damage.The orc hits you but does no damage. You block the orc's attack. _Something hits you but does no damage.fOggTQ  You feel better. You block the orc's attack.fOgg^39===2.8 (1fOgg fOgg  _The orc hits you but does no damage. Something hits you but does no damage.fOggc  You miss something. The orc hits you but does no damage.  You block the orc's attack.fOggg:*fOggDJ  You hear some strange, mumbled words.fOgg4 @You are confused.The orc misses you.fOgg8=== 0 =4.2 (1.4Confused throw: 3 darts (poison)Conf fOgg Y _The orc hits you from afar with a +0 trident.fOgg(B  You miss something. Something hits you but does no damage.fOggB =9-5.5 (1.3fOggL fOggO S _The orc barely misses you. x2fOgg2 ?  You barely miss something.fOggƻ J  You hear some strange, mumbled words.fOgg H  Something tries to affect you, but you resist.The orc hits you but does no damage. x2; Something barely misses you.fOggH5=7.0 (1.5fOggQfOggRu _The orc hits you but does no damage. The orc barely misses you.gOgg:P gOgg1T ODrink which item? Potions  c - a puce potion  e - 3 brown potions  h - 3 potions of curing  i - a viscous pink potion  k - 3 lumpy ruby potions  q - a fuming silvery potion  u - a metallic pink potion [!] read|quaff|evoke[?] describe selectedhOggphOggyhOgg \##...............#.. deadiverson the Shield-Bearer #................ #.. Human #................ #.. Health: 39/50 ==================------ #hOgg3 #......)........ ##.. Magic: 6/6======================== ###.............. #... AC: 9Str: 16 ######............. #... EV: 11Int: 11 ...#### ##....o....... #... SH:  0  Dex: 12 ......##### ##..{........ ##... XL:  6 Next: 77% Place: Dungeon:4 ..........######@o....## ##.... Noise: ==-------  Time: 3857.0 (0.0) #.............###..#### ##..#.. a) +0 long sword ######..............#######..###. Confused thrhOgg ow: 3 darts (poison) ####...................## #. Conf ###.....##.>............#.###.#..........##..........#...### oo 2 orcs (1 polearm)##..........#..........#....####............................####.................##......)..## _The orc barely misses you. x2  You barely miss something.  You hear some strange, mumbled words.  Something tries to affect you, but you resist.The orc hits you but does no damage. x2; Something barely misses you. _The orc hits you but does no damage. The orc barely misses you.hOgg  You feel better. Something hits you but does no damage.hOgg-a44=== 9 hOgghz-8.0 (1Throw: 3 darts (poison) hOggp&hOgg(l _You block the orc's attack. The orc barely misses you.hOgg9  You slash something!hOgg )Reactivating autopickup.You feel a bit more experienced. You block the orc's attack.hOgglx5===89=9.4 (1.4hOgghOgg9P _The orc barely misses you.iOgg  You hit the orc.  The orc is severely wounded.The orc hits you but does no damage.iOgg>4-60.9 (1.5iOgg iOggC _The orc hits you from afar with a +0 trident.iOgg~O8M_The orc hits you from afar with a +0 trident.  You hit the orc.  The orc is almost dead.The orc closely misses you. The orc hits you but does no damage.iOggdP]5-2.3 (1.4iOggbYiOgg\4 _You block the orc's attack. x2iOgg7  You slash the orc!iOgg )   orc (You kill the orc!iOgg1903.7iOgg}iOgg P _The orc barely misses you.iOgg!J.## ## .. #......)# # ##. #### ##......#### ##....o ##### ##..@........ ## .iOggJc######.)....## ##.. #.....###..#### ##..#. ######...#######..## ####............## ##.....##.>.....#.###. #.####....# ...iOggKiOggViOggW,40iOggW_iOggdd _You block the orc's attack.  Things that are here: _a +0 dagger; a +0 robe; an orc corpseiOgg iOggW [6=6.0 (1.3iOgg iOgg w _You closely miss the orc. The orc hits you but does no damage. x2iOgg iOgg -7.4 (1.4iOgge iOgg _You barely miss the orc. The orc misses you.jOgg&8  You hit the orc.  The orc is moderately wounded.jOgg9(8.8jOgg9AjOggC: _The orc hits you but does no damage.jOgg  You barely miss the orc.The orc is lightly wounded.jOggkE=70.2jOggejOggU _The orc hits you with a +0 trident. You block the orc's attack.jOgg 7  You slash the orc!jOgg\ e)jOgg` 011.6jOggH jOgg G _You kill the orc!jOgg#### ###..## # ## ##..#. #. . #. ... #. #......) # ##.. #. ### ##....... #.#### ##.. #.##### ##..)........ jOggʟ.######.)....###. ......###..#### ##..#.. #####........#######..###.# ####...................## #.###.....##.>............#.###...##..........#...###.###....###.jOggjOgg4-20jOggjOggP _You see here a +0 trident.kOgg$ [.. ##..####.#### ###..## ### ##..##.# #..# #....# #.#......)# ##..#. ## ##..#. .#### ##....)....###### ##..)........#######.)....#### ##.....# .....###..#### ##..#.. ####........#######..###.## ####.............# #..####.....##.>........###..#.####.#kOgg9=-3 _kOggkOgggkOgg#.# ##..###... [..# ##..####.#### ###..##### ##..##.# #..# #....## #....##......)# ##....# ##..# #.....# kOgg# ##.......# #. #### ##....)....###### ##..)............#######.)....####...# ....###..#### ##..#...# ###........#######..###.##  ####............# #..# ###.....##.>..###..#kOgg kOgg!&4kOgg)kOgg+kOggl@  ######..###..#.####..###..... [..# ##..####.#.#### ###..##### ##..##.# #.....#.# #....kOgg## #....##......)# ##....#  ##..# #.....#  ##.......# #.....# ### ##....) #....###### ##..)............#######.)....#### ##.....# ...###..#### ##..#...# ##.....#######..###.##  ####.......# #..#kOggskOgg$&5kOggkOggΦkOggCiM##### ###..##  #####..###. # ###..####..###.... ##[..# ##..####.## ###..####### ##..##.. ..kOggmD2.## #......)###.##..............# #.....#...kOggLkOggBM$50kOggkMN==6kOggTkOggVkOgg M...).######## ##..### ##.<..# ###### ###...###..##  #####..###. # ###..####..###.... ##[..# ##..####.## ###..####### ##..##.. ...## #kOgg ......)###...............# #.....###..####kOggF kOgg &7kOgg kOggL kOgg M##)........######..## ##### ...).######## #####..### ##.<..# ###### ###...###..##  #####..###. # ###..####..###.... ##[..# ##..####.##kOgg8  ###..####### ##..##.. ...## ##......).........# ##....####.)....####kOgg kOgg &8kOgg kOgg kOggk3M#########).........## ##)........######..## ##### ...).######## #####..### ##.<..# ###### ###...###..##  #####..###. # ###..####..###.... ##[..# ##..####.##kOgg` ###..####### ##..##.. .................## #....###..)........##kOgg(<9kOgg/kOgg1lOgg ######....## ########).........## ##)........######..## ###### ..).######## #####..### ##.<..## ##### ###...###..## #......# ######..###..#.####..###..... lOgg[..# ##..####.#.#### ###..##### ##..##....# #.....#.# #.....#...## #....##......)# ##....#lOggD##... ##.......# #.....# ## ##....) #....#lOggr"lOgg"##=lOggZ# 80lOggM*lOgg,lOggw\`M ###.##  ######....##  ######).........## ##)........######..## ##### lOgg\..).######## #####..### ##.<..# ##### ###...###..## # #####..###. ###..####..###.... ##lOgg]L##..####.## ###..####lOgg3]R### ##..##...lOggW]................# #.....##............#lOggjlOgghk&1lOggplOggrV _You see here a +0 pair of boots.lOgg lOgg[ &2lOgg lOgg , _A - a +0 pair of bootsmOgg)Wear which item? Armour (go to first with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)A - a +0 pair of boots[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip mOgg~mOggmOgg###.##deadiverson the Shield-Bearer ######....##Human ########).........### Health: 50/50 ======================== mOgg##)........######..## ####### Magic: 6/6======================== ..).######## #####..### ##.<..## AC: 9Str: 16 ########...###..## #......# EV: 11Int: 11mOgg ###......###..###....... SH: 9Dex: 12###........####..###...... XL:  6 Next: 91% Place: Dungeon:4##........@..# ##..####.#.. Noise: ---------  Time: 3882.6 (0.0)###............# ###..####.. a) +0 long swordmOggNJ#..............## ##..##... Throw: 3 darts (poison)................# #.....##mOgg................# #.....#................## #....###......).........# ##....###...............# #.....###..............# #.....# mOgg_The orc hits you with a +0 trident. You block the orc's attack.  You slash the orc! _You kill the orc! _You see here a +0 trident. mOgg^_You see here a +0 pair of boots. _A - a +0 pair of bootsmOggmOggy+3.6 (1mOgg mOggf  You start putting on your armour.mOgg+4.6 (2mOgg1mOgg޼mOgg+5.6 (3mOggmOggmOggj+6.6 (4mOggmOggA7.6 (5mOgg>mOgg. 11 mOgg(Z_You continue putting on your +0 pair of boots. x4mOggmOggmOggb _You finish putting on your +0 pair of boots.mOgg? mOgg mOgg mOgg mOgg^ mOgg $ _mOgg ,mOggp ,mOgg, mOggC mOgg ,mOggE mOgg mOgg ,mOggR mOgg mOggV ,mOgg mOgg4 mOgg ,mOgg mOgg mOgg ,mOgg mOgg mOgg ,mOgg mOgg# #....).######## #####..### ## ##. ###...###..## .# ##..# ###......###..# .###..## ###........####..##.## ##...........# ##.. ..#.## ###............# ## ....# ##..............## # ...## ##................# ...# #.........# 95.6 (8 mOgg0<...# ##.........## .### ##).........# # #### ##.........# ...#### ##..............# # ......#### ##....)........# #  .........##### ##..)........## ##  .............######.)....#### ##.mOggk  ####...###..#### ##.. mOgg1mOgg mOggE _Done exploring.nOgg{!nOgg1"nOgg]$nOggLZ........0nOgg#MnOggUnOggWE _Done exploring.nOggnOggnOggnOggnOggnOggnOggUE _Done exploring.nOgg3nOggKnOgg_ 4nOgg~nOggE _Done exploring.oOggoOggoWhere to? (Tab - D:4, ? - help)  D - Dungeon oOggoOggn# #....).######## #####..###deadiverson the Shield-Bearer ## ##.#########...###..## Human .# ##..####......###..## Health: 50/50 ======================== .###..#####........####..# Magic: 6/6======================== ..##.####...........# ##.. AC: 11Str: 16 ..#.##oOggM###............# ### EV: 11Int: 11 ....###..............## # SH: 9Dex: 12 ...## ##................#XL:  6 Next: 91% Place: Dungeon:4 ...##.....@...........#Noise: ---------  Time: 3895.6 (0.0) ...###................##a) +0 long sword .###oOggE##......).........# # Throw: 3 darts (poison) ######...............# # ...######..............# # ......#### ##....)........# #  .........##### ##..)........## ##  .............######.)....#### ##.  oOgg͟####.............###..#### ##..  _You continue putting on your +0 pair of boots. x4 _You finish putting on your +0 pair of boots. _Done exploring. _Done exploring. _Done exploring. _Done exploring.oOggjoOggKoOggoOggoOgg: _oOggXoOggoOgg,oOgg P  You see here a +0 trident. _oOggo  You see here a +0 hand axe. _oOgg% oOgg,,oOggoOggoOgg,oOggoOggoOgg,oOgg!oOgg#Y  There is a stone staircase leading down here.oOgg&oOgg!)oOgg)$ _oOgg+oOggp;5oOggzoOgg,oOggA  oOgg###  #@# 908.3 (12.7) #.#  #.# #.# #.#oOgg% #.# #.# #.# _You climb downwards.oOggoOggoOgg"a _There is a stone staircase leading up here.oOgg oOggd 3oOgg oOgg oOggh _oOgg oOggd oOgg oOggS oOgg oOgg' oOgg oOgg oOgg oOgg ,oOgg oOgg oOgg ,oOggN oOgg oOgg  ### #<# #.#oOgg  #.# #.##.##.#oOgg .#.........#.........#....##.....##.# ..oOggK ... .#h   black bear (asleep).#. .#...hoOgg B .#oOgg 14.3 (6.0)  A black bear comes into view.oOgg  zhh.oOggp 4==5.3 (7oOggw oOgg{ 4 _The black bear growls angrily.pOggOGn ### #<# #.# #.# pOggG#.# #.# #.# #.# #@# #.........  #.........  pOgg,H#....##...  ..##.# ..  ... .#  .#h .#  pOgggH<.... .# pOgg ### #<# #.# #.# #.# #.# #.# #.# #@# #.........  #.........  #....##... ..##.# .. ... .#  .#h .# .... .# pOggpOggpOgg pOgg=a _A black bear is nearby!qOgg] Evoke which item? Wands  o - a wand of acid (13)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedrOggarOggirOggp;###deadiverson the Shield-Bearer #<#Human#.#Health: 50/50 ========================#.#Magic: 6/6========================#.#AC: 11rOggUqStr: 16#.#EV: 11Int: 11#.#SH: 9Dex: 12#.#XL:  6 Next: 91% Place: Dungeon:5#@#rOggq3Noise: ==-------  Time: 3915.3 (0.0)#.........a) +0 long sword#.........rOggqThrow: 3 darts (poison)#....##.....##.# ..... .#rOggqh   black bear.#h .#rOggq.... .# _There is a stone staircase leading down here. _You climb downwards. rOgg#rj_There is a stone staircase leading up here.  A black bear comes into view. rOggKr_The black bear growls angrily. _A black bear is nearby!rOggxP  Okay, then.rOggayrOgg~rOgg. _rOgg+D rOgg}L Inventory: 27/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  f - 3 poisoned darts (quivered)  j - a throwing net rOgg*M Armour (go to first with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  p - a +5 ring of evasion (left hand)d - an amulet of faith Wands (go to first with /)o - a wand of acid (13)  y - a wand of digging (6) rOggM CScrolls (go to first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA rOggM [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]sOggD  d - an amulet of faith Wands (go to first with /)  o - a wand of acid (13)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 5 scrolls labelled MEYCSO REZEI  v - a scroll labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (go to first with !)  c - a puce potion  e - 3 brown potions  h - 2 potions of curingi - a viscous pink potionk - 3 lumpy ruby potionsq - a fuming silvery potionu - a metallic pink potionbotsOgg  g - 2 scrolls labelled XYD YCROOMM  n - a scroll labelled DEGEUR JITStOgg~.Armour (go to first with [) tOgg.v b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  p - a +5 ring of evasion (left hand)41%tOggkQ,Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  f - 3 poisoned darts (quivered)  j - a throwing net  y - a wand of digging (6)  n - a scroll labelled DEGEUR JITStopuOgg[uOgguOggA###deadiverson the Shield-Bearer #<#Human#.#Health: 50/50 ========================#.#Magic: 6/6========================#.#AC: 11Str: 16#.#EV: 11Int: 11#.#SH: 9Dex: 12#.#XL:  6 Next: 91% Place: Dungeon:5#@#Noise: ==-------  Time: 3915.3 (0.0)#.........a) +0 long sword#.........Throw: 3 darts (poison)#....##.....##.# ..... .#h   black bear.#h .#.... .# _You climb downwards. _There is a stone staircase leading up here.  A black bear comes into view. uOgg[37m_The black bear growls angrily. _A black bear is nearby! _Okay, then.uOgg?4uOggֵuOggзuOggZ@  A black bear comes into view. black bear growls angrily. _is nearby! _Okay, then.  Your movement speed is average.  Your attack delay is about 1.3 (and is slowed by your shield).uOgg@uOggYFuOggI  Your damage rating with your +0 long sword is about 12 (Base 10 x 105% (Dex) x _115% (Skill)).vOgg vOggF vOgg# vOgg& F _Unknown command.vOgg Y#<..... #.# #..............#....##... ..##.# ..... .#h.... .#vOgg vOggf :h.vOggM ;--6.3 (1 _vOggk vOggN vOggٗ1#< #.# #....#......#....##. ..##.# ....h .#vOgg?vOggǞA--7vOggvOggwOggEeM#<#.##.....h .#wOggwOgg_wOgg<h   black bearh.wOgg&8wOggwOgg^wOgg#u#< #.#.....#.h..##. ..##.# ..wOggwwOggV~<h.wOgg~&9wOgg+wOgglwOgg3#< #.# .h....#....##.wOggwOgg<h.wOgg4'20wOgg=wOgg#wOgg #< #.#h....wOggf wOgg <h.wOggk &1wOgg7 wOgg wOgg{ #. #h#wOggw wOgg{ <h.wOgg &2wOgg wOggS a _There is a stone staircase leading up here.xOgg* (((((((You throw a poisoned dart.xOgg xOgg j....h.xOggd ]3.4 (1.12xOgg xOggϼ e _The poisoned dart barely misses the black bear.xOggh ((((((You throw a poisoned dart.xOgg xOgge j...h..xOggf g4.5dart (poison) xOgg0 xOgg e _The poisoned dart barely misses the black bear.xOgg@ ((((poisoned)You throw a poisoned dart. The poisoned dart hits the black bear.yOggyOgg..h(5.7 (1.2Nothing quiveredyOgg!yOgg$1 _The black bear is poisoned.yOggR4yOgg] _Nothing quivered!yOgg[1###<h(.(#.........yOgg a:h.yOgga*60 yOgga _yOgghyOggwkzOggcEvoke which item? Wands  o - a wand of acid (13)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected{Ogg {Ogg {Ogg   deadiverson the Shield-Bearer   Human {Ogg ; Health: 50/50 ========================  Magic: 6/6========================AC: 11Str: 16EV: 11Int: 11###SH: 9Dex: 12#<#XL:  6 Next: 91% Place: Dungeon:5#@#Noise: ---------  Time: 3926.7 (0.0)#h#a) +0 long sword#.#Nothing quivered#(##.##.#h   black bear (poisoned)#(##.........#......... _The poisoned dart barely misses the black bear.You throw a poisoned dart. _The poisoned dart barely misses the black bear.You throw a poisoned dart. The poisoned dart hits the black bear. _The black bear is poisoned. _Nothing quivered!{OggG   deadiverson the Shield-Bearer   Human  Health: 50/50 ========================  Magic: 6/6========================  AC: 11Str: 16  EV: 11Int: 11 ### SH: 9Dex: 12 #<# XL:  6 Next: 91% Place: Dungeon:5 #@# Noise: ---------  Time: 3926.7 (0.0) #h# a) +0 long sword #.# Nothing quivered #(# #.# #.# h  [39;{Ogg /49m black bear (poisoned) #(# #.........  #......... You throw a poisoned dart. The poisoned dart hits the black bear. _The black bear is poisoned. _Nothing quivered!  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - black bearAim: a black bear (lightly wounded, poisoned, 79% to hit){Ogg  deadiverson the Shield-Bearer   Human  Health: 50/50 ========================  Magic: 6/6========================AC: 11Str: 16EV: 11Int: 11###SH: 9Dex: 12#<#XL:  6 Next: 91% Place: Dungeon:5#@#{Ogg65Noise: ---------  Time: 3926.7 (0.0)#*#a) +0 long sword#*#Nothing quivered#*##*##*#h   black bear (poisoned, corroded)#(##.........#......... _The black bear is poisoned. {OggN_Nothing quivered!  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - black bearAim: a black bear (lightly wounded, poisoned, 79% to hit)  The bolt of acid hits the black bear! The acid corrodes the black bear!{Oggv&  Aiming: Corrosive Bolt  Press: ? - help, Shift-Dir - straight line, f/p - black bear: a black bear (lightly wounded, poisoned, 79% to hit)  The bolt of acid hits the black bear! The acid corrodes the black bear!  The black bear is heavily wounded.  You block the black bear's attack.{Ogg-/  --more--|OggΫ h.(..  The black bear claws you but does no damage.====7.7 (1|Oggg|OggS _The black bear completely misses you.|Ogg |Ogg2 Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  j - a throwing net Wands (go to first with /)o - a wand of acid (12)  y - a wand of digging (6)}Ogg }Ogg}   deadiverson the Shield-Bearer   Human  Health: 50/50 ========================  Magic: 6/6========================AC: 11Str: 16EV: 11Int: 11###SH: 9Dex: 12#<#XL:  6 Next: 91% Place: Dungeon:5#@#Noise: ====-----  Time: 3927.7 (0.0)#h#}Ogg~ a) +0 long sword#.#Nothing quivered#(##.##.#h   black bear (poisoned, corroded)#(##.........#.........The black bear claws you but does no damage. _The black bear completely misses you.Throw: throwing netPress: ? - help, Shift-Dir - straight line, f/p - black bearAim: a black bear (heavily wounded, poisoned, covered in acid, 64% to hit)}OggY   deadiverson the Shield-Bearer }Ogg-Z   Human  Health: 50/50 ========================  Magic: 6/6========================AC: 11Str: 16EV: 11}Ogg\Z Int: 11###SH: 9Dex: 12}Ogg[ #<#XL:  6 Next: 91% Place: Dungeon:5#@#Noise: ====-----  Time: 3927.7 (0.0)#h#a) +0 long sword#.#Nothing quivered#(##.##.#}Ogg \ h   black bear (caught, poisoned, corroded)#(##.........#......... _The black bear completely misses you.Throw: throwing netPress: ? - help, Shift-Dir - straight line, f/p - black bearAim: a black bear (heavily wounded, poisoned, covered in acid, 64% to hit)  You throw a throwing net. The throwing net hits the black bear.  The black bear is caught in the net!}Oggb h  Throw: throwing net  Press: ? - help, Shift-Dir - straight line, f/p - black bearAim: a black bear (heavily wounded, poisoned, covered in acid, 64% to hit)  You throw a throwing net. The throwing net hits the black bear.  The black bear is caught in the net!  The black bear is heavily wounded.}Oggw b=---8.9 (1.2}Ogg }Ogg! 6---}Ogg /  --more--~Ogg̽= _The black bear struggles against the net.~Ogg You hit the black bear.  The black bear is severely wounded.~Ogg~.30.3 (1.4~OggP _The black bear struggles against the net. x2~Oggjoc hh  berserk, caught, poisoned…You hit the black bear.  The black bear is almost dead.The black bear goes berserk!1.7~Oggw~Oggy? _The black bear struggles against the net.~Ogg>, >  You slash the black bear!~Ogg3 D(~Ogg5 ~Ogg< 7  deadiverson the Shield-Bearer   Human  Health: 50/50 ========================  Magic: 6/6========================AC: 11Str: 16EV: 11Int: 11###SH: 9Dex: 12~Ogg< #<#XL:  6 Next: 134% Place: Dungeon:5#@#Noise: =--------  Time: 3933.1 (1.4)#(#a) +0 long sword#.#Nothing quivered#(##.##.##(##.........#.........You hit the black bear.  The black bear is almost dead.The black bear goes berserk! _The black bear struggles against the net.  ~Ogg&= XYou slash the black bear! _You kill the black bear!~OggL>  The black bear goes berserk! _The black bear struggles against the net.  You slash the black bear! _You kill the black bear!~Ogg> sYour Long Blades skill increases to level 4!You have reached level 7!~Ogg`H /  --more--Ogg E5/557/777% OggyOgg4 _Ogg` 7###<..(.(#.........##Oggog Ogg:h ;-40 _OggXn OggSu Oggu -5.1 (2Throw: throwing netOggWz Ogg } R _j - a throwing netOgg , ###<..(......##.# ..Ogg3 A6.1 (1Ogg Ogg OggNE ###<....Ogg7F{..##.... .#OggKOgghL&7OggVQOgg7[A8.1 (2Oggu_OggUb) _f - a poisoned dartOggk ###<...(#...... .#.#. .#OggOggF+9.1 (1OggOggOggu# ###<...(#.........#....##.#. .#.... .#Ogg*OggH+'40Ogg0Ogg2Ogggar ###<...#.........#.........#.......... .#OgghOggh&1OggmOggvA2.1 (2OggzOggi|5 _f - 3 poisoned darts (gained 2)Ogg; Ogg< OggA Ogg..#. .#......Ogga .##.#... .#Ogg]gOggg+4.1 (2Ogg*lOggn; _Found a stone staircase leading down.Ogg+OggOgg6OggCOgg4,OggYnOggOgghOggBOgg"$  There is a stone staircase leading down here.OggI _OggJ,OggLOgg(OOggCP,OggeQOggSOggbU,OggVOggZOggd[,Ogg\Ogg^Ogg`Ogg`Ogg,bOggcOggjf,Ogg"hOgg`iOggk,OgglOggnOgghs,OggtOggw,OggxOggn{v _q - 2 fuming silvery potions (gained 1)OggY _You now have 118 gold pieces (gained 11).OggOgg          ###########  #.........#  #.#.......#  ###.#.......### #  #.@...........# #  #.#.#.......#.# #  #.#.#######.#.# ##  #J#.# #.#.####.  #.# #.#.##...  #..#.#.#>..# J   jelly (asleep)ggm  #####.#...... #.###.#.. #.### 75.1 (31.0)  A jelly comes into view.J.J6.1 (32 _The jelly quivers.Ogg& ####  #.........#  #.#.......#  ###.#.......###  #.@...........#  #.#.#.......#.#  #J#.#######.#.#  #.#.# #.#. #.#.# #.#.##... #...# #.#.#>. ##### #.#...Ogg ####  #.........#  #.#.......#  ###.#.......###  #.@...........#  #.#.#.......#.#  #J#.#######.#.#  #.#.# #.#. #.#.# #.#.##... #...# #.#.#>. ##### #.#...OggT Ogg2"Ogg](Ogg+\ _A jelly is nearby!OggRV  Your movement speed is average.  Your attack delay is about 1.3 (and is slowed by your shield).Ogg] Oggr_  Your damage rating with your +0 long sword is about 12 (Base 10 x 105% (Dex) x _117% (Skill)).Ogg Oggj Ogg5 Ogg F _Unknown command.OggUc    ###########  #.........#  #.#.......#  ###.#.......###OggdW  #.............#   #@#.#.......#.#   #J#.#######.#.#  #.#.# #.#.##  #.#.# #.#.##.  #...# #.#.#>..  ##### #.#..... #.###.#  #.##  #.#OgglOggKm9=7.1 (1.0)OggSrOggFvR _The jelly barely misses you.OggWXC8.4 (1.3Ogg\Ogg4_~ _You completely miss the jelly. The jelly hits you but does no damage. x2Ogg C9.8 (1.4OggtOgg Ogg_You barely miss the jelly. The jelly closely misses you.Ogg  You hit the jelly. Your hands burn!  The jelly is moderately wounded.Oggg]1--81.1 (1.3OggtOggzK _The jelly misses you.Ogg^  You completely miss the jelly.The jelly is moderately wounded.OggB_W2--2.4OggdOggAgq _You block the jelly's attack. The jelly closely misses you.Ogg4  You barely miss the jelly.The jelly is moderately wounded.Ogge5 -3.8 (1.4Ogg/; Ogg< V _The jelly completely misses you.Ogg]   You slash the jelly! Your hands burn!  The jelly is severely wounded.49-5.1 (1.3Ogga Ogge 3 _You block the jelly's attack.Ogg  You hit the jelly. Your hands burn!  The jelly is almost dead.Oggg5---6.3 (1.2OggOgg'Z _The jelly hits you but does no damage. You block the jelly's attack.Ogg 9  You slash the jelly!Ogg2.Ogg6247.7 (1.4OggOgg|I _You kill the jelly!Ogg ###########..........####.#.......###.............#.#.......######## #.#.###.. #.#OggOggm6=--80OggOggOgg OggE Ogg Oggw BOgg Ogg OggB Oggb N7=Ogg Ogg nOgg) Ogg Ogg %8Ogg Ogg ,Ogg Oggr ,Ogg Ogg Ogg Oggv Ogg Ogg5 K9=Ogg OggO BOgg Ogg Oggg Ogg Ogg Ogg O50=Ogg Ogg Ogg Ogg Ogg ,Ogg Ogg XOgg K1=Ogg OggW Ogg Ogg Oggb ,Ogg Ogg` k2=Ogg Ogg] Ogg BOggE a3=Ogg Ogg ,Ogg" Ogg[ Ogg Ogg Ogg Ogg: #4Ogg^ 2=Ogg Oggg Ogg Ogg Ogg ,Ogg Ogg - _You start resting.Ogg 24018.7 (30.0)OggP 55=Ogg %9.7 (31Ogg OggQ " _HP restored.OggBR3OggROgg%TOggVBOgg\Ogg\Ogg']Ogg^Ogg_Ogg_9=Ogg`OggbOggb,Ogg^cOgg5eOggeOggf,OgggOggi,OggiOggkOgg,l,OgglOgg3nOgg;oOgggoOggoOggqOggr,OggsOggOgg?Ogg1AOgghAOggAOggEOgg(N! #.###.#...##.# #.#.#.###..... #.#.#.# ####..  #.#.#.# ## ###  ###...#.# M.  #.....#.# .#  Ogg9OG#.#####.# .# #  #.# ###.##.##....  #.# #....@..'....  #.# #.#.##.##....  #.# #.#.# .# .  #.# # #.# .# #.# #.# .. ### ### ## M   Menkaure (dormant) Oggp2 73.7 (54  Menkaure, Prince of Dust comes into view..MM===4.7 (55OggwOggx& _Menkaure shouts!OggH #.###.  #.#.#.  #.#.#.#   #.#.#.# ## ###  ###...#.# .. #.....#.# M# #.#####.# .# #  #.# ###.##.##....  #.# #....@..'....  #.# #.#.##.##....  #.# #.#.# .# .  #.# # #.# .# #.# #.# .. ### ### ##Ogg& #.###.  #.#.#.  #.#.#.#   #.#.#.# ## ###  ###...#.# .. #.....#.# M# #.#####.# .# #  #.# ###.##.##....  #.# #....@..'....  #.# #.#.##.##....  #.# #.#.# .# .  Ogg#.# # #.# .# #.# #.# .. ### ### ## OggLOggs] _Menkaure is nearby!OggH #.###.  #.#.#.  #.#.#.#   #.#.#.# ## ###  ###...#.# .. #.....#.# M# #.#####.# .# #  #.# ###.##.##....  #.# #....@..'....  #.# #.#.##.##....  #.# #.#.# .# .  #.# # #.# .# #.# #.# .. ### ### ##Ogg* #.###.  #.#.#.  #.#.#.#   #.#.#.# ## ###  ###...#.# .. #.....#.# M# #.#####.# .# #  #.# ###.##.##....  #.# #....@..'....  #.# #.#.##.##....  #.# #.#.# .# .  #.# # #.# .# Ogg+#.# #.# .. ### ### ## Ogg3Ogg4Ogg9:Ogg=] _Menkaure is nearby!Ogg5Ogg 9Evoke which item? Wands  o - a wand of acid (12)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedOgg1Ogg:OggD#.###.#...##.#deadiverson the Shield-Bearer #.#.#.###.....Human#.#.#.# ####..Health: 55/55 ========================#.#.#.# ## ###Magic: 7/7========================###...#.# ..AC: 11Str: 16#.....#.# M#EV: 11Int: 11#.#####.# .# #SH: 9Dex: 12#.# ###.##.##....XL:  7 Next: 24% Place: Dungeon:5#.# #....@..'....Noise: ===------  Time: 4074.7 (0.0)#.# #.#.##.gg^E+m##....a) +0 long sword#.# #.#.# .# .Throw: throwing net#.# # #.# .##.# #.# ..### ### ##M   Menkaure _You start resting. _HP restored.  Menkaure, Prince of Dust comes into view. _Menkaure shouts! _Menkaure is nearby! _Menkaure is nearby!Oggx #.###.#...##.#  deadiverson the Shield-Bearer  #.#.#.###.....  Human #.#.#.# ####..  Health: 55/55 ======================== #.#.#.# ## ###  Magic: 7/7======================== ###...#.# .. AC: 11Str: 16 #.....#.# M# EV: 11Int: 11 #.#####.# *# #  SH: 9Dex: 12 #.# ###.##*##....  XL:  7 Next: 24% Place: Dungeon:5 #.# #....@..'....  Noise: ===------  Time: 4074.7 (0.0) #.# #.#.##.##....  gg)y33ma) +0 long sword #.# #.#.# .# .  Throw: throwing net #.# # #.# .# #.# #.# .. ### ### ## M   Menkaure _Menkaure shouts! _Menkaure is nearby! _Menkaure is nearby!Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - MenkaureAim: Menkaure (86% to hit)Oggx#.###.#...##.#deadiverson the Shield-Bearer #.#.#.###.....Human#.#.#.# ####..Health: 55/55 ========================#.#.#.# ## ###Magic: 7/7========================###...#.# .*AC: 11OggyStr: 16#.....#.# *#EV: 11Int: 11#.#####.# *# #SH: 9Dex: 12#.# ###.##*##....OggyZXL:  7 Next: 24% Place: Dungeon:5#.# #....@..'....Noise: ===------  Time: 4074.7 (0.0)#.# #.#.##.##....a) +0 long sword#.# #.#.# .# .Throw: throwing netOggy6#.# # #.# .##.# #.# ..### ### ##OggyM   Menkaure _Menkaure is nearby! _Menkaure is nearby!Ogg zAiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - MenkaureOggRzVAim: Menkaure (86% to hit)  The bolt of acid hits Menkaure!Ogg Y.M..OggB J====5.7 (1Ogg Ogg K  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - MenkaureAim: Menkaure (86% to hit)  The bolt of acid hits Menkaure! _Menkaure is heavily damaged.OggUOggUWrEvoke which item? Wands OggW o - a wand of acid (11)y - a wand of digging (6) [!] read|quaff|evokeOggW][?] describe selectedOggOggOOgg_#.###.#...##.#deadiverson the Shield-Bearer #.#.#.###.....Human#.#.#.# ####..Health: 55/55 ========================#.#.#.# ## ###Magic: 7/7========================###...#.# ..AC: 11Str: 16#.....#.# M#EV: 11Int: 11#.#####.# .# #SH: 9Dex: 12#.# ###.##.##....XL:  7 Next: 24% Place: Dungeon:5Ogg#.# #....@..'....Noise: ====-----  Time: 4075.7 (0.0)#.# #.#.##.##....a) +0 long sword#.# #.#.# .# .Throw: throwing net#.# # #.# .##.# #.# ..### ### ##M   Menkaure _Menkaure is nearby!Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - MenkaureAim: Menkaure (86% to hit)  The bolt of acid hits Menkaure! _Menkaure is heavily damaged.Ogg!U #.###.#...##.#  deadiverson the Shield-Bearer  #.#.#.###.....  Human #.#.#.# ####..  Health: 55/55 ======================== #.#.#.# ## ###  Magic: 7/7======================== ###...#.# .. AC: 11Str: 16 Ogg{#.....#.# M# EV: 11Int: 11 #.#####.# *# #  SH: 9Dex: 12 Ogg?#.# ###.##*##....  XL:  7 Next: 24% Place: Dungeon:5 #.# #....@..'....  Noise: ====-----  Time: 4075.7 (0.0) #.# #.#.##.##....  a) +0 long sword #.# #.#.# .# .  Throw: throwing net #.# # #.# .# #.# #.# .. ### ### ## M   MenkaureAim: Menkaure (86% to hit)  The bolt of acid hits Menkaure! _Menkaure is heavily damaged.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - MenkaureAim: Menkaure (heavily damaged, 86% to hit)Ogg*  #.###.#...##.#  deadiverson the Shield-Bearer  #.#.#.###.....  Human #.#.#.# ####..  Health: 55/55 ======================== #.#.#.# ## ###  Magic: 7/7======================== ###...#.# .. AC: 11Str: 16 #.....#.# M# EV: 11Int: 11 #.#####.# .# #  SH: 9Dex: 12 Ogg m#.# ###.##.##....  XL:  7 Next: 24% Place: Dungeon:5 #.# #....@..'....  Noise: ====-----  Time: 4075.7 (0.0) #.# #.#.##.##....  a) +0 long sword #.# #.#.# .# .  Throw: throwing net #.# # #.# .# OggP #.# #.# .. ### ### ## M   MenkaureThe bolt of acid hits Menkaure! _Menkaure is heavily damaged.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - MenkaureAim: Menkaure (heavily damaged, 86% to hit)  The bolt of acid hits Menkaure! The acid corrodes Menkaure!Ogg" K #.###.  #.#.#.  #.#.#.#   Ogg# #.#.#.# ## ###  ###...#.# .* #.....#.# *# #.#####.# *# #  OggJ# #.# *##....  #.# Oggv# Z..  #.# ..  Ogg# #.# #.#.# .# .  Ogg# ~#.# # #.#  Ogg# #.# #.# .. ### ### Ogg#  Ogg$ Ogg} 9....OggU lasher 536.7 (1 _Menkaure is heavily damaged.  Aiming: Corrosive Bolt  Press: ? - help, Shift-Dir - straight line, f/p - MenkaureAim: Menkaure (heavily damaged, 86% to hit)  The bolt of acid hits Menkaure! The acid corrodes Menkaure! Oggֱ A_You destroy Menkaure!Ogg Oggf l _Your Long Blades skill increases to level 5!Ogg OggE Ogg Ogg H _No target in view!Ogge7IOggt8Ogg}:Ogg>P _Ogg?,Ogg"@OggAOggC,OggYCOggDOggFBOggrHOggIBOggWvOggyYBOggZOggK\Ogg~\Ogg\OggzOgg|,Oggo~,OggrOggOgg,OggOgg)Ogg.##....##.# #. .#>..#.##.# .......##.# ### ##.#...##.### ... .#.###......######.# .#.# ####..........# # .#.#########.....###$## .#.##...............$ .#.##.##########@....##.---- ##.##.# ##..........# ##.##.##.....######..## .......'..... .O... .#.##.##..... .... .#.##.# ##.. ...O   ogre (wandering)#.##.###.  #.##..gg417;2H######959.0)----6.7 (20OggOgg¸x _An ogre comes into view. It is wielding a +0 giant club.OggQrOgg2tEvoke which item? Wands  o - a wand of acid (10)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedOggMOggTOgg>].##....##.# #.deadiverson the Slasher .#>..#.##.#Human .......##.####Health: 55/55 ======================== ##.#...##.### ...Magic: 7/7======================== .#.###......######.#AC: 11Str: 16 .#.# ####..........# #EV: 11Int: 11 Ogg^.#.#########.....###$###SH: 9Dex: 12 .#.##...............$...XL:  7 Next: 53% Place: Dungeon:5 .#.##.##########@....##.Noise: ---------  Time: 4096.7 (0.0) ##.##.# ##..........#a) +0 long sword ##.##.##.....######..##Throw: throwing net .......'......O... .#.##.##......... .#.##.# ##.....O   ogre (wandering)#.##.###.  #.##..######Aim: Menkaure (heavily damaged, 86% to hit)  The bolt of acid hits Menkaure! The acid corrodes Menkaure! _You destroy Menkaure! _Your Long Blades skill increases to level 5! _No target in view! _An ogre comes into view. It is wielding a +0 giant club.Ogg~.##....##.# #. deadiverson the Slasher .#>..#.##.# Human .......##.# ###  Health: 55/55 ======================== ##.#...##.### ...  Magic: 7/7======================== .#.###......######.#  AC: 11Str: 16 .#.# ####..........# #  EV: 11OggInt: 11 .#.#########.....###$###  SH: 9Dex: 12 .#.##...............$...  XL:  7 Next: 53% Place: Dungeon:5 .#.##.##########@....##.  Noise: ---------  Time: 4096.7 (0.0) ##.##.# ##.....**...#  a) +0 long sword ##.##.##.....######*.##  Throw: throwing net .......'..... .O... .#.##.##..... .... .#.##.# ##.. ...  O   ogre (wandering)  #.##.###.  #.##..  ###### _No target in view! _An ogre comes into view. It is wielding a +0 giant club.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - ogreAim: an ogre, wieldinOgg*Kg a +0 giant club (wandering, hasn't noticed you, 86% to  hit)Ogg .##....##.# #.deadiverson the Slasher .#>..#.##.#Human .......##.####Health: 55/55 ======================== ##.#...##.### ...Magic: 7/7======================== .#.###......######.#AC: 11Str: 16 .#.# ####..........# #EV: 11Int: 11 .#.#########.....###$###SH: 9Dex: 12 .#.##...............$...XL:  7 Next: 53% Place: Dungeon:5 .#.##.##########@....##.Noise: ---------  Time: 4096.7 (0.0) ##.##.# ##.....**...#a) +0 long sword ##.##.##.gg 9;49m....######*.##Throw: throwing net .......'......**.. .#.##.##......... .#.##.# ##.....O   ogre (corroded)#.##.###.  #.##..######Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - ogreAim: an ogre, wielding a +0 giant club (wandering, hasn't noticed you, 86% to  hit)  The bolt of acid hits the ogre! The acid corrodes the ogre!  The ogre is heavily wounded.Ogg? OggXG {..O..====OggH $7.7 (1OggN OggO Ogg.Y /  --more--Ogg"' _The ogre shouts!OggIR OggT Evoke which item? Wands  o - a wand of acid (9)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedOgg Ogg Ogg| .##....##.# #.deadiverson the Slasher Ogg .#>..#.##.#Human .......##.####Health: 55/55 ======================== ##.#...##.### ...Magic: 7/7======================== .#.###......######.#AC: 11Str: 16 .#.# ####..........# #EV: 11Int: 11 .#.#########.....###$###SH: 9Dex: 12 .#.##...............$...XL:  7 Next: 53% Place: Dungeon:5 .#.##.##########@....##.Noise: ====-----  Time: 4097.7 (0.0) ##.##.# ##..........#a) +0 long sword ##.##.##.....######O.##Throw: throwing net ......Ogg [40m.'.......... .#.##.##......... .#.##.# ##.....O   ogre (corroded)#.##.###.  #.##..###### _The ogre shouts!Ogg .##....##.# #. deadiverson the Slasher .#>..#.##.# Human .......##.# ###  Health: 55/55 ======================== ##.#...##.### ...  Magic: 7/7======================== .#.###......######.#  AC: 11Str: 16 .#.# ####..........# #  EV: 11Int: 11 .#.#########.....###$###  SH: 9Dex: 12 Oggk .#.##...............$...  XL:  7 Next: 53% Place: Dungeon:5 .#.##.##########@....##.  Noise: ====-----  Time: 4097.7 (0.0) ##.##.# ##.....**...#  a) +0 long sword ##.##.##.....######O.##  Throw: throwing net .......'..... ..... .#.##.##..... .... .#.##.# ##.. ...  O   ogre (corroded)  #.##.###.  #.##..  ###### _The ogre shouts!  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - ogreAim: an ogre, wielding a +0 giant club (heavily wounded, covered in acid, 86%  to hit)Ogg'.##....##.# #. deadiverson the Slasher .#>..#.##.# Human .......##.# ###  Health: 55/55 ======================== ##.#...##.### ...  Magic: 7/7======================== .#.###......######.#  AC: 11Str: 16 .#.# ####..........# #  EV: 11Int: 11 .#.#########.....###$###  SH: 9Dex: 12 .#.##...............$...  XL:  7 Next: 53% Place: Dungeon:5 Ogg:.#.##.##########@....##.  Noise: ====-----  Time: 4097.7 (0.0) ##.##.# ##..........#  a) +0 long sword ##.##.##.....######O.##  Throw: throwing net .......'..... ..... .#.##.##..... .... .#.##.# ##.. ...  O   ogre (corroded)  #.##.###.  #.##..  ###### _The ogre shouts!  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - ogreAim: an ogre, wielding a +0 giant club (heavily wounded, covered in acid, 86%  to hit)  The bolt of acid hits the ogre!!Ogg #.> ### .### ... ..  ####.. # #### ........ . .# Ogg**...# .##...**## ...'..... ..*.. ....Ogg  ##.. ...  ##.    Ogg-Ogg/5_..J..Ogg5J   jelly  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - ogreAim: an ogre, wielding a +0 giant club (heavily wounded, covered in acid, 86%  to hit)  The bolt of acid hits the ogre!!  You kill the ogre!Ogg63748.7 (1OggB/  --more--Ogg_ m _A jelly comes into view.Ogg: Oggg d _Your Long Blades skill increases to level 6!OggJX #.#>..#.##.# #.......##.#### ###.#...##.### ... #.#.###......######.# OgglY 7#.#.# ####..........# # #.#.#########.....###$### ..#.##...............$... ..#.##.##########.....##. ###.##.# ##...@......##.##.##.....######J.##.......'..... ..... #.#.##.##..... .... #.#.##.# ##.. ... # #.##.#  ##.OggY ~ #.##..  ###### Ogg] Ogge =J)Ogglf &----Oggf &9 _Oggam OggBp Ogg J.----100Ogg/ OggOggOgg2J.Oggt&1OggOggCOggN You hit the jelly. Your hands burn!  The jelly is heavily wounded.2--=2.9 (1.2 _You block the jelly's attack.Ogg  You slash the jelly! Your hands burn!  The jelly is almost dead.Ogg̃$49OggD---4.2 (1.3OggoOggR _The jelly barely misses you.Ogg]  You barely miss the jelly.The jelly is almost dead.5.4 (1.2Ogge Oggf N _The jelly misses you. x2Ogg#7  You hit the jelly.Ogg+1.Ogg0U50-81Ogg1 6.6Ogg7Ogg9I _You kill the jelly!Ogg  Your movement speed is average.  Your attack delay is about 1.2 (and is slowed by your shield).OggOgg  Your damage rating with your +0 long sword is about 12 (Base 10 x 105% (Dex) x _121% (Skill)).Ogg Ogg Ogg Oggf F _Unknown command.Ogg} Ogg OggOggOggf _OggOggOgg#1Ogg(=OggOggOggOggOgg,Ogg Ogg",Ogg#Ogg%Ogg%U2=Ogg&Ogg(Ogg(Ogg)OggV+Ogg+Ogg,Ogg.Oggx/K3=Ogg0OggG2Oggv2Ogg3Ogg5,Ogg6Ogge8,OggX9Ogg;k4=OggL@OggBOggIBOgg,FXOggHa5=OggHOgg@KOggWMOggMOggNOggPOggR,OggSOggUOgg#XOggpXOggLYOgg?[Ogg\OggJ]9=Oggl^Ogg8`OggbOggVbOgggcOgg`f,OggvgOggRjM _You now have 122 gold pieces (gained 4).OgglOgglOggmOggxp,Ogg_qOgg^t OggtG_You now have 124 gold pieces (gained 2).Oggv3OggwOggpyOgg{,OggnOgg%OggOgg/OggOgg1Ogg,OggOgg OggOgg-Ogg#Ogg OggוOggWOggOgg_OggOgg?OggFOggOgg-OggOgg֡$ Ogg)_You now have 133 gold pieces (gained 9).OggfOggOggOggڥOggOgg-Ogg٧OggéOggd,OggOggwOggOggڮOggXOggOgg,OggOgg@Ogg{OggOggOggeOggOggOggOgguOggOggOggFOgghOggOggOgg/OggOgg,OggWOggOgg%OggOgg<OggOggOgg,OggOggOggOgg=OggOggsOggOgg OggOggOgggOggOggOggOgg,OggGOgggOgg,Ogg#OggOggJOgg~OggOgg,OggOggr _k - 4 lumpy ruby potions (gained 1)Ogg 3OggOggOgg.OggiOggOggOggX #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ##.####...........S.###  #......................  #..............@# Ogg]-....##.........#############.# ..................# ...##.# ###.#.###########.# .#.##.# # #. #.# .. ...##.# ##.#.###########.###... S   adder (asleep) ...##.### #.............##....... ##......######.#................#####..........#.######.######.##Ogg { 61.6 (55.0)  An adder comes into view.Oggk.SSOggL5==2.6 (56OggaOgg/ _The adder hisses angrily.OggE #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ............###  .........S..... Ogg .......@#........#  ..................#  ###.#.####.#  # #. #.#  ##.#..Ogg? #.............##.#.#...........  .OggOggE #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ............###  .........S.....  .......@#........# OggeF ..................#  ###.#.####. # #. #.#  ##.#.. #.............##.#.#...........  .Ogg"NOggNOggTOggX] _An adder is nearby!OgggM #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ............###  .........S.....  Ogg"h.......@#........#  ..................#  ###.#.####.#  # #. #.#  ##.#.. #.............##.#.#...........  .OggO #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  Ogg............###  .........S.....  .......@#........#  ..................#  ###.#.####. # #. #.#  ##.#..OggL #.............##.#.#...........  .Ogg6OggOgg Ogg/] _An adder is nearby!Ogg5T #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ............###  .........S.....  .......@#........#  ..................#  ###.#.####.#  # #. #.#  ##.#.OggT^. #.............##.#.#...........  .Ogg U #.#  #.# .##  #.# .. #  #.# #####.# .#  #.# ....... .#  #.# ........##.###  ............###  .........S.....  OggB .......@#........#  ..................#  ###.#.####. # #. #.#  ##.#.. #.............##.Ogg #.#...........  .Ogg- 4Ogg Ogg)   #<#  #.# #. .##.# .## .#  #.# .. .#  #.# #####.# .#  #.#  .# .# .##.### ##.####..#### #.S......Ogg k.......#...#### ..##..########### ##.# ..................#.##.# ###.#.###########.# # #.##.# # #. #.# ..###.# ##.#.###########.###...# ..##.### #.............##.. #......######.#............... Ogg E_An adder is nearby!Ogg OggC 9-3.6 (1.0)Ogg Ogg q _You block the adder's attack. The adder closely misses you.Ogg OggD G-4.8 (1.2Ogg Ogg w _You hit the adder but do no damage. You block the adder's attack.OggOgg}-6.1 (1.3Ogg%Oggi&r _You closely miss the adder. You block the adder's attack. x2OggڎOgg\(7.4OggOgg _You miss the adder. You block the adder's attack. The adder misses you.OggOgg=-8.6 (1.2Ogg Ogg-# _You miss the adder. The adder closely misses you.Oggx  You slash the adder!  The adder is severely wounded.Ogg%y5=9.9 (1.3OggOgge _The adder bites you but does no damage. The adder closely misses you.OggOgg*! 7  You hit the adder.Ogg( q†Ogg, >4-71.1 (1.2Ogg1 Ogg4 I _You kill the adder!Oggۄ Ogg 8-Ogg Oggl H _No target in view!Oggr Ogg3z Inventory: 27/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()f - 3 poisoned darts  j - a throwing net (quivered) Oggz Armour (go to first with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  p - a +5 ring of evasion (left hand)Ogg/{ d - an amulet of faith Wands (go to first with /)o - a wand of acid (8)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE Ogg]{ y n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA Ogg{ [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]Ogga - a +0 long sword (weapon). A sword with a long, slashing blade. Base accuracy: +1 Base damage: 10 Base attack delay: 1.4 This weapon's minimum attack delay (0.7) is reached at skill level 14. Ogg Your skill: 6.2; use (s) to set 14.0 as a target for Long Blades.  At 100% training you reach 14.0 in about 2.7 XLs.  Current attack delay: 1.2. Damage rating: 12 (Base 10 x 105% (Dex) x 121% (Skill)). This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. Ogg4Stash search prefixes: {inventory} {Long Blades} {one-handed} {melee weapon} Menu/colouring prefixes: identified melee equipped weapon OggX“While we were at grips with this great army and their dreadful broadswords  (maquahuitl [made of obsidian]), many of the most powerful among the enemy Oggv seem to have decided to capture a horse. They began with a furious attack, and  laid hands on a good mare well trained both for sport and battle. Her rider, Oggg(u)nwield, (d)rop, (=)adjust, (s)kill target, or (i)nscribe.Oggu|OggOOgg #<#deadiverson the Slasher#.##. .#Human#.#Ogg.## .#Health: 55/55 ========================#.#.. .#Magic: 7/7========================#.# #####.# .#AC: 11Str: 16  #.# ....... .#EV: 11Int: 11  Ogg#.# ........##.###SH: 9Dex: 12 ##.####.............####XL:  7 Next: 84% Place: Dungeon:5 #...............@†......OggtNoise: =--------  Time: 4171.1 (0.0) #...............#...####a) +0 long sword #....##.........###########Throw: throwing net ..##.# ..................# ..##.# ###.#.###########.# # #.##.# # #.#.# ..#  ..##.# ##.#.###########.###...#  ..##.### #.............##.......#  #......######.#................## You slash the adder!  The adder is severely wounded. OggB_The adder bites you but does no damage. The adder closely misses you.You hit the adder. _You kill the adder! _No target in view!OggOggOggFOgg}  The adder is severely wounded. _The adder bites you but does no damage. The adder closely misses you.  You hit the adder. _You kill the adder! _No target in view!Setting a skill training target for Long Blades at 14.0.OggROggOggOggOggOggP _Ogg,OggOggOgg,OggYOggOgg.OggcOggOggMOgg,OggOggOggKOggOgg+Ogg%OggOggOggOgg8Ogg,OggOgg"OggkOggOggOgg@OggOgg$OggyOggOgg,Ogg5 Ogg Ogg Ogg Oggw OggPOggOggOggOggOOggOggOggOggOggOggOggXOggOggOggg!Ogg!Ogg"Ogg$Ogg%Ogg%Ogg&Ogg,*b  You see here an adder corpse.Ogg+OggY, _Ogg,Ogg.Ogg/Ogg60Ogg0Oggd2Ogg3Ogg4Ogg4OggV6Ogg7Ogg7Ogg8Ogg:Ogg;Ogg <Ogg<Ogg>OggO?Ogg{?Ogg@OggBOgggD,OggEOggFOggHOggAHOggHOggJOggP########.# OggPQ#.......# #.#####.# ....# #.# ###.###.# ### OggPZ.....##.# .. .# Ogg Q.....##.### .##.# ..........#######....##. Ogg)Q.......†........@......>-OggHQ99.1 (28.0) ......#...#########...#. OggfQ......########### .# .... OggQ2#.#.##OggQ.# #.# ..# #.#.###########.###...#OggQ<...........##OggQa###.#..........##OggXOgg1YH-200.1 (29Ogg"^Ogg`; _Found a stone staircase leading down.Ogg/Ogg+0Ogg_0Ogg!3Ogg/5Ogg9BOgg9Ogg:Ogg:Ogg<OggT>,Ogg>Ogg@OggA,OggBOggDOggE,OggnFOgg*HOggV  ### ## ###.# <# ....# .# ###.# # # #.#  ###.# # ##.# #...@.# 5.1 (5.0)##.### #.##.## ....##.# †.......>. ..#...##...#.# ..########### #...# ............# #...# ###########.# #...# #.# #6.1 (6OggYOgg\9 _Found a stone staircase leading up.OggȈOgggOggOggOggOggOgg`nOggOggd###### ###.##<# ....#.#. # ####### .##.....# .##.###.##.## .Oggs.....#######...@##.#8.1 (2..†...............>...)#######...#.##### ##.# #...# ###########.###...# .........##.....OggA9.1 (3OggOgg) _Found a great mace.Ogg Ogg Ogg Ogg# Ogg6 Ogg Oggy" XOgg|# Ogg% Ogg& OggD' OggG( Ogg\* Ogg+ ,Ogg, Ogg|. Oggs0 ,Ogg0 Ogg2 Ogg@4 ,Ogg4 Ogg6 Ogg8 Ogg8 Ogg9 OggU< Ogg= ,Ogg`> Ogg? OggA OggB OggB Ogg\D OggE Ogg F OggF OggH OggJ ,OggK OggN OggtP ,OggPQ OggR OggsT OggT OggU OggW Ogg Y ,Ogg|Y Ogg [ Ogg] ,Ogg`^ Ogg` Ogga Ogga Oggb Oggnd Ogge ,Oggf Oggi Oggs Oggt Oggmv ,Ogg*w Oggy Ogg{ Ogg]{ Ogg{ Ogg} Ogg ,Ogg Ogg[ Ogg Ogg Ogg Ogg OggD Ogg OggM Ogg Ogg ,Ogg Ogg Ogg ,OggǓ Ogg! Oggi ,Ogg4 Ogg B  You see here a +0 great mace.OggY Ogg  _Ogg Ogg Ogg ,Ogg Ogg6 Ogg Oggݯ Ogg Oggi Ogg[ Ogg Oggb Ogg Ogg Oggи Ogg Ogg Ogg Oggټ Ogg| Ogg Ogg Ogg Ogg6 Ogg Ogg Ogg Ogg~ Ogg% Ogg Ogg Ogg OggW Ogg Oggk Ogg Ogg Ogge Ogg Ogg, Ogg Ogg Ogg Oggm Ogg Ogg ,Oggv Ogg Ogg Ogg OggH Ogg OggB ########.# #...#.#  #.# #...#.# ########.###...#.# ......##.......#.# ..............##.# ##.######.###.# ### #.# # #.# .# #. ###.#####5# #.# #.# #..@....... # ....# #.#.####### # #### #.#..  # #.## ... ... #.# 5   lemure (asleep).. #.# #.# Ogg { 51.1 (42.0)  A lemure comes into view.Ogg k.55Ogga 5==2.1 (43Ogg Ogg ( _The lemure shouts!Ogg H #...#.# #.# #...#.#Ogg p#.##.##.##.# #.# # #.# #.# ###.#####.#  #.# #..@....5.. # ....# #.#.####### # #### #.#.. # #.## ... #.#Oggd R #.# #.#OggA w #...#.# #.# #...#.##.##.##.##.# #.# # #.#OggB  #.# ###.#####.#  #.# #..@....5..  ....# #.#.#######  #### #.#.. # #.## ... #.# #.# OggmC V#.# Ogg7J OggJ OggQ Ogg/U ] _A lemure is nearby!OggH #...#.# #.# #...#.##.##.##.##.#OggH #.# # #.# #.# ###.#####.#  #.# #..@....5.. # ....# #.#.####### # #### #.#.. # #.## ... #.# #.# #.#OggR! #...#.# #.# #...#.##.#OggZ#.##.##.# #.# # #.# #.# ###.#####.#  #.# #..@....5..  ....# #.#.#######  #### #.#.. # #.## ... #.# #.# #.# Ogg4OggOggQG _A lemure is nearby!OggOgg# o[?25h[?0c  Search for what [Enter for "long b", or ? for help]? Ogg% [?25l[?1cOggP  Okay, then.Ogg!Ogg!Oggv. _Oggo[?25h[?0c  Search for what [Enter for "long b", or ? for help]? Ogg{ [?25l[?1cOggcOgg$Ogg:1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position OggbK a - [carried] a - a +0 long sword (weapon)Ogg Ogg Oggv ########.# #...#.#deadiverson the Slasher#.# #...#.#Human ########.###...#.#Health: 55/55 ======================== Ogg ......##.......#.#Magic: 7/7======================== ..............##.#AC: 11Str: 16 #####.######.###.#EV: 11Ogg bInt: 11 ### #.#Ogg c# #.#SH: 9Ogg0 ,Dex: 12 OggI ..# #.####.#####.#Ogg /XL:  7 Next: 84% Place: Dungeon:5 #.# #.##..@....5..Ogg Noise: ==-------  Time: 4252.1 (0.0) # ....#Ogg #.#.#######a) +0 long sword # ####OggR b#.#..Throw: throwing net ..# #.## ..... ...#.#Ogg S5   lemure #..#.##.# _The lemure shouts! _A lemure is nearby! Ogg _A lemure is nearby!Search for what [Enter for "long b", or ? for help]? _Okay, then.Ogg QSearch for what [Enter for "long b", or ? for help]? long bOgg< 4Ogg= Ogg . _Ogg6Ogg6Ogg>OggAF _Unknown command.Ogg-OggInventory: 27/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()f - 3 poisoned darts  j - a throwing net (quivered) OggArmour (go to first with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  p - a +5 ring of evasion (left hand)d - an amulet of faith Ogg[Wands (go to first with /)o - a wand of acid (8)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA Oggܹ[Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]Oggl  d - an amulet of faith Wands (go to first with /)  o - a wand of acid (8)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 5 scrolls labelled MEYCSO REZEI  v - a scroll labelled EMPIFE WENU OggS x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (go to first with !)  c - a puce potion  e - 3 brown potions  h - 2 potions of curingi - a viscous pink potionk - 4 lumpy ruby potionsq - 2 fuming silvery potionsu - a metallic pink potionbotOggF A  g - 2 scrolls labelled XYD YCROOMM Ogg5 R n - a scroll labelled DEGEUR JITSOgg.Armour (go to first with [)  b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=) Oggvo p - a +5 ring of evasion (left hand)41%Oggp H n - a scroll labelled DEGEUR JITS  c - a puce potion  e - 3 brown potions  h - 2 potions of curing  i - a viscous pink potion  k - 4 lumpy ruby potions  q - 2 fuming silvery potions Oggq e u - a metallic pink potionbotOgg  q - 2 fuming silvery potions  u - a metallic pink potionOggOgg͛Ogg########.# #...#.#deadiverson the Slasher#.# #...#.#Human ########.###...#.#Health: 55/55 ======================== ......##.......#.#Magic: 7/7======================== ..............##.#OggKYAC: 11Str: 16 #####.######.###.#EV: 11Int: 11 ### #.## #.#SH: 9Dex: 12 ..# #.####.#####.#XL:  7 Next: 84% Place: Dungeon:5 #.# #.##..@....5..Ogg'Noise: ==-------  Time: 4252.1 (0.0) # ....##.#.#######Ogg¤Ra) +0 long sword # #####.#..Throw: throwing net ..# #.## Ogg ..... ...#.#5   lemure #..Ogg,#.##.# _A lemure is nearby! OggU_A lemure is nearby!Search for what [Enter for "long b", or ? for help]? _Okay, then. Ogg_Search for what [Enter for "long b", or ? for help]? long b _Unknown command.OggOgg1;Ogg ......... #######. #.# #...#. ########.###...#.##.#. ..............##.##.######.###. ##OggZ # #.# .###@#####.# #.# #......5.......#.####### # #####.#..# #.## ... .#..#.#Ogg Ogg ;5.Ogg ;--3.1 (1 _Ogg# Ogg& Oggq ######### ........ ####### #.# ########.#####. ..............##.######.## ##Ogg  #@# .###.#####.# #.# ##......5.......#.#.####### # ####.#..# #.## ... .#..OggΣ Ogg A--4Ogg Ogg Ogg wM...############ ######### ........ Ogg "####### #.# ########.#####. ..............##.######.## ## #.# .Ogg ##.#####.# #.# #.##......5...Ogg ].#.###.##.#Ogg9 Ogg+ Ogg &5Ogg" Ogg OggaM†...............>...)....... ...############ ######### ........ ####### #.# ########.#####. ..............##.######.## ## #.# ..# #.####.#####.#...OggcOggk55   lemureOgg]l&6OggErOgg uOgg...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# ########.#####. ..............Ogg##.######.## ##  .##.#####.# #.# #..5..5.......####### # ####.#..# #.##OggOggi<5.Ogg&7Ogg}OggOggQj### #.##.##.# ...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# ########.#####. ..............##.######.## ##OggqR| #. .##5#####.# #.# #.....5.......####### # ####.#..Ogg}VOggq5.8Oggf  ....#.######### .### #.##.##.# ...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# ########.#####. ..............##.######.###. OggY d## #5# .##.#####.# #.# #.....5.......#######Ogg Ogg <5.Ogg &9Ogg*, Ogg* L####.#........... ....#.######### .### #.##.##.# ...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# ########.#####. ..............##.##.######.###5 ##  .##.#####.# #.# #.....5...Ogg Ogg" c5.60Ogg Ogg Ogg</ #.#################.#........... ....#.######### .### #.##.##.# ...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# ########.#####.#. ..............##5##.######.## ##  .##.#####.#Ogg=OggD<5.OggeE&1Ogg*LOggNOgg  #.#################.#........... ....#.######### .### #.##.##.# ...#######....##.########## †...............>...)....... ...OggB############ ######### ........ ####### #.# ########.###...#.##.#5 ..............##.######.## ## #.#Ogg_Ogg_<5.Ogg &2OggOggOggJ#  #.#################.#........... ....#.######### .### #.##.##.# ...#######....##.########## †...............>...)....... ...############ ######### ........ ####### #.# #...#. ########.###...#5##. ..............##.######.##OggOgg<5.Ogg.&3OggOggOggDOgg<5.Ogg)&4OggOggP1Ogg.6<5.Ogg6&5OggN:Ogg;Oggl Oggu <5.Oggv Ogg v 6Ogg| Ogg~ Ogg u  You barely miss the lemure. The lemure hits you.Oggy f49---=7.4 (1.3Ogg! Oggg# = _The lemure hits you but does no damage.Ogg ^  You hit the lemure.  The lemure is lightly wounded.OggY50---8.7OggOggęS _The lemure barely misses you.Ogg۴  You miss the lemure.The lemure is lightly wounded.Ogg)70.0OggOggP= _The lemure hits you but does no damage.Ogg3  You slash the lemure!  The lemure is heavily wounded.Ogg>[ K   Pikel (wandering)5   lemureKThe lemure hits you but does no damage.Ogg?0=1.3OggHOggQ _Pikel, Merchant of Souls comes into view. He is wielding a +2 whip of flaming.Ogg  You barely miss the lemure.The lemure is heavily wounded.Pikel shouts!OggzKK.Ogg\W46-2.6OggOgg- _The lemure hits you. x2Ogg|  Oggw}  Ogg You slash the lemure!OggV K. The lemure is severely wounded.OggQ 5-3.8 (1.2Ogg{ Ogg) 4 _You block the lemure's attack.OggA i  You hit the lemure but do no damage.OgguC OgghN K.5 2 lemures (1 wandering)OggN 5The lemure is severely wounded.A lemure comes into view.OggO #7OggO @--5.1 (1.3OggX Ogg\ L _The lemure misses you.Ogga  You closely miss the lemure.The lemure is severely wounded.Ogg OggN7  The lemure shouts!OggOggr K.55.Ogg 5=6.3 (1.2OggPOgg%= _The lemure hits you but does no damage.Ogg^  You miss the lemure.The lemure is severely wounded.Ogg`Ogg`Ogg:hK55.-7.5OggoOgghs4 _You block the lemure's attack.Ogg .##.#deadiverson the Slasher .##.#Human Ogg! .##.##############Health: 47/55 ====================---- .######.#............#Magic: 7/7======================== .##.....#.##########.#AC: 11OggM Str: 16 .### #.##.##.##.#EV: 11Oggy Int: 11 ...#######....##.##########.#SH: 9Ogg* Dex: 12 †...............>...).......#XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############Noise: =--------  Time: 4277.5 (0.0) ########## #...#K#a) +0 long sword .........# #...#5#Throw: throwing net Ogg[ .########.# #...#.##.# #...#5# ########.###...#.#Ogg} K   Pikel ......##.......#.#55 2 lemures Ogg v..............##.# #####.######.###.# Ogg _The lemure hits you but does no damage.  You miss the lemure.The lemure is severely wounded. Ogg _You block the lemure's attack.  Press: ? - help, v - describe, . - travelThe floor.Ogg @K  You miss the lemure.  The lemure is severely wounded. _You block the lemure's attack.  Press: ? - help, v - describe, . - travelHere: Pikel, wielding a +2 whip of flaming and wearing a +0 robe  The floor.Ogg K :.##.#deadiverson the Slasher .##.#Human .##.##############Health: 47/55 ====================---- .######.#............#Magic: 7/7======================== .#OggK #.....#.##########.#AC: 11Str: 16 .### #.##.##.##.#EV: 11Int: 11 ...#######....##.##########.#SH: 9Dex: 12 †...............>...).......#XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############Noise: =--------  Time: 4277.5 (0.0) Ogg`L ########## #...#K#a) +0 long sword .........# #...#5#Throw: throwing net ########.# #...#.##.# #...#5# ########.###...#.#K   Pikel ......##.......#.#55 2 lemures ..............##.# #####.######.###.#OggL 1You miss the lemure.The lemure is severely wounded. _You block the lemure's attack.  Press: ? - help, v - describe, . - travelHere: Pikel, wielding a +2 whip of flaming and wearing a +0 robe  The floor.OggM OggW Ogg?[ . _Ogg OggI Evoke which item? Wands  o - a wand of acid (8)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedOggZOggOggr.##.#deadiverson the Slasher .##.#Human .##.##############Ogg"Health: 47/55 ====================---- .######.#............#Magic: 7/7======================== .##.....#.##########.#AC: 11Str: 16 .### #.##.##.##.#EV: 11OggWInt: 11 ...#######....##.##########.#SH: 9Dex: 12 Oggծ†...............>...).......#XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############Noise: =--------  Time: 4277.5 (0.0) ########## #...#K#a) +0 long sword Ogg.........# #...#5#Throw: throwing net Ogg .########.# #...#.##.# #...#5# ########.###...#.#OggEK   Pikel ......##.......#.#Oggj55 2 lemures ..............##.# Oggw#####.######.###.#You miss the lemure.The lemure is severely wounded. Ogg<_You block the lemure's attack.  OggPress: ? - help, v - describe, . - travelHere: Pikel, wielding a +2 whip of flaming and wearing a +0 robe _The floor.Ogg.# #.# deadiverson the Slasher .# #.# Human .# #.##############  Health: 47/55 ====================---- .# #####.#............#  Magic: 7/7======================== .# #.....#.##########.#  AC: 11Str: 16 .### #.##.##.# #.#  EV: 11Int: 11 ...#######....##.##########.#  SH: 9Dex: 12 †...............>...).......#  XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############  Noise: =--------  Time: 4277.5 (0.0) ########## #...#K# a) +0 long sword ggm.........# #...#5# Throw: throwing net ########.# #...#.# #.# #...#5# ########.###...#.# K   Pikel ......##.......#.# 55 2 lemures ..............##.# #####.######.###.#Press: ? - help, v - describe, . - travelHere: Pikel, wielding a +2 whip of flaming and wearing a +0 robe _The floor.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - PikelAim: Pikel, wielding a +2 whip of flaming and wearing a +0 robe (64% to hit)Ogg#K5lemurea lemure (severely wounded, Oggrl 5*Ogg *5, f - lemureAim: a lemure (64% to hit)Ogg .# #.# deadiverson the Slasher .# #.# Human .# #.##############  Health: 47/55 ====================---- .# #####.#............#  Magic: 7/7======================== Ogg .# #.....#.##########.#  AC: 11Str: 16 .### #.##.##.# #.#  EV: 11Int: 11 ...#######....##.##########.#  SH: 9Dex: 12 †...............>...).......#  XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############  Noise: =--------  Time: 4277.5 (0.0) ########## #...#K# a) +0 long sword .........# #...#5# Throw: throwing net ########.# #...#.# #.# #...#5# ########.###...#.# K   Pikel ......##.......#.#Ogg  55 2 lemures ..............##.# #####.######.###.#Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - lemureAim: a lemure (64% to hit)  The bolt of acid hits Pikel! The acid corrodes Pikel!  Pikel is moderately wounded.Oggȳ \The bolt of acid hits the lemure. The acid corrodes the lemure!Ogg /  --more--Ogg57n  #.# #.# #.###      #. #.# #.#####.# †........#   #...#*# #...#*# #...#*Ogg8G #.# #...#**# (corroded)#.#(1 corroded)#.#  The lemure is almost dead.The bolt of acid hits the lemure!OggOgg)iK55..Oggh8====8.5 (1OggOggY _The lemure is moderately wounded.OggOggOgg2Ogg> _Unknown command.Ogge Evoke which item? Wands  o - a wand of acid (7)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedOggg?OggeEOggLt.##.#deadiverson the Slasher .##.#Human .##.##############Health: 48/55 ====================---- OggaMn.######.#............#Magic: 7/7======================== .##.....#.##########.#AC: 11Str: 16 OggM.### #.##.##.##.#EV: 11Int: 11 OggM...#######....##.##########.#SH: 9Dex: 12 OggM†...............>...).......#OggMXL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############Ogg_NTNoise: ====-----  Time: 4278.5 (0.0) ########## #...#K#a) +0 long sword .........# #...#5#Throw: throwing net ########.# #...#5#OggNz#.# #...#.# ########.###...#.#K   Pikel (corroded) ......##.......#.#OggN55 2 lemures (1 corroded) ..............##.# Ogg O#####.######.###.#The lemure is almost dead.The bolt of acid hits the lemure! OggfOu_The lemure is moderately wounded. _Unknown command.Oggl.# #.# deadiverson the Slasher .# #.# Human .# #.##############  Health: 48/55 ====================---- .# #####.#............#  Magic: 7/7======================== Oggm.# #.....#.##########.#  AC: 11Str: 16 .### #.##.##.# #.#  EV: 11Int: 11 ...#######....##.##########.#  SH: 9Dex: 12 †...............>...).......#  XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############  Noise: ====-----  Time: 4278.5 (0.0) ########## #...#K# a) +0 long sword .........# #...#5#Oggzm Throw: throwing net ########.# #...#5# #.# #...#.# ########.###...#.# K   Pikel (corroded) ......##.......#.# 55 2 lemures (1 corroded) ..............##.# #####.######.###.#The bolt of acid hits the lemure! Oggnp_The lemure is moderately wounded. _Unknown command.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - lemureAim: a lemure (moderately wounded, 64% to hit)Ogg.# #.# deadiverson the Slasher .# #.# Human Ogg+0.# #.##############  Health: 48/55 ====================---- .# #####.#............#  Magic: 7/7======================== .# #.....#.##########.#  AC: 11Str: 16 .### #.##.##.# #.#  EV: 11Int: 11 ...#######....##.##########.#  SH: 9Dex: 12 Oggwx†...............>...).......#  XL:  7 Next: 84% Place: Dungeon:5 ...#########...#@############  Noise: ====-----  Time: 4278.5 (0.0) ########## #...#K#Ogg a) +0 long sword .........# #...#5#Ogg Throw: throwing net ########.# #...#5# Ogg(#.# #...#.# ########.###...#.# K   Pikel (corroded) Ogg*......##.......#.# 55 2 lemures (1 corroded) OggSM..............##.# #####.######.###.#OggAiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - lemureAim: a lemure (moderately wounded, 64% to hit)  The bolt of acid hits Pikel!  Pikel is severely wounded.The bolt of acid hits the lemure!Ogg/  --more--OggV Z  You kill the lemure!OggW I #.# #.# #.###      #. #.# #.#####.# †........#  Ogg+ } #...#*# #...#*# #...#* #.# #...#**# #.#5   lemure (#.#  That felt strangely unrewarding. The bolt of acid hits the lemure!  The acid corrodes the lemure!OggIOggLpThe lemure is severely wounded.A lemure comes into view.Ogg WK5...5 2 lemures (1 corroded)5OggW+9.5 (1Oggi`OggdF _Pikel barely misses you.Ogg4OggOggڌF _Unknown command.Oggd  You hit Pikel but do no damage.Ogg= 5.  Pikel is severely wounded.Oggc=---80.8 (1.3OggkOggNN _Pikel barely misses you.Oggvs;  You barely miss Pikel.Ogg 5.  Pikel is severely wounded.Oggj9=---2.1OggOgg8 _Pikel hits you but does no damage.Ogg  3  You hit Pikel.Ogg d  Pikel is almost dead.Ogg k5. Ogg (3.4Oggv$ Ogg& 2 _You block Pikel's attack. x2Ogg  You hit Pikel but do no damage.Pikel is almost dead.Ogg 5 3 lemures (1 wandering, 1 corroded)5Pikel barely misses you.Ogg (4.7Ogg Oggn Y _A lemure comes into view.Oggo  You barely miss Pikel.  Pikel is almost dead.The lemure shouts!Oggz55.50==5.9 (1.2OggqOggj8 _Pikel hits you but does no damage.Ogg  You hit Pikel.  Pikel is almost dead.Pikel hits you with a +2 whip of flaming.OggB5.Ogg1`45---7.1OggKOggj& _Pikel burns you.Ogg.a  You completely miss Pikel.  Pikel is almost dead.Pikel hits you with a +2 whip of flaming.Oggp 5.  Pikel burns you.  Pikel hits you with a +2 whip of flaming.Oggiqw39-----8.4 (1.3Ogg'|Ogg& _Pikel burns you.Ogg  You barely miss Pikel.  Pikel is almost dead.Ogg ]40--9.6 (1.2Ogg& Ogg* 8 _Pikel hits you but does no damage.Ogg/ You closely miss Pikel.  Pikel is almost dead.The lemure is no longer covered in acid.Ogg )90.8OggK Ogg R _Pikel completely misses you.Ogg:  You barely miss Pikel.  Pikel is almost dead.Ogg512.1 (1.3OggOgg8 _Pikel hits you but does no damage.Oggq _Pikel hits you but does no damage.  You miss Pikel.  Pikel is almost dead.  Pikel barely misses you.  with a +2 whip of flaming.35--3.3 (1.2Ogg< _Pikel burns you.Ogg[ You miss Pikel.  Pikel is almost dead.Ogg[-4.6 (1.3Ogg_Ogg\ _Pikel is no longer covered in acid. Pikel hits you but does no damage.Ogg\v  You completely miss Pikel.  Pikel is almost dead.Oggw_6--5.9OggJOgg}G _Pikel misses you.OggTd 3  You hit Pikel.Oggi  You kill Pikel!With Pikel's spell broken, his former minions thank you for their freedom.OggEk Oggs <)§§OggVs #5##.##.##.#Oggu Ogg .##.#deadiverson the Carver .##.#Human .##.##############Health: 36/55 ===============--------- .######.#............#Magic: 7/7======================== .##.....#.##########.#AC: 11Str: 16 .### #.##.##.##.#EV: 11Int: 11 ...#######....##.##########.#SH: 9Dex: 12 †...............>...).......#XL:  7 Next: 188% Place: Dungeon:5 ...#########...#@############Noise: =--------  Time: 4297.1 (1.2) ########## #...#)#a) +0 long sword .........# #...#§#Throw: throwiOgg ng net ########.# #...#§##.# #...#5# ########.###...#.# ......##.......#.# ..............##.# #####.######.###.#Pikel is almost dead. _Pikel misses you.You hit Pikel.  You kill Pikel!With Pikel's spell broken, his former minions thank you for their freedom. _The lemure departs this earthly plane. x2  You hit Pikel.  You kill Pikel!  With Pikel's spell broken, his former minions thank you for their freedom. _The lemure departs this earthly plane. x2  Your Long Blades skill gained 2 levels and is now at level 8!You have reached level 8!Oggن /  --more--OggK"g40/618/872844% Ogg.h _You feel stronger.Oggx ###################.#.................#.##############.##.# ..#######....##.######### †...............>...)...... ...#########...#.########### ###  .........§ ######## ### #.## #.#OggM-80 _  Things that are here: _a +2 whip of flaming; a +0 robe; the kobold corpse of PikelOggz 3Ogg/| Ogg; Ogg S1=Oggv BOgg Ogg_ Ogg Ogg) Ogg ,Ogg Ogg a2=Ogg& Ogg׌ ,Ogg( OggD ,Oggb OggÒ Ogg 93Oggi Ogg ,Ogg/ Ogg ,Ogg Ogg d44=Ogg Oggʡ ,Ogg Ogg ,Ogg Ogg( ,Ogg Ogg Ogg W5=Ogg/ OggȲ ,Oggw Ogg OggĴ Ogg_ Ogg̷ Ogg K6=Oggʹ Ogg ,Ogg Ogg ,Ogg Ogg+ Oggy U7=Ogg Ogg Ogg" Ogg Ogg ,OggN Ogg ,Ogg Ogg Ogg4 %8Ogg@ OggO Ogg Ogg OggD ,Ogg Ogg Ogg5 D9=Ogg Ogg ,Ogg Ogg Ogg OggZ Oggx Ogg V50=OggI OggP Oggs Ogg Ogg Ogg$ Ogg Ogg Ogg Ogg Ogg Ogg K1=Ogg? Oggm Ogg OggA Ogg ,OggV Ogg Ogg U2=Ogg Ogg Ogg> Ogg Ogg Ogg Ogg Ogg Ogg %3Ogg Ogg Ogg9 Ogg Ogg ,Ogg} Ogg Ogg Ogge Ogg Ogg K4=Ogg Ogg$ ,OggY OggA Oggh Ogg Ogg" Ogge U5=Ogg| Ogg{ Ogg Ogg Ogg Ogg1 Ogg Ogg a6=Ogg Oggy Ogg Ogg2 OggT ,Ogg Ogg] ,Ogg Ogg Ogg U7=Ogg Ogg BOggI ,OggS Ogg Ogg 8Ogg Ogg" Ogg*" OggB# OggA% ,Ogg% Ogg& K9=Ogg' Ogg' Ogg) Ogg.) Ogg) Ogg* ,Ogg+ Ogg, ,Oggr- Ogg/ Ogg/ V60=Ogg0 Ogg3 ,Ogg4 OggX6 Ogg6 Ogg8 Ogg@ -..#.##.#Ogg@ #.##.##.# _You start resting.OggG 1365.1 (67.0)OggH Z1=6.1 (68Ogg_L Ogg.N " _HP restored.Ogg 3Ogg Ogg Ogg Ogg BOggT ,OggȪ OggA Ogg$ OggT Oggt Ogg Ogg O=Ogg! Ogg Ogg Ogg˼ Ogg Ogg3 Ogg Ogg Ogg Ogg Ogg ,Ogg Ogg Ogg Ogg3 Ogg2 Ogg Ogge ,OggO Ogg Oggb Ogg Oggw Ogg Ogg{ ,Ogg Ogg Ogg Ogg8 OggZ Ogg Ogg ,Ogg XOggQ Oggj Oggr Ogg Ogg Ogg] OggJ ##########.###...#.# ..........##.......#.# ................##.# .######.######.###.# ##.#### #.# #.# #.# ...# #.# #.###.#####.# ...##.# #.# #.#......5... .# ....# #.#.#.Ogg  ).## #### #@#.#..81.1 (15 #.# #.## ...... ... ... ....... <#.#.#.# ...##.. ....#.#.# #. ... #.#Ogg  #. ## . Ogg Ogg ,2.1 (16Ogg$ Ogg 9 _Found a stone staircase leading up.Ogg߅Ogg1OggOggOggOggQOggnOggQOggJOgg}OggOggOggҖOggOggxOggOgg..............##.# ######.######.###.# #### #.# #.# #.# ..# #.# #.###.#####.# #.# #.#......5... .# ....# #.#.#.####### ## #### #.#.#...  #######.#.#.### ... ..........@...#  .....<#.#.#.#.# ##.. ........#.#.#  ####.#....#.# #.######.#. Ogg͢[0;10;1mS. S   adder (asleep)## .# ..Ogg| 6.1 (4.0)  An adder comes into view.OggmOgghS.SOgg+7.1 (5OggƶOgg/ _The adder hisses angrily.OggA.# #.# #.# #.# #.# #.###.#  #.# #.#....  ....# #.#.#.#######  #### #.#.#...  #######.#.#.###  ..........@...#  .....<#.#.#.#.#  #.#.# ..#S# #.######.# . .. ## .# ..Ogg.# #.# #.# #.# #.# #.###.#  #.# #.#....  ....# #.#.#.#######  #### #.#.#...  #######.#.#.###  ..........@...#  .....<#.#.#.#.#  #.#.# ..#S# #.######.# Ogg. .. ## .# .. Ogg Ogg6!Ogg&Ogg)] _An adder is nearby!OggP+.# #.# #.# #.# #.# #.###.#  #.# #.#....  ....# #.#.#.#######  #### #.#.#...  #######.#.#.###  ..........@...#  .....<#.#.#.#.#  #.#.# ..#S# #.######.# . .. ## .# ..OggPOggU.# #.# #.# #.# #.# #.###.#  #.# #.#....  ....# #.#.#.#######  #### #.#.#...  #######.#.#.###  ..........@...#  .....<#.#.#.#.#  #.#.# ..#S#Oggb #.######.# . .. ## .# .. OggN4OggOgg] _An adder is nearby!Ogg #####.######.###.#  #.# #.# #.# ..# #.# #.###.#####.# #.# #.# #.#......5...  ....# #.#.#.####### # #### #.#.#... .. #######.#.#.### ..............# .....<#.#.#@#.# #.. ........#.#.#  ####.#....#S# Ogg h #.######.#. ...## #.#  ...#.#Ogg+ Oggj <S.Ogg8 )8.1 (1 OggU _Ogg Ogg OggOgg.=9.2 (1.1Ogg]Ogg _You closely miss the adder. The adder closely misses you.Ogg@3 Ogg0? 2 rr   quokkaYou miss the adder. You block the adder's attack.  A quokka comes into view.Ogg^@ .90.4 (1.2OggdF OggZK = _The adder bites you but does no damage.Ogg{n 7  You hit the adder.OggWs l  The adder is heavily wounded.Ogg^{ gr .Ogg{ -1.5 (1.1Oggm Ogg S _The adder closely misses you.Ogg   You closely miss the adder.The adder is heavily wounded.Oggwr.2.7 (1.2OggROggsV _The adder closely misses you. x2Ogg#7  You hit the adder.Ogg'{ r. OggThe adder is almost dead.3.8 (1.1 _The adder barely misses you.Ogg!f  You closely miss the adder.The adder is almost dead.4.9 _You block the adder's attack. x2Ogg/  You miss the adder.The adder is severely wounded.6.1 (1.2Ogg"Ogg= _The adder bites you but does no damage.Oggş  You hit the adder but do no damage.The adder is severely wounded.Oggζ 7.2 (1.1 _The adder closely misses you. The adder bites you but does no damage.Ogg  You hit the adder.  The adder is almost dead.Ogg1 (8.3Ogg Ogg = _The adder bites you but does no damage.Ogg9  You slash the adder!Ogg Ogg}.r.r   quokkaOggk3559.5 (1.2Ogg9Ogg#=I _You kill the adder!Ogg~:  You slash the quokka!Ogg†400.6 (1.1 _You kill the quokka!OggOggOggAOggH _No target in view!Ogg 3Oggd Ogg Ogg Ogg $ _Ogg ,Ogg0" ,Ogg$ OggE @ _v - 2 scrolls labelled EMPIFE WENU (gained 1) #.# #.#......5... ....# #.#.#.#######  #### #.#.#...  #######.#.#.###  ..............# . .....<#.#.#.#.#  ........#.#†#.#  ####.#....#.#.#  #.######.#@# -5.6 (5.0 . .........(..... #####.#.####### ...... ###.### OggX -6.6 (6 _Found 7 stones.Ogg|53Ogg6Ogg <Ogg?Oggl?OggC,OggDOgg/EOggFOgg"JOggL,OggMOggaPOggsR,OggnSOggqOggsOgg.tOgguOgg  ####.#....#.#.# .# #.######.#.######## ... . .........(...... ...#########.#.######## #..................... #...#######.########## #.........#....# #.......#.##.##...@...).# #- ###.......# #.......# #........... ..#.#.....### .⌠...#.....# ....#######.#.### #..  You pick up a book of Geomancy and begin reading...Oggۈ.24.9 (6.0OggE-5.9 (7Ogg,OggE] _You add the spells Sandblast, Stone Arrow and Passwall to your library.Oggq Ogg Oggd Ogg Ogg{" Ogg$ Ogg) ,Ogg* Ogg* Ogg+ Ogg/ Ogg9 ...#########.#.######## #..................... #...#######.########## #.........#....#  #.......#.##.#  #.......).# #  ###.......#  ##.......#  #.@...............#.#.....###.w..⌠...#.....#......#######.#...### #...⌠. Ogg[: w   ribbon worm (asleep).. Ogg@ { 7.9 (2  A ribbon worm comes into view.OggI l>wwOggI +8.9 (3OggQ OggVU A _Found a staircase to the Ecumenical Temple.OggVU  ...#.#. #.. #...#######. #.........#....# #.......#.##.# #.......).# # ###.# ##.# #..#.#.....###.>w.⌠...#.....#...#######.##...### #..#.⌠.#..##OggY Oggb |.w9.9 (1Oggj Ogg~m Ogg2  #................... #...#######.######## #.........#....#  #.......#.##.# #.......).# # ###.......# #. ##.###...##...........@#.#.....###⌠..>.w⌠...#.....# ......#######.###...#### #.. #.⌠. #. ## OggT H(catching breath)Ogg `````The ribbon worm expels a string of sticky webbing.Ogg~>....@30OggDOggHW _The stream of webbing misses you.Ogg; #...#######.########.#. #.........#....# #.#. #.......#.##.#.... #.......).# ##.. ###.......# #.⌠. ##.......####...###....................#.#.....###⌠..>.w@...#.....# .........#######.####...#### #.. #.⌠. #. ### Ogg<1Ogg#OggJc _There is a fountain of clear blue water here.Ogg Q  You slash the ribbon worm!  The ribbon worm is heavily wounded.Ogg R6==3.0 (1.1OggWOggZX _The ribbon worm barely misses you.Ogg{*  You hit the ribbon worm.  The ribbon worm is heavily wounded.Ogg+ 0-4.1Ogg0 Ogg.3 C _The ribbon worm bites you but does no damage.OggJp  You hit the ribbon worm.  The ribbon worm is heavily wounded.-5.3 (1.2Oggt Ogg%w 9 _You block the ribbon worm's attack.Ogg  You hit the ribbon worm.  The ribbon worm is severely wounded.Ogg(6.5OggOgg69 _You block the ribbon worm's attack.Ogg? _You block the ribbon worm's attack.  You hit the ribbon worm.  The ribbon worm is severely wounded. _You block the ribbon worm's attack.  You barely miss the ribbon worm.  The ribbon worm is severely wounded.OggA-7.6 (1.1Ogg FOggH9 _You block the ribbon worm's attack.Ogg9?  You slash the ribbon worm!Ogg_1.Ogg -8.8 (1.2Ogg OggO _You kill the ribbon worm!OggC #...#. #.#.##.........#....# #.#.. #.......#.##.# ....# #.......).# # #... ###.......# #.⌠. ##.......####...###....#.#.#.....####.⌠..>.@⌠...#.....##.#######.####...#### #..  #.⌠. #... ###.##OggOgg@4-90Ogg_OggOggX \ #...#. #.#.##.#....# #.#.. #.......#.##.# ....###.......).# # #...####.......# #.⌠.# ##.# ####...###..... #.#.#.....### #.⌠..>@.⌠...#.....# #.#######.# ####...#### #..Ogg`Z  #.⌠.# #...# ###.. ###Oggz` Ogg@a A-40Oggf Ogg[h Ogg  #...#. #.#.##.#....# #.#... #.#.##.# ....###.).# # #...####.......# #.⌠.# ##.......# ####...###. #.#.#.....### #.⌠..@..⌠...#.....# #.#######.# ####...#### #..  #.⌠.#  #...#  ###.. ###Ogg Ogg&1Ogg%Ogg i _There is a staircase to the Ecumenical Temple here.Ogg-bOggbOgg2hOggnOggn-2 _OggnsOggg: ######### ##._._._.## ##_......._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #...≈≈...≈≈...# #_.≈≈.....≈≈._# Temple#......@......# #_.≈≈.....≈≈._# #...≈≈...≈≈...# #_..≈≈≈.≈≈≈.._###....≈.≈....####_......._####._._._.##Ogg;]#########  You climb downwards. Welcome to the Ecumenical Temple! Found eighteen altars.Ogg)<OggB_____Ogg-3.5 (1.7____ _Found a staircase back to the Dungeon. _There is a staircase back to the Dungeon here.Ogg{k# ##._._._.## ##_._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #...≈≈...≈≈...# #_.≈≈.....≈≈._# #......<# #_.≈≈.....≈≈._# #...≈≈...≈≈...# #_..≈≈≈.≈≈≈.._####_._## Ogg_.____OggK340 _Ogg _._____OggOgg%r# ##._._._.## ##_._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #...≈≈...≈≈...# #_.≈≈.....≈≈._# #......<.@....# #_.≈≈.....≈≈._# Oggs#...≈≈...≈≈...# ### Oggz_.____Oggd{&5Ogg_.___OggOgg)0# ##._._._.## ##_._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #...≈≈...≈≈...# #_.≈≈.....≈≈._# #......<..@...# Ogg#_.≈≈.....≈≈._# #...≈≈...≈≈...# #_..≈≈≈.≈≈≈.._###.##_._### OggX_._____Ogg&6Ogg_.____OggOgg{a ## ##._._._.## ##_.Oggb _## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #...≈≈...≈≈...# #_.≈≈.....≈≈._# #......<...@..# #_.≈≈.....≈≈._# #...≈≈...≈≈...# #_..≈≈≈.≈≈≈.._###..##_._######Oggi R__Oggj &7Oggo _.___Oggp Ogg ####### ._._._.## _......._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #..≈≈...# #_.≈≈.....≈≈@_# #......<......# Ogg #_.≈≈.._# #...≈≈...≈≈...##_..≈≈≈.≈≈≈.._###....≈.≈....##_......._##._._._.#########OggҖ t____Ogg &8Ogg) _.______Ogg Oggmp####### ._._._.## _......._## ##....≈.≈....## #_..≈≈≈.≈≈≈.._# #..OggJq≈≈..@# #_.≈≈.....≈≈._# #......<......# #_.≈≈.._##...≈≈...≈≈...##_..≈≈≈.≈≈≈.._###....≈.≈....##_......._##._._._.Oggv_._____Oggnw&9Ogg{L_._Ogg{z____Ogg}Ogg0M #########  ##._._._.##  ##_......._## #....≈.≈....#_..≈≈≈.≈...≈≈...≈≈..._.≈≈.....≈≈._#......<......#....._#Ogg2G__Ogg3'50Ogg7_.____Ogg:n _There is a glowing golden altar of the Shining One here.OggV  You kneel at the altar of the Shining One.Ogg/  --more--OggH OggJ pThe Shining One Followers of the Shining One are bound to the code of the honourable warrior, soldiers in their god's eternal crusade against evil. For forsaking dark magic and underhanded tactics, the Shining One rewards them and their allies with the power they need to slay demons and the undead. Especially devout warriors can even call upon angels in times of need. The Shining One's followers can convert to Elyvilon or Zin while keeping some piety. Favour - The Shining One is neutral towards you. OggAK Granted powers:(Cost)The Shining One occasionally guards your life. The Shining One prevents you from stabbing unaware foes. You radiate a small righteous aura, and foes within it are easier to hit. The Shining One partially shields you from negative energy. You and your allies can gain power from killing the unholy and evil. You can call upon the Shining One for a divine shield. (3 MP, Piety-)You can channel blasts of cleansing flame.(5 MP, Piety-)You can summon a divine warrior.(8 MP, Piety--)The Shining One will bless your weapon with holy wrath... once. [!]: Overview|Powers|Wrath [J/Enter]: join religionOgg Oggdeadiverson the CarverHumanHealth: 61/61 ========================Magic: 8/8========================#########AC: 11Str: 17##._._._.##EV: 12Int: 11##_......._##SH: 9Dex: 12##....≈.≈....##XL:  8 Next: 46% Place: Temple#_..≈≈≈.≈≈≈..@#Noise: ---------  Time: 4450.5 (0.0)#...≈≈...≈≈...#a) +0 long sword#_.≈≈.....≈≈._#Throw: throwing net#......<......##_.≈≈.....≈≈OggLr[37m._##...≈≈...≈≈...##_..≈≈≈.≈≈≈.._###....≈.≈....####_......._## _There is a staircase to the Ecumenical Temple here.  You climb downwards. Welcome to the Ecumenical Temple! Found eighteen altars. _Found a staircase back to the Dungeon. _There is a staircase back to the Dungeon here. _There is a glowing golden altar of the Shining One here.  You kneel at the altar of the Shining One.Oggi  The Shining One welcomes you!Ogg 4_____--more--Ogg9  of the Shining One ......1.5 (1 _____Oggs=Ogg ______Ogg Ogg _____Ogg f _You offer a prayer to the Shining One.OggOggUeWhere to? (Tab - D:5, ? - help) OggD D - Dungeon  T - Temple OggnOggdeadiverson the CarverHuman of the Shining One ......Health: 61/61 ========================Magic: 8/8========================#########AC: 11Str: 17Ogg]##._._._.##EV: 12Int: 11##_......._##SH: 9Dex: 12##....≈.≈....##XL:  8 Next: 46% Place: TempleOgg#_..≈≈≈.≈≈≈..@#Noise: ---------  Time: 4451.5 (0.0)#...≈≈...≈≈...#Ogg a) +0 long sword#_.≈≈.....≈≈._#Throw: throwing net#......<......##_.≈≈.....≈≈._##...≈≈...≈≈...#Oggm#_..≈≈≈.≈≈≈.._###....≈.≈....####_......._## _Found a staircase back to the Dungeon. Ogg_There is a staircase back to the Dungeon here. _There is a glowing golden altar of the Shining One here.  OggYou kneel at the altar of the Shining One. _The Shining One welcomes you! _You offer a prayer to the Shining One.OggrOggOggOggOgg}P _OggnOggOggWOggOgg,OggGOggOgg= ,OggX Ogg Ogg ,OggOggOggOgg5Ogg OggOggWOggOggOOggwZ  There is a staircase back to the Dungeon here.OggOggOgg$ _OggOgg&Dungeon:5OgghOgg,OggzOgg #...#######.#####.#.##.........#....##.#... #.......#.##.#....###.......).# # #...####.......# #.⌠.# ##.......# ####...###........... #.........#.#.....### #.⌠..@..⌠...#.....#61.0 (9.5 Ogg#.........#######.# ####...#### #.. #.⌠.# #...# ###.. ### Oggp@_You climb upwards. Welcome back to the Dungeon!OggOgg9Oggi _There is a staircase to the Ecumenical Temple here.Ogg Ogg^Ogg&OggOggjOggEP _Ogg,OggOggOggc Ogg!,Ogg"Ogg$,Oggw%Ogg+'Ogg|(,Ogg=)Ogg*Ogg3,,Ogg,OggH2Ogg2Ogg53Ogg3Ogg5Ogg7,Ogg7Oggv9Ogg:,OggG;Ogg<Ogg>BOgg>@OggA,Ogg)BOggrEOgg\FOggFOggGOggmHOggSI,Ogg JOggKOggLL,OggLOggOOggPOgg QOggQOggROgg=T,OggTOggUOggV,OggHWOggXOggX,OggYOggZOgg8\,Ogg\Ogg]Ogg^,Ogg_OggqaOgg[d,OggaeOgggfOgg[g,OgghOggRjOgg%k,OggkOgg mOggm,OggnOggKpOggpOggqOggqOggrOggesOgg{sOggtOggHuOggSv,OggwOggDyOggzOgg{Ogg{Ogg}OggOggOggOggŃOgg,OggoOgg]OggX,OggOggOggOgg3,OgghOggzOggOgg.OggOggf,OggOggiOggؒOggOgg'OggOggOggԔOggOggƕOggJ,OggOggOgg,OggOggȚOggBOggwOggƜOggOgg۟,Ogg#OggOgg,OggΡOggOggOgg OgguOggɤOggC,OggOgg_Oggۦ,OggBOggܨOggw,OggOggOggOggȫOgg0OggOgg/,OggOggkOgg,Ogg8OggOggP,OggOggTOgg#.#######.........#. ....#.......#..#.##...#############.##..#.#..#.........#.##..#.#.##...#############.##..#.#.##.........Oggv.............#.#....#.......########.##.##....###..........##.####...####.....###########@# #.⌠.# ##.....510.0 (49.0)(.......####...###......Ogg#######.#.........#.#... ###.⌠..>..⌠...#... #.........######Oggi ####...#### #.⌠.#Ogg*#...####..OggJOggLOgg2 ,1.0 (50OggH Ogg % _Found 6 stones.Ogg+ Ogg OggJ Ogg. Ogg Ogg+ BOgg Ogg Ogg Ogg Ogg: Ogg Ogg4 Ogg Oggi Ogg Oggp Ogg" Oggt Ogg Oggx Ogg Oggv Ogg Oggk Ogg Ogg@ ,Ogg Ogg ;  You see here 6 stones.Ogg Ogg  _Ogg Ogg Ogg8 ,Ogg" Oggp Ogg Ogg Ogg OggB Oggu Oggl Ogg Ogg ,Ogg Ogg[ OggM ,Ogg Ogg Oggj Ogg Ogg Ogg Ogg Ogg OggS Ogg Ogg  ,Ogg Ogg Ogg! ,Ogge! OggW" OggE# Oggu# Ogg# Ogg% Ogg& Ogg& Oggs' Ogg( Ogg+* ,Ogg* Ogg, Ogg, Ogg, Ogg, Ogg3 Ogg4 ,Ogg4 Ogg5 Ogg6 Ogg7 OggW7 Ogg9 Ogg: Ogg: Ogg<; Ogg< Ogg3> ,Ogg> Ogg? Ogg@ Ogg@ OggCA Ogg{B OggC OggC Ogg D Ogg9E Ogg9F OggnF OggF OggG OggH Ogg,I OggI OggJ Ogg$L ,OggrL OggM OggN ,OggDO OggMP OggQ ,OggQ OggS Ogg\      #   .#   ###.  #.)  ###.################  #..@................47.0 (36  ####################       Oggb Ogg*c ,8.0 (37Oggh OggRj + _Found a quarterstaff.Oggw Ogg Ogg OggK Ogg OggQ XOgg Oggg Ogg7 D  You see here a +0 quarterstaff.Oggs K _OggI Ogg ,Ogg Ogg Ogg ,Ogg OggX Ogg Ogg1 Ogg Ogg Ogg(,OggOggOggTOggOggNOggOggOggOgg Ogge Ogg OggE Ogg OggsOggOggOggOggOgg,OggfOggOgg#OggYOggOggOggOggOgg2OggKOggmOggOgg Ogg!Ogg"Ogg#Ogg#Ogg$Ogg%,Ogg&Ogg(Ogg(Ogg%)Ogg)OggG+Ogg+Ogg,Ogg,OggZ.OggO/Ogg/Ogg/Ogg31Ogg2OggJ2Ogg2Ogg@4Ogg4Ogg"5Oggy5Ogg7OggAQ #.# #.##.......... ### ###########.## #.## #... ###### ## #### ##..#.## #..) OggB#......####.+. ###### #.......#..# ...... #.#.#..#@# ######70.0 (22 #..####### ...... ##.####### #.#####...(. #....###.### OggC##...##.# #...##.# #...##.# #...#OggDC!#.#OggeLOggL%1.0 (23OggYSOggVE _Found a hammer. Found a runed translucent door.OggEpOggpOggqOgguOggZzOgg{Ogg*|OggpOggH7 _Crazy Yiuf shouts!OggIOggOggOggӏOggOggOgg0OggOggkOgg^OggOggOggOggOgg8OggsOgg!OggJOggN,OggcOggIOgg{OggOgg=OggOggOggOggOggOgg,OggROggOggBOgghOggOggOggOgg~OggOggOggNOggOgg,OggnOgg9OggOggOgg.OggOgg,Ogg|OggOggxOggOgglOggOgg,Ogg@OggOggOgg:Ogg OggOOgg~OggOggOggOggUOggOggPOgg$OggT&Ogg&Ogg7'Ogg,Ogg.,OggR/Ogg6D  You see here a +0 quarterstaff.Ogg8Ogg9 _Ogg9Ogg(?Ogg@OggAOggAOggGOggH,OggIOggNOggO,Ogg-POggROggT,OggDUOggqZOgg[,Ogg\Ogg`OggebOggbOggcOgggOggi,Ogg]jOggnOggp,OggqOggtOggtuOgguOgguOggyOgg{Ogg4{Ogg{OggOggOggڀOggFOggyOggOgg̅Ogg2OggOgg,OggaOgg3OggSOgg}Ogg OggdOggwOggOggOgg-Ogg7OggROggʚOggOggBOgg%OggOggOggOggOgg,OggOgg1OggOggOggӮOgg!Oggϲ,OggγOggOggIOggOggeOggҺOggOggOggOggOgg,OggOgg=OggOgg-OggOggOggE,Ogg OggFOgg OggGOggOggOggmOggOgg_Ogg;  You see here 6 stones.OggOgg _OggOggOggBOggOgg,OggMOgg8Ogg,OggfOgggOgg,OggOggOgg,OggqOggzOgg,OggOgg)BOggOggOggF,OggOggOgg,OggOggOgg,OggOggOggv,OggsOggOggOggOggOggOggZ,Ogg/Ogg Ogg ,OggOggOgg-,Ogg&OggOgg,OggOggOggOggOggOgg)XOggC*OggN,Ogg,OggG-Ogg/Ogg1Oggt2Ogg2Ogg4Ogg6,Ogg7Ogg9Ogg#;OggS;Ogg+<Ogg4>Ogg.?OggU?Ogg?Ogg@Ogg9A,OggyAOgg1BOggBOgg C,OggCOggDOgg.DOgg_DOggDOgg{EOggEOggEOggMGOgg)I,OggXJOggLOggNOgg>NOgg4OOggPOggROgg SOgg(TOggVOgg9X,OggiYOgg[Ogg],OggR^OggK_Ogg_,Oggb`OggdOggeOggfOgg.gOgghOggjOgg4jOggjOgglOggmOgg7nOggnOggp@  There is an open door here.OggoqOggq _Ogg#rOggrOggs,OggsOggtOgguOgguOggvOgg$xOgg z,OggzOgg |Ogg},Ogg&~OggrOgg}OggOggOggŌOgg#,OggOgg'OggOggԒOgg OggXOggOgg/OggOggÚOgg8,OggќOggOgg],OggҢOggަOggm,Ogg Ogg!@  There is an open door here.Ogg1Oggv _OggOggٮOggt,Ogg˯OggOggM,OggOggOgg,OggOgg]Oggû,OggOggٿOggOggkOgg OgguOgg,Ogg=OggOggOggOggxOggOgg2,OggOggOgg,OggOggOgg,OggzOggOggV,OggtOggOggOggOgg9OggOgg,OggGOgg Ogg`,Ogg OggOgg,OggOggOgg,Ogg Ogg1Ogg,OggbOggOgg,OggOggvOgg>,Ogg,Oggi,OggOggOggh,OggOggOgg ,OggB Ogg`Ogg,OggkOggOgg,Ogg[OggDOgg*,OggOggZOggOggLOggOggMOgg|,OggOgg$OggV,OggOgg Ogg",Ogg$Ogg5'Ogg/),Ogg)Ogg*Ogg.,,Ogg,Ogg.Ogg /,Ogg/Ogg2Ogg3,Ogg4Ogg6Ogg8,Ogg"9Ogg9Ogg:,Oggu;Ogg<Oggt>,Ogg|?Ogg@OggEBOggBOggCOggDOgg`F,Ogg6GOggHOggmI,OggIOggKOggLOgg-LOggLOggNMOgg5NOgg]NOggNOggJQOggROggROggSOggTOggUOggVOgghVOggXOggX,Ogg\YOggYOgg\Z,OggZOgg[Ogg4\,Ogg{\Ogg^Ogg_Ogg_Ogg`OggbOggdOgg>dOggdOgg~fOggg,OggRhOgg|iOggk,OggkOgglOggcnOggnOgg:oOggpOgg@rOggurOggAsOgg+uOggw,OggwOggDyOggMz,OggzOgg |Ogg}Ogg\~OggOggOgg,OggOggOgg ,OggBOggOgg?,OggOggܑOggOgg^OggOggOggOgg՚OggOggOggʠ,Ogg1OggOggͥ,Ogg`Ogg9OggũOggOgglOggOgg6,OggOgg Ogg]OggOggOggOggiBOggOggOggǺOggOggTOgg'OggIOggxOggѾOggf,OggOggOgg,OggOggOgg,Ogg(OgguOgg,OggOggOggGOggOgglOggOgg,Ogg#OggOggOggOggOggOgg,OggOggOgg,OggOggd  You see here an adder skeleton.OgglOgg  _OggOggOggWOggOggOggOgg,OggOggOggOggOgg-OggOggOggOggOggNOgg Ogg( Ogg Ogg Ogg OggZOggOggOggOggOggOgg8OggOgg4Ogg4OggOgg!OggR!Ogg_"Ogg$Ogg',Oggp(Ogg+Ogg-,Ogg,/Oggw1Ogg/3,Ogg3Ogg6Ogg 7OggG7Ogg7Ogg9Ogg :,Ogg:Ogg;Ogg<,Ogg8?Ogg]AOggB,OggdCOggDOggL.######.#.########  ...........(......  #######.#.######## ##  .................. .g  #######.###########.  ......#....# ..  ......#.##.# .#  ......[.##.######.#   #.......##......@.#  #.......###########  ...........   #.#.....###   ..#.....#   #######.#    g   gnoll (polearm, asleep) # #..       OggVT 766.0 (195.0)  A gnoll comes into view. It is wielding a +0 spear.OggYl.gg)Ogg-Z6===76Ogg$_OggSd< _The gnoll shouts! You hear a shout! x2Ogg]-#....#.#.#  ######.#.########  ..........(......  ######.#.######## ## ................. .. ######.###########g #....# #..  #.##.# #.#  .....[.##.######@#  .##........#  ########### ..........  .#.....### .#.....#  #Ogg4h#####.#  #..  Ogg,Ogg~U.gOggX;---8.0)OggHOggOgg...#.#÷....#.#.# ######.#.######## ..........(...... ######.#.######## ### ................. ..g ######.###########.#..g.#Ogg j#.##.# [.##.######........###########.........##g 2 gnolls (1 polearm, 1 wandering) .#.... ######.##..Ogg   A gnoll comes into view. It is wielding a +0 whip.OggOgg~} ggg   gnoll sergeant (polearm)gg 2 gnolls (1 polearm)  The gnoll shouts!  A gnoll sergeant comes into view. It is wielding a +0 trident.Ogg\^0-===9OggOggع9 _The gnoll hits you with a +0 spear.OggOggхOgg8jg.gOgg7--70.1 (1.1OggOgg5 _You closely miss the gnoll. The gnoll closely misses you.OggWOggcYOggdf.ggOggeG--10OggnOggrw _You barely miss the gnoll. The gnoll hits you but does no damage.Oggh 4Ogg Oggș F _Unknown command.OggfWp#....#. ######.#.######## ..........(...... ######.#.######## ### ................. ... ######.###########g# .....#....# #.gg#### [.##.#####..##.......########... #.....### ######   gnoll ( #..Ogg]Ogg_OggBhQggOggh%-OggBi2 _Ogg`rOgg~.######.#.######## ...........(...... #######.#.######## ### .................. ... #######.###########g# ......#....# #.gg# .#.##.# #.#  Ogg.[.##.######.# #.......##......@.# #.########### ....  #.#.....### .#.....#  #######.#  #..  OggOgg0.Oggf1=-3OggwOggOgg 4Ogg Ogg; Ogg #.######.#.# .(...... #.#.# ### . ... .#.###.# .#....# #.gg# .#.##.# #.# .[.##.######.# #.##.# #.## #. .#.#.....### Ogg .#.....# .#.#  ## #..        Ogg OggJ &4Ogg Ogg Ogg1I#.######.#.# #.(...... #.#.# ### . ... .#.#.# .#....# #.gg# #.#.##.# #.# Ogg2#.[.##.######.# #.##.#  ##.## #. .#.#.....### ⌠...#.....#.#.## #.. Ogg`7Ogg`@gg   gnoll sergeant (polearm)5OggOgg5 Ogg`m#.######.#.# .#.(...... .#.#.# ###. ....#.#.#.#....# #.gg# .#.#.##.# #.# ##.[.##.######g##.##.# # ##.###. ...#.#.....### .⌠...#.....#.#.# #### #.. ##OggYnOggrOggctOggE}ggg   gnoll (polearm)Ogg}&6OggOgg Ogg@#.######.#.# ..#.(...... ..#.#.# ### #. ... #...#.#.# #.#....# #.gg# ..#.#.##.# #.##.[.##.######g# .####.##..@...g.# .# ##.#OggF# .###. ....#.#.....### ..⌠...#.....#.#.# .#### #.. .# .#OggOggOgg.gg=7OggOggOgggOgg/Ogggg.g 2 gnolls (1 polearm)Ogg2&8OggOggcOgge. Ogg)0 Ogg; T.gOgg< .=9OggG OggM T _The gnoll sergeant misses you.OggA .######.#.# #.(...... #.#.# ### . ... ...#.#.# .#....# #.gg# #.#.##.# #.# .[.##.######.# ####.OggH ##...@ggg.# # ##.## ###. #.# #### #.. ##Ogg/ Ogg '80Ogg Ogg c _The gnoll hits you but does no damage. You block the gnoll sergeant's attack.Ogg X  You slash the gnoll sergeant!  The gnoll sergeant is moderately wounded.The gnoll hits you from afar with a +0 spear.58--1.3 (1.2Oggv Ogg [ _The gnoll sergeant barely misses you.Ogg~  You hit the gnoll sergeant.  The gnoll sergeant is heavily wounded.OggSf9=-2.4 (1.1OggOgg>c _The gnoll hits you but does no damage. You block the gnoll sergeant's attack.Ogg  You closely miss the gnoll sergeant.The gnoll sergeant is heavily wounded.Oggp(3.5Ogg Ogg _The gnoll hits you but does no damage. The gnoll sergeant barely misses you.OggG  You barely miss the gnoll sergeant.The gnoll sergeant is heavily wounded.The gnoll hits you from afar with a +0 spear.OggLH[8-4.7 (1.2OggROgg|V< _You block the gnoll sergeant's attack.Ogg  You slash the gnoll sergeant!  The gnoll sergeant is almost dead.Oggc9==5.8 (1.1OggOOgg| r _The gnoll misses you. You block the gnoll sergeant's attack.Ogg  The gnoll sergeant blocks your attack.  The gnoll sergeant is almost dead.The gnoll barely misses you.Ogg d2----60Ogge Ogg D _The gnoll sergeant hits you with a +0 trident!OggȞThe gnoll barely misses you. _The gnoll sergeant hits you with a +0 trident!  You hit the gnoll sergeant but do no damage.closely misses you.  but does no damage.OggG-7.9 (1.1OggܨOggR _The gnoll barely misses you.Ogg ?  but does no damage. _The gnoll barely misses you.  The gnoll sergeant blocks your attack.  The gnoll sergeant is almost dead.with a +0 trident!  You block the gnoll's attack.Ogg"|43-------=9.1 (1.2Ogg,Ogg0E _The gnoll sergeant hits you but does no damage.OgghU  You barely miss the gnoll sergeant.The gnoll sergeant is almost dead.The gnoll barely misses you.0------90.2 (1.1OggOggD _The gnoll sergeant hits you with a +0 trident.Ogg  You closely miss the gnoll sergeant.The gnoll sergeant is almost dead.Ogg!-OggL&1.4 (1.2OggOggr _The gnoll misses you. You block the gnoll sergeant's attack.Oggp  You hit the gnoll sergeant.  The gnoll sergeant is almost dead.1=2.5 (1.1Ogg;z Ogg~ _The gnoll hits you but does no damage. The gnoll sergeant closely misses you.Ogg*G  You barely miss the gnoll sergeant.The gnoll sergeant is almost dead.The gnoll hits you from afar with a +0 spear.OggG @34---OggH %30OggnT OggX D _The gnoll sergeant hits you with a +0 trident.Ogg  You completely miss the gnoll sergeant.The gnoll sergeant is almost dead.4.6 (1.1Ogg Ogg:c _The gnoll hits you but does no damage. You block the gnoll sergeant's attack.Oggނ  The gnoll sergeant blocks your attack.  The gnoll sergeant is almost dead.Ogg`5---5.7OggOgg5y _The gnoll barely misses you. You block the gnoll sergeant's attack.Oggԃ  You hit the gnoll sergeant but do no damage.The gnoll sergeant is almost dead.Ogg(6.8OggOggp} _The gnoll completely misses you. You block the gnoll sergeant's attack.Ogg @  You hit the gnoll sergeant.Ogg. )gg 2 gnolls (1 polearm)  You kill the gnoll sergeant!Oggh2 6538.0 (1.2Ogg= Ogg@ y _The gnoll barely misses you. The gnoll hits you but does no damage.Ogg >.######.#.# #.(...... #.#.# ###  ... #.#.# #....# #.gg# #.#.##.# #.# .[.##.######.# .##....@gg.#  ##.Ogg ## . #.# Ogg Ogg b6=90OggO Ogg _The gnoll barely misses you.Things that are here: _a +0 trident; a +0 ring mail; a +0 bucklerOggŵ  You slash the gnoll!  The gnoll is heavily wounded.Oggg/800.1 (1.1Ogg]Ogg< _The gnoll hits you but does no damage.Ogg57  You hit the gnoll.Ogg@9OggBY.   gnollOggF041.2OggNOggP OggQ;_You kill the gnoll!Ogg"\  You hit the gnoll.  The gnoll is lightly wounded.OggV7=2.3OggPOggS _The gnoll closely misses you.Oggy  You hit the gnoll.  The gnoll is heavily wounded.3.5 (1.2OggOgg< _The gnoll hits you but does no damage.Ogg& 9  You slash the gnoll!Oggg1 C)Ogg5 =6=4.6 (1.1Ogg< Ogg1? I _You kill the gnoll!Ogg .######.#.#  .(......  .#.# ###   ...  .#.#.#  #....# #.gg#  .#.##.# #.#  .[.##.######.# Ogg  .##....)@..#  ##.##  #.  .#.#.....###  ...#.....#  .#.#    #..       Ogg Ogg 5--50Ogg| OggF  Things that are here: _a +0 whip; a +0 spear; a gnoll corpseOggq.######.#.#  (......  .#.# ###   ...  #.###.#  #....# #..g#  #.##.# #.#  Oggq([.##.######.#  #.##....))@.#  #.##  .  #.#.....###  #.....#  #Oggr.#  # #..    Ogg{Ogg}d8--6 _OggτOggOggw #.######.#.# .(...... #.#.# ### . ... .#.###.# .#....# #..g# .#.##.# #.# .[.##.######.# #.##....)@..# #.## #. .#.#.....### .#.....# .#.# # #..   Ogg<7Ogg Ogg  Things that are here: _a +0 whip; a +0 spear; a gnoll corpseOggo#.######.#.# #.(...... #.#.# ###OggN . ... .#.#.# .#....# #..g# #.#.##.# #.# #.[.##.######.# #Ogg6.##....@)..#  ##.## #. .#.#.....### Oggi⌠...#.....#.#.#Oggd# #.. OggOgg)$8 Ogg^ _OggTOgg  Things that are here: _a +0 whip; a +0 spear; a gnoll corpse _a +0 trident; a +0 ring mail; a +0 bucklerOggɜo[?25h[?0c  Search for what [Enter for "long b", or ? for help]? Ogg w [?25l[?1cOggROgg13 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] OggLzResults at your position ([,] to cycle)  a - [carried] A - a +0 pair of boots (worn)  b - [carried] b - a +0 scale mail (worn)  c - [carried] l - a +0 kite shield (worn)  d - [carried] w - a +2 cloak of stealth (worn)  e - [right here] a +0 buckler (1 further duplicate)  f - [right here] a +0 ring mail Results elsewhere ([,] to cycle)  g - [D:5] a +0 leather armour (3 further duplicates)Oggh - [D:5] a +0 robe (4 further duplicates)  i - [D:4] a robe  j - [D:3] a leather armour (1 further duplicate)  k - [D:3] a scale mail (1 further duplicate)  l - [D:1] a +0 chain mail  m - [D:1] a +0 scale mailOgg Level 1 of the Dungeon<>>>_(Press ? for help) ######### ####### #.......# #.....# #.#####.# #.....######.#...#.### #################### ########....................# #.......######### #.........# #......#.....#)####.#>).#.#.# #.#####.........#####.#######.# #.####..........###.#####.#.# #.# #..####.............# #.# #.......##.#.....##.......#.## #.#####..# #.....####.###.###.# #.###...##.##...###########..## #.#......# ##...## #.........# #.# #......###.## ##...## ##.#.###.## ##.## #####[##### #.###...#### #.###.....###........# #.###.# #..Ogg Q.....######.# #.......##........# #.##..# ###..............## ##.....###.##.##..# ##'###.## #.......#######...####...####.##.##..# ##...## #.# #.###.#.# ##.....# #####.####.....#.#.####.....## #.##.# #...# ##....### ##.###.# #..#...##.#.##.......## ##.###.###...####.....#≈######...##.###.###..###<#..........####...###.##.......'.....#≈≈≈##..............##©##©#.#.........+.......##>###...####.....###≈≈#.....######.#..#####.#..........####...###.......## ##......#≈≈#.##.##### #.#...#####.##.......## #.....#####......# ##......≈≈..#### #≈###......##.##.##.....## #......##.#.##.######.....≈≈~## ##≈##.......##..#####...## #......##.#.##.#..........~~..#####.~.#.#.....##...## ##'## ##...#.#Oggu' Ogg/( Ogg8+ deadiverson the CarverHuman of the Shining One ......Health: 38/61 ==============----------Magic: 8/8========================AC: 11Str: 17EV: 12Int: 11SH: 9Dex: 12XL:  8 Next: 56% Place: Dungeon:5Ogg+ Time: _a +0 whip; a +0 spear; a gnoll corpseThings that are here: _a +0 whip; a +0 spear; a gnoll corpseThings that are here: _a +0 trident; a +0 ring mail; a +0 buckler  Search for what [Enter for "long b", or ? for help]? armorOgg- Ogg- Ogg>/ Ogg8 Ogg; q9= _OggaC ,OggC ,OggE OggMI OggL ,Ogg+N OggR Ogg}V OggV M40=OggXY OggY] Ogg` ,Ogg]b Oggf Oggj ,Oggk Ogg o Oggr ,Oggv Ogg8z Ogg1 ...................# ..........<#.#.#.#.# #..#.........#.#÷#.# #....####.#....#.#.# #.##.####.######.#.######## .......#............(...... Ogg #.##...#########.#.######## ### #.#..#...........g......... ... #.#.##...#######@###########.#Noise: --------- #.#.##.........#....# #..g#a) +0 long sword #.#....#.......#.##.# #.#Throw: throwing net #....###.......[.##.######.# Ogg ###...####.......##....[)..##.⌠.# ##.......###########g   gnoll (wandering) ###...###........... Ogg .........#.#.....### .⌠..>..⌠...#.....#Ogg!  g4815.6 (7.0)g  A gnoll comes into view. It is wielding a +0 club.Ogg i1==6.6 (8Ogg Ogg 3 _You block the gnoll's attack.Ogg  You hit the gnoll.  The gnoll is moderately wounded.Ogg+7.6 (1Ogg'Ogg*3 _You block the gnoll's attack.OggJR  You hit the gnoll.  The gnoll is severely wounded.OggR -8.8 (1.2Ogg^ Oggb S _The gnoll closely misses you.Ogg 9  You slash the gnoll!Ogg C)Oggy _2=720.0Ogg Oggf I _You kill the gnoll!Oggw OggZ Ogg OggH _No target in view!Ogg OggOgg#Ogg%H _No target in view!OggXOggYWhere to? (Tab - D:1 @ (x,y), ? - help)  D - Dungeon  T - Temple Ogge Ogg ...................#deadiverson the Carver ..........<#.#.#.#.#Human of the Shining One ...... #..#.........#.#÷#.#Health: 42/61 ================-------- #....####.#....#.#.#Magic: 8/8======================== #.##.####.######.#.########AC: 11Str: 17 .......#............(......EV: 12Int: 11 #.##...#########.#.######## ### SH: 9Dex: 12 #.#..#...........)......... ...XL:  8 Next: 57% Place: Dungeon:5 #.#.##...#######@###########.#Noise: =--------  Time: 4820.0 (0.0) #.#.##.........#....# #..g#a) gg ^;10;1m+0 long sword #.#....#.......#.##.# #.#Throw: throwing net #....###.......[.##.######.# ###...####.......##....[)..##.⌠.# ##.......########### ###...###........... .........#.#.....### .⌠..>..⌠...#.....#The gnoll is severely wounded. _The gnoll closely misses you.You slash the gnoll! _You kill the gnoll! _No target in view! _No target in view!Oggf Ogg Ogg Ogg%  _#..#### #.#.#...........################### ......... ..........<#.#.#.........#.#÷#.# #....####.#....#.#g# ####. .......#...( #...##. ###-.#...........)......... ...##...#######.###########.# #.#.##.........#....# #..g# #.#....#.......#.##.# #.#.#g   gnoll (wandering)........Oggf. +1.0 (1Ogg. !-Ogg/ $2.0 (2OggC8 Ogg? s _A gnoll comes into view. It is wielding a +0 flail.OggOgghOggOggF _Unknown command.Ogg,.....# #.#.#.#########.# #### #.#.#...........# #########.#.#.###########........# .........<#.#.#.#.# ..#.........#.#÷#.# ....####.#....#.#g# ##.####.######.#.######## ......#.........@..(...... .##...#########.#.######## ### .#..#...........)......... ... .#.##...#######.###########.# .#.##...#....# #..g# .#....#.#.##.# #.# ....###.......[.##.######.# ##...####.......##....[)..#OggV-  #.⌠.# ###########Ogg%1Ogg8i.ggOgg89R3====3.0 (1Ogg?OggB' _The gnoll shouts!OggW 1=---4Ogg` Oggc x _You completely miss the gnoll. The gnoll hits you with a +0 flail.Ogg  You hit the gnoll.  The gnoll is moderately wounded.Ogg> y36-----5.1 (1.1OggH Ogg( 9 _The gnoll hits you with a +0 flail.Ogg  You barely miss the gnoll.The gnoll is moderately wounded.OggN_7--6.2Oggl _The gnoll completely misses you.Ogg  You barely miss the gnoll.The gnoll is moderately wounded.Ogg-7.4 (1.2OggOgg(K _The gnoll misses you.OggD1  You barely miss the gnoll.The gnoll is moderately wounded.Ogg1c4-8.5 (1.1Ogg:OggB=9 _The gnoll hits you with a +0 flail.Oggp  You hit the gnoll.  The gnoll is heavily wounded.Oggzqo28---90OggzOgg9}9 _The gnoll hits you with a +0 flail!Ogg4OggxOgg^ _You are too injured to fight recklessly!Ogg 4Ogg Ogg ^ _You are too injured to fight recklessly!Ogg+@4OggOJOggJM^ _You are too injured to fight recklessly!OggEK _The gnoll hits you with a +0 flail! _You are too injured to fight recklessly! _You are too injured to fight recklessly!  You hit the gnoll.  The gnoll is heavily wounded.Ogg.30.7 (1.2OggOgg*S _The gnoll closely misses you.Ogg  You hit the gnoll but do no damage.The gnoll is heavily wounded.10Oggl Ogg1R _The gnoll barely misses you.Ogg{9  You slash the gnoll!Ogg1)Oggl9--82.8 (1.1OggOggI _You kill the gnoll!OggX ?###.# #.#...........#.# ..# #.#.#.#########.# #### #.#.#...........# #########.#.#.###########........# ......<#.#.#.#.# #.........#.#÷#.# ..####.#....#.#.# ##.####.######.#@######## ....#............(...... ##...#########.#.######## ### #..#...........)......... ... #.##...#######.###########.# #.##...#....# #..g# #....#.#.##.# #.# ...###.......[.##.######.# #...####.##....[)..#-30OggR OggQ N _You see here a +0 flail.OggOggEOgguOggOggOggGOggOggTOgg330Ogg!Oggd%,OggO&Ogg^)Ogg)OggZ+Ogg0OggP1Ogg!3Ogg6Ogg- 1=-gg   gnoll (wandering) _You start resting.OggOgg +8.8 (5OggK +9.8 (6OggNOgg}r _A gnoll comes into view. It is wielding a +0 whip.Ogg* .....# #.#.#.#########.##### #.#.#...........# ..#########.#.#.########### ..................# <#.#.#.#.#OggQ v#.........#.#÷#.#...####.#....#.#.###.####.######.#)######## ......#.........@..(...... .##...#########.#.######## ### .#..#........g..)......... ... .#.##...#######.###########.# .#.##.........#....# #..g# .#....#.#.##.# #.# ....###.[.##.######.# ##...####.......##....[)..#  #.⌠.# ##.###########Oggά Ogg e.ggOggu K====40.8 (1Oggf Ogg6 ' _The gnoll shouts!Oggq #..#### #.#.#...........#.#########.#.#.###########.................# <#.#.#.#.# #..#.........#.#÷#.# #....####.#....#.#.# #.##.####.######.#)######## .......#............(...... #.##...#########@#.######## ### #.#..#.........g.)......... ... #.#.##...#######.###########.# OggF #.#.##.........#....# #..g# #.#....#.#.##.# #.# #....###.[.##.######.# ###...####.......##....[)..#  #.⌠.# ##.......########### ###...#....Ogg Ogg| 29-=---1Ogg N _The gnoll hits you with a +0 whip.OggCOggC:---OggLOggO^ _You are too injured to fight recklessly!Oggw  You hit the gnoll.  The gnoll is moderately wounded.Oggd30-2.9 (1.1OggOgg3 _You block the gnoll's attack.OggaZ  You hit the gnoll.  The gnoll is heavily wounded.Ogg[(4.0OggdOgggz _The gnoll hits you but does no damage. The gnoll closely misses you.Ogg  You hit the gnoll.  The gnoll is severely wounded.Ogg7-5.2 (1.2OggOggr3 _You block the gnoll's attack.Ogg  You barely miss the gnoll.The gnoll is severely wounded.Ogg: ,60Ogg Ogg 8 _The gnoll hits you with a +0 whip.Oggj 9  You slash the gnoll!Oggv D)Oggz 597.3 (1.1Oggo _ _You kill the gnoll!Ogga....#########.#.#.###########.................# <#.#.#.#.# ##..#.........#.#÷#.# .#....####.#....#.#.##.##.####.######.#)######## ........#............(...... .#.##...#########.#.######## ### .#.#..#.........@.)......... ... .#.#.##...#######.###########.# .#.#.##.........#....# #..g# .#.#....#.#.##.# #.##....###.[.##.######.# ####...####.......##....[)..# # #.⌠.# ##.......########### ####...#...............#.#.....###-80OggOgg+  Things that are here: Ogga_a +0 whip; a gnoll corpseOgg^OggWhere to? (Tab - D:1 @ (x,y), ? - help)  D - Dungeon  T - Temple Ogg Ogg ....#########.#.#.###########deadiverson the Carver ....................#Human of the Shining One ...... ...........<#.#.#.#.#Health: 30/61 ===========------------- ##..#.........#.#÷#.#Magic: 8/8======================== .#....####.#....#.#.#AC: 11Str: 17 ##.##.####.######.#)########EV: 12Int: 11 ........#............(......SH: 9Dex: 12 .#.##...#########.#.######## ### XL:  8 Next: 59% Place: Dungeon:5 .#.#..#.........@.)......... ... Noise: ---------  Time: 4848.3 (0.0) .#.#.##...#######.###########.#OggE [33ma) +0 long sword .#.#.##.........#....# #..g#Throw: throwing net .#.#....#.......#.##.# #.# ##....###.......[.##.######.# ####...####.......##....[)..# # #.⌠.# ##.......########### ####...###........... #.........#.#.....###The gnoll is severely wounded. _The gnoll hits you with a +0 whip.  You slash the gnoll! _You kill the gnoll!Things that are here: _a +0 whip; a gnoll corpseOgg Ogg Ogg p1= _OggK Ogg Ogg OggS Ogg> Ogg ,Ogg Ogg Ogg a2=Ogg Ogg Ogg Ogg Ogg Ogg) Ogg Ogg Ogg Ogg Ogg Ogg OggU Ogg Ogg: Ogg 93Ogg BOgg Oggq Ogg Ogg Ogg> Oggp Ogg Oggl Ogg L4=Ogg Ogg~  Ogg Q There is a stone staircase leading up here.Ogg ! Ogg2% Ogg% $ _Ogg$' Ogg W4=Ogg Ogge Ogg6 Ogg ' l _You climb upwards.  There is a stone staircase leading down here.Ogg( Oggq) @5 _Ogg* Ogg/ Ogg1 ,Ogg2 Ogg7 OggX8 Ogg8 Ogg29 Ogg> Ogg? Oggc@ S6=OggA OggXG OggH OggWI OggO Ogg_S OggT ,OggV OggZ Ogg\ ,Ogg@^ Oggc Oggf a7=Oggg Oggl Oggm Ogg n Ogg5p OggWs Oggt Oggt OggUu Ogg~y Oggz Ogg{ 98Ogg{ OggU Ogg& OggӀ ,Ogg Ogg~ Oggޅ ,Ogg: OggV Ogg S9=Ogg Ogg܎ Ogg ,Ogg Ogg Ogg ,Oggܖ Oggl Ogg Ogg Ogg Ogg Ogg Ogg7 L40=Ogg Ogg Oggq ,Ogg Ogge Ogg ,Ogg Ogg Oggɴ i1=Ogg Ogg Ogg ,Ogg Ogg Ogg ,Ogg@ Ogg Ogg OggA K2=Ogg Oggq Ogg5 Ogg Oggm Ogg; Ogg ,Ogg OggF Ogg ,Ogg Ogg Ogg Ogg 93Ogg Ogg Ogg5 ,Ogg Ogg Ogg ,Ogg[ Ogg) Ogg7 N44=Ogg Ogg! Ogg Ogg ,Ogg Ogg Ogg; ,Ogg: Oggp Ogg m5=Ogg Ogg Ogg ,Oggs Ogg Ogg2 Oggh OggZ Ogg %  Ogg +There is a stone staircase leading up here.Ogg| Ogg  _Ogg Oggj Ogg Ogg K6=Ogg Ogg: Ogg Ogg Ogg Ogg  Ogg ,Ogg  OggI Ogg Ogg U7=Ogg  OggE Ogg ,Ogg OggI Ogg ,OggB Ogg" Ogg# OggM$ %8Ogg"% OggD' Ogg( ,Ogg) Ogg, W  There is a stone staircase leading up here.OggX- Ogg. Ogg/ $ _Ogg0 Ogg3Ogg Ogg#OggK9=OggJOgg-$l _You climb upwards.  There is a stone staircase leading down here.Ogg&Ogg& _Ogg'Ogg)Oggt,,Ogg=-Ogg/Ogg.1Ogg|1V50=Ogg 2OggQ3OggV5,Ogg5Ogg6Ogg7,OggV8Ogg9Oggg;,Ogg;Oggv=Ogg?OggK?K1=Ogg?OggD>There is a stone staircase leading up here.up _You climb upwards.down here.  Things that are here:  a jackal skeleton; a jackal skeleton; a jackal skeletonOggFOgg,G _OggGOgg7IOggJ,OggJOggMW  There is a stone staircase leading up here.OggNOggOOggtP\2= _OggPOgg2OggOgg ,Ogg#Ogg0l _You climb upwards.  There is a stone staircase leading down here.Ogg[55 _Ogg7Ogg :Ogg;Ogg <%3Ogg>OggBOgg,Ogg?Oggb Ogg; ,OggOgg  Things that are here:  a +0 dagger; a goblin skeletonOggOggnR4= _OggOggy#Ogg%,Ogg'Ogg$+Ogg1.,Ogg[0OggX6  Things that are here:  a +0 dagger; a goblin skeletonOgg8OggJ9 _Ogg:Ogg=Ogg@Ogg\@U5=OggAOggCOggE,OggFOggHOggYK,OggMOggPOggSOggTK6=Ogg6VOggcXOggj[Ogg[OggM]Ogg2`Oggb,OggcOgg0fW  There is a stone staircase leading up here.OggWhOgg kOggkOgglU7= _OggZnOggDd 1  You climb upwards.OggG,OggKHOggW _Level annotation: 1 transporterThere is a stone staircase leading down here.OggMYOggY _OggZOgg5_Ogg{`Ogg`%8OggaOggeOgggOgghOgg&iOggXmOgginOggnOggoOgg tOgg/uOgguK9=OggvOggZzOgg{,Ogg{Ogg}Ogg~,OggwOggOggɂ,OggOggOggOggV60=OggƉOggɍOgg.,OggSOggOgg,OggGOggOggךa1=OggOggh1 _HP restored.Ogg3OggxOgghOggOgg0OggOggǨOggOgg;OggөOggլOggO=OggOgg.OggC,OggOggaOggOgg)OggOggOgg,OggcOggTOggG,OggOggOgg,OggCOggOgg|,OggOggyOgg,OggGOggOgg,OggOggpOgg,OggeOgg6Ogg6OggqOggOggJOggOggOggOggOgg,OggOggOgg4,OggOggOggb,OggOggOgg9,OggOggOggCBOggOggt,OggOggOggP,OggOggOggG,OggOgg9OggOgg@OggOggOggi,OggOgg}Ogg|,OggOggOggOggOggOggOgg,OggOggUOgg,OggvOggOOgg Ogg OggD Ogg OggDOggOggtOggVOggOgg`Ogg_OggOgg,OggOggOggv",Ogg$Ogg-&Ogg',Ogg'Oggh)Ogg#1Ogg7:     ########### ###### #.........# .......#####.#######.# Ogg8##.............# #.#  # ####.###.###.#  # ##...## #.........#  # ##.## #####@#####  987.3 (139.0)  #.# ##.#   #.# #..#   ##'## #.##   ##...## #.#  .....## #.#    ##.......## ##.##    Ogg.9..........####...##   +..   Ogg9Ogg>OggbAS _You see here a +0 chain mail.Oggp$ Ogg} 18.0)Ogg} Oggۄ ) _B - a +0 chain mailOggOggWear which item? Armour (go to first with [) Ogg8' b - a +0 scale mail (worn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)B - a +0 chain mail[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip OgggOgglOggq)  deadiverson the Carver  Human of the Shining One ......###########  Health: 61/61 ======================== ######## #.........#  Magic: 8/8======================== .......#####.#######.#  AC: 11Str: 17 Oggq####.............# #.#  EV: 12Int: 11 # #.....####.###.###.#  SH: 9Dex: 12 # ##...## #.........#  XL:  8 Next: 59% Place: Dungeon:1 # ##.## #####@#####  Noise: ---------  Time: 4988.3 (0.0)#.###.#  a) +0 long sword#.##..#  Throw: throwing net##'###.## ##...## #.# ###.....## #.# Oggr  ##.......## ##.##   ..........####...##   #.........+.......#  You climb upwards. _Level annotation: 1 transporter _There is a stone staircase leading down here. _HP restored. _You see here a +0 chain mail. _B - a +0 chain mailOgguOggv+9.3 (1OggxOgg}d  You start removing your armour.Ogg~,90.3 (2OggoOgghOgg͇+1.3 (3OggGOgg}OggՏ+2.3 (4OggޒOggOgg+3.3 (5OggpOgg[  43 _You continue removing your +0 scale mail. x4OggOggOgg&  You finish removing your +0 scale mail.  You start putting on your armour.Ogg+4.3 (6Ogg#OggAOgg+5.3 (7OggOggDOgg+6.3 (8OggOggOgg+7.3 (9OggQOggCOgg/8.3 (10.0)OggOgg.- 13Oggf^0 _You continue putting on your +0 chain mail. x5Ogg߿OggOgg%_ _You finish putting on your +0 chain mail.Ogg Ogg Ogg Ogg_ F _Unknown command.Oggw;OggDrop what?28/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 long sword (weapon) Missiles (select all with ()f - 3 poisoned darts  j - a throwing net (quivered) Armour (select all with [)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Ogg B - a +0 chain mail (worn)b - a +0 scale mail Jewellery (select all with "=)  p - a +5 ring of evasion (left hand)d - an amulet of faith Wands (select all with /)o - a wand of acid (6)  y - a wand of digging (6) Scrolls (select all with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selectedOgg57[top]Ogg(1 turn)  a - a +0 long sword (weapon)  b + a +0 scale mail[Enter] accept (1 chosen)Ogg Oggl   deadiverson the Carver  Human of the Shining One ......###########  Health: 61/61 ======================== ######## #.........#  Magic: 8/8======================== .......#####.#######.#  AC: 13Str: 17 ####.............# #.#  EV: 10Int: 11 # #.....####.###.###.#  SH: 9Dex: 12 # ##...## #.........#  XL:  8 Next: 59% Place: Dungeon:1 Ogg # ##.## #####@#####  Noise: ---------  Time: 4998.3 (0.0)#.###.#  a) +0 long sword#.##..#  Throw: throwing net##'###.## ##...## #.# ###.....## #.#   ##.......## ##.##   ..........####...##   #.........+.......#   _You continue removing your +0 scale mail. x4  You finish removing your +0 scale mail.  You start putting on your armour. _You continue putting on your +0 chain mail. x5 _You finish putting on your +0 chain mail. _Unknown command.OggN +9.3 (1Ogg Ogg / _You drop a +0 scale mail.Ogg Ogg Put on which piece of jewellery? Jewellery (go to first with "=) Ogg߮  p - a +5 ring of evasion (left hand)d - an amulet of faith[?] describe selected Ogg [!] equip|wield|wear|put on[tab] equip|unequip Ogg+`OggfOggm!  deadiverson the Carver  Human of the Shining One ......###########  Health: 61/61 ======================== ######## #.........#  Magic: 8/8======================== .......#####.#######.#  AC: 13Str: 17 ####.............# #.#  EV: 10Int: 11 # #.....####.###.###.#  SH: 9Dex: 12 # ##...## #.........#  XL:  8 Next: 59% Place: Dungeon:1 # ##.## #####@#####Oggn  Noise: ---------  Time: 4999.3 (0.0)#.###.#  a) +0 long sword#.##..#  Throw: throwing net##'###.## ##...## #.# ###.....## #.#   ##.......## ##.##   ..........####...##   #.........+.......#  You finish removing your +0 scale mail.  You start putting on your armour. _You continue putting on your +0 chain mail. x5 _You finish putting on your +0 chain mail. OggoQ_Unknown command. _You drop a +0 scale mail.OggxOggzReally put on d - an amulet of faith? Y - Yes  N - NoOgg@Ogg4U  deadiverson the Carver  Human of the Shining One ......OggU###########  Health: 61/61 ======================== ######## #.........#  Magic: 8/8======================== .......#####.#######.#  AC: 13Str: 17 ####.............# #.#  EV: 10Int: 11 # #.....####.###.###.#  SH: 9Dex: 12 # ##...## #.........#OggSV  XL:  8 Next: 59% Place: Dungeon:1 # ##.## #####@#####  Noise: ---------  Time: 4999.3 (0.0)#.###.#  a) +0 long sword#.##..#OggV%  Throw: throwing net##'###.## ##...## #.#OggW, ###.....## #.#   ##.......## ##.##   Ogg@X0..........####...##   #.........+.......#  You finish removing your +0 scale mail.  You start putting on your armour. OggeX_You continue putting on your +0 chain mail. x5 _You finish putting on your +0 chain mail. _Unknown command. OggX0_You drop a +0 scale mail.OggbYOgg%^Oggc%  Ogg+dAYou start putting on your amulet.OgghD5000.3 (1OggioA1.3 (2OggqOggtOggu+2.3 (3OggxOgg#|Ogg|+3.3 (4OggOgghOggƃ+4.3 (5OggOggx% Ogg _You continue putting on your amulet of faith. x5  You finish putting on your amulet of faith.  You feel a surge of divine interest.OggtOggјp _d - an amulet of faith (around neck)OggcOggOgg;Ogg%Do ................0OggGOggJ] _Partly explored, unvisited transporter.Ogg[OggOggOggOgg ,Ogg] _Partly explored, unvisited transporter.OggOggX3OggJOgg] _Partly explored, unvisited transporter.Ogg0 Ogg Where to? (Tab - D:1 @ (x,y), ? - help)  D - Dungeon  T - Temple OggKOgg`  deadiverson the Carver  Human of the Shining One ......###########  Health: 61/61 ======================== ######## #.........#  Magic: 8/8======================== .......#####.#######.#  AC: 13Str: 17 ####.............# #.#  EV: 10Int: 11 # #.....####.###.###.#  SH: 9Dex: 12 # ##...## #.........#  XL:  8 Next: 59% Place: Dungeon:1 # ##.## #####@#####Ogga  Noise: ---------  Time: 5004.3 (0.0)#.###.#  a) +0 long sword#.##..#  Throw: throwing net##'###.## ##...## #.# ###.....## #.#   ##.......## ##.##   ..........####...##   #.........+.......#  OggbYou finish putting on your amulet of faith.  You feel a surge of divine interest. _d - an amulet of faith (around neck) _Partly explored, unvisited transporter. _Partly explored, unvisited transporter. _Partly explored, unvisited transporter.OggXcOggdOggqOggrOgg=w: _Ogg yOgg_zOgg|,OggOggE,OggOggOggO,OggOggvOgg]OggOgg+OggeOggOgg Ogg OggOggݟOgg0OggOggOgg,OggOggROggOggOggOggXOgg,OggOgg(OggOgg.OggrOggOggο,Ogg+Ogg1Ogg,OggLOggOgg,OggOggROgg,OggOggOggg,OggOggOggK,OggOgg9Ogg,OggOggQOggcOggOgg1OggXOggOggOgg4OggOgg8 Ogg,OggOggOggOggOggOggOggOgghOggOggOggvOggOgg Ogg"Ogg-$Ogg{$Ogg$OggN(Oggn)Ogg)Ogg*Ogg-Ogg*/,Ogg0OggP3Ogg5Ogg'6Ogg8Ogg,<Ogg>Oggl?OggAOggDOggF,OggrGOggJOggoLOggLOggNOggPOggmQOggQOggROggSOgg`UOggUOgg)VOgg XOgg]YOggYOggOZOgg5\Ogg],Ogg=^OggaOggb,OggcOggjfOggDh,OggiOggkOggl,Ogg-mOggfoOggp,OggqOggsOgg{uOgguOggvOggyOgg{,Ogg|Ogg~~Ogg>,OggOggJOgg ,OggNOggNOgg0,OggOggOgg,OggbOggOggKOggOggOggOgg,OggOggOgg,OggOggo=  You see here a +0 spear.Ogg0Ogg _Ogg֭OggޯY  There is a stone staircase leading down here.Ogg2OggOgg$ _Ogg Oggʠ2OggOggP,OgguOggչ #.##...###................#...##....#...........#.###...#####.#......^.<.##.## #)..####........)..)...... #...##[.......#.#<##.##>## #[.....###......#.##.##.## Oggκ#...#### #...#....##.##.#. #...# ##......#.##.##.#. #...# ##@.#.÷.##.##.##.#.56.8 (52.5) ###...# ##..##....#.##.##.#. #....####..###......##.##... #.#.###...####..#......##..# #.#.# #.###.........#......# #.#.###.##........[.....÷.## #.#.#...#............#.#÷.## #.#.#.###...........##.#.... OggE#.#.#.# #...........##.##.#. _You climb downwards.OggʻOggOgg&a _There is a stone staircase leading up here.Ogg Ogg Ogg Oggװ ,0.0)Ogg Ogg Oggt E _Done exploring.Ogg3OggTOgg94Ogg/DOgg-FE _Done exploring.Ogg2OggOgg&Ogg184Oggj?OggAE _Done exploring.OggL5Ogg6Where to? (Tab - D:2, ? - help)  D - Dungeon  T - Temple Ogg}q Oggu :#.##...###................ deadiverson the Carver#...##....#...........#.## Human of the Shining One ......OggB *#...#####.#......^.<.##.## Health: 61/61 ========================#)..####........)..)...... Magic: 8/8========================#...##[.......#.#<##.##>## AC: 13Str: 17#[.....###......#.##.##.## EV: 10Int: 11#...#### #...#....##.##.#. SH: 9Dex: 12#...# ##......#.##.##.#. XL:  8 Next: 59% Place: Dungeon:2#...# ##@.#.÷.##.##.##.#. Noise: ---------  Time: 5056.8 (0.0)Oggv ###...# ##..##....#.##.##.#. a) +0 long sword#....####..###......##.##... Throw: throwing netOggΐ #.#.###...####..#......##..##.#.# #.###.........#......##.#.###.##........[.....÷.## #.#.#...#............#.#÷.##Ogg  #.#.#.###...........##.#.... #.#.#.# #...........##.##.#.Ogg" w  _There is a stone staircase leading down here. OggI _You climb downwards. _There is a stone staircase leading up here. _Done exploring. Oggp f_Done exploring. _Done exploring.Ogg" Ogg8 Ogg Ogg Ogg : _Ogg§ Ogg ,Ogg{ OggԱ Ogg Ogg Oggp Ogg Ogg OggA Ogg~ Ogg Ogg ,Ogg Ogg OggV ,Ogg Ogg OggR ,Ogg Ogg &  OggP ZThings that are here:  a +0 dagger; a goblin skeletonOgg Ogg  _Ogg Ogg Ogg Ogg OggB Ogg) Ogg Ogg Ogg Ogg  Things that are here:  a +0 dagger; a goblin skeletonOgg% Ogg  _Ogg? Ogg! Ogg} ,Oggg Ogg Ogg ,Ogg OggI Ogg[ ,Ogg Ogg2 n _ Things that are here: _a +0 dagger; a goblin skeleton Ogg  Things that are here: _a +0 dagger; a goblin skeleton  There is a stone staircase leading down here.Ogg$! Ogg# Ogg9$ $ _Ogg% Ogge 3Ogg/ OggO Ogg OggA OggG   ##### #...# #...# #...# #...########################### #............................... #...##.>..##################....# Ogg=! ##.###...#....÷.@.[#............#73.3 (16.5)  #.# #...#.#########.#######....# ##.####....#...........#...÷.. .....##.#..##...####.#.#.#######. .....##............# #. .....##.............# #. .....##.........# #. ..)..##..........# #) .....##..........# #† _You climb downwards.OggH" Ogg* Ogg, a _There is a stone staircase leading up here.OggqOggOr3OggǏ,0.0)OggOggOggE _Done exploring.Ogg6 OggI Where to? (Tab - D:3, ? - help)  D - Dungeon  T - Temple OggNOggjhdeadiverson the Carver #####Human of the Shining One ...... #...#Health: 61/61 ======================== #...#Magic: 8/8======================== #...#AC: 13Str: 17 #...############################# EV: 10Int: 11 Ogg:i'#................................ SH: 9Dex: 12 #...##.>..##################....# XL:  8 Next: 59% Place: Dungeon:3 ##.###...#....÷.@.[#............# Noise: ---------  Time: 5073.3 (0.0)  #.# #...#.#########.#######....# a) +0 long sword ##.####....#...........#...÷..... Throw: throwing net .....##.#..##...####.#.#.#######. .....##.....................# #. .....##.....................# #.Oggi  .....##.....................# #.  ..)..##.....................# #)  .....##.....................# #† Things that are here: Oggj_a +0 dagger; a goblin skeleton _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here. _Done exploring.Ogg[kOggkOggtOggvOggzf _Ogga{Ogg{Ogg)  Things that are here:  a jackal skeleton; a jackal skeleton; a jackal skeletonOggOgg _Ogg0OggDOgg,OggOgg?OggOggOgg~OggXOgg,Ogg1OggOggOggOgg]Ogg Ogg8OggtOggOggOggOggOggOgg%  Ogg)4There is a stone staircase leading down here.OggߟOggdOgg$ _Ogg٢Ogg";4Ogg#Ogg$Ogg$OggK6   #..##..# ##  #..######## ##.## #  #..##.....## #..##  #..##......####..#  #...........# #..##  #...#.÷.....# ##.. Ogg7 #....## ##  #....###...## #..  #.@..####### ##.84.8 (11.5)  #.....# ##..  #.....## ######..#  #......# #......##  #......## #.......# Ogg_7 #.......###.......  #......÷##........Ogg7{  ##.........###...... Ogg7e #### ###.... Ogg73_You climb downwards.Ogg8Ogg=OggX@a _There is a stone staircase leading up here.OggIOgg,0.0)OggOggv Ogg  E _Done exploring.Ogg_~ Ogg Ogg Ogg Ogg1 OggR Ogg  Ogg 7_Done exploring.Ogg[ Ogg Ogg Ogg\ OggR Ogg [ _Done exploring.OggOggWhere to? (Tab - D:4, ? - help)  D - Dungeon  T - Temple OggLOggZn  #..##..# ## deadiverson the Carver  #..######## ##.## # Human of the Shining One ......  #..##.....## #..## Health: 61/61 ======================== Ogg[ #..##......####..# Magic: 8/8========================  #...........# #..## AC: 13Str: 17  #...#.÷.....# ##..# EV: 10Int: 11  #....#......# ##.. SH: 9Dex: 12  #....###...## #.. XL:  8 Next: 59% Place: Dungeon:4 Ogg\ #.@..####### ##. Noise: ---------  Time: 5084.8 (0.0)  #.....###.. a) +0 long sword  #.....## ######..# Throw: throwing net  #......# #......## Ogg\% #......## #.......#  #.......###........   #......÷##.........   ##.........###......   #........### ###....  _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here. _Done exploring. _Done exploring. _Done exploring.Ogg]Ogg^Ogg oOggpOgg*u: _Oggs{Ogg}Ogg}Oggc~OggكOgg)OggoOggOgg^Ogg7,Ogg֍OggגOgg/OggiOgg0OggOggBOggbi  You see here a ball python skeleton.Ogg+Ogg _OggOggOgg OggLOggޮOggOggOggOggOggOggOgg7OggOggOggQOggOggAOggOggC,OggOggOggOggOggOgg_OggOggOggOggOggBOggOggOgg!OggoOggjOggOgg>OggOggOggNOggOggOggOgg2,Ogg0OggOggOggOgg=OggA Ogg Ogg Ogg OggOggrOggOggOggO>  You see here a +0 dagger.OggOgg _OggOgg!Ogg"Ogg?#Ogg$Ogg'OggZ),Oggd*Oggh-Ogg.Ogg4/Ogg0Ogg:3Ogg4OggQ5OggN6OggK9Ogg:,Ogg<Oggv?OggUA,OggBOggEOggF,OggGOgg}JOgg0LOggLOgg2MOggOOggIQOggQOggGROggUOggsVOggVOggWOggYOggG[Oggo[OggS\Ogg_Ogg=a,OggbOggLgOggJj,OgglOggpOggyt,OggvOggNyOgg{,Ogg}Ogg*OggOggOgg]Ogg!Oggב  There is a stone staircase leading down here.OggxOggOggR$ _OggEOgg I 5  You climb downwards.OggOggOgg,Ogg  Ogg### ### #@# #######.#127.3 (42.5) #.# #.......# #.# ###.##### Ogg#.# #.....# #. ######### #.# #######.### ........# #.# #........##.# #.......# #.# #........##.# #.......### ##.####...... ..........# #.........† Ogg_Level annotation: 1 runed translucent door, Crazy YiufOggaOggOgg;a _There is a stone staircase leading up here.Ogg' Ogg Ogg Ogg Ogg Ogg* : _Ogg OggQ ,Ogg Ogg_ OggC ,Ogg Ogg Ogg Ogg Ogg OggOgg,Ogg_OggOgg,Ogg, Ogg OggM,OggOgggOggOggROggOggOggnOggOgg6OggF"Oggy#Ogg#Ogg~%Ogg8*OggW+Ogg+Ogg+Ogg-/OggE0,Ogg0Ogg3Ogg4,Ogg5Ogg8Oggq9Ogg9,Ogg<Ogg>Ogg[>Ogg>OggZAOggBOgg+COggCOggqFOggGOggGOggKHOggKOggbMOggMOggaNOggMQOggROggSOggSOggVOggXOggHXOggYOgg\Ogg{]Ogg]Ogg~^OggaOggbOggcOgg3dOgggOggi,OggjOggmOggoOggoOggpOggBsOggtOgg=uOgg+vOggzb  You see here a +0 giant club.Oggh|Ogg| _OggIOggOgg΃,OggOgg݇Ogg,OggxOggdOggOggOgg.OggOggʕ,Ogg͖OggLOggz,OggOgg<OggOgg0Ogg-OggOggťOgg OggrOgg6OggyOggOgg/OggOggOgg2OggOggOgg9OggOggHOggOggOgg$OggMOggOggOggOggOggOgg,OggwOggOggOggOggJOggOgg(OggaOggOggOggOggNOggOggOgg0;.#.#..#.........).)......... ... .#.#.##...#######.###########.# Ogg.#.#.##.........#....# #..g# .#.#....#.......#.##.# #.# ##....###.......[.##.######.# ####...####.......##....[)..# Ogg# #.⌠.# ##.......########### ####...###.............. #.........#.#...@.##### 690 #.⌠..>..⌠...#.....# #.........#######.# Ogg2####...#### #..  #.⌠.#  ...  #...# Ogg^S ....  ###..  ..... Oggx#### >..... OggOgg-70.3 (43OggOgg; _Found a stone staircase leading down.OggAOgg;BOggQCOggIOggLOggMOggPOggNSOggVOggVOgg4YOgg*]OggX`Ogg`Ogg+bOggqgOggi,Ogg@kOgg!mOggnOggCoOggoOggqOggjsOggsOgg7tOgguOggywOggwOggxOggyOggu{,OggQ|OggOggOggOggOggOgg%,OggOggdOgg͇Ogg-OggOggSOgg,OggOggOggv,OggOggLR  There is a stone staircase leading down here.Ogg3OggQOggk ###...###....... ........#.#.....##### ⌠..>..⌠...#.....# ........#######.###### ## #......#  #.⌠.# #### #......#  #...# ..... #......# Oggz ###.. ......#......###  #### ......'@........84.3 (14 ......##........ ...(. #......... .... #.#####... ### #......... ########.. _You open the door.OggE _Found 8 stones.OggOggWOggOgg Ogg#Ogg$$ _Ogg(Ogg(@  There is an open door here.Ogg*Oggv+ _Oggp,Oggr0Ogg.2,Ogg^3Ogg5Oggf7,Ogg8Oggm:Ogg&<Ogg<OggN=OggA?OggA,OggJBOggCOggE,OggFOggIOggJ,OggKOgg6LOggL,OggoMOggNOggOOggVOOggOOggPOggEQOggvQOggQOggROggSOgg)TOggTOgg}VOggWOggXOggXOgg{YOggBZOgguZOggZOggh\OggC]Oggv]Ogg]Ogg^Ogg_Ogg_Ogg`Ogg aOggaOggaOgg,Ogg\?Ogg}A@  There is an open door here.OggWCOggC _OggDDOggEOgg!G,OggGOggIOggJJ,OggKOggLOggN,OggQOggDSOgg"U,OggVOggXOgg8[,Ogg\Ogg`Ogg$cOggcOggeOggiOggmOggmOggtpOggtOggw,OggxOggzOgg6|,Ogg_}OggOggOgg&OggLOggOggOgg OggOggOggBOgg2OggOggOggOggOggOgg׸OggOgg3OggOOggOggOggOggq,OggOggOgg<OggjOggOggOggOggHOggOggOggOggOggOggOggD,OggOggOgg ,OggOgg1Ogg:OggOggOgggOgg,OggrOggzOggOggOggOggOggOggOggOgg0Ogg8OggOggOgg%Ogg=OggpOggOggOggOggOggOggOggOggOgg\OggOggOgg;OggOggOggO,OggOggOggOggOgg-OggOgg&,OggiOgg OggOggAOggmOggOgg)Ogg[OggOgghOgg,Ogg;OggDOggMOggOgg Ogg Ogg,OggOgg"Ogg $,Ogg$Ogg&OggN(,Ogg )Ogg*Oggx,,Ogg-OggQ1Ogg64,OggK5Oggb;Ogg,?Ogg?Ogg@OggCOgg9FOggFOggGOggKOggNOgglNOggOOgg*SOggSU,OggVOggZOgg\,Oggp]Ogg _Ogg:`Oggu`OggaOggeOggfOgg gOgg,hOggRiOggj,OggPkOggdmOgg)p,OggytOggvuOggVx,OggzOgg~Ogg׀,OggOggOgg؇,OggDOggOggZOggOggFOggOgg,OggeOgghOgg,OggOggOggOggWOggׯOggOggW,OggOggCOggp,OggSOggKOggOggOggJOggOgg,OggDOggOgg,OggSOggXOgg,OggOggOgg,OggOggOggOgg@OggOggOgg,OggJOgg6Ogg,OggPOgg.Ogg,OggHOgg$Ogg,Ogg OggOggr,OggOggOgg8,OggOgg#Ogg,OggQOgg6Ogg@,OggOggXOggOgg^OggOggOgg ,OggOggrOgg,Ogg<Ogg Ogg BOgg Oggt ,Ogg Oggl Ogg OggU Ogg Ogg Ogg' Oggt Ogg Ogg& Ogg' Ogg&( Oggz( Ogg, OggP- ,Ogg- Ogg0 Ogg1 ,Ogg2 Ogg4 Ogg5 ,Ogg6 Ogg 9 Ogg9 ,Ogg9 Ogg< Ogg= ,Ogg> Ogg@ Ogg(B ,OggC Ogg_H OggI ,OggJ OggM OggN ,OggO OggQ OggAS ,OggT Ogg [ Ogg\ ,Ogg^ Ogggb Ogg d ,Ogg^e Oggsh Oggk ,Ogg]n OggEq Oggt ,Oggu Oggjx OggFz Oggz Ogg{ Ogg Ogg ,OggX Ogg׈ Ogg ,OggÍ OggO Oggէ ,Ogg` Ogg ##.............(........ .#..#.##...##.#.########## ##..#.#..#.........).)........... ##..#.#.##...#######.###########. ##..#.#.##.........#....# #... ....#.#....#.......#.##.# #.#. ##.##....###.......[.##.######.#. ##.####...####.......##....[)..#. ##.# #.⌠.# ##..@....###########.359.3 (128.0) ...####...###.................... ##.#.........#.#.....###############.⌠..>..⌠...#.....##.........#######.##########...#### #......#Ogg5 #.⌠.# ########......# ### #...###......#......# #.. ###..........#......#####.# Ogg7 Ogg T _Key pressed, stopping explore.Ogg IOggn Ogg Ogg $ _Ogg Ogg OggF Ogg Ogg Ogg] Ogg ,Ogg4 Ogg Ogg ,Ogg Ogg Ogg ,OggE Ogg Ogg ,Oggs Ogg Ogg Ogg@ Ogg OggQ! Ogg" Ogg># Ogg$ OggG& Ogg' Ogg+( Ogg( OggM+ Ogg. ,Ogg/ Ogg"2 Ogg3 ,OggQ4 Ogg}6 Ogg 8 ,Ogg 9 Ogg: Ogg < ,Ogg< Ogg> Ogg.@ ,OggC ,OggKD ,OggD OggF OggH ,OggmI OggJ OggL ,OggL OggN OggO Ogg-P Ogg&Q OggS Ogg?T OggT OggT OggV OggX BOggZ Ogg.\ Oggw\ Ogg\ Ogg^ Ogg!` ,Ogg` Oggb Oggd ,Ogg"e Oggf Oggh ,Oggh Oggj Oggk ,Ogg%q nOgg8r Oggcs Oggs Ogglt Oggx ;  You see here 6 stones.Oggz Oggz  _Ogg{ Ogg} OggT Ogg OggB OggI Oggo Ogg Ogg] Ogg) Oggֈ BOggz XOggj XOgg XOgg Ogg9 ,Ogg Oggv OggK Ogg Ogg Ogge OggS ,OggϜ Ogg Ogg ,Ogg` Ogg Ogg ,Ogg OggR OggW Ogg Ogg OggL Ogg ,Ogg Ogg( OggW ,Ogg Ogg Ogg Ogg OggI Ogg Oggy Ogg Ogg OggU Ogg? ,Ogg Ogg Ogg ,Oggk Oggg Ogg ,Oggչ Ogg Ogg Ogg Ogg Ogg? Ogg Ogg Ogg Ogg OggF ,Ogg Oggc Oggn Ogg Ogg- Ogg Ogg Ogg. Ogg Ogg Ogg Ogg\ Ogg OggN Ogg ,OggT Ogg Ogg Ogg' Ogg Ogg9 Oggi ,Ogg Ogg D  You see here a +0 quarterstaff.Ogg Ogg  _Ogg Ogg4 Ogg Ogg Oggv Ogg Ogga ,Ogg Ogg OggG ,Ogg Ogg Ogg_ ,Ogg Ogg Ogg ,Ogg OggZ Ogg ,OggY Ogg Ogg ,OggZ Ogg Ogg Ogg ,Oggz OggK ,Ogg Ogg Ogg  Ogg` Ogg Ogg OggQ ,Ogg OggV Oggx Ogg Ogg] Ogg Ogg ,Ogg Ogg Ogg Ogg@ Ogg Ogg  OggQ  OggR 1 Crazy Yiuf shouts!OggT OggT OggTV Ogg[ _Crazy Yiuf whimpers, "Mountain song poople!"Ogg_ Ogg~` Ogg` Ogg'a Ogg;c $ Oggc g_Crazy Yiuf says, "Peeping illywillydillykilly hand!"Oggd Ogge Ogge Oggg OggSj Oggl Oggm Oggm Ogglt c #.# #.#.##.#####Oggt  #.# #.#.##.######.###.. #.# #.#.##... ### #############.##### #.##### #...... ###### ### ######.Ogg.u F ##..#.## ###..)# #. #......####@+g..# .434.3 (75OggVu #.0) #.......#..##...# #......... #.#.#..#.### ### #Oggu . #..####### #......... ##.# ########## #.#### #...(.... g   Crazy Yiuf....# ##.######Ogg2v #...# #.# #...# #.OggVv Oggl| Ogg} Ogg 3Ogg OggP '0.0)....#...#..#.....(..........Ogg Oggv Ogg6 ] _Could not explore, unopened runed door.OggOgg-OggmOgg4OggOggR] _Could not explore, unopened runed door.Ogg.'OggL  As you open the door, it creaks loudly!Ogg$9g.Ogg#%L======5.3 (1Oggd)Ogg3.m _Crazy Yiuf cries, "East mobile foot!"Ogg{~#.# #.#.##.#####....... deadiverson the Carver#.# #.#.##.######.###.. Human of the Shining One ......#.# #.#.##............. Health: 61/61 ========================### #############.##### Magic: 8/8========================#.##### AC: 13Str: 17#...... EV: 10Int: 11######### ######. SH: 9Dex: 12##..#.## ###..)##. XL:  8 Next: 59% Place: Dungeon:5#......####@g...# #########. Noise: ======---  Time: 5435.3 (0.0)#.......#..##...# #......... a) +0 long sword#.#.#..#.### ##Ogg# #########. Throw: throwing net#..########.........##.############.#####...(.... g   Crazy Yiuf#....###.########...##.##...##.# _Crazy Yiuf cries, "East mobile foot!"Throw: throwing netPress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - Crazy YiufAim: Crazy Yiuf, wielding a +3 quarterstaff of chaos and wearing a +0 cloak  (60% to hit)Ogg #.# #.#.##.#####....... deadiverson the Carver#.# #.#.##.######.###.. Human of the Shining One ......#.# #.#.##............. Health: 61/61 ========================### #############.##### Magic: 8/8========================#.##### AC: 13Str: 17#...... EV: 10Int: 11######Ogg ### ######. SH: 9Dex: 12##..#.## ###..)##. XL:  8 Next: 59% Place: Dungeon:5#......####@g...# #########. Noise: ======---  Time: 5435.3 (0.0)#.......#..##...# #......... a) +0 long sword#.#.#..#.### ### #########. Throw: throwing net#..########.........##.############.#####...(.... g   Crazy Yiuf#....#Ogg##.########...##.##...##.#Throw: throwing netPress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - Crazy YiufAim: Crazy Yiuf, wielding a +3 quarterstaff of chaos and wearing a +0 cloak  (60% to hit)  You throw a throwing net. The throwing net hits Crazy Yiuf.Ogg/  --more--Ogg? g(caught)Crazy Yiuf is caught in the net!Ogg g=-----6.4 (1.1Nothing quiveredOggr Ogg 3 _Crazy Yiuf struggles against the net.Oggn, You hit Crazy Yiuf.  Crazy Yiuf is moderately wounded.Crazy Yiuf says, "Shower Hive mumblescurry!"-----70OggOgg3 _Crazy Yiuf struggles against the net.Ogg  You hit Crazy Yiuf.  Crazy Yiuf is moderately wounded.8.6 (1.2OggOggq > _Crazy Yiuf struggles against the net. x2Ogg5  You hit Crazy Yiuf.  Crazy Yiuf is moderately wounded.OggɧOgg!9.8OggկOgg; _Crazy Yiuf struggles against the net.OggH C ggOggx You hit Crazy Yiuf but do no damage.Crazy Yiuf is moderately wounded.Crazy Yiuf struggles against the net.40.9 (1.1Ogg D _The net rips apart, and Crazy Yiuf comes free!Ogg  You barely miss Crazy Yiuf.  Crazy Yiuf is moderately wounded.Crazy Yiuf hits you with a +3 quarterstaff of chaos.Ogg 0==-2.0Pois Ogg& Ogg Q _You are poisoned.OggM  You hit Crazy Yiuf.  Crazy Yiuf is moderately wounded.OggNP59-3.1OggUOggSYC _You feel sick. You block Crazy Yiuf's attack.Ogg  You closely miss Crazy Yiuf.  Crazy Yiuf is moderately wounded.OggaV7-4.2OgguOggEb _You feel sick. Crazy Yiuf barely misses you.Ogg  You hit Crazy Yiuf.  Crazy Yiuf is moderately wounded.Ogg* [6-5.4 (1.2Ogg Ogg! f _You feel sick. Crazy Yiuf completely misses you.Oggm 38=====--------Pois You hit Crazy Yiuf but do no damage.    Crazy Yiuf says, "Paint!"Oggnn Crazy Yiuf hits you with a +3 quarterstaff of chaos!  You are more poisoned.Oggv /  --more--Ogg]W  Crazy Yiuf hits you with a +3 quarterstaff of chaos!Ogg^s-------- 9 =6.5 (1.1Ogg_L-4 long swordCorr (-4) OggVgOggkN _The acid corrodes you!Ogg Ogg RDrink which item? Potions  c - a puce potion  e - 3 brown potions  h - 2 potions of curing  i - a viscous pink potion  k - 4 lumpy ruby potions  q - 2 fuming silvery potions Ogg u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedOgg#OggZ)Ogg12L#.# #.#.##.#####....... deadiverson the Carver#.# #.#.##.######.###.. Human of the Shining One ......#.# #.#.##............. Health: 38/61 ==============----------### #############.##### Magic: 8/8========================#.##### AC:  9  Str: 17#...... EV: 10Int: 11######### ######. SH: 9Dex: 12##..#.## ###..)#Oggv3~#. XL:  8 Next: 59% Place: Dungeon:5#......####@g...# #########. Noise: ==-------  Time: 5446.5 (0.0)#.......#..##...# #......... a) -4 long sword#.#.#..#.### ### #########. Nothing quivered#..########......... Pois Corr (-4) ##.############.#####...(.... g   Crazy Yiuf#....###.########...##.##...##.#Crazy Yiuf hits you with a +3 quarterstaff of chaos! _The acid corrodes you!Oggr;:Okay, then.Ogg#<OggDOggE. _OggTOgg$Oggf-Drink which item? Potions  c - a puce potion  e - 3 brown potions  h - 2 potions of curing  i - a viscous pink potion  k - 4 lumpy ruby potions  q - 2 fuming silvery potions  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedOggsOgg*{Ogg#.# #.#.##.#####....... deadiverson the Carver#.# #.#.##.######.###.. Human of the Shining One ......#.# #.#.##............. Health: 38/61 ==============----------### #############.##### Magic: 8/8========================#.##### AC:  9  Str: 17#...... EV: 10Int: 11######### ######. SH: 9Ogg#1Dex: 12##..#.## ###..)##. XL:  8 Next: 59% Place: Dungeon:5#......####@g...# #########. Noise: ==-------  Time: 5446.5 (0.0)#.......#..##...# #......... a) -4 long sword#.#.#..#.### ### #########. Nothing quivered#..########......... Pois Corr (-4) ##.############.#####...(.... g   Crazy Yiuf#....###.########...##.##...##.#Crazy Yiuf hits you with a +3 quarterstaff of chaos! _The acid corrodes you! _Okay, then.OggOgg47=========-7.5 (1Ogg[Ogg= _You feel better. You block Crazy Yiuf's attack.Ogg  You completely miss Crazy Yiuf.  Crazy Yiuf is moderately wounded.Crazy Yiuf hits you with a +3 quarterstaff of chaos!Ogg 34====-----=8.6 (1.1Pois Corr (-4) OggN Ogg/ Q _You are poisoned.Ogg   You closely miss Crazy Yiuf.  Crazy Yiuf is moderately wounded.You feel very sick.Oggz1-------9.8 (1.2OggOggL _Crazy Yiuf misses you.Ogg@ct You feel very sick. _Crazy Yiuf misses you.slash Crazy Yiuf!  Crazy Yiuf is severely wounded.  You feel sick.  Crazy Yiuf glowers.Oggcx29---50.9 (1.1OggjOggm4 _You block Crazy Yiuf's attack.OggUOgg|Drink which item? Potions  c - a puce potion Ogg e - 3 brown potions  h - a potion of curing  i - a viscous pink potion  k - 4 lumpy ruby potions  q - 2 fuming silvery potions  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedOggfOgg OggR#.# #.#.##.#####....... deadiverson the Carver#.# #.#.##.######.###.. Human of the Shining One ......#.# #.#.##............. Health: 29/61 ===========-------------### #############.##### Magic: 8/8========================#.##### AC:  9  Str: 17#...... EV: 10Int: 11######Ogg=### ######. SH: 9Dex: 12##..#.## ###..)##. XL:  8 Next: 59% Place: Dungeon:5#......####@g...# #########. Noise: =--------  Time: 5450.9 (0.0)#.......#..##...# #......... a) -4 long sword#.#.#..#.### ### #########. Nothing quivered#..########......... Pois Corr (-4) ##.#Oggr###########.#####...(.... g   Crazy Yiuf#....###.########...#Ogg#.##...##.# _Crazy Yiuf misses you.You slash Crazy Yiuf!  Crazy Yiuf is severely wounded.OggYou feel sick.  Crazy Yiuf glowers. _You block Crazy Yiuf's attack.Ogg  You feel better.  Crazy Yiuf hits you with a +3 quarterstaff of chaos.34====Ogg-1.9 (1Ogg%OggA(A _Crazy Yiuf draws strength from your wounds!Oggx5  You hit Crazy Yiuf.  Crazy Yiuf is almost dead.Crazy Yiuf hits you with a +3 quarterstaff of chaos.24----2OggOggM _You convulse.OggK8  You hit Crazy Yiuf.OggC)Ogg6634.1 (1.2Ogg,OggJ _You kill Crazy Yiuf!Ogg 6#.# #.#.##.#####.#.# #.#.##.######.###.#.# #.#.##.### #.##.##.###### #### ######.###..#.## ###..)# #.##......####.@...# #.##.#..##...# #.#.#.#..#.### #### #.##..####### #.Oggh ###.# ##.#### #...(.#....# ##.# Oggw Ogg ! c5-----50Ogg% Ogg*   There is an open translucent door, spattered with blood here.  Things that are here: _a +3 quarterstaff of chaos; a +0 cloak; the gnoll corpse of Crazy YiufOggKP 4Ogg{Q OggtT OggU U26=OggY BOgg\ XOgg^ b7=Ogg` Oggc ,Ogg:f Ogg@l Oggl Oggm Oggx 8-Ogg| f 61.1 (6 _You start resting.Ogg} 13 2.1 (7+0 long swordOgg& Ogg [ _You are no longer corroded.OggoZ3Ogg[Ogg8]OggZb8=OggbOggca9=OggvdOggve,OggfOggg,OgggOgghOggh:30OggPiOggpj,Ogg kOgg.l,OgglOggm,Ogg}nOggoi1=OggQpOggsq,OggrOggsOggsOgg7tOggua2=OgguOggv,OggxOggy,Ogg~zOgg|Ogg{|93Ogg7}Ogg~,OggdOgg,OggтOgg OggsOgg?OggTOggS4=OggOgg_,Ogg&Ogg/,Ogg͊OggOggÌa5=Ogg,OggXOggs,OggWOggii6=Ogg(Ogg',OggOgg,Ogg&Ogg,OggOggOggD7=OggbOgg,OggOgg,OggJOggOgg98Ogg8Ogg,OgghOggܪ,OggcOggX99Ogg0=OggOgg&,OggOggOgg=OggOgg ,OggGOggYOggֻL40=OggμOggξ,OggOggOggOggOggOggvS1=OggOgguOggOggOggOgg[OggOggDOggK2=OggQOggOggOggOgg\OggOgg`Ogg*,OggrOgg6Ogg93OggOggOggOggOgg{OggOggOggOggN44=OggOgg,Ogg8Ogg|OggOggOgg+OggW5=OggOgg,OggOggOgg>Ogg. Ogg ,Ogg OggOggnK6=OggnOggGOgg.OggOggU7=Ogg/Ogg',OgguOgg,Ogg Ogg"Ogg #%8Ogg $Ogg&,Ogg'Ogg),OggF+Ogg-,Ogg.Ogg0Ogg}1K9=Ogg2Ogg4OggS5Ogg=6Oggw8,Ogg9Ogg;OggR<V50=Ogg =Ogg>Ogg[?Oggj@OggB,OggDOggEOggJFK1=OggGOgghJ,OggLOgg5N,OggUOOgg5Q,OggROggbU2=OggW,OggXOgg[,Ogg\Ogg^Ogg^3Ogg_OggaOgg9bOggcOgge,Ogg9k4=OggkOggo,OggpOggr,OggesOggtOgguU5=OgguOggw,OggxOgg7z,OggzOgg&|Ogg|K6=Ogg|Ogg},Ogg~Ogg,OggOgg7=OggхOgg<OggOgg,OggzOggzOgg}8Ogg,OggOggOggK9=OggOggOggOggOgg,OggOggyl60=OggtOggOggOggOgg,OggUOgg,OggMOggڥ_ _You start resting.Ogg̬572.1 (110.0)1=31OggOgg" _HP restored.OggG IOgg}K Ogg9M OggM OggQ Oggo 3#.# #.#.##.#####.#.# #.#.##.######.###.#.# #.#.##.### #.##.##.####### ##### ######.###..#.## ###..)# #.##......####.)@..# #.#4.1 (Oggp l1.0)#.#..##...# #.#.#.#..#.######## #.##..####### #.###.# ##.#### #...(.#....# ##.###...# #.# # OggBq Ogg x Oggz E _Done exploring.OggWl OggNm Oggm OggF <0Ogg $ OggW 7_Done exploring.Ogg(Oggp)Ogg2*OggJ4OggPOgg|RE _Done exploring.OggIOgg!OggOgg[ _Done exploring.OgguOggeWhere to? (Tab - D:5, ? - help) OggfD D - Dungeon  T - Temple Ogg;OggT#.# #.#.##.#####......... deadiverson the Carver#.# #.#.##.######.###.... Human of the Shining One ......#.# #.#.##............... Health: 61/61 ========================### #############.####### Magic: 8/8========================#.####### AC: 13Str: 17#.......# EV: 10Int: 11###### ##### ######.## SH: 9Dex: 12##..#.## ###..)##.## XL:  8 Next: 63% Place: Dungeon:5#......####.)@..# #########.## Noise: ---------  Time: 5574.1 (0.0)#.......#..##...# #........... a) +0 long sword#.#.#..#.######## ggQUI0m#########.## Nothing quivered#..########.........####.##############.#####...(......#....###.##########...##.###...##.# _You start resting. _HP restored. _Done exploring. _Done exploring. _Done exploring. _Done exploring.Ogg>VOggWOggbOggd[39;49mOggi: _Oggpk _Done exploring. _Done exploring. _ There is an open translucent door, spattered with blood here.  Things that are here:  a +3 quarterstaff of chaos; a +0 cloak; the gnoll corpse of Crazy YiufOggsOgg>t _OggzuOgg}Oggځ,OggOggOgg,OggOvOggOggBOggOgg]OggXOggyOgg,OggOggKOgg>OggOggOggI Ogg1 Oggw Oggt Ogg Ogg Ogg* Ogg Ogg Ogg` Ogg Ogg6 Ogg' Ogg8) ,OggJ* Ogg3 D  You see here a +0 quarterstaff.Ogg.5 Ogg5  _Ogg6 Ogg> Ogg@ Oggk@ OggMA OggH OggZJ ,Ogg@K OggHR OggS ,OggT Ogg>[ Ogg^ BOggKu Ogglz Ogg{ ,Ogg| Ogg Ogg, ,Ogg Oggƌ Ogg Ogg Ogg9 OggN Oggo ,Ogg Oggh OggA BOggW Oggy ,Ogg Ogg/ Ogg ,Ogg Ogg Ogg BOgg] Oggk Ogg ,Ogg Ogg OggX Ogg Ogg Ogg ,OggT Ogg XOggm Ogg ,OggW Oggv Ogg ,Ogg Ogg! Ogg Ogg Ogg Ogg Ogg OggP Ogg Ogg Ogg ,Ogg Ogg_ Ogg ,Ogg Ogg Ogg ,Ogg Ogg Ogg ,Ogg* Ogg Ogg ,Ogg Ogg Ogg} Ogg OggN Ogg! ;  You see here 6 stones.Ogg" Ogg8#  _Oggp$ Ogg( Ogg) Ogg) Ogg) Ogg. Ogg0 Oggl0 Ogga1 Ogg5 Ogg5 OggB6 Ogg6 Ogg: Ogg,; ,Ogg; Ogg> OggA@ ,Ogg@ OggD OggE ,OggpF Ogg J OggN ,OgghN OggQ Ogg'S ,Ogg T OggV OggW ,OggIX Ogg8[ Ogg6\ ,Ogg\ Ogg_ OggS` ,Ogg` Oggc Oggjd Oggd Ogg=e Oggg Oggh Oggi Oggci Oggl Oggm ,Oggn Oggq Ogg1s ,Ogg+t Oggv Oggmx ,Oggx Ogg{ Ogg} ,OggQ~ OggЀ Ogg ,Ogg* Ogg, Ogg" ,Ogg OggR Ogga ,Oggڈ Oggs Ogg ,Ogg' Ogg Ogg ,OggN Ogg Ogg ,Ogg& Ogg. Ogg ,Ogg Ogg Ogg5 ,Ogg Ogg Ogg ,Ogg\ Oggn Ogg ,Ogg Ogg Ogg Ogg/ OggǴ Ogg Ogga ,Ogg Oggʽ Ogg   There is a stone staircase leading down here. _Ogg7 ;6Ogg9 ,Ogg: Ogg = _You climb downwards.  Found a chain mail.  There is a stone staircase leading up here.Ogg Ogg Q        ###  ..#  #.#   #.#   ###.#######   #..@....... 661.8 (87.Ogg 7)   #...5....####   #.##++##.#   .[ ..   #.#   #5   white imp      Ogg Ogg OggQ ` _A white imp is nearby!OggOggd48=2.8 (1.0) Ogg<OggUAv _You barely miss the white imp. You block the white imp's attack.Ogg> C3.9 (1.1Ogg Ogg v _You barely miss the white imp. You block the white imp's attack.OggGOggH(5.0OggOOggT OggT_You closely miss the white imp. The white imp barely misses you.Ogg;  You hit the white imp.  The white imp is heavily wounded.Ogg!(6.1OggUOgg8W _The white imp closely misses you.Ogg4  You hit the white imp.  The white imp is almost dead.Ogg5(7.2OggE<OggA7 _You block the white imp's attack.Ogg3z  You hit the white imp.  You kill the white imp!OggE2.Ogg4480OggpOggX _The Shining One accepts your kill.OggO 4OggQ Ogg`T H _No target in view!OggU Ogg# Ogg1 OggJ OggF Ogg $ _Ogg8 ,Oggש ,Oggު Ogg Ogg ,Ogg Ogg Ogg| ,Ogg OggV Ogg Ogg Ogg Ogg Ogg ,Ogg Ogg& Ogg Ogg2 ,Ogg Ogg ,Oggk Ogg Ogg OggJ Ogg Oggp Ogg ,OggL Ogg@ Ogg ,Ogg OggR Ogg Oggj Ogg Ogg Ogg Ogg4 Ogg Ogg Oggn ,Ogg Ogg Ogg Ogg' Ogg Ogg~ Oggm Ogg OggI OggV Ogg ,Ogg Ogg~ Ogg ,Ogg Ogg ,Ogg Ogg M _You now have 147 gold pieces (gained 7).Ogg% Ogg Ogg Ogg  Ogg OggG Ogg Oggx Ogg Ogg/ Ogg Ogg Ogg0&  ###  ..###  #.#..  #.##.  ###.#######.# )######## ##..<........# ......... ........########.......# .##++##.#......+....... #...#######-90.2 (22.0)Ogg4'  #.#.##........#+ #...##........+ #.#.##........# #................  ........#######.###.  ........#.# .#  ........#.# #  ......#....Ogg/ \-1.2 (23Ogg~4 Ogg7 $ _Found a flail.Ogg3OggROggOggòBOggOggh,OggOggּOggW,OggUOgg[Ogg:,OggoOgg=  You see here a +0 flail.OggwOgg}5 _OggOggCOggOggTOggOggPOggOggjOggOgg,OggOgg{=  You see here a +0 flail.Ogg K _OggOgg,Ogg8Ogg6OggXOggOgg Ogg Ogg,OggOggOgg,OggOgg)Ogg,Ogg-Ogg9%7 _You open the door.Ogg&3OggK'Ogg,@  There is an open door here.Ogg<6# #.##.# #######.##)########## ........##..........# ...########.......# ##.#......+.......#  #...######.......#  #.#.##........#+## Ogg6[ #...##........'..#  #.#.##........#@##  #................+ .....#######.###.## .....# #.# #.# .....# #.# #.# ...#.. #.. ..# Ogg6\g   gnoll (missile, asleep) ...... ... ...... ..g ......#OggJ  706.2 (15g)gA gnoll comes into view. It is wielding a +0 flail and quivering a throwingnet.The gnoll shouts!OggQa(((((((Ogg Ogg @.....gg 2 gnolls (1 wandering).ggThe gnoll throws a throwing net. The throwing net closely misses you.==7.2 (16OggOgg _A gnoll comes into view. It is wielding a +0 club. _You see here a throwing net.Ogg  #.##.##)## #... #.......#+.......#  ##.......#  ......#+##  ......'..#  #@##  .........+###.###.## #.# #.# #.# #.# #.. ..# ... .ggOgg& C #.##.##)## #... #.......#+.......#  ##.......#  ......#+##  ......'..#  #@##  .........+###.###.## #.# #.# #.# #.# #.. ..# ... .Ogg OggA 4Oggՙ Ogg d _There are monsters nearby!OggLa  b - a throwing netOggNOgg-POgg]- g   gnoll sergeant (polearm, wandering)gggg 2 gnollsg.  The gnoll shouts! You hear a shout!Ogg|^8.0)Throw: throwing netOggdOggo~ _A gnoll sergeant comes into view. It is wielding a +0 trident.Ogg* 4Ogg Oggt N _There are no items here.Pgg;.# #....# .# #.##.# #######.##)########## <........##..........# ....########.......# +##.#......+.......# #...######.......# #.#.##.#+## #...##........@..# #.#.###.##  #................+.#######.###.##.# #.# #.#...# #.# #.#gg 2 gnolls#.. #.. ..#. .gg..g.PggPggPgg   gnollg..Pgg6--9 _PggPggQ _There is an open door here.PggH.# ###### #.# #....# #.# #.##.# #.#######.##)##########<..............# .....########.......# ++##.#......+.......# #...######.......# #.#.###+## #...##.'..# #.#.##.#.##  #................+.#######.###.##.# #.# #.#...# #.# #.##.. #.. .g#. ...PggPggI--10 _PggPggPggd ###  ..# ######  #.# #....#  #.# #.##.# ##.#######.##)##########<...........# ......########.# #++##.#......+.# #...######..@....# #.#.##.#+## #...##.'..# #.#.###.##  #................+Pgg.#######.###.##.# #.# #.#...# #.# #.##.. #.. .g#PggPgg(g   gnollgPggQ&1PggPggPgg& \  ###  ..# ###### #.# #....#  #.# #.##.# ###.#######.##)########## #..<...........# .......########.# ##++##.#......+.# #...######.......# #.#.##........#+## #...##.'..# #.#.###.## #................+  .#######.###.## Pgg' R .# #.# #g#  ........# #.# #.#Pggb, Pgg/ Pgg8 wg 2 gnollsgPgg_9 &2PggB PggE Pgg ,M## .####...  #.# #.##.# ##.#######.##)######### #..<........##...# .......######## ##++##.#......+..######.......#.#.##........#+##...#.#g   gnoll..+##.# #g#Pgg Pgg Pgg g 2 gnollsg.Pgg &3Pggk Pgg Pggw>7 ###  ..# ###### #.# #....#  #.# #.##.#  ###.#######.##)########## ##..<...........# ........########.# .##++##.#......+.# #...######.......# #.#.##........#+## #...##........'..#Pggk?   gnoll #.#.##........#.## #..............g.+ .#######.###g##PggPggPggg 2 gnollsg.Pgg'&4PggPggPgg> ###  ..# ###### #.# #....# #.# #.##.#  ###.#######.##@########## ###..<........#...# #........########.# #.##++##.#......+.# [ #...######.......# #.#.##........#+##   gnoll #...##........'..# #.#.##........#g## #..............g.+PggLPggPggg 2 gnollsg.Pgg&5PggNPgg׮N _You see here a +0 flail.PggQZ4Pgg1dPgggPgg## .######... #.#   ###.#######.##)######### ###..<........##..........#.......########....... #.##++##.#......+....... [..######.......   gnoll#Pgg#+#.g..#.###g##PggPgg@g'Pgg-6 _Pgg,PggPgg  ###  ..# ###### #.# #..@.# #.# #.##.#  ###.#######.##)##########  ###..<........##........#  #........########.....#  #.##++##.#......+.# .[ #...######.......# #.#.##.......g#+## #...##.'..#Pgg Pgg @g.Pgg Pgg: 7Pgg Pgg Pgg^Pgg_PgggPgg jPggeP ### ..# ###### #.# #.@..# #.# #.##.# ###.#######.##)## ###..<..##..# #.########.......# #.##++##.#......+.......#  .[ #...######..g....# # #.#.##........#+##  #...##.'..#PggmPggn&8PggrPggtPgg.P### ..# ###### #.# #....# #.# #@##.####.#######.##)#############..<........##..........# #........######## #.##++##.#......+Pgg]Q+.#.[ #...######..g....##  #.#.##........#+## #...##.'..# #.#.##.#g##PggQYPggY&9Pgg_PggaPgg  ###..#######....###.####.#######@##)#############..<........##..................######### #................+Pgg' Pgg-( '20PggG- Pgg. PggCp IPggQ{ Pgg nPgg3 Pggm Pggg ,Pgg} Pgg# kgg   gnollPgg H Pgg͙ G ### ..# ######  Pgg K#.# #.g..#  Pgg ,#.# #.##.#  Pgg# p#@##) 5.2 (5  ###..<........#Pgg> "  ...######PggX !   Pggq / .[   # Pgg   Pgg '   Pgg a  _You start waiting.PggB ### ..# ######  #.# #.g..#  #.# #.##.#  #@##)  ###..<........#  ...######    .[   #      _A gnoll is nearby!PggMPggzEvoke which item? Wands  o - a wand of acid (6)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedPgg Pgg Pggo !deadiverson the CarverHuman of the Shining One ......Health: 61/61 ========================Magic: 8/8========================###AC: 13Str: 17..# ######EV: 10Int: 11#.# #.g..#SH: 9Dex: 12#.# #.##.#XL:  8 Next: 64% Place: Dungeon:6###.#######@##)##########Noise: ---------  Time: 5725.2 (0.0)###..<........##..........#a) +0 long sword#........########.......#Pgg& Throw: throwing net#.##++##.#......+.......#.[#...######..g....###.#.##........#+##g   gnoll#...##........'..##.#.##........#g###................+ _A gnoll sergeant comes into view. It is wielding a +0 trident. _There are no items here. _There is an open door here. _You see here a +0 flail. _You start waiting. _A gnoll is nearby!Pgg' P  Okay, then.Pggd( Pggl0 Pgg-4 . _PggpKQuiver which action? ([-] to clear)  b - Throw: throwing net (quivered)f - Throw: 3 darts (poison)  o - Zap: wand of acid (6) [*/%] inventory [^] all abilities[!] focus mode: off|onPgg|PggTdeadiverson the CarverHuman of the Shining One ......Health: 61/61 ========================Magic: 8/8========================###AC: 13Str: 17..# ######EV: 10Int: 11#.# #.g..#SH: 9Dex: 12#.# #.##.#XL:  8 Next: 64% Place: Dungeon:6###.#######@##)##########Noise: ---------  Time: 5725.2 (0.0)###..<........##..........#a) +0 long sword#........########.......#Throw: 3 darts (poison)#.##++##.#......+.......#.[#...######..g....###.#.##........#+##g   gnoll#...##........'..##.#.##........#g###................+ _There are no items here. _There is an open door here. Pgg_You see here a +0 flail. _You start waiting. _A gnoll is nearby! _Okay, then.PggXPggԖPggePgg9;(Pgg}PggP(gPgg]6.4 (1.22PggPgg˒R _You throw a poisoned dart. The poisoned dart hits the gnoll.Pggn8 9  You slash the gnoll!Pgg; PggA Sg)PggaD >5==7.5 (1.1PggN PggR I _You kill the gnoll!Pgg~## .#####.g..#PggZ #.# #@##.#  ###.#######.##)###########..<........##...#.......######## #.##++##.#......+... .[..######..g....###+#PggDA.'..#.###g##PggPggb0--80Pgg Pgg% _The gnoll hits you with a +0 flail.  Things that are here: _a +0 club; a gnoll corpsePgg.{ Pggςn(poisoned)  You throw a poisoned dart. The poisoned dart hits the gnoll.Pgg 1=-9.6 (1.1dart (poison) Pgg&PggS _The gnoll is poisoned. The gnoll hits you but does no damage.Pgg  You slash the gnoll!  The gnoll is almost dead.Pgg2 PggU _57--=30.8 (1.2Pgg Pgg4 9 _The gnoll hits you with a +0 flail. PggUN9  You slash the gnoll! PggWC) PggZ86-2.0 Pgga PggdI _You kill the gnoll! Pgg,- _No target in view! Pgg3 Pgg Pgg Pgg,S8-- _ PggB Pgg7 Pgg Pgg  Pgg PggD PggK9= PggJ Pgg Pgg0 Pgg Pgg Pgg  Pgg Pgg PggV60= Pgg  Pgg, Pgg Pggu1= _HP restored. Pgg   f - 3 poisoned darts (gained 2) Pgg  Pgg= _You see here a +0 flail. Pgg%### ..# ###### #.# #.)@.# -.# #)##.# #######.##)########## 3 darts (poison)###..<........##...#........########.g  #.##++##.#......+.......# g   gnoll sergeant (polearm, wandering) .[#...######.......##.#.##........#+###...##..'..# Pgg045.0 (13.0) Pgg?  The gnoll sergeant shouts! Pgg&.gg   gnoll (polearm, missile, wandering) Pgg='6===6.0 (14 Pgg- Pgg2  A gnoll comes into view. It is wielding a +0 spear and quivering 2 throwing _nets. Pgg ((((gpoisoned)You throw a poisoned dart. The poisoned dart hits the gnoll.  The gnoll is poisoned. Pgga+ .)..ggg 2 gnolls (polearms, 1 missile, 1 pois…)The gnoll shouts!  A gnoll comes into view. It is wielding a +0 halberd.(((( Pgg.)..gg   gnoll sergeant (polearm)gg 2 gnolls (polearms, 1 missile, 1 pois…)=7.2 (1.2)2  Pgg PggVD_The gnoll throws a throwing net. You block the throwing net. Pggr>  _Unknown command. Pgg~ ### ..# ###### #.# #.@(.# #.# #)##.# ###.#######.##)## ###..<..##..# #.########.g.....# #.##++##.#......+.gg....#  .[ #...######.......# # #.#.##........#+##  #...##.'..#---80 _  Pgg9H_You see here a +0 flail. Pgg$B### ..# ###### #.# #.)@.# #.# #)##.# ###.#######.##)##  ###..<..##.g  #.########g.  #.##++##.#......+.(.....# g   gnoll sergeant (polearm) .[ #...######.......# g   gnoll (polearm, missile, poisoned) #.#.##........#+## gg.. PggC---9 _ _You see here a throwing net. Pgg( Pggy7 gg 2 gnolls (polearms, 1 missile, 1 pois…) Pgg7>b - 2 throwing nets (gained 1) PggO9/=50 PggD PggfH< _You block the gnoll sergeant's attack. Pgg$ ### ..# ###### #.# #.@..# #.# #)##.# ###.#######.##g## PggH ###..<..##gg.# #.########.......# #.##++##.#......+.(.....#  .[ #...######.......# # Pggx #.#.##........#+##  #...##.'..# Pgg Pgg Pggg)g   gnoll sergeant (polearm) Pgg>.-1 Pgg PggN _You see here a +0 flail. Pggg### ..# ###### #.# #.)..# #.# #@##g####.#######.##)#############..<........##gg........# #........######## #.##++##.#......+.(.....#.[ #...######.......#  #  #.#.##........#+## #...##.'..# #.#.##.#g## Pgg1g. Pgg3g   gnoll sergeant (polearm) PggTG-2 _ Pgg  Pgg  Things that are here: _a +0 club; a gnoll corpse Pggu ###..#######.)g.#)##.####.#######@##)#############..<........##gg................########.# ##++##.#......+.(.[ #...######..#................+ Pggȋ Pggg.g   gnoll sergeant (polearm) Pggۗ-3 _ Pgg Pgg֣ Pgg### ..# ###### #.# #.g..# #.# #)##.####.#######.##)#############..<......@.##gg........# #........#########  Pgg| #.##++##.#......+.(.....#.[ #...######.......##  #.#.##........#+## #...##.'..# #.#.##.#g Pgga## #........+........#######.###.## Pgg= Pgg Pggz K)g Pgg &4 PggH  Pgg  Pgg^  ### ..# ###### #.# #.)..# #.# #g##.# ###. Pgg #.##)# ###..<.##gg.# # Pgg A.########.# Pgg  #.##++##.#......+.(.....#  .[ #...###### Pgg- j.#  # #.#.##.#+## PggQ X #...##.'..#  Pggu S #.#.##.#g##  # Pgg ].+  .#.###.## Pgg]  Pgg )gg   gnoll sergeant (polearm) Pgg &5 Pgg\  Pgg  PggƧ ### ..# ###### #.# #.)..# #.# #)##.# ###.#g##)# ###..<.##gg Pgg.# #.########.# #.##++##.#......+.(.....#  .[ #...######.#  # #.#.##.#+## #...##.'..#  #.#.##.#g##  #.+  .#.###.## Pgg Pgg˳H.g Pgg;&6 Pgg Pgg Pgg ### ..# ###### #.# #.)..# #.# #)##.# ###.#.##) ###..<...@..g.##gg Pggp. #.########.# Pgg #.##++##.#......+.(.....# Pgg .[ #...######.# Pgg<s # #.#.## Pgg_f.#+## #...##.'..# Pgg #.#.##.#g## #. Pggk.+  .#.###.## Pgge  PggO Pgg)gg.g   gnoll (polearm) Pgg&7 Pggo# Pgg' PggO ### ..# ###### #.# #.)..# #.# #)##.# ###.#g##) ###..<..@..g..##gg #.########.# #.##++##.#......+.(.....# .[ #...######.# # #.#.##.#+## #...##.'..# #.#.##.#g## #...+  .#.###.## Pgg> Pgg\ Pgg w.g.g Pgg&8 Pgg Pgg Pgg0x ### ..# ###### #.# #.)..# #.# #)##.# ###.#.##) ###..<.@..g.g.##gg #.########. #.##++##.#......+.(..... .[ #...######. # #.#.##.#+ #...##.'.. #.#.##.#g #... .#.###. Pgg&&  Pgggg.g.g 2 gnolls (polearms, 1 missile)  The gnoll sergeant attacks as it pursues you! PggW PggmN58--= Pgg 9 Pggv Pgg>  Pgg@_The gnoll sergeant hits you from afar with a +0 trident. Pgg Z     ###   ..# ######   #.# #.)..#  Pgg   #.# #)##.#   ###.#g##)   ###..<@..g.g..##gg   #.#   #.##++##.#......+.(   .[ #...######   # #.#.##.#+   #...##.'   Pgg  #.#.##.#g   #.   .#.###. Pgg  Pgg< , Pgg . . Pggj g.g.gThe gnoll sergeant attacks as it pursues you! Pgg$ '60 PggZ  Pgg < _You block the gnoll sergeant's attack. Pggv h     ###  ..# ######   #.# #.)..#   Pgg#w  #.# #)##.#   ###.#.##)  ###..@..g.g.g.##gg   PggMw C #. Pgguw #   #.##++##.#......+.( Pggw   .[ #...######  Pggx   # #.#.##.#   #...##.'   #.#.##.#   #   .#.### Pgg>x  PggN  Pgg  PggD  Pgg5 g.g.g.-1 Pgg  Pgg a _There is a stone staircase leading up here.Pgg%     ###  ..# ######  #.# #.)..#  #.# #)##.#  ###.#.##) PggT&c ###.@<.g.g.g..##gg  #.#  #.##++##.#......+.(  .[ #...######  ## #.#.##.  #...##Pgg&.  #.#.##.  #  .#.Pgg-Pgg.PggD0Pgg;g.g.g.Pgg<G-2 _PggFPggKPggqz    ###  ..# ######  #.# #.)..#  #.# #)##.#  ###.#.##)# PggKr###..@g.g.g...##gg. #.#. #.##++##.#......+.(. .[ #...######. ## Pggr\#.#.##.# #...##.' #.#.##.# #. .#.#PggQwPgg2yPggs{Pgg.g.g.gPgg_9=-3Pgg͐Pggqa _There is a stone staircase leading up here.PggsPgg tPggzPgg%  PggM/The gnoll hits you from afar with a +0 halberd!Pgg;g.Pgg`4----==4PggxPggM ###...###....................# .........#.#.....############# .⌠..>..⌠...#.....# .........#######.###### ###...#### #......#  #.⌠.# ########......# #######  #...###......#......# #....#.  ###..........#......#####.##.#.5  ####.......'@g.............# #.......##............# #....(..#...........###.# #.......#.#####...### #.# #.#####.#.........# #.#. #.# #.########..#####.#. #.# #..........PggMN<. #.# #.###############.## #.# ### #.# _You block the gnoll sergeant's attack.Pgg4O;----Pgg%XPggPgg250Pggl --Pgg5.7 (2.5PggPgg} _You climb upwards. _There is a stone staircase leading down here.Pggq  You hit the gnoll sergeant but do no damage.Pgg45--=-6.9 (1.2Pgg/Pgg!D _The gnoll sergeant hits you with a +0 trident.Pgg7C8.0 (1.1Pgg Pgg _You closely miss the gnoll sergeant. The gnoll sergeant closely misses you.PggY PggD a6=-9.1Pgg Pgg _You closely miss the gnoll sergeant. You block the gnoll sergeant's attack.PggI n  You hit the gnoll sergeant.  The gnoll sergeant is lightly wounded.PggI )70.2PggR Pgg V _ _The gnoll sergeant completely misses you.Pgg  You slash the gnoll sergeant!  The gnoll sergeant is heavily wounded.The gnoll sergeant hits you with a +0 trident.PgghS4-=Pgg1.4 (1.2Pgg%PggE _The gnoll sergeant hits you but does no damage.Pggn  The gnoll sergeant blocks your attack.  The gnoll sergeant is heavily wounded.PggnPggo\5--2.5 (1.1PggXvPgguy[ _The gnoll sergeant barely misses you.PggF  You barely miss the gnoll sergeant.The gnoll sergeant is heavily wounded.PggEGF-30PggIPPggS< _You block the gnoll sergeant's attack.Pgg*  You barely miss the gnoll sergeant.The gnoll sergeant is heavily wounded.PggV+ d42-4.6 (1.1Pgg9 Pgg@= D _The gnoll sergeant hits you with a +0 trident.Pgg  You hit the gnoll sergeant but do no damage.The gnoll sergeant is heavily wounded.Pgg =3-Pgg &5.8 (1.2Pggj" Pgg& [ _The gnoll sergeant barely misses you.Pgg  You barely miss the gnoll sergeant.The gnoll sergeant is heavily wounded.Pgg5-6.9 (1.1PggPgg< _You block the gnoll sergeant's attack.Pgg  The gnoll sergeant blocks your attack.  The gnoll sergeant is heavily wounded.Pggo32----=8.1 (1.2PggPggD _The gnoll sergeant hits you with a +0 trident!Pgg  You hit the gnoll sergeant.  The gnoll sergeant is heavily wounded.PggK0-----Pgg--90PggPgg D _The gnoll sergeant hits you with a +0 trident.PggPt  You hit the gnoll sergeant but do no damage.The gnoll sergeant is heavily wounded.Pggt!-Pgg/u'80.3 (1.2Pgg~Pgg? _You block the gnoll sergeant's attack. x2Pgg  You hit the gnoll sergeant.  The gnoll sergeant is heavily wounded.Pgg (1.5Pgg Pgg < _You block the gnoll sergeant's attack.Pgg  You slash the gnoll sergeant!  The gnoll sergeant is almost dead.Pgg}^1=2.7Pgg!Pggs< _You block the gnoll sergeant's attack.Pggm`] _You block the gnoll sergeant's attack.  You slash the gnoll sergeant!  The gnoll sergeant is almost dead. _You block's attack.  You hit the gnoll sergeant.  The gnoll sergeant is almost dead.PggKa(3.9PgghPggok\ _The gnoll sergeant closely misses you.Pgg5@  You hit the gnoll sergeant.Pgg܇C)Pgg<6735.0 (1.1Pgg;PggR _You kill the gnoll sergeant!Pgg:I...###.# #.#.....## ⌠..>..⌠...#.....# #######.###### ...#### #......#  #.⌠.# ########......# ##...###......#......# #....#.###.#......#####.##.#.#####.'>@.#.##.##.#.#....(..#..###.#.##.......#.#####...### #.#.##.#####.#...# #.#.##.# #.##..#####.#.##.# #.##.# #.#.# PggJb2=-60PggQPggV+  Things that are here: PggVS_a +0 trident; a +0 scale mail; a +0 bucklerPgg%, ...###.# #.#.....# ..>..⌠...#.....# #######.###### ...#### #......# Pgg, o#.⌠.# ########......# # #...###......#......# #....#. ###.#......#####.##.#.#.####.'>)#.#.#.##.#.#....(..#.Pgg, ###.#.#.#.......#.#####...### #.#.##.#####.#.........#Pgg - #.# #.########..##.# #..Pggn-  Pgg4 Pgg4 G-7 _Pggo: Pgg< PggB*d#...###.#.#.#.....# Pgg*⌠..>..⌠...#.....#.#######.#######...#### #......#  #.⌠.# ########......#  #...###......#......# #....#  ###.#......#####.##.#.# ####.'>.#.# #.##.#Pgg8+ #....(..#.###.#.# #.......#.#####...### #.#. #.#####.#.........# #.#.# #.# #.########..#####.#.# #.# #..#  #.# #.#.###  #.# ###PggV+A #.#Pgg2Pgg2&8Pgg8PggI?~  Things that are here: _a +0 trident; a +0 scale mail; a +0 bucklerPggIPggƏPggO3PggPgg PggOPggPggPggPgg,Pgg՞Pgg}Pgg#4Pgg0=PggPgg,PggPggPgg,Pgg^Pgga5=PggPgg,PggSPggرPgg PggxPggPgg"S6=PggַPgg,Pgg¼PggL,PggPgg,PggPggoa7=PggPgg2,PggPggC,PggjPggPgg98PggPgg,PgguPggPggPggXPggPggS9=PggAPggPggPgg_Pgg/,PggPgg,PggPggPggSL40=PggPgg,PggPgg>,Pgg1Pggi1=PggPgg,PggPgg,PggPgga2=PggPgg0,PggPgg,PggPggPggPggPggGO3Pgg-Pgg,PggPggu,PggrPggPggN44=Pgg` Pgg ,Pgg Pgg ,Pgg Pgg  m5=Pgg Pgg@ ,Pgg Pgg7 ,Pgg PggK ,Pgg PggI a6=Pgg/ Pgg ,Pggg PggA 7=Pgg ,Pgg PggL ,Pgg Pgg! Pgg! %8Pgg_# Pgg)& ,Pgg& Pgg0( ,Pgg%) Pgg* ,Pgg3+ Pgg4, Pgg_, K9=Pgg9- Pgg. ,Pggh/ Pgg0 ,Pgg11 PggC2 Pggk2 O50=Pgg+3 Pgg4 ,PggN5 Pgg*8 ,Pgg9 Pgg; Pgg< K1=Pgg= Pgg? ,PggVA PggC ,Pgg:E PggG PggG PggPI PggNK PggK N2=PggL PggN Pgg%O PggP PggS ,Pgg>U PggW ;3PggY PggN[ ,Pgg<\ Pgge 4=Pggf Pgggh Pggh Pggj Pgg2l ,Pggm Pggo Pgg p U5=Pggp Pggq ,Pggr Pggnt Pggt Pggv PggEx Pggx K6=Pgg{ Pgg/} ,Pgg} Pgg ,Pgg$ Pgg 97Pgg~ 2=Pgg Pgg ,Pgg Pgg ,Pgg Pgg3 ,Pgg Pgg PggQ %8Pgg; Pgg ,Pgg Pgg$ ,Pgg Pgg Pgg K9=Pgg PggJ ,Pgg Pgg ,Pgg Pgg Pgg< V60=Pgg Pgg ,Pggī Pggѭ Pgg Pgg[ Pggx ,Pgg Pgg _ _You start resting.Pgg 1882.0 (94.0)Pgg Z1=3.0 (95Pgg Pgg " _HP restored.Pggi  You are illuminated by a small divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 1.1 (and is slowed by your shield).Pgg PggB   Your damage rating with your +0 long sword is about 13 (Base 10 x 105% (Dex) x _126% (Skill)).Pgg54PggPggF _Unknown command.Pgg.......#.#.....############# >..⌠...#.....# .......#######.###### #...#### #......# .⌠.# ########......# ######### #...###......#......# #....#... ###..........#......#####.##.#.# ####'>).............#.#. #.......##.#.....#....(..#..###.#.##.......#.#####...### #.#.##.#####.#.........# #.# #.########..#####.#.##.# #...................##.# #.###############.####.# ### #.##.# PggPgg /4.0 (1.0) Pgg  _Pgg(Pgg+Pgg2>..⌠...#.....# ....#######.########## #......# .⌠.# ########......# ########## ...###......#......# #....#... ##..........#......#####.##.#.#.#  ####.......'>).............#.#.# #.......##..#.....##....(..#..###.#.#Pgg#.......#.#####...### #.#.####.#####.#.........# #.#.# #.# #.########..#####.#.##.# #...................##.# #.###############.####.# ### #.##.#  PggؽPgg&5PggPggPggov >..⌠...#.....# #######.###### #### #......# ⌠.# ########......# # ###......#......# #....#...# .#......#####.##.#.#.# ####.......'>).#.#.# #.##.#.....##....(..#.###.#.#.#.#.#####...### #.#.##.#####.#...# #.#.# #.# #.#..##.# #...#.# #.### Pgg ~ Pgg~ &6Pgg PggY Pgg) ..⌠...#.....# #######.###### #### #......# .# ##......# # ###......#......# #....#...# .#......#####.##.#.#.# .'>).#.#.# #.Pgg* ##.#.....##....(..#.###.#.#...##.#.#####...### #.#.##.#####.#.........# #.#.# #.# #.##.#.# #...#.# #.#### Pggk3 9=Pgg$4 7Pgg9 Pgg; PggBPgg"C  Skill  Level Cost  Apt Skill  Level Cost  Apt Pgg a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0      Pgg'1 c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   5.4   1.0   0      e + Long BladesPgg8.9   9.0   0               f - Armour   3.0   4.0   0      Pgg+6 g - Dodging   0.0   1.0   0       h - Shields   5.4   6.0   0       i - Stealth   0.0   0.8  +1  Pgg@                        Pgg                    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  Pgg(}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsPggB Pgg Pgg D..⌠...#.....#Pgg@ %deadiverson the Carver ....#######.######Human of the Shining One ...... .#### #......#Health: 61/61 ======================== .# ########......# ##########Pgg Magic: 8/8======================== .###......#......# #....#...#AC: 13Str: 17 ..........#......#####.##.#.#.#EV: 10Pgg Int: 11 ###.......'>).............#.#.#SH: 9Dex: 12Pgg# #.......##............#.....### XL:  8 Next: 73% Place: Dungeon:5PggV #....(..#.....@.....###.#.#...# Noise: ---------  Time: 5887.0 (0.0)#.......#.#####...### #.#.##### a) +0 long swordPgg >#.#####.#.........# #.#.#Throw: 2 darts (poison)#.# #.########..#####.#.#Pgg #.# #...................##.# #.###############.###Pgg; #.# ####.##.##.##.##.#You are illuminated by a small divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 1.1 (and is slowed by your shield).  Your damage rating with your +0 long sword is about 13 (Base 10 x 105% (Dex) x _126% (Skill)). _Unknown command.PggI Pgg Pgg Pgg PggtW⌠...#.....# #######.###### #### #......# # ##......# #### PggHX###......#......# #....#...# #......#####.##.#.#.# .'>).#.#.#  #.##.#.....###  #....(..#.###.#.#...#  #.#.#####...### #.#.#####  #.#####.#.........# #.#.#  #.# #.#######  #.# #.....PggX  #.# #.###### PggbA8.0 (1PggIiPggjPggf Pgg[r Level 5 of the Dungeon <<<>>>>(Press ? for help)##.#############.# #.⌠.# ##.......###########.##.#####...(.......####...###....................##....###.########.#.........#.#.....###############...##.####.⌠..>..⌠...#.....##...##.##.........#######.######Pggs Y#...##.#####...#### #......##...##.##.⌠.# ########......# ########## ###.##.##...###......#......# #....#...# ###.##.####..........#......#####.##.#.#.# #.).##.#####.......'>).............#.#.# ###.#################.##.......##............#.....### #.....................##....(..#......@....###.#.#...#Pggis  ########################.......#.#####...### #.#.##### #.#####.#.........# #.#.##.# #.########..#####.#.##.# #...................##.# #.###############.###Pggs #.# ####.##.##.##.##.##.#####################.#PggLt t#.....).................##########################PggT.@Pgg B..Pgg$ B..Pgg B..Pgg! A..Pgg A..PggX A#.Pgg) A.#PggO #..########.........##.####...####.......##....[)..#.#..Pgg #.#.#..#.######## #########.##.##....###.......[.##.######.#.#..PggE #.......#..##...# #.............#.#....#.......#.##.# #.#.#.PggMF&.Pgg #......####.)...# #########.##..#.#.##.........#....# #...#..Pgg8 ##..#.## ###..)##.##..#.#.##...#######.###########.####### ..Pggjq ###### ##### ######.##..#.#..#.........).).................# .Pggr&.Pgg #.......#..#.##...#########.#.###############.### ..Pgg #.#######.........#............(................# ..Pgg ### #############.#######.##.##.####.######.#)################### #.PggX #.# #.#.##.................#....####.#....#.#.#.#Pgg #.# #.#.##.######.###.....##..#.........#.#÷#.#..Pgg #.# #.#.##.#####.....................<#.#.#.#.##.Pgg #.# #.#.##.##.....###.#.......................#.#PggPggMx #.# #.......'.....# #.........#########.#.#.############Pggx&.Pgg #.# ###.##.##.....######).##..#### #.#.#...........#.#Pggq #.#####.##.######..........#.....# #.#.#.#########.#..Pgg #.....#.##.##########.....##.###.# #.#...........#.#Pggj5..Pgg ###...#.##...................# #.# #.###.#####.###.##.Pgg/D #.#.#.#########.....###.#### #.# #.# #.# #.# #.#.#Pggț #.#.#.# ####..........#.######.######.###.# #.# #.#Pgg35..Pgg  #.#.#.###......######.#................##.# #.# #.#..Pgg #.###.#...##.### #.............##.......#.# #.# #.#..Pgg +  ##### #.#.......##.# ##.#.###########.###...#.# #.# #.#..Pgg Q  #...# #.#.#>..#.##.# #.#.##.# #...#.# #.# #.##Pgg5 &.Pgg +  #.#.# #.#.##....##.######.#.###########.# #...#.# #.# #.###Pgg<}  #.#.# #.#.####..##.##...................# #...#.# #.###.#Pgg} 5##Pgg#  #.#.#######.#.# ##....##.........########### #...#)# #.....#.Pgg &#Pgg  #.#.#.......#.# #...............#...#########...#.#############Pgg2 &.Pgg`6 B  #.............# #................†...............>...).......###Pgg<;#.PggK57..Pggo7..PggZ* 7..Pgg7;.>PggAXPggl.⌠...#.....#deadiverson the Carver ...#######.######Human of the Shining One ...... #### #......#Health: 61/61 ======================== # ########......# ##########Magic: 8/8======================== ###......#......# #....#...#AC: 13Str: 17 .........#......#####.##.#.#.#EV: 10Int: 11 Pgg`m##.......'>).............#.#.#SH: 9Dex: 12  #.......##............#.....### XL:  8 Next: 73% Place: Dungeon:5  #....(..#......@....###.#.#...# Noise: ---------  Time: 5888.0 (0.0)  #.......#.#####...### #.#.##### a) +0 long sword#.#####.#.........# #.#.#Throw: 2 darts (poison)#.# #.########..#####.#.##.# #...................##.# #.###############.####.# ####.##.##.##.##.#You are illuminated by a small divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 1.1 (and is slowed by your shield).  PggmYour damage rating with your +0 long sword is about 13 (Base 10 x 105% (Dex) x _126% (Skill)). _Unknown command.PggJnPgg2pPggd{Pgg.}Pggw}PggPggPggPggPggPggkPggPggPgg:PggPgg6PggkPggPggPgg?PggrPggPggPggWPggPggTPggPggPggUPggPggPgg PggBPggPggPggPgg-PggPggPggPgg6PggPgg1PggPgg2Pgg PggPgg,PggyPggPgg<PggvPgg PggPggPggPggPggPggU Pgg PggPgg2PggPggPggPgg,PggsPggPgg!!Pgg~"Pgg#,Pgg'Pgg^)Pgg)Pgg*Pgg.Pgg 0,Pgg1Pgg4PggZ6,Pgg*7Pgg=XPggBPgg)CPggCPggDPgg JBPgg&KPggbNPggkPPggPPggQPggrUPggVPgg.WPggXPggw[Pgg"]PggV]Pgg^Pgg`eXPgg2gPgghPgghPggiPgg:lPggm,PggnPggqPggsPggIsPgg9tPggvPggxPggxPggyPgg{Pgg}Pgg}Pgg~PggBPgg!PggͅPggPggPggnPggQPgg֍PggPgg~PggPgguPggPggEPggPgg֕PggPggzPgg%PggEPggPgg1PggPggPggPggcPggPgg$PggWPggȠPggFPggSPggPgg&PggPggPgg̦Pgg^Pgg #.........##.# #.......  #.#.......# #.# #....... Pgg%  ###.#.......### ##.####.......  #.............# #.............  #.#.#.......#.# #.............  #.#.#######.#.# ##....##....... PggH #.#.# #.#.####..##.##.......#.# #.#.##....##.######.#.Pggf# #.#.#@..#.##.# #.#.932.0 (4Pgg4.0)#### #.#.......##.# ##.#.Pgg PggG#.###.#...##.### #.... #.#.#.###......######.Pggޮ #.#.#.# ####..........Pgg  #.#.#.#########.....##  Pgg###...#.##..............  #.....#.##.##########...  #.#####.##.######....... PggPggPgg+lglowing. Your movement speed is average.r attack delay is about 1.1 (and is slowed by your shield).damage rating with your +0 long sword is about 13 (Base 10 x 105% (Dex) x _126% (Skill)). _Unknown command. _There is a stone staircase leading down here.Pgg.Pgg.Pgg1Pggr6Pgg3;83.0 (1.0) _PggG<Pgg ###....##.  ..... .. Pgg  #......# #  #...)..#.#  .####...#....  ...........#  ...........#.# 6Pgg7 .......@.....#  .............# Pgg`q.............+ ....)........#.........#####Pgg.........#.........#Pgg=########## PggPgg Pgg+8 (1.8PggPgg _You climb downwards.  Found a flail and a mace. _There is a stone staircase leading up here.Pgg4Pgg:PggF _Unknown command.PggxIPgg2PggPgg: _PggdPgg,PggPggPgg,PggPggPggPgg3PggPggPggʪ,PggPggPggPggPggPggyPggcPggμPggPggePggbPggPggPgg9Pggj,PggoPggwPgg,PggPggEPgg_,Pgg^Pgg7Pgg3PggzPggCPgguPgg,PggNPggnPgg+,PggPggPgga,Pgg9PggPgg,PggPggPgg,PggPgg Pggo Pgg Pgg PggPgg|,Pgg<Pgg8Pgg,Pgg.PggPgg ,PggQ!Pgg#Pgg3'Pgg+PggN,Pgg-Pgg0PggPggQ#.# #)##.# ###.#######.##)########## #..<.gg.....##..........# ...g...########....... ##++##.#......+.(.....##...######.......##.#.###+###...##Pgg&'.#.#.###.##55.8 (22.0)#...g......+  ........#######.###.##........# #.# #.#  PggX........## #.###.#  ......#.....###.....##PggZg   gnoll (polearm)  .....................+.........#...........##.#......#.######....#PggPggRPgg\ _A gnoll is nearby!Pggf  #.# #)##.#)########## <..........# #.......# +.(.....#  #...######.......#  #.#.##........#+##  Pggg #...##........'..#  #.#.##.....@..#.##  #...g............+  #######.###.##   #.# #.#   #.###.#  #.....##  .......+  .......#  ....# Pgg  #.# #)##.#)########## <..........# #.......# +.(.....#  #...######.......#  #.#.##........#+##  #...##........'..#  #.#.##.....@..#.##  #...g............+  #######.###.##   #.# #.#   #.#  Pgg #.....##  ...  ...  .Pgg Pggn Pgg Pgg \ _A gnoll is nearby!Pgg2 ((((((, poisoned)  You throw a poisoned dart. The poisoned dart hits the gnoll.PgglPggxp...(g..Pgg8y16.9 (1.1)Pgggy?dart (poison) PggPgg, _The gnoll is poisoned.Pgg  ((((((You throw a poisoned dart.Pgg3Pggȧ]....g.Pgg7-8.1 (1.2Pggc8Nothing quiveredPgg/v _The poisoned dart barely misses the gnoll.Pggſ ###.#######.##)##########..<.gg.....##..........# ....g...########Pgg_ # ##++##.#......+.(.....# #...######.......# #.#.##........#+## #...##.'..# #.#.##.#.## #...(.g....+........#######.###.## .# #.# #.# .## #.###.# #.....###.....## .....................+ #...........# #.#......#.######....# # ..#....#Pgg Pgg w.g90Pggk Pgg  PggF ###.#.##)##..<.gg.....##..# #....g...##.# #.##++##.#......+.(.....# [ #...######.......# #.#.##.#+## #...##.'..# #.#.##.#.## #...(..g.+ .#.###.## .# #.# #.# .## #.###.# ......#.....###.....## .......+ .#...........# #.#......#.######....#  # ..#....# PggPu56--=60 Pgg5V PggXE _The gnoll hits you from afar with a +0 halberd. Pgg ###.#.##)#  ###..<.gg.....##..#  #....g...#.#  Pgg! #.##++##.#......+.(.....# .[ #...######.......# # #.#.##.#+## #...##.'..# #.#.##.#.## #...(..g@..+ .#.###.##  PggX.# #.# #.#  .## #.###.#  ......#.....###.....##  PggH.+  .# Pgg.#  #.#......#.######....#  # ..#....# Pgg;?  Pgg1 Pggm Pgg3 _You block the gnoll's attack. Pggn  You hit the gnoll.  The gnoll is moderately wounded. Pggn-2.2 (1.1 Pgg8w Pggz3 _You block the gnoll's attack. Pgg`   You hit the gnoll.  The gnoll is heavily wounded.7--3.3 Pggqg  Pggj z _The gnoll closely misses you. The gnoll hits you but does no damage. Pgg )  You hit the gnoll but do no damage.The gnoll is severely wounded. Pgg (4.4 Pgg  Pgg i _The gnoll looks more healthy. The gnoll misses you. PggT  You barely miss the gnoll.The gnoll is severely wounded.5.5 Pgg_ Pgg3 _You block the gnoll's attack.!Pgg7  You hit the gnoll but do no damage.The gnoll is severely wounded.!Pgg68086.6!PggI=!Pgg??3 _You block the gnoll's attack.!PggA9  You slash the gnoll!!Pgg!C)!Pgg%057.7!Pggk,!Pgg/I _You kill the gnoll!!Pgg) ###.#.##)# ###..<.gg.....##...# #....g...#.......#!Pgg*T #.##++##.#......+.(.....#  .[ #...######.# ## #.#.##!Pgg5*.#+## #...##.'..#!Pgg-+ #.#.##.#.## #...(..@...+ .#.###.## ........# #.# #.#  .## #.###.#  ......#.....###.....##  .+  .#.#  #.#......#.######....#  # ..#....#!Pgg3!Pgg_4%-!Pgg480!Pgg :!Pgg>P _You see here a +0 halberd.!Pgge  ###.#.##)# ###..<.gg.....##....# #....g...#.......# #.##++##.#......+.(.....#!Pgg  .[ #...######.#  ## #.#.##.#+## #...##.'..# #.#.##.#.## #...(.@)...+ !Pgg# I.#.###.##!PggH  ........# #.# #.# ........## #.###.# !Pgg  ......#.....###.....##  .+  .#.# !Pgg  #.#......#.######....#  # ..#....#!Pgg< !PggE m9=-9 _!Pgg !Pgg !Pgg3  ###.#.##)# ###..<.gg.....##..........# #....g...#.......# #.##++##.#......+.(.....# .[ #...######!Pgg 5.# ## #.#.##.#+## #...##.'..# #.#.##.#.## #...(@.)...+ .#.###.## ........# #.# #.#!Pgg{  ........## #.###.# ......#.....###.....## .....+ .........#.# !Pggɐ  #.#......#.######....#  # ..#....#!PggÙ !PggC '70!Pgg "Pgg5M ###.#.##)# ###..<.gg.....##.# #....g...########.......# #.##++##.#......+.(.....# .[ #...######"Pgg6.# ## #.#.##........#+## #...##..'..# #.#.##.#.## #...@..)...+ .#.###.## "Pgg7..# #.# #.# ........## #.###.# ......#.....###.....## ........"Pgg7.+ .........#.# #.#......#.######....#  # ..#....#"Pgg?"Pgg4@&1"PggRM"PggEX"PggX60=2.7 (2Throw: 2 darts (poison)"Pgg _"Pgg`T _f - 2 poisoned darts"Pgg###.#.##)# ###..<.gg.....##.# #....g...########.......# #.##++##.#......+.(.....# .[ #...######."Pgg># ## #.#.##........#+## #...##..'..# #.#.##.#.## #....@.)...+ .#.###.## ..# #.# #.# "Pggj..............#."Pgg................"Pgg܆=#.#..... "Pgg"Pgg+3.7 (1"Pgg̙"Pggx"Pggl###.#.##)# ###..<.gg.....##..........# #....g...#.......# #.##++##.#......+.(.....# "Pgg.[ #...######.#  ## #.#.##.#+## #...##.'..# #.#.##.#.## #.....@)...+ "Pgg.#.###.## ........# #.# #.# .................. "Pgg%"Pgg[&&4"PggP,"Pgg."PggI  #.# #)##.# "PggGJ  ###.#######.##)########## ###..<.gg.....##...##....g...########.......# #.##++##.#......+.(.....#  .["PggJ #...######.......# ###.#.##.#+## #...##."PggJ '..# #.#.##.@......#.## "PggJ  #......).........+ ..#######.###.#"Pgg?K ^........# #.# #.#........## #.###.#......#.....###.....##"PggK ..+.........#...........##.#......#.#####"PggK !"PggbU "Pgg[V "PggV M1=5"Pgg}] "Pgg` "Pgg% #.# #.)..#  #.# #)##.#  ###.#######.##)##########  ###..<.gg.....##....##....g...########.......#  #.##++##.#......+.(.....# .[#...######.......# ##.#.##.#+## #...##.'..# #.#.##........#.##  #......).........+ .#######.###.#........# #.# #.#........## #.###.#......#.....###.....##..+.........#...........#"Pgg/ "Pgg0 &6"Pgg69 "Pgg: #PggtJ#.# #.)..# #.# #)##.# ###.#.##)### ###..<.gg.....##...# #....g...#.......# #.##++##.#......+.(.....# [ #...######.#PggDK2#  #.#.##.#+## #...##.'..# #.#.##.#.## #......)...+ .#.###.##..# #.# #.#........## #.###.#......#.....###..#PggK...##......+ #PggU#PggV&7#Pgg]#PggN_#PggS/..# ###### #.# #.)..#  #.# #)##.#  ###.#######.##)########## #..<.gg.....##...# #Pgg~....g...########.......# .##++##.#......+.(.....# #...######.......# #.#.##.#+## #...##.'..# #.#.##........#.##  #......).........+.#######.###.##.# #.# #.#..## #.###.#......#.....###.....##..+#Pgg+ #Pgg #Pgg 8#Pgg#PggN#Pgg&c### ..# ###### #.# #.)..#  #.# #)##.# #.#######.##)########## #..<.gg.....##...# ...g...########.......# #Pggc##++##.#......+.(.....# #...######.@.....# #.#.##.#+## #...##.'..# #.#.##........#.## #......).........+  .#######.###.##Pggd.# #.# #.#  .#Pgg~d.## #.###.#  ......#.....###.....###Pggo#PggpB=9#Pggw#Pgg{#PggM## .####.).  #.# #)##.# ##.#######.##)######### #PggĢ#..<.gg.....##...# ...g...########.. ##++##.#......+..######.......#.##..#+###...##........'..##.##.###.##Pgg,S80#Pgg#Pgg>+1.7 (2#Pggq03#Pgg#Pgg_ _f - 3 poisoned darts (gained 1)#PggO#Pgg#Pgg$X#PggT,#PggžB#Pggs#Pgg#Pgg#Pgg#Pgga#PggG,#Pgg#Pggn#Pgg@  There is an open door here.#Pgg5 _#Pgg#Pgg#Pgg#Pgg#Pgg#Pgg#Pgg B#Pggv ######.##)########## gg.....##..........# #Pgg..########.......### #.#......+.......# #...######.......# #.#.##........#+## ##.# .##........'..# ....# #.#.##........#.##.....$......)........@'......#Pgg>91.7 (10.0) ....#######.###.##....(. ....# #.# #.# ..... ....## #.###.# .... ..#.....###.....## ... .........+ .. .....#...........# . .....#.######....#  # ..#....# #Pgg_You open the door.#PggE _Found 8 stones.$Pgg3$Pgg1$Pgg$Pgg;.##)# .....##..........# #.......### .#......+.......#.. ...######.......#.# # .#.##........#+##.###.# ...##........'..#.....#. .#.##.#.##.....$. ......).........@.#.###.##....(.# #.# #.# ..## #.###.# ...#.....###.....##......+.l...l   iguana (asleep)#....#......#.######....#......#  0.0)  An iguana comes into view.l.l$Pgg2[23;28H2.7 (1$Pgg $Pggs _The iguana hisses angrily. _There is an open door here.$Pgg)).##...........#.# # ...#+##.###.# ....'..#.....#. ....#.##.....$. ).........@....... #.###.##....(..  #.# #.# .......   ....... ...... ....... ....... ......#  # $PggxU).##...........#.# # ...#+##.###.# ....'..#.....#. ....#.##.....$. ).........@....... #.###.##....(..  #.# #.# .......   .................... .............#  # $Pgg^$Pgg_$Pggh$PggkH _An iguana is nearby!$Pggl$Pgg).##...........#.# # ...#+##.###.# ....'..#.....#. ....#.##.....$. ).........@....... $Pgg#.###.##....(..  #.# #.# .......   ....... ...... ....... ....... ......#  # $Pgg~ ).##...........#.# # ...#+##.###.# ....'..#.....#. ....#.##.....$. $Pgg} <).........@....... #.###.##....(..  #.# #.# .......   .................... .............#  # $Pgg $Pgg $Pgg $Pgg1 ^ _An iguana is nearby!$Pggo ).##...........#.# # ...#+##.###.# ....'..#.....#. ....#.##.....$. ).........@....... #.###.##....(..  #.# #.# .......   ....... ...... ....... $Pgg/ a....... ......#  # $Pggz ).##...........#.# # $Pggz ...#+##.###.# ....'..#.....#. ....#.##.....$. ).........@....... #.###.##....(..  #.# #.# .......   .................... .............# $Pgg%{ ; # $Pgg 4$Pgg t _An iguana is nearby!$Pgg.....##..........# ######### #......+.#.. #.######.#.# .# #.##........#+##.###.# #.##........'..#.....#.# #.##........#.##.....$.#....)..'.......#######.###.##@...(..## #.# #.##.......### #.###.##.# #.....###.....##l#..............+..##.#.######....#......##  # ..#....##.####.#....+$Pgga$Pgg:l.$Pgg-3 _$PggI$Pgg%Pgg# ########## #......+.. # ..######..# . #.##........#+##.###.# # ....'..#.....#. #.#.#$ .....).........'........#######.###.##....(..# #.# .###.##l #.....###.....##. ...............+.##l   iguana+.....$.#.#..#.##...#%Pgg+9  Found 7 gold pieces.%Pgg4,.=4%Pgg 1%Pgg 6> _The iguana bites you but does no damage.%Pggѽ%Pgg@-5.9 (1.2%PggL%PggC _You closely miss the iguana. The iguana closely misses you.%Pgg;  You closely miss the iguana.7.0 (1.1%Pgga%Pgg> _The iguana bites you but does no damage.%Pgg} %PggU~ (8.1%Pgg %Pgg p _You barely miss the iguana. You block the iguana's attack.%Pgg %Pgg (9.2%Pgg %Pgg  %Pgg _You closely miss the iguana. The iguana closely misses you.%Pggy0-6000.3 _You barely miss the iguana. The iguana bites you.&PggB10&Pgg _You barely miss the iguana. The iguana completely misses you.&PggT:  You hit the iguana.  The iguana is moderately wounded.1=2.4 (1.1 _The iguana bites you but does no damage.&PggW  You slash the iguana!  The iguana is severely wounded.&Pgg&PggE0=3.5&Pgg(&PggT _The iguana closely misses you.&Pgg[ :  You slash the iguana!&PggNf D.&Pggk . 8&Pggk -4.7 (1.2 &Pggl =_You kill the iguana!&Pgg"s &Pggu l _Your Long Blades skill increases to level 9!&Pggu N-&Pgg &PggR H _No target in view!&Pgg&Pggq&Pgg,&Pgg(&Pgg: _&Pgg &Pgga&Pgg9=&Pggs&Pgg&Pgg˞,&Pgg&Pggn&Pgg&Pgg&Pggѣ&PggK&Pggy,&Pgg&Pgg,&Pgg%&PggN _You now have 157 gold pieces (gained 10).&Pgg&Pgg6&Pgg_&Pgg&Pgg&Pgg%&Pgg &PggO&Pgg,&Pgg,&Pgg&Pgg&Pggd&Pgg&Pgg&Pgg%&PggY&Pgg&Pgg&Pgg&Pgg&Pggt&Pgge5.......'..#.....#.#... .&Pgg#.##.......#.#### ).........'............. ####.###.##....(..#.#### &Pgg #.# #.##.......# #  #.###.##.......# # &PggI###.....##.......#.#.#........+.....................#.....&Pgg##- ######....#......##.### &Pgg0 ..#....#......# ... ####.#....+.....$. #.... &PggYA#..#.##...##.....# .......##.....# ...s   scorpion (wandering) &Pgg#....##...## ...........#s....# ......####.#&Pgg016.7 (12.0)&PggRSss.&Pgg?F-7.7 (13&PggD&Pgg:[ _A scorpion comes into view.'PggMc ##.......#.#### ).'............. #....(..#.####  #.# #.##.......# #  #.......# # #.......#.#.#. +............. #.....@.....## #......##.### 'PggM #......# ... +.....$. #.... ##.....# .... #.....# ... #s....##.....#'PggN'Pgg ##.......#.#### ).'............. #....(..#.####  #.# #.##.......# #  #.......# # #.......#.#.#. +............. #.....@.....## 'Pgg#......##.###  #......# ... +.....$. ##.....# #.....# ... #s....##.....#'Pgg'PggQ'Pgg'Pgg _ _A scorpion is nearby!'Pgg ##.......#.#### ).'............. #....(..#.####  #.# #.##.......# #  #.......# # #.......#.#.#. +............. #.....@.....## #......##.###  #......# ... +.....$. #.... ##.....# .... 'Pgg#.....# ... #s....##.....#'PggX ##.......#.#### ).'............. #....(..#.####  #.# #.##.......# #  #.......# # 'Pgg#.......#.#.#. +............. #.....@.....## #......##.###  #......# ... +.....$. 'Pgg ##.....# #.....# ... #s....##.....#'Pgg{4'PggZ'Pgg_ _A scorpion is nearby!'Pggw %.#.##.......#.#### .).........'............. #####.###.##....(..#.####  #.# #.##.......# #  #.###.##.......# # # ..###.....##.......#.#.#. ...........+.............'Pgg c.#.....## .######....###.##  ..#....#......# ... .####.#....+.....$..#.... .#..#.##...##.....#.#.... ....#.##...##.....#.# ... 'Pgg ##....##...##s....# # ............#.....# 'Pgg6 K#####.#.....# 'PggQ ^#...)..#.# .#'Pggk 'Pgg 'Pgg @s...'Pgg #8'Pgg .0) _'Pgg" 'Pgg 'Pgg8 ).........'....... ######.###.##....(..#.#### #.# #.##.......# # # #.###.##.......# # # ...###.....##.#.#.#...........+....... #.#..## #.######....###.## # ..#....#...@..# ... #.####.#....+.....$..#.... #.#..#.##...##.....#.#.... #....#.##...##.s...#.# ... ###....##...##.....# # .............#.....#  #####.#.....#  #...)..#.# .#.....##...#....# #'Pgg9 'PggCF <s.'PggG &9'PggO 'Pgg!S 'PggT######.###.##....(..#.#### #.# ...# # ###.##..# # 'Pgg,...###.....##..#.#..........+..... ##...##########.###  ..'PggY?#... .####'Pgg+...@.$..#......#.##...##..s..#.'Pggs##.....#.# ##...'Pgg| # ............. 'Pgg^ #####)..#.# 'PggB##...#....# ##..... ........#.#'Pgg'Pgg%='Pgg< 20'Pgg'Pgg6 _You block the scorpion's attack.(Pgge  You barely miss the scorpion. You block the scorpion's attack.(Pggf-1.8 (1.1(Pggn(Pgg@qV _The scorpion closely misses you.(Pgg:  (PggK~You slash the scorpion!  The scorpion is heavily wounded.(Pgg5=3.0 (1.2(Pggn(PggNA _The scorpion stings you but does no damage.(Pgg Z  You hit the scorpion but do no damage.The scorpion is heavily wounded.You block the scorpion's attack.-4.1 (1.1 _The scorpion stings you but does no damage.(Pgg! T  You barely miss the scorpion.(Pgg7" MThe scorpion is moderately wounded.(PggR# B-5.2(Pgg) (Pggr- A _The scorpion stings you but does no damage.(Pgg (Pgg޹ You closely miss the scorpion.The scorpion is moderately wounded.(Pgg-6.4 (1.2(PggV(PggN _The scorpion misses you.)Pgg  You hit the scorpion but do no damage.The scorpion is moderately wounded.)PggK-7.5 (1.1)Pgg)Pggw _You block the scorpion's attack. The scorpion closely misses you.)Pgg  You hit the scorpion.  The scorpion is heavily wounded.80)Pggk)Pggg6 _You block the scorpion's attack.)PggwM  You hit the scorpion but do no damage.The scorpion is heavily wounded.)PggM-9.7 (1.2)Pgg2U)PggWU _The scorpion barely misses you.)Pgg(  You slash the scorpion!  The scorpion is almost dead.)Pgg`) .30.8 (1.1)Pgg- )Pggy/ V _The scorpion closely misses you.)Pgg1 :  You hit the scorpion.)Pgg 2.)Pgg 6852.0 (1.2)Pgg )Pgg: L _You kill the scorpion!*Pgg&{  #.# ...# # ###.##..# # ...###.....##.#.#..........+..... ##....##########.###  ..#... .####+.....$..#......#.##...##..@..#.#.#.# ##... # #...... ........#.#-30*Pggƀ*Pggq*Pgg*Pgg*PggZ,*PggL*PggB*Pgg _You now have 164 gold pieces (gained 7).*PgglX*PggG*PggX*PggF.......'...... *Pgg&.###.##....(..#.#### *Pgg#.# #.##.......#.#.. #.###.##.......#.#.# ##.......#.#.#. .......+............. ............## ##...*Pgg..##.####... ..#....#......##@....... *Pgg-#....+........#....... .##...##.....#.#....... #.##...##.....#.#......# ..##...##.....#.#o..o.# ........#.....#.#.....o#oo 2 orc priests (asleep) ...####.#.....#.#......#*PggSooo 3 orcs (asleep) )..#.# .#.....#.#...oo.# #....# ##.......*Pgg 41.0 (8  3 orcs and 2 orc priests come into view.Found a book of Callings.*Pgg*Pgg*Pgg  The orc shouts! x3; The orc priest shouts!  The orc priest calls down the wrath of Beogh upon you.*PggU&...#.o:.oo.ooooooo.5----===2.0 (9*Pgg2*Pgg<' _Beogh smites you!*PggS  ..(..#.####  ....#.#.. ...#.#.# ..#.#.#. ....... ....## #.####... #@....... .......#....... .....#.#....... .....#.#.o....# .....#.#.:.oo.# .....#.#......# .....#.#....o.# )..#.# #.#...o..#  *Pgg "*PggI. Y ..(..#.####  ....#.#.. ...#.#.# ..#.#.#. ....... ....## #.####... #@....... *Pgg. .......#....... .....#.#....... .....#.#.o....#.....#.#.:.oo.#.....#.#......# *Pgg/ .....#.#....o.# )..#.# #.#...o..# *PggI> *Pgg> *Pgg'M *PggjR d _There are monsters nearby!*Pgg9;  ..(..#.####  ....#.#.. ...#.#.# ..#.#.#. ....... ....## #.####... #@....... .......#....... .....#.#....... .....#.#.o....# .....#.#.:.oo.# *Pggz; .....#.#......# .....#.#....o.# )..#.# #.#...o..# *Pgg; , *Pgg ..(..#.####  ....#.#.. ...#.#.# ..#.#.#. ....... ....## #.####... #@....... .......#....... .....#.#....... .....#.#.o....#.....#.#.:.oo.#*Pgg h.....#.#......# .....#.#....o.# )..#.# *Pgg8#.#...o..# *Pgg4*Pgg*Pgg4d _There are monsters nearby!,PggjJ##.###.##....(..#.####  #.# #.##.......#.#..  #.###.##.......#.#.##.....##.......#.#.#. ........+..............#...........## ####....#......##.####...  ..#....#......##........ ##.#....+.......@#....... .#.##...##.....#.#....... .#.##...##.....#.#.o....# ...##...##.....#.#.:.oo.#.......#.....#.#......#####.#.....#.#....o.#)..#.# .#.....#.#...o..# ,Pgg;k.#....# ##....... ....#.# #.,Pggpv,Pggvwm2-------3.0 (1 _,Pgg,Pgg-Pgg&X---4-Pgg--Pggl/-Pgg-Pggoo   orc-Pgg&5-Pgg-Pgg-Pgg9-PggGoo   orc priesto   orc-PggH=3=6.2 (1.2-PggsU-Pgg1Zs _You barely miss the orc. The orc hits you but does no damage..PggT.Pgg^.PggTbo.oo 2 orcs.Pggb,70.Pggn.Pgges _You hit the orc but do no damage. The orc barely misses you..Pgg_5  You hit the orc..Pggbj  The orc is heavily wounded..Pggd.Pggsoooo   orc priestooo 3 orcs.Pggct-8.3 (1.1.Pgg.Pgg_: _The orc hits you but does no damage..Pgg 7  You slash the orc!.Pggr ) 2 orcsYou kill the orc!.Pgg .PggjL .Pgg8N .PggL\ o.o 2 orc priests   orc.Pgga V4=9.4.Pggr .Pggx m _The orc priest looks encouraged for a moment./Pgg1>  You slash the orc priest!/Pgg<2/PggA .o.   orc priestThe orc priest is severely wounded./PggxC1=50.5/PggM/Pgg^R8 _You block the orc priest's attack./Pggf|  You hit the orc priest.  You kill the orc priest!/Pggi/Pgg4k/Pgg8s,/Pgg o.oo The Shining One accepts your kill.The orc priest invokes the aid of Beogh against you./Pggl39------91.6/Pggj/Pgg+' _Beogh smites you!0Pgg5  You hit the orc.0Pgg o. The orc is moderately wounded.0PggHl40-------2.70Pgg70Pggv: _The orc hits you but does no damage.0Pgg 7  You slash the orc!0Pgg 0PggN 0Pgg- ..o   orc0Pggw B-3.80Pgg 0Pgg, G _You kill the orc!1Pgg  You hit the orc.  The orc is severely wounded.1Pgg@ oo   orc priesto   orc1Pgg (4.91Pgg 1Pgg : _The orc hits you but does no damage.1Pgg67  You slash the orc!1PggE )  You kill the orc!1Pggg1Pgg1Pgg^1=6.01Pgg#1Pggm _The orc priest looks encouraged for a moment.2Pgg.......'............. #.###.##....(..#.#### #.# #.##.......#.#.. .###.##.......#.#.# #.....##.......#.#.#. +............. .......#...........## ###....#......##.####... ..#....#......##@.o..... #.#....+........#....... #.##...##.....#.#....... #.##...##.....#.#......###...##.....#.#.:....#....#.....#.#......# ..####.#.....#.#2Pgg......# )..#.# .#.....#.#......# #....# #2Pgg2PggK0o.2Pgg4-702Pgg2Pggp _Items here: )))) [ ††.2Pgg/ f  You hit the orc priest.  The orc priest is lightly wounded.2Pgg 5=8.1 (1.12Pgg* 2Pgg' A _The orc priest hits you but does no damage.2Pgg'  You hit the orc priest.  The orc priest is moderately wounded.2Pgg V2=9.22Pgg 2Pgg 8 _You block the orc priest's attack.3Pgg^  You hit the orc priest.  The orc priest is moderately wounded.3Pggݑ)60.33Pgg3PggҞX _The orc priest closely misses you.3Pgga  You barely miss the orc priest.The orc priest is moderately wounded.3PggU,103Pgg23Pgg[ _The orc priest completely misses you.3Pggo  You hit the orc priest.  The orc priest is heavily wounded.3PggpI32.4 (1.13Pggz3Pgg~W _The orc priest barely misses you.3Pggv  You hit the orc priest.  The orc priest is heavily wounded.3Pgg 8*3Pgg]  The orc priest calls down the wrath of Beogh upon you.3Pgg8@3Pgg"d38--303Pggy*3Pgg.4 _Pain shoots through your body!4Pgg   You hit the orc priest.  The orc priest is almost dead.4Pgg &44Pgg4Pgg+W _The orc priest barely misses you.4Pgg|  You hit the orc priest.  You kill the orc priest!4PggC)4Pgg6935.5 (1.14Pgg4PggX _The Shining One accepts your kill.4Pgg ###.##....(..#.#### .# #.##.......#.#.. .###.##.#.#.# .....##.#.#.#. ......+...... #.4Pgg ..## ### ##....#......##.####.... .#....#......##))....#....+..#@. .##...##.....#.#. 4Pgg8 .##...##.....#.#......## .##...##.....#.#.:....#.....#.....#.#..4Pgg s....#####.#.....#.##.# .#.....#.# ....# #...##+### 4Pgg 3..#.# 4Pgg 4Pgg3 H9=-4Pggb $-64Pgg 04Pgg 4Pgg 4Pgg-# #.##.......#.#.. ###.##.#.#.# ...##.#.#.#.+...... #.4Pggo..######. #....#......##.####.........#......##)).... #....+..#.. ##...##.....#.#. 4Pgg##...##.....#.#......## ##...##.....#.#.:....# 4Pgg9w.....#.....#.#......#####4Pgg]#.# .# #4Pgg~...##+####.# #........4Pggb#.# ...4Pgg4Pggho40=-74Pgg4Pgg5Pgg ## ......#.#.#..+............#.....######. ###.####....#))...+5Pggm3..#.#...##.....###.:....# .......... ...#5Pgg5PggF&85Pgg5PggA5Pgg'7 .....+............#.....######. ###.####....#))...+..#.#...##.....###. .......####..... ...#5Pgg@5Pgg)A\3=95PggH5PggTX  You pick up a book of Callings and begin reading...5PggT,70.5 (25PggZ5Pgg^  You add the spells Summon Small Mammal, Call Imp, Call Canine Familiar and _Summon Blazeheart Golem to your library.5Pggn I5Pggr 5Pggu ,5Pggz 5Pggz k44==5Pgg 5Pgg ,5Pgg 5Pgg| 5Pggɋ 5PggV 5Pgg 5PggВ 5Pgg= 5Pgg 5PggO W5=5Pgg# 5Pggy ,5Pgg 5Pgg 5Pgg! 5PggR 5PggB 5Pggժ 5Pgg D6=5PggѬ 5Pgg ,5PggƲ 5PggG 5Pggn 5Pgg 5Pgg 5PggC N7=5Pgg 5PggT ,5Pgg 5Pgg) ,5Pgg 5Pgg ,5Pgg 5Pgg 5PggG %85Pgg) 5Pgg ,5Pgg 5Pgg ,5Pgg 5Pgg: 5Pggs K9=5Pgg/ 5Pgg ,5Pgg* 5Pgg ,5Pgg 5Pgg 5Pgg $505Pgg 2=5Pgg 5Pgg ,5Pgg 5Pgg~ ,5Pgg 5PggU,5Pgg5Pgg5Pgg#15Pgg(=5Pgg5PggE2=5Pgg,5Pgg,5PggQ#5Pgg(5Pgg)%35Pgg*5PggN25PggT;z   wight (wandering)z5PggVE1102.5 (32.0)5Pggm8Pgg.\  You hit the wight.  The wight is lightly damaged.8Pgg]7==8Pgg2.6 (1.18Pgg8PggS _The wight closely misses you.8Pgg!\  You hit the wight.  The wight is lightly damaged.8Pgg"#38Pgg" 08Pgg*8Pgg.R _The wight barely misses you.8PggS  You completely miss the wight.The wight is lightly damaged.4.7 (1.18Pgg  8Pgg  8Pgg c_You block the wight's attack. The wight closely misses you.8Pgg  You slash the wight!  The wight is severely damaged.8PggD V49---=8Pggk 5.88Pgg; 8Pgg = _The wight hits you with a +0 battleaxe!9Pggu  You hit the wight.  You destroy the wight!9PggD)9Pggܢ89-6.99Pgg9PggX _The Shining One accepts your kill.9PgglV ## .......+......#.....######. ####.####.... .#))...+..#.#...##.....###. ........# ....#....#9Pgg]9Pgg^0--9Pgg^%709Pggd9Pggjl  Things that are here: _a +0 battleaxe; a +0 robe:PggM3:Pgg":PggÆ:Pgg : _:PggÍ:Pgg'N50---:Pgg:Pgg,:PggP:Pgg#,:Pggq:Pgg:PggK1=:Pggգ:Pggh,:PggB:Pgg:Pggų:Pgg:Pgg%N2=:Pgg:Pgg\:Pgg:Pgg$:Pgg:Pgg:Pgg]:Pgg:Pgg:Pgg:Pgg.:Pggh%3:Pgg|:Pgg:Pgg:Pggb:Pgg:Pgg:Pgg:Pgg:Pgg#4:Pgg (=:Pgg:Pgg0,:Pgg:Pgg,:Pgg:PggG:Pgg}#5:Pgg2=:Pggy:Pgg:Pgg:PggO:Pgg:PggL:Pgg:PggV :Pgg :Pgg :PggO:Pgg:PggD6=:Pgg:Pgg:Pgg:Pggo:Pgg,:Pgg!:Pgg$k7=:Pgg~%:Pgg),:Pgg+:Pggl/,:Pgg-1:Pgg4:Pggr5%8:Pgg7:Pggd=:Pgg=:Pgg(?:PggB:PggB:PggD:PggI:PggLI:PggM:PggSa9=:PggV:Pgg^B:Pgg5a:Pgg}a:Pgg c:Pggg:PgghV60=:Pggi:Pggn,:Pggo:Pgg0t,:Pggu:Pgguz:PggzK1=:Pgg:Pgg'1 _HP restored.:Pgg:Pgg:Pgg:Pgg:Pgg:Pgg":PggB:Pgg_:Pgg:Pgg۞:Pggf:Pgg:Pgg:Pgg٦9=:Pgg?:Pgg1:PggS..#......##.####......#......##)).........+........#..........##.....#.#......... ...##.....#.#).....##. ..##.....#.#......# ...#.....#.#......# :PggBr###.#.....#.#......#  .#.....#.#...@..# - ##........##'### # #........+... # ......## ......## ......##....s s   scorpion (asleep)+ #......#  #....... ##:Pgg_J 59.9 (42.0)  You open the door.:Pggiw .  A scorpion comes into view.:Pgg?-60.9 (43:Pggs:Pgg5 _The scorpion moves out of view.:Pgg@ :PggA :Pgg7C :PggJ :Pgg(T o))...+..#..##.....#.#... ).....##. .. ###:PggiT M. .#  ##........##@### #........+......... ......##........:PggT .....#...s(....$.:PggT + ...s   scorpion:PggT >#.. :PggT >###... :PggU :PggX ,0.0):Pgg0e As.:PggDi +1.9 (1:Pgg:o :Pgg]s z _Found 3 stones and 9 gold pieces. _There is an open door here.;Pgg)) #.......... #......... #).....##. ;PggU#......# #......# #......#  #......#  ;PggR#@###  +......... ;Pgg؛ ##...s....  #.....(..  #......$.  #........ ;PggHl #........  #...##... ;PggH5)) #.......... #......... #).....##. #......# #......# #......#  #......#  #@###  +.........  ##...s....  #.....(.. #......$. #........  #........ #...##... ;Pgg>4;PggF;PggwI_ _A scorpion is nearby!;Pgg+..#.. ##.....#.#......... ##.....#.#).....##. ##.....#.#......# .....#.#......# ##.#.....#.#......#  .#.....#.#......# . # #...##'####.... # #.+..@....... # ;Pgg1##...s # ......##.....( # ......##......$ +  #.. # #. # #...##;Pgg,i #...# .;Pgg;Pgg:s.;Pgg*.=2;Pgg;PggA _The scorpion stings you but does no damage.;PggJ <3;Pgg ;Pgg; _You hit the scorpion but do no damage. The scorpion closely misses you.;Pgg؋  You hit the scorpion.  The scorpion is moderately wounded.;Pgg{-5.0 (1.1;Pggb;PggV _The scorpion closely misses you.@Pgg>@Pgg@@PggC@PggG@PggLP _@PggP,@PggjR@PggS@PggV@PggW@Pgg/X@PggyZ@Pgg]@Pgg^@PggI_@Pgga@Pgg*if..#.#......# ..... ..#.#......##........#.#......##.....#..#.#......##.....#.....##'####.....# . ........+...........##.. @Pggi ......##.............  ......##.....(.......>  ......##......--73.4 (4.0 #..... #........... #...#. #...#@Pggujm! #...### #... #.......####....#@Pgg{\--4.4 (5@Pggd}@PggJ _Found a stone staircase leading down.@Pgg+5.4 (6@Pgg̔T _You now have 173 gold pieces (gained 9).@Pgg}D @PggD @PggF @PggK @PggN @PggNO @PggS ,@PggW @Pgg6X @PggY @Pgg\ @Pgg_ ,@PggGa @Pggc @Pggg @Pgg;h @Pggi @Pggp @Pgg|t @Pggt @Pggv @Pggx @Pgg0| ,@Pggp} @Pgg: ##'####.....# ..# +...........##..# @Pggt ##..............# ##.....(.......>+ ##..............#  #.....# @Pgg #......#  #...##.........# @PggÆ #...##.# #...##.### @Pgg F#... #.# ### #.......##.......#@Pggo Y#.......##.....#####.###  h - a viscous amethyst potion@Pgg '81@Pgg +2.4 (7@Pgg @PggB , _You see here 7 stones.@Pgg @Pgg  There is a stone staircase leading down here.@Pgg׬ 7 _You open the door.@Pgg @Pgg @Pgg @Pgg @PggD @Pggv @PggW ,@Pgg @Pgg @Pgg @PggV @Pgg @PggA @Pggc @Pgg @Pgg` B@Pgg @PggU ,@PggU @Pgg @Pgg @Pgg! @Pgg @Pgg @Pgg B@Pgg @PggE @Pggk @Pgg @Pgg @Pgg ,@Pgg @Pgg @Pgg ,@PggZ @Pgg @Pgg ,@Pggi @Pgga @Pgg ,@Pgg @PggX @Pgg .#### ...... ..> .#### #.. .#.. #.. .#.# . #.. ..#.#.#. ..# #.. ........ ....#.. ......######....#### .##.####........@..#201.4 (19.0) .##)).........#.##.####### ...#..........#+##........ .#.#............@Pgg Q..#####.## .#.#).....##.......## .#.#......##........# .#.#......##........# .#.#......##.....#..## .#.#......##.....##..#@Pgg @Pggc ,2.4 (20@Pgg @Pgg ; _Found a stone staircase leading down.APggvBAPggBAPgg_CAPgg]FAPggvJ,APggwO,APgg7QAPggQAPggRAPggXAPgg[APggK\APgg]APgg_APggc,APggdAPggkAPggnAPggnAPggoAPggrAPggv,APgg-xAPggzAPgg~,APgg`APggAPgge,APggAPggAPggAPggΡ#.. #.#.# # #.# #.#.# .# .o. #.###.#.# #.# ## .. #.....#.#... .#.. #.......#.#### .#.... '............. ....>## # #....(..#.#######.##... .. #.......#.#.......##..## .# #.......#.#.#...@# #...# ..# #.......#.#.#....###...#...# +..........#.....# #.....######....## #......##.####...........# #......##)).........#.##.####### o   orc priest (wandering) +........#....#+##........ ##.....#.#..............#####.## ##.....#.#).....##.......##APgg[mAPgg 210.4 (8.0)APgg+1.4 (9APggAPggMx _An orc priest comes into view. It is wielding a +0 club.APggs + #.#.# # #.#.# .# .o.  #.# ## ..  .#..  .#....  ....>## # (..#.#######.##... .. #.......##..## .# #...@# #...# ..# #....# .......... ...######....#### .#.......# )).# .# . ) APgg #.#.# # #.#.# .# .o.  #.# ## ..  .#..  .#....  ....>## # (..#.#######.##... .. #.......##..## .# #...@# #...# ..# #....# .......... ...######.....#.....)).# .#.)APgg94APgg@APggb _An orc priest is nearby!APgg # #.... .. #.#.# # .o .# #.#.# .# .o .###.#.# #.# ### .....#.#... ..#.. .#.#### ##.#.... ............. .....>## # ....(..#.#######.##... .. .#.#......@##..## .# .APgg #.#.#....###...# ..# .#.#.#....###...#...# .......#.....# .....######....#### ......##.####.....# ......##))#.##.####### o   orc (wandering) ........#.#+##.............#.#..............#####.##APgg  An orc comes into view. It is wielding a +0 dagger.The orc shouts! The orc priest shouts! You hear a shout!APgg APgg+ ..oo  You hear an angry growl.APgg+ 4==2.4 (1APgg5 APgg: 0 _The orc moves out of view.APgg M.## #.... o..  ....  .# ...o.###.#.# #.# ### .o.).#.#... ..#...o..#.#######.#...... APgg #................>## #(..#.#######@##... ........##..## #.#....###...# .......#.#.#....###...#...#.o   orc priestowizard (wandering)APgg voo 2 orcs (1 wandering)APgg3  An orc wizard and an orc come into view.Found a dagger.APgg4 APgg8 ]  The orc wizard shouts! The orc shouts! You hear a shout!APggv9 APgg: APggL !.oo..ooo.oo 3 orcsAPggL .=3APggW APggc q _An orc comes into view. It is wielding a +0 club.BPgg5## ##### . ## #.... ...o. # # ..o  .# #. ....###.#.# #.# .### ..o)#.#... ..#.ooBPgg#.#######.#...... ............@...>## #(..#.#######.##..... ..#.......##..### #....###...# #.#.#....###...#...#.........#..........######....###.####.....# ##)).##.#######BPgg   The orc priest mumbles some strange prayers to Beogh against you.BPggx BPggd BPggT BPgg+..o..o   orcBPggTb51-------4BPggW$BPgg")' _Beogh smites you!BPggLM M ## ##### . ## #.... .. .. # # ....  .# #. ..... .###.#.# #.# #.### .o.).#.#... #...#.o....#.#######@#.o.... ................>## #(..#.#######.##..... .. .......#.#.......##..### .#..#.#..##BPggM Z.####.....#BPggzU BPgg^ }.oo   orc wizardBPgg_ P---5BPggh BPgg l CPgg*CPgg+CPgg7o.oopriesto   orc wizardCPggK8A--6CPggACPggECPggSv>  You slash the orc wizard!CPggA .o   orc wizard  The orc wizard is almost dead.2------==7.5 (1.1CPggCPgg8 _You block the orc wizard's attack.CPggU* <  You hit the orc wizard.CPgg#, CPgg- CPgg7  ooo   orc priesto   orcCPgg8 8You kill the orc wizard!CPgg< g48-5-8.6CPgg}F CPggJ = _The orc priest hits you with a +0 club.DPggY,<  You hit the orc priest.DPgg7o)-90DPggADPggx8 _The orc priest is lightly wounded.DPgga  You hit the orc priest.  The orc priest is moderately wounded.DPgg9 DPgg} DPgg o.o o 2 orcsDPgg \9-20.7 (1.1DPggI DPgg 8 _You block the orc priest's attack.DPggBd  You barely miss the orc priest.DPgg o.  The orc priest is moderately wounded.10DPggPDPgg5T _You block the orc priest's attack. You block the orc's attack.EPgg  You barely miss the orc priest.The orc priest is moderately wounded.The orc hits you but does no damage.EPgg`EPgg EPgg&2EPgg=EPggb _The orc priest miscasts a cantrip.EPggC\  You hit the orc priest.  The orc priest is severely wounded.EPggY]&3EPggLgEPggk] _The orc hits you but does no damage. You block the orc priest's attack.EPgg9  You barely miss the orc priest.The orc priest is severely wounded.The orc priest hits you but does no damage.EPgg: 6504.8 (1.1EPggD EPgg)H 1 _You block the orc's attack.FPgg$~  You slash the orc priest!  You kill the orc priest!FPggFPggFPgg7oo.oo 2 orcsFPgg065.9FPggFFPgg FPggR_The Shining One accepts your kill.FPgg27  You slash the orc!FPggV  You kill the orc!FPggO$ooFPgg4760FPggFPgg 1 _You block the orc's attack.FPgg ## ##### .# #.... #.... .. #.#.# # #..#.# #. .....#FPgg #.# #.### ...).....#.#... #...#........#.#######.#...............@oo.>## #(..#.#######.##..... .....#.#.......##..### .# #....###...# ....###...#............#.....# ######....#####.####...........))...#.##.FPgg $#######FPgg FPgg FPggd S.oFPggA \1=-7FPgg FPgg m _Items here: $ )) [ †.GPggn7  You slash the orc!GPgg| )   orcYou kill the orc!GPggG.=8GPggGPggΎQ _The orc closely misses you.GPgg  You hit the orc.  The orc is moderately wounded.GPggGPgg.30.0 (1.1GPggMGPgg~1 _You block the orc's attack.GPgg8  You hit the orc but do no damage.The orc is moderately wounded.2=1.1GPgg @GPggIF: _The orc hits you but does no damage.GPgg  You barely miss the orc.The orc is moderately wounded.GPgge(2.2GPggiGPgg@: _The orc hits you but does no damage.GPgg  You hit the orc.  The orc is severely wounded.3.3GPgg. GPgg 1 _You block the orc's attack.GPgg 6 x  You hit the orc.)GPgg7 4340GPggX= GPgg3? G _You kill the orc!GPgg4GPgg GPggĪH _No target in view!HPgg23HPgg3HPgg 9HPggM>: _HPggQ@HPgg@HPgg%BHPgg]EHPggUFK4=HPggGHPggK,HPggMHPggIU,HPggVHPggZHPgg[N5=HPgg{\HPgg_HPgg`HPggaHPggd,HPggfHPggujHPggjK6=HPgg8mHPggqpHPggpHPggArHPgguHPgg## #(..#.#######)##..... ........##..### ...###...# #.#.#....###...#...#.......#..........######....###HPggk 0.####.....#HPggUo HPggQv q.hhHPgg!w P====5.3 (1.0)HPgg~ HPgg 4 _The black bear growls angrily.IPggr (poisoned)You throw a poisoned dart. The poisoned dart hits the black bear.IPggK {  The black bear is poisoned. The black bear bites you. The black bear claws you.IPggq 6-=---6.5 (1.22IPgg+ IPgg 8 _You block the black bear's attack.IPgg@ IPgg  You throw a poisoned dart. The poisoned dart hits the black bear.  The black bear bites you. You block the black bear's attack. x3  The black bear claws you but does no damage.IPgg 1------7.6 (1.1dart (poison) IPgg{ IPgg' W _The black bear barely misses you.IPgg very poisoned)You throw a poisoned dart. The poisoned dart hits the black bear.  The black bear looks even sicker.JPggX  The black bear is lightly wounded.  The black bear barely misses you. You block the black bear's attack.8.8 (1.2Nothing quiveredJPgg!JPggL%B _The black bear claws you but does no damage.JPggW  You slash the black bear!  The black bear is heavily wounded.The black bear bites you but does no damage.JPggl49---=60.0JPggJPggR _The black bear claws you. You block the black bear's attack.JPgg Y The black bear bites you but does no damage.. You block the black bear's attack.  You barely miss the black bear.  The black bear closely misses you.-10JPgg JPgg B _The black bear claws you but does no damage.JPggQ >  You slash the black bear!JPgg[ C(JPgga 13=2.1 (1.1 _You kill the black bear!JPggh JPggk m _Your Long Blades skill increases to level 10!JPgg2 ### ##### ..# #....JPgg2~ ### #....  .... #.. #.#.# # ## .... #.# #.#.# .# #. ..... #.###.#.# #.# #.### ...). #.....#.#... #.@.#...... ##.#######.#...... JPgg2?'................$)..>## # #....(..#.#######)##..... .. #JPgg3.#.#.......##..### .# #.#.#.#....###...#JPgg93f ..# ##.#.#....###...#...# +JPggf3L........#.....# #...........######....####JPgg=JPggP>$50JPggx>7---3JPgg>0 _KPggKPggKc  f - 3 poisoned dartsKPgg8--4.1 (2Throw: 3 darts (poison)KPgg)KPggVW _You see here a black bear corpse.KPgg ## ##### .# #.... ## #.... .... KPggFt.. #.#.# # ## .... .# #.#.# .# #. ..... .###.#.# #.# #.### ...). .....#.#... #.†.#...... .......#.#######@#...... .KPgg{........$)..>## # ....(..#.#######)##..... .. .......#.#.......##..### .# KPgg.#.#.#....###...# ..# KPgg.#.#.#....###...#...# ...........#..KPggw...# .######....#### KPgg-C......##.####...........#KPggA5.1 (1KPggKPgggKPggrw ## ##### .# #.... #.... .. #.#.# # ##..#.# #. .....##.# #.### ...).....#.#... #.†.#........#.#######.#...............@)..>## #(..#.#######)##..... ..KPggxl...#.#.......##..### .# ..#.#..## ......##)).........#.##.#######KPggKPgg51=KPgg86KPggKPggN  You now have 190 gold pieces (gained 17).KPgg+7.1 (2KPgg¤KPggߦK _Items here: )) [ †.KPggz uKPgg~ KPggl KPgg #2KPgg 2=KPgg KPgg KPggߊ KPgg KPggҐ KPgg KPggŒ KPggN KPgg KPggS KPggb KPgg %3KPggX KPgg KPggۡ KPggӣ KPggB KPgg KPggG KPgg KPggx KPgg D4=KPgg KPgg KPggҳ KPgg KPgg KPgg: KPgg KPggr KPgg KPggƿ N5=KPgg KPgg ,KPgg KPgg KPgg KPggh KPgg KPgg K6=KPgg KPgg$ ,KPgg KPgg KPgg KPgg KPggZ KPgg U7=KPgg KPgg= KPggv KPgg+ KPgg ,KPgg} KPggU ,KPgg> KPgg KPgg  %8KPgg KPggQ ,KPggu KPgg KPgg KPggv KPggr KPgg KPgg D9=KPgg& KPgg' KPgg' KPgg( KPgg* KPgg* KPgg+ KPgg- KPgg- O60=KPgg/ KPgg1 ,KPgg03 KPgg6 KPgg6 KPgge8 KPgg; KPgg; %1KPgg > KPggA ,KPgg6D KPggG KPgg,H KPggFJ KPggM KPggN KPggP KPggW KPggW K2=KPggeY KPgg[ ,KPgg\ KPgg_ KPgg` KPgga KPgge KPggf U3=KPggg KPggXk KPggk KPgg,m KPggp KPggp KPggr KPggv KPggw %4KPggPy KPgg{ KPgg{ KPgg| KPggU KPgg KPggE KPggׅ a5=KPggX KPgg ,KPggA KPgg ,KPgg KPggU KPgg KPgga KPggј KPgg KPgg& N6=KPgg& KPgg KPgg KPgg KPgg ,KPgg KPgg. _ _You start resting.KPgg 1317.1 (50.0)KPgg Z7=8.1 (51KPgg+ KPgg " _HP restored.LPggLPggLPggLPggLPggLPggLPgg0,LPggLPgg LPggWLPggf  You see here a black bear corpse.LPgg,LPgg _LPggLPggLPgg;O=LPggLPggLPggOLPggLPggLPggLPggb,LPggLPggLPggLPggSLPgg LPggLPgg,LPggLPggLPggj,LPggLPgg LPgg) ## #<  #.  #.  LPgg)'#.  ###.## ### #....# .... LPgg*### ##### #.@####.... 27.1 (9.0)LPggK*_# #.... #.###........ ### #.... #...'........ LPgg|*=#.. #.#.# #####....... #.# #.#.# .# #.........LPgg* #.###.#.# #.# #.####...). LPgg*#.....#.#... #.†.#...... #.......#.#######.#...... LPgg*r'.........))..>### LPgg+,#LPgg2LPggK3/8.1 (10.0)LPggC9LPgg\<9 _Found a stone staircase leading up.LPggd _LPgg LPgg ,LPggN LPgg ,LPggA LPgg LPgg BLPgg LPgg ,LPgg LPggS LPgg BLPgg LPggk LPgg LPgg LPgg LPgg| [####<# #.# #.# #.# ####.## #######..#....# #........ #### #.#..####........ .... #.###....@....... 34.1 (6.0).. #...'...... .#.# #####...... .#.# .# #........ .#.# #.# #.####...)....< LPgg Z.#.#... #.†.#.......... ...#.#######.#.......... .....))..>####'## LPgg (..#.#######)##..... ..LPggW LPgg +5.1 (7LPgg#& LPgg;) ; _Found an escape hatch in the ceiling.MPggJv3MPggAyMPggOMPggMPgg[BMPgg,MPgg MPggvMPggMPggMPggMPggMPggĔ,MPggȕMPgglMPgg:,MPggΜMPggMMPgg,MPggMPggMPgg ,MPggMPggfMPgg ,MPgg4MPgg׵MPggMPggBMPgg3MPggҼMPgg,MPggMPggMPggMPgg MPggMPggMPgg,MPggMPggQMPgg,MPgg,MPgg,MPggMPggaMPgg(,MPgg,MPggMPgg ,MPgg MPgg=MPgg,MPggMPgg@  There is an open door here.MPgg]MPgg _MPggMPggMPgg=,MPggMPggMPggMPgg%MPggMPggMPgg,MPggMPggMPgg ,MPgg} MPggD MPgg MPggMPggMPggMPggMPggMPggMPggMPggLMPggzMPggMPggMPggMPggMPgghMPggMPggMPggMPggMPggS!MPgg-#MPggk#MPgg#MPgg/MPgg2,MPgg2MPgg5MPgg6,MPgg*7MPgg9MPgg:MPgg:MPggE;MPgg6>MPgg@MPgg@MPggAMPggDMPggF,MPggGMPgg\JMPggL,MPgg&NMPggPMPggR,MPggKTMPggdVMPgg@XMPggtXMPggBYMPgg[MPgg*^,MPggt_MPggbMPggLf,MPgggMPggjMPggm,MPgg7oMPggDrMPggTu,MPggxMPggzMPggBMPggMPggY,MPggMPggXMPgg,MPggMPggMPggĐMPggMPggőMPggYMPgg֕,MPgg[,MPggMPgg.MPggMPggCMPggGMPggMPggMPggMPgg%MPgglMPgg֢MPggJMPgg.,MPggɦMPggMPggMPggʩMPgg[MPggMPggMPggHMPggMPggIMPggγMPggMPggMMPggMPgg*MPggaMPggRMPggMPgg/,MPggMPggMPgggMPggMPggMPggGMPggl,MPggMPggMPgg,MPggNMPgg9MPgg,MPgg(MPggMPggu,MPgg5MPggMPgg',MPggMPggMPgg1,MPggMPggMPgg_,MPggnMPggMPgg6,MPggMPggMPgg,MPgg!MPgg*@  There is an open door here.MPggMPgg _MPgg,MPggMPggMPgg MPgg MPgg MPggt,MPgg]MPggLMPgg,MPgg9MPggMPgg,MPggMPggP(MPggx+MPgg+MPgga-MPgg0MPggL6BMPgg6MPgg8MPgg8MPgg9MPgg<MPgg>,MPgg?MPggCMPggFBMPgg4IMPggf,MPggXMPggAMPgg͘MPgg,MPggMPggMPgg,MPgg:MPggMPgg,MPggvMPgg MPggR,MPggMPggMPggy,MPggǬMPggܭMPgg,MPggLMPggMPgg˳MPggMPggMPgg޶MPgg,MPggMPggMPgg,MPggMPggMPggMPggMPggkMPgg&MPgg,MPggMPgg7 _You open the door.MPggh3MPgg/MPgg@  There is an open door here.MPgg?MPgg _MPggFMPggMPgg|MPggMPggqMPgg@  There is an open door here.MPggMPgg _MPgg@MPggdMPgg,MPggMPggMPggMMPgg}MPgg5MPggRMPggBMPggSMPgg#.......##.....#####.#####.#####.##.##  #.##..####  #.###'##.#  #.#......#  #...#...@#  ##.......'._.#  #..#....#Z.Z#  #.##+## #.##+##... #.# ##... Z   hound zombie (dormant) #.# ... Z   gnoll zombie (dormant) #.# .. MPgg  429.1 (94.0)  You open the door.  You and your allies can now gain power from killing the unholy and evil.You can now call upon the Shining One for a divine shield.Z..ZZZ*30.1 (95MPggMPgg _A hound zombie and a gnoll zombie come into view. _Found an ancient bone altar of Kikubaaqudgha.^PggB  You slash the hound zombie!  The hound zombie is moderately damaged.^Pgg I  You block the hound zombie's attack.^Pgg ZZ. Z 2 gnoll zombiesThe hound zombie bites you but does no damage.^Pggs :==1.2 (1.1)^Pgg ^Pggp _ _A gnoll zombie comes into view.^Pgg >  You hit the hound zombie.^Pgg _    gnoll zombieThe hound zombie is severely damaged.^Pgg 0-2.3^Pgg ^Pgg : _You block the hound zombie's attack.^Pgg  You hit the hound zombie.  The hound zombie is severely damaged.^PggB-3.4^Pgg#^Pgg'U  You hit the hound zombie.  The hound zombie is severely damaged. _You block the hound zombie's attack.  You hit the hound zombie.  The hound zombie is severely damaged. _You block the hound zombie's attack._Pgg4Q _You block the hound zombie's attack.  You hit the hound zombie.  The hound zombie is severely damaged. _You block the hound zombie's attack.  You slash the hound zombie!  You destroy the hound zombie!_Pgg7_Pgg7_Pgg?xZ 2 gnoll zombies_PggZC,40_PggI_PggMX _The Shining One accepts your kill._Pgg  You hit the gnoll zombie.  The gnoll zombie is moderately damaged._Pgg&5_Pgg_PggZ _The gnoll zombie closely misses you._Pgg  You slash the gnoll zombie!  You destroy the gnoll zombie!_PggSg  The Shining One accepts your kill._Pgg/.   gnoll zombie_Pgg>4==6.5 (1.1_Pgg_Pgg ' _You hear a shout!_PggWF@  You slash the gnoll zombie!_Pgg9Q pp   burial acolyteZ   gnoll zombieThe gnoll zombie is almost destroyed.A burial acolyte comes into view. It is wielding a +2 dagger of venom._PgggS4-70_Pgg]_Pggg: _You block the gnoll zombie's attack._Pgg8  You hit the gnoll zombie.  You destroy the gnoll zombie!_Pgg[ | '  The Shining One accepts your kill._Pgg= 8*_Pgg;  The burial acolyte utters a dark prayer and points at you._Pgg_ 8@_Pggu 58----=8 _Your life force is offered up._PggM #.....### ##.#### .#### #.##.#.##..#####.###'##.# #.#......######...#....#...###.......@p_.#..#....#...# #.......##+## #.##+##...#.# ##..#.# ... #.# .. _PggX _Pgg'Y /--9_Pggy^ _Pggc ~ _The burial acolyte barely misses you. _There is an open door here.`Pgg  You hit the burial acolyte.  The burial acolyte is moderately wounded.9=-----40 _You block the burial acolyte's attack.`Pgg<  You completely miss the burial acolyte.The burial acolyte is moderately wounded.`Pggɒ&1`Pgg`Pgg< _You block the burial acolyte's attack.`Pgg  You closely miss the burial acolyte.The burial acolyte is moderately wounded.The burial acolyte hits you but does no damage.`Pgg |====2Pois `Pgg `PggX Q _You are poisoned.`Pgg   You hit the burial acolyte.  The burial acolyte is moderately wounded.You feel very sick.  re more poisoned.The burial acolyte hits you with a +2 dagger of venom.6=========-3.6 (1.1Pois `Pggf `Pgg 8-`Pgg /  --more--aPggW _You are more poisoned.aPgg <You hit the burial acolyte.  The burial acolyte is heavily wounded.You feel very sick.aPgg<\0---40aPggEaPgg]H4 _You block the burial acolyte's attack.bPggt<  You barely miss the burial acolyte.The burial acolyte is heavily wounded.You feel very sick.bPggJ=46----5Pois bPggCbPgg~F[ _The burial acolyte barely misses you.bPgg<_  You hit the burial acolyte.  The burial acolyte is severely wounded.You feel very sick.bPgg[d:*bPgg9  The burial acolyte utters a dark prayer and points at you.bPggG8@bPgg32====------==6Pois bPggkbPggR _Your life force is offered up. The burial acolyte is healed.bPgg  bPgg  The burial acolyte utters a dark prayer and points at you. _Your life force is offered up. The burial acolyte is healed.  You hit the burial acolyte.  The burial acolyte is heavily wounded.You feel very sick.  The burial acolyte hits you but does no damage.bPggQ! |29=======--------7bPgg( bPgg+ V _You are more poisoned.bPggN|  You completely miss the burial acolyte.The burial acolyte is heavily wounded.You feel very sick.bPgg}^25-----8bPggԃbPggDT _The burial acolyte misses you.cPggO--cPggcPgg|F _Unknown command.cPggScPgg)$cPggfDrink which item? Potions  c - a puce potion  e - 3 brown potions  h - a viscous amethyst potion  i - a viscous pink potion cPggT? k - 4 lumpy ruby potions  q - 2 fuming silvery potions  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selecteddPgge2 dPgg9#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 25/67 ========----------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#dPgg:XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6448.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois #.# ##...#.# ...p   burial acolyte#.# .. _You are more poisoned.You completely miss the burial acolyte.The burial acolyte is heavily wounded.You feel very sick. _The burial acolyte misses you. _Unknown command.dPggAP  Okay, then.dPgg+BdPgg(HdPggJ. _dPgg\dPggARead which item? Scrolls  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 5 scrolls labelled MEYCSO REZEI  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selectedePggnePggvePggcJ#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 25/67 ========----------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10ePggCInt: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6448.6 (0.0)ePggi#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois #.# ##...#.# ...ePgg̀p   burial acolyte#.# ..You completely miss the burial acolyte.The burial acolyte is heavily wounded.You feel very sick. _The burial acolyte misses you. _Unknown command. _Okay, then.ePgguP  Okay, then.ePggÊePggePggz. _ePggePgg Ability - do what?CostFailure  Invocations -  X - Renounce ReligionePgg None0% a - Divine Shield3 MP, Piety-17% [?] toggle between ability selection and description.fPgg fPgg #.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 25/67 ========----------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#fPgg Noise: =--------  Time: 6448.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois #.# ##...#.# ...p   burial acolyte#.# ..The burial acolyte is heavily wounded.You feel very sick. _The burial acolyte misses you. _Unknown command. _Okay, then. _Okay, then.fPgg _The burial acolyte misses you. _Unknown command. _Okay, then.Okay, then.  A divine shield manifests in front of you!  You feel very sick.fPggr1-6--------9.6 (1Shield (2) fPggSfPgg< _You block the burial acolyte's attack.iPggÎ  You completely miss the burial acolyte.The burial acolyte is heavily wounded.You feel sick.iPggϓ:*iPggi     #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#...#  ##.......*p_.#  iPggj#..#....#...#  #.......##+##  #.##+##... #.# ##... #.# ... #.# ..The burial acolyte utters a dark prayer and points at you.iPggA%    #.##.## #.##..#### iPggA`#.###'##.# #.#......#####  #...#....#...#  ##.......*p_.#  #..#....#...#  #.......##+##  iPgg1BN#.##+##... #.# ## #.# ...iPggkBC #.#  iPggB iPggJ  Your life force is offered up.  * * * LOW HITPOINT WARNING * * *iPgg8@iPgg16===---==50iPggiPgg-9--iPgg/  --more--iPggb4 _The burial acolyte is healed.kPggn kPggȼ DDrink which item? Potions  c - a puce potion  e - 3 brown potions  h - a viscous amethyst potion  i - a viscous pink potion  k - 4 lumpy ruby potions  q - 2 fuming silvery potions kPggL u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedmPgg mPgg) mPgg3 #.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 16/67 =====-------------------#.##.##Magic: 6/9================--------#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: ===------  Time: 6450.6 (0.0)#..#....#...#a) +0 long sword#.......##+##mPgg Throw: 3 darts (poison)#.##+##...Pois Shield (2) #.# ##...#.# ...p   burial acolyte#.# .. _The burial acolyte is healed.mPggp It was a potion of mutation. You feel extremely strange.  You feel a little pissed off. You feel robust.You feel very sick.3/73---1.6 (11mPggmPgg4 _You block the burial acolyte's attack.pPggoEpPggnHDrink which item? Potions  c - a puce potion  e - 3 brown potions  h - a viscous amethyst potion  i - a viscous pink potion pPgg'If k - 3 potions of mutation  q - 2 fuming silvery potions  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedpPggTpPgg_]pPgge0#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 13/73 ====--------------------#.##.##Magic: 6/9================--------#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14pPgg>g-#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6451.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois Shield (1) #.# ##...#.# ...p   burial acolyte#.# .. _The burial acolyte is healed.  It was a potion of mutation. You feel extremely strange.  You feel a little pissed off. You feel robust.You feel very sick. _You block the burial acolyte's attack.pPggz  It was a potion of enlightenment.  You feel very buoyant.You fly up into the air. You feel sick. You block the burial acolyte's attack.pPgg{2-2.6 (1Will+ Fly pPggpPgg^ _Your divine shield fades away.qPgg. qPggɣ Drink which item? Potions  c - a puce potione - 2 potions of enlightenment  h - a viscous amethyst potion  i - a viscous pink potion  k - 3 potions of mutation  q - 2 fuming silvery potions  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selectedsPgg\sPgg sPggR #.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 12/73 ===---------------------#.##.##Magic: 6/9================--------#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6452.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poisosPgg5 n)#.##+##...Pois Will+ Fly #.# ##...#.# ...p   burial acolyte#.# ..You feel very sick. _You block the burial acolyte's attack.  It was a potion of enlightenment.  You feel very buoyant.You fly up into the air. You feel sick. You block the burial acolyte's attack. _Your divine shield fades away.sPggeYou fly up into the air. You feel sick. You block the burial acolyte's attack. _Your divine shield fades away.attraction.attractive to monsters.eel sick.  The burial acolyte hits you but does no damage.sPggP 1==3.6 (1Pois Attr Will+ Fly sPgg&sPgg4*P _You are lethally poisoned!tPggD tPgg vDrink which item? Potions  c - a puce potione - 2 potions of enlightenment  h - a viscous amethyst potion  i - a viscous pink potion  k - 3 potions of mutation  q - a potion of attraction tPgg  u - 2 metallic pink potions [!] read|quaff|evoke[?] describe selecteduPgg] uPggC uPggZ m#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 11/73 ===---------------------#.##.##Magic: 6/9================--------#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11uPgg #.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6453.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)uPgg #.##+##...Pois Attr Will+ Fly #.# ##...#.# ...p   burial acolyte#.# .. _Your divine shield fades away.It was a potion of attraction.  You feel attractive to monsters.You feel sick.  The burial acolyte hits you but does no damage. _You are lethally poisoned!uPgg     #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#...#  ##.......@p_.# uPgg! H #..#....#...#  #.......##+##  #.##+##... #.# ##... #.# ... #.# ..uPgg^ y    #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#...#  ##.......@p_.#  uPgg #..#....#...#  #.......##+##  #.##+##... #.# ## #.# ... #.# uPgg/  uPgg   It was a potion of magic. Magic courses through your body.  * * * LOW HITPOINT WARNING * * *You feel very sick.uPgg8 8/73 -9========4.6 (1uPgg uPggW < _You block the burial acolyte's attack.vPggPo vPgg0p 8-vPgg?w vPggz F _Unknown command.vPggtvPggyDrink which item? Potions  c - a puce potione - 2 potions of enlightenment  h - a viscous amethyst potion  i - a viscous pink potion  k - 3 potions of mutation  q - a potion of attraction  u - a potion of magic [!] read|quaff|evoke[?] describe selectedwPggѝ wPgg wPgg #.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 8/73==----------------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6454.6 (0.0)#..#....#...#a) +0 long sword#.......##+##wPgg Throw: 3 darts (poison)#.##+##...Pois Attr Will+ Fly #.# ##...#.# ...p   burial acolyte#.# .. _You are lethally poisoned!It was a potion of magic. Magic courses through your body.  * * * LOW HITPOINT WARNING * * *You feel very sick. _You block the burial acolyte's attack. _Unknown command.wPgg  It was a potion of cancellation.  Your magical effects are unravelling.wPgg      #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#...#  ##.......@p_.#  #..#....#...#  #.......##+##  wPggQ #.##+##... #.# ##... #.# ... #.# ..You feel magically purged. You float gracefully downwards.wPggy    #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#...#  ##.......@p_.#  wPgg;#..#....#...#  #.......##+##  #.##+##... #.# ## #.# ... #.#  wPggr  Your enlightenment fades.* * * LOW HITPOINT WARNING * * *You feel very sick.wPgg8*xPggj:K5-xPgg%@/  --more--xPgg   The burial acolyte utters a dark prayer and points at you.Your life force is offered up.  The Shining One protects you from harm!xPgg/ 8@xPgg Y-==5.6 (1xPgg; xPgg Q _The burial acolyte is healed. You feel less attractive to monsters.yPgg%yPgg&yPggO-yPggb0> _Unknown command.yPgg֍yPggoDrink which item? Potions  e - 2 potions of enlightenment  h - a viscous amethyst potion  i - a viscous pink potion  k - 3 potions of mutation  q - a potion of attraction  u - a potion of magic yPggD[!] read|quaff|evoke[?] describe selected{Pgg4q{Pggcz{Pgg#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 5/73=-----------------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: ===------  Time: 6455.6 (0.0){Pgg#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois #.# ##...#.# ...p   burial acolyte#.# ..The burial acolyte utters a dark prayer and points at you.Your life force is offered up.  The Shining One protects you from harm! _The burial acolyte is healed. You feel less attractive to monsters. _Unknown command.{Pgg  It was a potion of heal wounds. You feel much better. You feel sick.  The burial acolyte hits you but does no damage.{Pggy26/73 ========--6.6 (1Pois {Pgg{PggV _You are more poisoned.|Pgg`3 |Pggd5 Evoke which item? Wands  o - a wand of acid (6)|Pgg5 y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected~Pgg~Pgg~Pggm#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 26/73 ========----------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17~Pgg7#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: =--------  Time: 6456.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois ~Pggl#.# ##...#.# ...p   burial acolyte~Pgg#.# ..The Shining One protects you from harm! _The burial acolyte is healed. You feel less attractive to monsters. _Unknown command.~PggIt was a potion of heal wounds. You feel much better. You feel sick.  The burial acolyte hits you but does no damage. _You are more poisoned.~Pgg! #.....### deadiverson the Carver ##.#### Human of the Shining One *..... #.#### Health: 26/73 ========---------------- #.##.## Magic: 9/9======================== #.##..#### AC: 13~PggStr: 17 #.###'##.# EV: 10Int: 11 #.#......#####  SH: 9Dex: 14 ~PggN#...#....#...#  XL:  9 Next: 14% Place: Dungeon:6 ##.......@p_.#  Noise: =--------  Time: 6456.6 (0.0) ~Pggr#..#....#...#  a) +0 long sword ~Pgg#.......##+##  Throw: 3 darts (poison) ~Pgg#.##+##... Pois ~Pggu #.# ##... #.# ...~Pgg p   burial acolyte #.# ..~Pgg~Pgg8}The burial acolyte hits you but does no damage. _You are more poisoned.~PggVAiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - burial acolyte~PgguAim: a burial acolyte, wielding a +2 dagger of venom and wearing a +0 robe  (lightly wounded, haloed, 73% to hit)~Pgg'H **pPggbb.**pPgg #.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 26/73 ========----------------#.##.##Magic: 9/9Pgg K========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#.**#XL:  9 Next: 14% Place: Dungeon:6##.......@*_.#Noise: =--------  Time: 6456.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts (poison)#.##+##...Pois #.# ##...Pgg# q#.# ...p   burial acolyte (corroded)#.# ..The burial acolyte hits you but does no damage. _You are more poisoned.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight lineThe bolt of acid hits the burial acolyte!  The acid corrodes the burial acolyte!PggV      #.##.## #.##..#### #.###'##.# #.#......#####  #...#....#.**#  ##.......@*_.#  #..#....#...#  #.......##+##  #.##+##... #.# ##... #.# ... #.# ..The burial acolyte is severely wounded.You feel very sick.Pgga =  Pgg p  #.##.## Pgg x#.##..#### Pgg #.###'##.# PggS (#.#......#####  #...#....#.**#  Pgg6 b##.......@*_.#  #..#....#...#  #.......##+##  #.##+##... #.# ## #.# ... #.#  Pggv A1--Pgg /  --more--Pgg ..pThe burial acolyte hits you with a +2 dagger of venom.Pgg e--====7.6 (1Pgg Pgg N _* * * LOW HITPOINT WARNING * * *PggKPggPggPggҔ> _Unknown command.Pgg Pgg Evoke which item? Wands  o - a wand of acid (5)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selectedPgguPggPgg)#.....###deadiverson the Carver##.####Human of the Shining One *.....#.####Health: 21/73 ======------------------#.##.##Magic: 9/9========================#.##..####AC: 13Str: 17#.###'##.#EV: 10Int: 11#.#......#####SH: 9Dex: 14#...#....#...#XL:  9 Next: 14% Place: Dungeon:6##.......@p_.#Noise: ====-----  Time: 6457.6 (0.0)#..#....#...#a) +0 long sword#.......##+##Throw: 3 darts Pgg^*(poison)#.##+##...Pois #.# ##...#.# ...p   burial acolyte (corroded)#.# ..The burial acolyte hits you with a +2 dagger of venom. _* * * LOW HITPOINT WARNING * * * _Unknown command.PggG #.....### deadiverson the Carver ##.#### Human of the Shining One *..... #.#### Health: 21/73 ======------------------ #.##.## Magic: 9/9======================== #.##..#### AC: 13Str: 17 #.###'##.# EV: 10Int: 11 #.#......#####  SH: 9Dex: 14 #...#....#.**#  XL:  9 Next: 14% Place: Dungeon:6 ##.......@p_.#  Noise: ====-----  Time: 6457.6 (0.0) #..#...PggwI.#...#  a) +0 long sword #.......##+##  Throw: 3 darts (poison) #.##+##... Pois  #.# ##... #.# ... p   burial acolyte (corroded) #.# ..The burial acolyte hits you with a +2 dagger of venom. _* * * LOW HITPOINT WARNING * * * _Unknown command.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight linePggT ! #.....### deadiverson the Carver ##.#### Human of the Shining One *..... #.#### Health: 21/73 ======------------------ #.##.## Magic: 9/9======================== #.##..#### AC: 13PggU Str: 17 #.###'##.# EV: 10Int: 11 #.#......#####  SH: 9Dex: 14 #...#....#...#  XL:  9 Next: 14% Place: Dungeon:6 ##.......@p_.#  Noise: ====-----  Time: 6457.6 (0.0) PggU #..#....#...#  a) +0 long sword #.......##+##  Throw: 3 darts (poison)PggOV  #.##+##... Pois  #.# ##... #.# ... p   burial acolyte (corroded) #.# .. PggV _Unknown command.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight lineThe bolt of acid hits the burial acolyte!  The burial acolyte seems to be corroded for longer.  PggV <You kill the burial acolyte!PggZ     #.##.## #.## #.## #.#.  #...**#  Pgg[ ##..*_.#  #..  #..  #.# #.#  #.#  #.#  Pgg ..)  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight lineThe bolt of acid hits the burial acolyte!urial acolyte seems to be corroded for longer.  You kill the burial acolyte!  The Shining One accepts your kill.Pgg V18-78.6 (1Pgg N-PggV /  --more--PggT _You feel very sick.Pgg/ #.......# #.....#####.#### #.#### #.##.## #.##..#### #.###'##.# #.#......##### #...#....#@..# ##.......')_.# #..#....#...# #.......##+###.##+Pgg %##...#.# ##...#.# .#.# ..Pgg Pgg _7----9Pgg Pgg  _You feel sick.Pgg!W......+.#..........##+##PggX5-----60Pois Pgg^Pggd0 _You close the door. You feel sick.PggDPggyE8-Pgg^FPggIPggNd3PggNPggOPggqRPggRg2=-PggSPggVPggWJ1-PggGXPgg"[Pgg[PggC\PggcT0=Pggin5.6 (5 _You start resting. You feel sick. x6Pgggj36.6 (6PggnPggqS _You are no longer poisoned.PggKPgg:LPggLPggHP,PggUy1PggW,PgghXPgg4[,Pgg%\Pgg^M2Pgg/`PggdnPggePggBgPgggPgg3hPggjPggrjI3=PggtkPggmPggnPggoPggq,PggrPgguPggguS4=Pgg"vPggx,PggyPgg*},Pgg!~PggpPggǀ75PggPgg,PggمPggPgg>Pgg"Pggu6=Pgg,PggPggO,PggPggPggF=7=PggPggVPgg',Pgg&Pgg,PggPggܟPgg78Pgg|Pgg,PggPggX,PggPgg/_9=PggqPggX,PggEPgg,PggPgg԰Pgg0T20=PggPgg,PggPgg,PggPgg,PggPggM1Pgg*PggPggTPggPggPggPggPggQ72Pgg(=PggSPggPggPgggS3=PggLPgg,Pgg$Pgg,PggPggPggx74PggPgg-PggPgg,Pggw,PggPgg_5=Pgg|PggPggPggPggPggPggPgghPggS6=PggfPggPggIPggPgg,PggPggPgg4 77Pgg Pgg Pgg$ Pgg Pgg ,Pgg Pgg Pgg I8=Pggj Pgg ,Pgg Pgg Pgg Pgg PggQ Pgg Pgg  Pgg PggH !9Pgg 2=Pggn Pgg Pgg, Pgg Pgg) PggT Pgg Pgg Pgg :30Pgg Pgg+" ,Pgg" Pgg@% ,Pgg9& Pgg( Pgg') S1=Pgg:* Pgg+ ,Pgg, Pggi/ ,PggG0 Pgg2 Pgg3 K2=Pgg3 Pgg5 Pgg 6 Pgg6 Pgg|8 Pgg8 Pgg : Pgg: Pgg-; 93Pgg < Pgg~> Pgg> Pggs? Pgg(B ,Pgg4C PggE Pgg F S4=PggG PggI ,Pgg>J PggN ,PggO PggR PggTR K5=PggbS Pgg*V ,PggXW PggZ ,Pggn[ Pggb^ Pgg^ 96Pgg_ PggWb Pggb Pggc Pgg~f Pggf Pggg Pggi ,Pgg=j Pggk Pggl S7=Pggl Pggsn BPggo ,PggVp Pggq Pggq K8=Pgg9r Pgg m9Pggw Pgg c40=Pgg# ,Pgg Pgg ,Pgg؎ Pgg Pgg D1=Pgg\ Pggǒ Pgg Pgg Pgg: ,Pgg Pgg Pggb 92Pgg@ Pgg Pgg. Pgg Pgg ,Pgg^ Pgg i3=Pggg Pgg Pgg ,Pgg Pgge Pgg[ Pgg> w4=Pggq Pgg Pgg Pgg5 BPggJ Pggh 5Pgg 6=Pgg1 ,Pgg BPgg ,Pgg Pgg `7=8Pgg E9=Pgg 50=Pgg XPgg ,Pgg Pgg Pgg! 91Pgg Pgg ,PggP Pgg ,Pgg Pgg d52=Pgg Pgg ,Pgg Pgg& ,Pgg Pgg. ,PggZ Pgg m3=PggM Pgg ,PggP Pgg Pggu Pgg} Pgg] Pgg %4Pgg Pgg ,Pgg Pgg" PggD" PggG# PggA& Pgg& D5=Pgg' Pgg) Pgg* Pgg=+ Pgg. ,Pgg/ Pgg2 PggI2 N6=Pgg3 Pgg5 ,PggV6 Pggh7 Pgg7 Pgg7 Pgg|9 ;7Pgg9 Pgg: ,Pgg; PggR< ,Pgg< PggdW 8=9=60Pgg|Y a1=PggZ Pgg] BPggs_ Pgg_ Pgga Pgge k2=Pggf Pggg Pgg*g Pggg Pggi ,Pggi Pggsj Pggj %3Pggk Pgg,l ,Pggl PggHn Pggn Pgglo Pgg6r a4=Pggr Pgg,t ,Pggt Pggu ,Pgg ,Pgg{> Pgg? ,PggU@ PggA ,PggB Pgg C ,PggRC PggD ,PggBE PggF BPgg(H ,PggH PggnI ,PggI Pgg;K ,PggK PggRM ,PggM PggN ,PggXO PggqP ,PggP PggQ ,PggR PggS ,PggT Pgg6U ,PggU PggV ,PggW Pgg~X ,Pgg#Y Pgg\ ,Pggh` XPggb ,Pgg/o Pgg3q ,Pggq Pggs ,Pggt Pggxw ,Pggx Pggz ,Pgg{ Pgg} ,Pgg~ Pgg ,Pggف Pgg҃ ,Pgg- Pgg ,Pgg$ Pgga ,PggЋ Pgg ,Pggy Pgg Pgg Pgg Pgg` ,Pgg> Pgg̗ Pgg2 Pggb Pgg BPggk ,PggÝ Pgg ,Pggu Pgg ,Pgg! Pgg ,Pgg Pgg֥ ,Pgg3 Pgg ,Pgg Pgg ,PggĬ Pgg Pgg Pggr Pgg ,Pgg Pgg ,Pgg Pgg Pggκ Pgg Pgg׽ ,Pgg Pgg( ,Pgg3 Pgg Pgg[ Pgg^ Pgg: ,Pgg( Pgg ,Pgg XPggy Pgg Pgg Pgg Pgg Pgg. Pgg ,Pgg Pgg ,Pgg Pgg ,Pgg Pgg ,Pgg Pggi ,Pggc Pgg0 ,Pgg PggI ,Pgg Pgg ,Pgg RPgg Pgg nPgg PggY Pgg Pggc Pgg ,Pgg) Pgg! ,Pggh" Pgg_$ ,Pgg:% Pgg. n 761.6 (99.0) _You start waiting.Pgg+/ -2.6 (100.0)Pggb4 Pgg!7 # _Done waiting.Pgg -Pgg-Pgga.PggZ4Pgg8 ###.####  .##.#####'##.......#####..#....#...#.......+@_ #..#....#.......##+#Pgg;,0.0)PggqAA3.6 (1PggC  Things that are here: _a +2 dagger of venom; a +0 robe; a human skeletonPgg: IPgg Pggw Pggy _Pgg 7 _You open the door.Pgg 3Pgg9 Pgg4 @  There is an open door here.Pgg Pgg  _Pggl PggB Pgg Pgg Pgg1 Pgg Pgg' Pgga Pgg Pgg Pgg ,Pgg Pgg Pgg" ,Pgg# Pgg% Pgg.( ,PggA) Pgg?, Pggl, Pgg, Pgg/ M _You now have 199 gold pieces (gained 9).Pggn1 3Pgg1 Pgg2 Pgg 4 Pgg84 Pgg4 Pgg5 Pgg7 ,Pgg8 Pgg9 Pgg ; Pgg ; Pggc; Pgg< Pgg"> ,Pgg> Pgg @ Pgg=B PggjB PggoC PggCG 7 _You open the door.PggJ 3PggWK PggL PggN ,PggO Pgg;Q @  There is an open door here.PggJV PggV  _Pgg|W PggZ ,PggQ\ Pgg^ N _You now have 209 gold pieces (gained 10).Pgg` Pgg` Pgga Pggoe ,Pggf PggQj N _You now have 227 gold pieces (gained 18).Pggm 3Pggn Pgg-q ,Pggq Pgg]v N _You now have 239 gold pieces (gained 12).Pggx 3Pggy Pgg{ Pgg ~ Pgg>~ Pgg) PggZ @  There is an open door here.Pgg Pggm  _Pgg Pgg; Pgg ,Pgg# Pggċ Pgg= Pggj Pggۍ Pgg Pggq ,Pgg Pgg Pgg ,PggM Pgg #..##### #...#....#...# ##.......+)_.# #..#....#...# #.......##'#### #.##+##.......# #.# ##.....##  #.# ###.....#  #.# ##.'....@+   #..#.#.#.#  .#####.....#  #........#### ##########            Pgg a##'5#94.6 (31.0)ZZ###5   shadow imp (asleep)ZZ 2 hound zombies (dormant)Pgg  As you open the door, it creaks loudly!  A shadow imp and 2 hound zombies come into view.Pggf Z5.Z5ZZPgg@ M======5.6 (32Pgg| Pgg , _The shadow imp shouts!PggnPgg Z.  You hit the hound zombie but do no damage.Pgg 1-=-----6.5 (0.9)Pgg^Pgg"1 _The hound zombie bites you.Pggpa Pggb g0------7.5 (1.0Pgg1k PggUo s _You barely miss the hound zombie. The hound zombie bites you.Pgg  You hit the hound zombie.  The hound zombie is lightly damaged.Pgg~ C5ZPgg -8.4 (0.9Pgg Pgg : _You block the hound zombie's attack.PggM  You slash the shadow imp!  You kill the shadow imp!The Shining One accepts your kill.PggOPggZ Z. Pgg^c3==9.4 (1.0PgggPggj& _You feel better.Pgg  You hit the hound zombie.  The hound zombie is lightly damaged.  The hound zombie bites you but does no damage.Pgg0-800PggPgghY _The hound zombie barely misses you.Pgg   You slash the hound zombie!  The hound zombie is heavily damaged.Pgg.=1Pgg*Pgg=: _You block the hound zombie's attack.Pgg  A red film seems to cover your vision as you go berserk!  You feel yourself moving faster! You feel mighty! You slash the hound zombie!  You destroy the hound zombie!Pgg Pgg3    #...#  ...+)_.#  #..#....#...#  #.......##'####  #.......#  #.# ##.....##  #.# ###.....###  #.# ##.'....@Z.#  Pgg#..#.#.#.#..#  .....# ##  #........#### ########## Pggu Z   hound zombiePgg"'Pgg=BThe Shining One accepts your kill.Pgg\109/109=82.2 (0.83 darts (poison)Berserk PggPgg: _You block the hound zombie's attack.Pgg  You slash the hound zombie!8 (0.6Pgg Pggt d _The hound zombie is heavily damaged.PggTd   You slice the hound zombie!!  You destroy the hound zombie!'93.5 (0.7Pggi n _The Shining One accepts your kill.PggLPgg'Pgg|PggŪF _Unknown command.Pggұp#.#......##### #...#....#...# ##.......+)_.# #..#....#...# #.##'#### #.##+##.......# #.# ##.....## #.# ###.....### #.# ##.'.....@.# #..#.#.#.#..# .#####.....#### #........#### ########## Pgg_Pggݹ8--4.2 _Pgg PggQ _There is an open door here.Pgg #.#......#####  #...#....#...#  ##.+)_.# #..#....#...# #.##'#### Pgg *#.##+##.......# Pgg b#.# ##.....## #.# ###.....### #.# ##.'.....'@# #..#.#.#.#..# .#####.....#### #........#### ########## Pggt Pgg A--9Pgg Pgg  k _You feel a strong urge to attack something.Pgg5 z#...#....#...# ##.......+)_.# ..#....#...#  #.......##'####  Pgg_ >#.##+##.......#  #.# ##  Pgg{ q#.# ###.....###.# ##.'.....'. #..#.#.#.#.Pgg M.#####.....#### #........#### Pgg 7########## Pgg Pgg| X5.6Berserk PggX Pgg PggV# #.#......#####  #...#....#...##.......+)_.#  #..#....#...#  #.......##'####  #.##+..#  #.# ##.....#  #.# ###.....##.# ##.'.....'@## #..#.#.#.#..# .#####.....#### #........##############Pgg-,      )_.#    .##'####  .......#  #.# ##.....##  #.# ###.....### Pgg.x #.# ##.'.....'@##  #..#.#.#.#..#  PggD....####  ..#### Pgg. ####  You feel your anger nearly subside. You are no longer berserk.You are exhausted.Pgg073/73 6.33 darts (poison)Slow -Berserk Pgg7Pgg:2 _You feel yourself slow down.PggSI4PggLPggNPgg x #.#......#####  #...#....#...#  ##.+)_.#  #..#....#...#  #.##'####  #.##+##.......#  #.# ##.....##  #.# ###.....###  #.# ##.'.....@.##  #..#.#.#.#..#  .#####.....####  #........####  ##########     Pgg Pggz -7.8 (1.5Pgg; Pgg Q _There is an open door here.Pgg4Pgg/PggPggXPggPgg ,Pgg/ Pgg Pgg Pgg PggPggT,PggPgg PggPggT,PggLPgg\,PggnPggQ ,Pgg+!Pggi$,Pgg%Pgg,(,Pgg)Pgg,,Pgg-PggX/Pgg/Pgg0Pgg3,Pgg5Pgg6Pgg6Pgg7Pgg:,Pgg;Pgg>,Pgg>PggmA,Pgg5Pggb,PggPggv,PggPgg,Pgg Pgg ,Pgg Pgg@,PggPggZ,Pgg,Pgg,PggPggPgg}j 45.3 (37.5) _You start waiting.Pgg76.8 (39.0Pgg"Pgg%[ _You feel yourself speed up.Pgg Pgg KInnate Abilities, Weirdness & Mutationsa - You regain HP and MP as you explore.b - You sometimes lose your temper in combat.c - You are robust. (+10% HP)Pgg~FPgg'MPggS #.#......#####  deadiverson the Carver#...#....#...#  Human of the Shining One *.....##.......+)_.#  Health: 73/73 ========================#..#....#...#  Magic: 9/9PggIT_========================#.......##'####  AC: 13Str: 17#.##+##.......#  EV: 10Int: 11#.# ##.....##  SH: 9Dex: 14#.# ###.....###  XL:  9 Next: 19% Place: Dungeon:6#.# ##.'.....@.##PggU  Noise: ---------  Time: 6846.8 (0.0)#..#.#.#.#..#  a) +0 long sword.#####.....####  Throw: 3 darts (poison)#........####  -Berserk ##########         You feel your anger nearly subside. You are no longer berserk.You are exhausted. _You feel yourself slow down. _There is an open door here. _You start waiting. _You feel yourself speed up.PggZPggZPgg-`PggbPgg Pgg &Drink which item? Potions  e - 2 potions of enlightenment  i - a viscous pink potion  k - 3 potions of mutation  q - a potion of attraction PggB  u - a potion of magic [!] read|quaff|evoke[?] describe selectedPgg)Pgg-Pgg5 #.#......#####  deadiverson the Carver#...#....#...#  Human of the Shining One *.....##.......+)_.#  Health: 73/73 ========================#..#....#...#  Magic: 9/9========================#.......##'####  AC: 13Str: 17#.##+##.......#  EV: 10Int: 11#.# ##.....##  SH: 9Pgg5Dex: 14#.# ###.....###  XL:  9 Next: 19% Place: Dungeon:6#.# ##.'.....@.##  Noise: ---------  Time: 6846.8 (0.0)Pgg[6#..#.#.#.#..#  a) +0 long sword.#####.....####  Throw: 3 darts (poison)#........####  -Berserk ##########Pgg~6m      Pgg6_   Pgg6You feel your anger nearly subside. You are no longer berserk.Pgg6You are exhausted. _You feel yourself slow down. _There is an open door here. Pgg-7_You start waiting. _You feel yourself speed up.Pggp@PggAReally quaff the potion of mutation? Y - Yes  N - NoPgg; Pggr  #.#......#####  deadiverson the Carver#...#....#...#  Human of the Shining One *.....##.......+)_.#  Health: 73/73 ========================#..#....#...#  Magic: 9/9========================Pgg -#.......##'####  AC: 13Str: 17#.##+##.......#  EV: 10Int: 11#.# ##.....##  SH: 9Dex: 14#.# ###.....###  XL:  9 Next: 19% Place: Dungeon:6#.# ##.'.....@.##Pgg b  Noise: ---------  Time: 6846.8 (0.0)#..#.#.#.#..#  a) +0 long sword.#####.....####  Throw: 3 darts (poison)#........####  -Berserk ##########  Pgg˱       Pgg   _You start waiting. _You feel yourself speed up.Pgg You feel extremely strange.  You feel frail. You feel a little more calm.Pgg/ Iridescent scales grow over part of your body.You occasionally lose the ability to drink potions when taking damage.Pggϳ G67/675137.8 (1Pgg2 Pggm  _You feel yourself speed up.  You feel extremely strange.  You feel frail. You feel a little more calm.Iridescent scales grow over part of your body.You occasionally lose the ability to drink potions when taking damage. _Large bone plates grow over parts of your arms.Pgg^PggaInnate Abilities, Weirdness & Mutationsa - You regain HP and MP as you explore.b - You are partially covered in iridescent scales. (AC +2)  c - You are partially covered in large bone plates. (SH +4)  d - You occasionally lose the ability to drink potions when taking damage.PggWPggPggw #.#......#####  deadiverson the Carver#...#....#...#  Human of the Shining One *.....##.......+)_.#  Health: 67/67 ========================#..#....#...#  Magic: 9/9========================#.......##'####  AC: 15Str: 17#.##+##.......#  EV: 10Int: 11#.# ##.....##  SH: 13Pgg2Dex: 14#.# ###.....###  XL:  9 Next: 19% Place: Dungeon:6#.# ##.'.....@.##  Noise: ---------  Time: 6847.8 (0.0)#..#.#.#.#..#  a) +0 long sword.#####.....####  Throw: 3 darts (poison)#........####  -Berserk ##########          Pgg+_You feel yourself speed up.You feel extremely strange.  You feel frail. You feel a little more calm.Iridescent scales grow over part of your body.Pgg You occasionally lose the ability to drink potions when taking damage. _Large bone plates grow over parts of your arms.Pgg&Pggn'Pgg,Pgg.Pgg$pInnate Abilities, Weirdness & Mutationsa - You regain HP and MP as you explore.b - You are partially covered in iridescent scales. (AC +2)  c - You are partially covered in large bone plates. (SH +4)  d - You occasionally lose the ability to drink potions when taking damage.Pgg Pgg Pgg( #.#......#####  deadiverson the Carver#...#....#...#  Human of the Shining One *.....##.......+)_.#  Health: 67/67 ========================#..#....#...#  Magic: 9/9========================#.......##'####  AC: 15Str: 17PggN#.##+##.......#  EV: 10Int: 11#.# ##.....##  SH: 13Dex: 14#.# ###.....###  XL:  9 Next: 19% Place: Dungeon:6#.# ##.'.....@.##  Noise: ---------  Time: 6847.8 (0.0)#..#.#.#.#..#  a) +0 long sword.#####.....####  Throw: 3 darts (poison)#........####Pgg  -Berserk ##########    Pgg?      _You feel yourself speed up.PggiYou feel extremely strange.  You feel frail. You feel a little more calm.Iridescent scales grow over part of your body.PggYou occasionally lose the ability to drink potions when taking damage. _Large bone plates grow over parts of your arms.Pgg%PggY&Pgg+Pgg-Pgg~4PggPggPgg߅PggЉ,Pgg0Pggn,PggPggPggh,Pgg9PggvPgg<PggvPggfPggPggPggPggPggPgg}PggPggEPgg6Pgg8PggqPggPgg}Pggv,PggmPggPggD #.  #.##.##  #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..##'####  #.##'##.......#  Pgg|#.#5Z ##.....##  #.#Z####.....###  #.####.'.....'.###..#.#.#.#..# 5   shadow imp (asleep).#####.....#### ZZ 2 gnoll zombies (dormant)#........##############PggF 55.8 (8  You open the door.PggZ5.ZZ5ZZ6.8 (9PggAPgg0   #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  Pgg'##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...'.##  #.#..#       _A shadow imp and 2 gnoll zombies come into view.PggF_  #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...' #.#..#     PggET4PggaYPggg]d _There are monsters nearby!Pgg   #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...'.##  #.#..#       Pgg   #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...' Pgg§#.#..#     Pgg4PggżPggd _There are monsters nearby!PggY  #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  Pgg`Z#....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...'.##  #.#..#       Pggo  #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##Pgg...' #.#..#     Pggy4Pgg@ Pgg d _There are monsters nearby!Pgg  #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...'.##  #.#..#       Pgg_&   #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....## Pgg'  #.#Z####.....###  #.##...' #.#..#     Pgg0 Pgg|1 Pgg9 Pgg< d _There are monsters nearby!Pgg&   #.##.## #.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  #.#.Z ##.....##  #.#Z####.....###  #.##...'.##  #.#..#       Pggݽ   #.##.## Pgg j#.##..####  #.###'##.#  #.#......#####  #...#....#...#  ##.......+)_.#  #..#....#...#  #....@..#  #.##5##.......#  Pgg [#.#.Z ##.....##  #.#Z####.....###  #.##...' #.#..#     Pgg Pgg{ Pgg\ Pgg d _There are monsters nearby!Pgg _There are monsters nearby!  You barely miss the shadow imp.Pgg~@Z.Pggr5=7.9 (1.1PggPggvA _The shadow imp hits you but does no damage.Pgg  You hit the shadow imp.  The shadow imp is severely wounded.Pgg^,80PggPggt8 _You block the shadow imp's attack.Pgg` |  You hit the shadow imp.  You kill the shadow imp!Pgga g  The Shining One accepts your kill.Pggb Pggyl ........@..Z##..ZZ 2 gnoll zombiesPggp 7209Pggy Pgg$ _You recover from your berserk rage.You hit the gnoll zombie.  The gnoll zombie is moderately damaged.Pgg .61.0 (1.1Pgg Pgg C _The gnoll zombie hits you but does no damage.PggO  You hit the gnoll zombie but do no damage.The gnoll zombie is moderately damaged.PggP (2.1PggX Pgg(\ : _You block the gnoll zombie's attack.PggʿF  You hit the gnoll zombie.  Pgg]OThe gnoll zombie is severely damaged.Pgg,30Pgg Pgg: _You block the gnoll zombie's attack.PggT  You slash the gnoll zombie!  You destroy the gnoll zombie!Pgg"Pgg&.   gnoll zombiePgg*&4PggV1Pggw4X _The Shining One accepts your kill.Pgg j  You hit the gnoll zombie.  The gnoll zombie is lightly damaged.Pgg -5.2 (1.1Pgg' Pgg5  _You block the gnoll zombie's attack.  You hit the gnoll zombie.60Pgg= Pgg@ d _The gnoll zombie is heavily damaged.Pggb  You slash the gnoll zombie!  You destroy the gnoll zombie!Pggj 2'Pggen .=7Pggu Pggcx X _The Shining One accepts your kill.Pggx 4Pgg PggZ H _No target in view!Pgg^ #.##.## #.##..#### #.###'##.# #.#......##### #...#....#...# ##.......+)_.# #..#....#...# #.......##'#### #.##@##.......# #.#..###.....## #.#.####.....### #.####.'.....'.## #..#.#.#.#..#.#####.....#####... ########## Pgg7bPggrc---8 Pggc _PgghPgg^lQ _There is an open door here.PggG3PggPggPggfPggP _Pggq,PggPggtPgg,PggjPgg\PggdPgg,PggPggPggPggPggPgg,PggVPggYPgg,PggPggPggPggHPggPgg,Pgg:,PggPggPggqPggPgg4PgggPgg5,PggPgg PggB,PggPggPggPggPggsPgg&PggPggPggiPggLPgg,Pgg;PggQ Pgg ,Pggf PggAPgg2,PggPggPggPgg4PggPggPgg|BPggPgg!Pgg"Pgg`#Pgg%Pgg'Pgg'Pgg(Pggd+Pgg1-Pggg-Pgg.Pggn1Pgg3Pgg3Pgg4Pgg ;BPgg;Pgg>PggPAPggAPggBPggEPggHPgg IPggNJPgg7MPgg^Q,PggRPggPUPgg^XPggXPggYPgg[PggD^Pgg~^Pgg`PggDbPggd,PggePgg-lPgg^nPggnPggoPgggrPgg5uPggquPgg}vPggyPggc|,Pgg_}PggPgg,PggrPgg3Pgg...##.....#.#..............#####. ...##.....#.#)....g##.......## #. ...##.....#.#......##........# #. ....#.....#.#......##........# #. ###.#.....#.#......##.....#..###. .# .#.....#.#......##.....##..##. .# ##........##'####.....##..### .# #........'...........##..# .#......##@.............###-- .#......##.....(.......>'.. .#......##..............### .+ #..............# .##..............# ## #...##.........#g   gnoll (polearm, missile, wandering) #...##.ggm......(.# #...##.......####...##.......#Pgg1902.2 (34.0)Pggu.gg)Pggl5==3.2 (35PggyPgg~' _The gnoll shouts!Pgg).....# .... ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@....... #.....(.......> #........ #........  #........  #...##...  #...##.......(.#  #...##...  . Pgg%1 ).....# .... ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@....... #.....(.......> #........ #........ #........ #...##...  #...##.......( #...##...Pgg2 E .Pgg:> 4PggwH PggEL \ _A gnoll is nearby!Pgg0 ).....# .... ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@....... #.....(.......> #........ #........  #........  #...##...  #...##.......(.#  #...##...  . Pgg@ ).....# .... ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@....... #.....(.......> #........ #........Pgg:A U #........ #...##...  #...##.......( #...##... .PggK PggL Pgg V PggY \ _A gnoll is nearby!Pgg\l :).....# ....Pggl ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@.......Pgg m < #.....(.......> #........Pgg2m H #........  #........ Pggm #...##...  #...##.......(.#  #...##...  . Pgg).....# .... ..... #.#..... .#.#......##... ##........##'####... #........'.........  #@....... #.....(.......> #........ #........ #........ #...##...  #...##.......(PggC #...##... .Pgg PggPggPggu\ _A gnoll is nearby!Pgg1+.......#+##.....#........#####).....##PggB2##.....g# ...#.#......#...# ###Pggk2.#.#......##.....#..#.#.....#.#......##....#Pgg2##'#######........'.Pgg2##..# .....##.......###Pgg2.....##.....(>'.. .#Pgg3n......##.### .+Pgg83S.... ..... Pgg\3N###..Pgg3:.(.Pgg3&.###Pgg8PggsU.gPggA--4.2 (1.0) _PggPggPggY###)).##.#####+........#....#+##.....PggY*........####)###...... ...#.....g#...# Pgg Z{###.#.#......#..#Pgg/Z.#.....#.#......##....##........##@####...Pgg_Z###..'.##..# ..#PggZc..###...(PggZm>'.. .#......#PggZA### .+.. .PggZK... ###Pgg[D.(.Pggf_Pggj.g--5PggrPggvQ _There is an open door here.Pgg).####.....#....###))..#.##.#####+........#....#+##.............####)## .......# ###g..#.#.....#.#...@..#.###'####...###........'...........##..# ....##..............###....(.......>'.. .#......#...## .+.... ....... ##.Pgg$Pgg.=6PggPgg3 _You block the gnoll's attack.PggOC7.3 (1.1PggZPgg] _You barely miss the gnoll. The gnoll barely misses you.Pgg PggZ W4--8.4Pgg# Pgg x _You completely miss the gnoll. The gnoll hits you with a +0 spear.Pgg\  You hit the gnoll.  The gnoll is lightly wounded.Pgg-9.3 (0.9PggPggY  _You block the gnoll's attack.  You slash the gnoll!  The gnoll is severely wounded.Pggp@5=-Pgg/=10.3 (1.0PggaPgg"3 _You block the gnoll's attack.Pggq47  You hit the gnoll.Pgg?C)PggHD.-1PggMPggP PggP;_You kill the gnoll!PggCPgg1F8-Pggܗ\ _Unknown command.Pggqiw#.....######....####.##......##.####...........#....#......##))..#.##.######+........#..#+##......##.....#.#..............#####.###.....#.#).....##.## #.##.....#.#......##.PggiY# #.# ...#.....#.#......##........# #.# ##.#.....#.#....@.##.....#..###.# # .#.....#.#......##.....##..##.. # ##..##'####.....##..#### # #........'.....##..# # ......##.......#### # ......##.....(>'...Pgg.j  # ......##.......####  Pgg]j+ .. #........# #  # Pggj. #......# # PggytPggQu5-2 _Pgg|Pggˆm  b - 3 throwing nets (gained 1)PggY6=-Pgg$3.3 (2PggPgg. _You see here a +0 spear.Pgg$!Pgg!Pgg#Pgg'PggO(PggH,Pgg-Pgg-Pggk/Pgg2Pgg3Pggi6Pgg <Pggc<K7=Pgg>PggH1 _HP restored.PggIO3PggQPggBTPggW,PggYPgg]@  There is an open door here.Pgg$d ..+#..........#+##.. #...##.....#.#....#### #...##.....#.#).....##.......## #...##.....#.#......##........# #...#.....#.#......##........# ####.#.....#.#....).##..### #.# .#.....#.#......##.....##..#Pggod# ##........##'####.....##..# #.# #........'@..........##..# .# ......##..............## ..# ......##.....(.......>'. ..# ......##..............# ..+ ... #..............Pggd# ..# z. #..............# z   wight (dormant)## . #...##.........#Pggd #...##.......(.# #...####Pggyk+9.3 (6PggYuz.zPgg[v,20.3 (7Pgg~Pggx _A wight comes into view. It is wielding a +0 long sword.Pgg....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####.. #........'@.......  ......##....... ......##.....(.> ......##....... .z. #.......  .. #.......  . #...##..  #...##.......(.#   PggFFF....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####.. #........'@.......  ......##....... ......##.....(.> ......##....... .z. #....... .. #.......  . #...##.. #...##.......( PggvLPggLPgg@SPggU\ _A wight is nearby!Pgg....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####.. #........'@.......  ......##....... ......##.....(.> ......##....... .z. #.......  .. #.......  . #...##..  #...##.......(.#   Pgg8F....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####.. #........'@.......  ......##....... ......##.....(.> ......##....... .z. #....... .. #.......  . #...##.. #...##.......( PggPggPggPgg\ _A wight is nearby!Pgg)....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####..Pgg _ #........'@.......  ......##....... ......##.....(.> ......##....... .z. #.......  .. #.......  . #...##..  #...##.......(.#   Pgg˹ ....).....# ...# ...# #.#....).# .#.....#.#...... ##........##'####.. #........'@.......  ......##....... ......##.....(.Pgg 8> ......##....... .z. #....... .. #.......  . #...##.. #...##.......( Pgg Pgg Pgg Pgg 1 #....+.#.#+## ##...##.....#.#....... ##...##.....#.#).....##.## #...##.....#.#......##Pggf .# .#.....#.#......##.# .####.#.....#.#....).##.....#.. .#.# .#.....#.#......##.....##...# ##.##'####.....##.. .#.# #..##..# .#.#.##..#Pgg/ h..##.....(.>'.# z......##....+.z.... #....#.#..... #.....# zz 2 wights (1 dormant)#...... #...##.#Pgg ....... #...##.......(.#  #...##.### _A wight is nearby!PggG Pgg Pgg z...zzPggu Y*=1.3 (1Pgg> Pgga  _A wight comes into view. It is wielding a +0 long sword. _A wight is nearby! _is nearby! _comes into view. It is wielding a +0 long sword.There is an open door here.Pgg~....+.#.#+##. #...##.....#.#.......# #...##.....#.#).....##.## # #PggH...##.....#.#......##.# ##.....#.#......##.# # ####.#.....#.#....).##.....#..# #.# .#.....#.#......##.....##..## ##.Pgg=##'####.....##..# #.# #.'##..# #.# .Pggz)##.Pgg## .z.....##.....(.>'.# .......##...#Pgg+ ...z... #.......# ....... #.....#  ....... #...##......... #...##.. PggPgg.Pgg^pz...z.Pgg-2 _PggPggPgg +.#.#+##. ...##.....#.#........#####. ...##.....#.#).....##.## #. ...##.....#.#......##.# #.#.....#.#......##.# #..#.....#.#....).##.....#..###. .# .#.....#.#......##.....##..##. .# ##.##'####.....##..# .# #.'.##..# .# ..z....##.# .# .......##.....(.>'. .# ....z..##.# .+ ....... #.# ....... #.#    wight ....... #...##ggP 39;49m.... #...##... PggV PggI% =z.Pgg% &3Pgg. Pgg1 Pgg, m.+.#.#+## #...##.....#.#........##### #...##.....#.#).....##.## # #...##.....#.#......##.# #.#.....#.#......##.# ##.#.....#.#....).##.....#..### #.# .#.....#.#......##.....##..## ..# ##.##'####.....##.. #.# #....z...'.##..# #.# .##. ..# .....z.##.....(PggX .>' ..# .......##. ..+ ....... #.# ..# ....... #.#z 2 wights# ....... #...##.# . #...##.....(.#  #...##.###Pgg- Pgg Pgg U.zz.Pgg &4Pgg Pgg PggPggPgg$.z.z.5Pgg0Pgg4PggJPgg|Xa.zz=PggY 6PggdPgg7hR _The wight barely misses you.Pggm^  You hit the wight.  The wight is moderately damaged.PggX_&7Pgg iPggo3 _You block the wight's attack.Pggl  You hit the wight.  The wight is heavily damaged.Pgg &8Pgg Pgg S _The wight closely misses you.Pggt w  You slash the wight!  You destroy the wight!Pggw Pgg" .   wightPggJ .49Pggv Pgg X _The Shining One accepts your kill.Pgg\  You hit the wight.  The wight is lightly damaged.Pgg.30.4 (1.1Pgg2Pgg3 _You block the wight's attack.Pgg  You hit the wight but do no damage.The wight is lightly damaged.PggA(1.5PggPggH3 _You block the wight's attack.Pgg)  You slash the wight!  The wight is severely damaged.Pgg*4=20Pgg3Pgg53 _You block the wight's attack.Pgg{ _You block the wight's attack.  You slash the wight!  The wight is severely damaged. _You block's attack.  You hit the wight but do no damage.  The wight is severely damaged.-3PggtPggl3 _You block the wight's attack.Pgg&oI  You barely miss the wight.The wight is severely damaged.The wight hits you with a +0 long sword.P: 66/66 (67)-4DrainPgguPggȁ _You partially resist. You feel drained.You slash the wight!  You destroy the wight!PggC)PggE ealth: 66/67 -7Pggd5.6 (1.1 _The Shining One accepts your kill.PggјPggk _Your life force feels restored.Pgg6PggPggy^ _No target in view!PggPggEPggEH _No target in view!PggPggxPgg6PggZPggh7= _PggPggݷPgg5Pgg Pggz  There is an open door here.  Items here: )) [[.Pgg?##...###......### .##...##.....#.#).....##....... .##...##.....#.#......##........ .......#.....#.#......##..####.#.....#.#....).##.....#.. ..#.# .#.....#.#......##.....##.. Pgg....# ##........##'####.....##...# #..)...........##.. ..#.# .@##..............- ....# ..##.....(.>..# z.......##.........+ z.......##.......Pgg?b..# ........##....... ##### .........#...##.. zz 2 wights (1 polearm, dormant) .........#...##(. #PggeH .........#...##.......## #PggM #...##.......Pgg-7.6 (2.0PggPggz..zzz)PggE-8.6 (3PggPgg  X _2 wights come into view.Pggä #).......#.#.......#.#......#....#.#....).# .#.....#.#...... ##........##'#### #........)...... .......@# .z......#(> ........# .z......# ........# ......... # .........( # ......... # PggA L#).......#.#.......#.#......#....#.#....).# .#.....#.#...... ##........##'#### #........)...... .......@# .z......#(>PggB r ........# .z......# ........# ......... .........( .........PggP PggQ Pgg!^ Pggb d _There are monsters nearby!Pgg~K#).......#.#.......#.#......#Pgg~....#.#....).# .#.....#.#...... ##........##'#### #........)...... .......@# .z......#(> ........# .z......#Pgg~I ........# ......... # .........( #Pgg~C ......... # Pgg#).......#.#.......#.#......#....#.#....).# .#.....#.#...... ##........##'#### #........)...... .......@# .z......#(> ........# .z......# ........# ......... .........( .........PggPgglPggPggd _There are monsters nearby!Pgg#....+........#.#+##.... ##...##.....#.#..............## ##...##.....#.#).....##.## ##...##.....#.#......##.# ....#.....#.#......##........# ####.#.....#.#....).##.....#..## .Pgg #.# .#.....#.#......##.....##..#.# ##.##'####.....##..# .#.# #............##..# .#.# ........##.......## .z##.....(>'# ........##......#+ .z##......# ...# .##......# #### ..#...##..# .Pggu.#...##.(. .........#...##.###PggPggPggeRz..zPgg Pggư)9.6 (1 Pgg _PggνPgg   Items here: )) [[. _2 wights come into view. _There are monsters nearby!There are monsters nearby!  There is an open door here. _Items here: )) [[.Pgg P....+.#.#+##. #...##.....#.#.......# #...##.....#.#).....##.## # #...##.....#.#......##.# ##.....#.#......##.# # ####.#.....#.#....).##.....#..# Pgg X#.# .#.....#.#......##.....##..## ##.##'####.....##..# #.# #.)##..# #.# ..z.....##.Pgg) F## ..##.....(.>'.# ........##...Pggǁ (#+ ..z.....##.......# ........##.....#  .........#...##...........#...##.. Pggӑ Pgg A=40 Pgg _Pgg Pgg PggB+.#.#+##. ...##.....#.#........#####. ...##.....#.#).....##.## #. ...##.....#.#......##.# #.#.....#.#......##.# #..#.....#.#....).##.....#..###. .# .#.....#.#......##.....##..##. .PggC# ##.##'####.....##..# .# #.).##..# .# ..z.....##.# .# ........##.....(.>'. .# ........##.# .+ ..z.....##.# ........##.PggxD# .........#...##....#...##... PggsGPggIPggdKPgg^z.z.zz 2 wights (1 polearm)1PggiPggmPgg,Pggz.zz.2Pgg>Pgg Pggv-Pgg.Pgg<T.zz.Pgg#=&3PggJPggMPggPggPggt.z.z4PggJPgge Pgg,t Pgg|u Pgg l.z.zPgg- &5Pgg[ Pgg Pgg] .+.#.#+## #...##.....#.#........##### #...##.....#.#).....##.## # #...##.....#.#......##.# #.#.....#.#......##.# ##.#.....#.#....).##.....#..### #.# .#.....#.#......##.....##..## ..# ##.##'####.....##.. #.# #.z.##..# #.# .z##. .Pgg" a.# ........##.....(.>' ..# ........##. ..+ ........##.# ..# ........##.## .........#...##.# .#...##.....(.#  .#...##.###Pgg{ D=6Pgg Pgg Z _The wight hits you but does no damage. You block the wight's attack.Pgg  You hit the wight.  The wight is moderately damaged.Pgg&7PggrPgg6 _You block the wight's attack. x2Pgg  You hit the wight.  The wight is moderately damaged.Pgg-8.7 (1.1PggPgggZ _You block the wight's attack. The wight hits you but does no damage.PggG  You completely miss the wight.The wight is moderately damaged.PggH,90PggTPggZ6 _You block the wight's attack. x2PggƳ  You slash the wight!  The wight is almost destroyed.=50PggdPggq _The wight closely misses you. You block the wight's attack.Pggp w  You slash the wight!  You destroy the wight!Pgg~ )   wight (The Shining One accepts your kill.Pgg >30-1.8 (1.1Pgg PggՒ Z _The wight hits you but does no damage. You block the wight's attack.Pggz #....+.#.#+## ##...##.....#.#....... ##...##.....#.#).....##.## #...##.....#.#......##.# .#.....#.#......##.# .####.#.....#.#....).##.....#.. .#.# .#.....#.#......##.....##...# ##.##'####.....##.. .#.# #..##..# .#.# .z##..# ..##.....(.>'.# ........##..Pgg| ..+ ........##....#.# ........##.....## .........#...##.# .........#...##.......(.#  .#...##.###Pgg \-20Pgg Pgg _The wight hits you but does no damage.  There is an open door here. _Items here: ))) [[[.Pgg |a  You hit the wight.Pgg|-3.7 (0.9PggPgg` _The wight is moderately damaged.Pgg'  You completely miss the wight.The wight is moderately damaged.4.6Pgg-Pggd0< _The wight hits you but does no damage.Pggw  You slash the wight!  You destroy the wight!Pgg4f)Pgg>=3=5.7 (1.1Pgg'PggX _The Shining One accepts your kill.Pgg4Pgg_Pgg#H _No target in view!Pggap 4Pgg8x Pggz H _No target in view!Pgg< Pgg Pgg Pgg Pggk Pgg : _Pgg Pgg# ,Pgg% Pgg2 Pgg5 PggD6 Pggg8 Pgg; Pgg? ,PggxA PggD PggH PggdH Pgg%J PggGW Pgga ..........#.....#.##.. .....####.#.....#.#....).##..... Pggb ..)..#.# .#.....#.#......##.....# ..#....# ##........##'####.....##.# #........)...# .....#.# #.......)##........... .<.....# #........##.....(.........# #........##........... .......+ ###...........--Pggb 60.7 (5.0......# #........##...#### #.........#...##...... #.........#...##......Pgg)c # #.........#...##...... #### ######....#...##......Pggpc  ....######...... .>..# #...... #......Pggc Pggl Pggm F--1.7 (6Pggu Pgg x 9 _Found an escape hatch in the floor.PggeIPggPgg!BPggJ2Pgg5Pgg@5Pgg7Pgg;Pgg<,Pgg=Pgg/@Pgg\B,Pgg:CPggEPggbG,PggwHPgg;JPggK,PggLPggNPggdQ,PggNSPgg;UPggV,PggjWPggXPggZ,Pgg9[Pgg\Pgg3^PggU^Pgg^PggaPggKb,PggcPggQdPggePggePggfPggkPggcsXPggu,Pgg+vPggyPgg{Pgg*|Pgg}Pgg1@  There is an open door here.PggQPgg҅ _PggPgg=XPgg]Pgg#.....###..#.#............+..................#...........#...........###...#.######....#......##.####.. # ..#....#......##))..... #.####.#....'........# #.#..#.##...##.....#.#.Pgg #....#.##...##.....#.#)  ####....##..@##.....#.# .......#.....#.# #......####.#.....#.#....) #...)..#.# .#.....#.  .####...#....# .##........##'##  ...........#.# .##........)o   orc (asleep)...........#.# .##.......)##..........<.....# o##........##...PggA.............# #........##...Pggs 78.7 (17.0)  An orc comes into view. It is wielding a +0 club.Pggyoo.PggS5==9.7 (18PggPgg% _The orc shouts!PggYh......+.....##....# # ..#....#)) #....'. #...##. #...##.)  #..@##. .............#. #......####.#.) #...)..#.# .#.  . .##.   .##.)   o##.......)  < .##...   #....PggZ......+.....##....# # ..#....#)) #....'. #...##. #...##.)  #..@##. .............#. #......####.#.) #...)..#.# .#.  . .##.   .##.)  Pgg' o##.......)  < .##...   #....PggPgg9 PggPggU[ _An orc is nearby!Pgg_......+.....##....# # ..#....#)) #....'. #...##. #...##.)  #..@##. .............#. #......####.#.) #...)..#.# .#.  . .##.   .##.)   o##.......)  < .##...   #....Pggw......+.....##....# # ..#....#)) #....'. #...##. #...##.) Pgg #..@##. .............#. #......####.#.) #...)..#.# .#.  . .##.   .##.) PggG  o##.......)  < .##...   #....PggPggNPggPgg [ _An orc is nearby!Pgg\Y......+.....##....# # ..#....#Pgg)) #....'. #...##. #...##.)  #..@##. .............#.Pgg9T #......####.#.) #...)..#.# .#.  . .##. Pgg{j  .##.)   o##.......)  <Pgg< .##...   #....Pgg ......+.....##....# # ..#....#)) #....'. #...##. #...##.)  #..@##.Pggd 4 .............#. #......####.#.) #...)..#.# .#.  . .##.   .##.)   o##.......)  < .##... Pgg Y  #....Pgg Pgg Pgg Pggo [ _An orc is nearby!Pgg ...............+.....#...........#############.####.. # ..))....####.#....'..#...#.##...##.....#.Pgg .##.)####....##...##.. ...........@.#. #####.#.))..#.# .#...####...#....# .##........##'##..........#.)....Pgg* o##.)##<.....# .##..........+.Pgg7 Pgg @o.Pggd &--Pgg 80.0) _Pgg Pgg Pgg d##.######.######....#......##.####...  # ..#....#......##))....#.####.#....'..#..#.#..#.##...##.....#.#.#....#.##...##.....#.#).....#####....##...##.....#.#......#.............#.....#.#......##......####@#.....#.#....).#Pgg 5#...)..#.##.#.....#.#......#.####...#....##.##........##'###...........#.##o##.)......#.##.##.)##.<.....##.##.##.......##.##.##..+..##.##.....)# #.##.PggN Pgg <o.Pgg A--1Pgg Pgg Pgg2########.####...  # ..))....####.#....'..#...#.##...##.....#...#.##).....#####....##...##. ............. #......####))..#...####...#....##o##........##'##..........#.##.).....)##<......+.)###.....####.#...#PggPgg.=2PggմPgg: _The orc hits you but does no damage.Pgg=( Pgg You hit the orc.  The orc is moderately wounded.Pggg&3Pgg[PggQ _The orc closely misses you.Pgg  You hit the orc.  The orc is severely wounded.4PggaPgg41 _You block the orc's attack.Pgge Pgge You hit the orc but do no damage.The orc is severely wounded.Pggf-5.6 (0.9PggpPggDt1 _You block the orc's attack.Pgg7  You slash the orc!Pgg E)Pggh !Pgg> -6.7 (1.1PggS Pgg G _You kill the orc!PggXj 4PggHo Pgg"r H _No target in view!Pgg Pgg" C  Skill  Level Cost  Apt Skill  Level Cost  Apt Pgge  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1      Pgg ,     b - Unarmed Combat   0.0   1.0   0  Pgg      c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1  Pgg      l - Evocations   0.0   1.0   0  Pgg @ d - Short Blades   6.6   1.0   0      Pggc e + Long Blades 10.7  12.0   0          Pgg      f - Armour   3.0   4.0   0      Pgg . g - Dodging   0.0   1.0   0      PggE ) h - Shields   5.4   6.0   0       i - Stealth   0.0   0.8  +1              Pgg             Pgg !            Pgg         Pgg" The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] HelpPggF G[=] set a skill target  Pggk g[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsPgg PggPggPgg....#.######....#......##.####... deadiverson the Carver# ..#....#......##))...... Human of the Shining One **....#.####.#....'........#....... Health: 67/67 ========================#.#..#.##...##.....#.#....... Magic: 9/9========================#....#.##...##.....#.#).....# AC: 15Str: 17####....##...##.....#.#......# EV: 10Int: 11.............#.....#.#......# SH: 13Dex: 14#......####.#.....#.#....).# XL:  9 Next: 33% Place: Dungeon:6#...)..#.##@#.....#.#......# Noise: =--------  Time: 6986.7 (0.0)  Pgg_.####...#....##)##........##'### a) +0 long sword...........#.##.##........)..... Throw: 3 darts (poison)...........#.##.##.......)##...........<.....##.##........##.................##.##........##.... .............+..##........##.... ....)........#####........##.... .........##### #.........#...# You hit the orc but do no damage.The orc is severely wounded. _You block the orc's attack.  You slash the orc! _You kill the orc! _No target in view!PggPgg PggPggYPgg>  You are illuminated by a small divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 1.0 (and is slowed by your shield).PggRHPggK  Your damage rating with your +0 long sword is about 14 (Base 10 x 110% (Dex) x _130% (Skill)).PggPgg  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting   4.8   5.0   0   j - Spellcasting   0.0   1.2  -1          Pgg b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0      e + Long Blades 10.7  12.0   0               f - Armour   3.0   4.0   0  gg9m     g - Dodging   0.0   1.0   0       h - Shields   5.4   6.0   0       i - Stealth   0.0   0.8  +1              Pgg@                        Pgg#        The relative cost of raising each skill is in cyan.  Pgg,Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  Pgg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsPgg  e * Long Blades  10.7Pggo e - Long Blades  10.7Pggg = a + Fighting 4.8Pgg: ....#.######....#......##.####... deadiverson the Carver# ..#....#......##))...... Human of the Shining One **....#.####.#....'........#....... Health: 67/67 ========================#.#..#.##...##.....#.#....... Magic: 9/9========================#....#.##...##.....#.#).....# AC: 15Str: 17####....##...##.....#.#......# EV: 10Int: 11.............#.....#.#......# SH: 13Dex: 14#......####.#.....#.#....).# XL:  9 Next: 33% Place: Dungeon:6#...)..#.##@#.....#.#......# Noise: =--------  Time: 6986.7 (0.0)  .####...#....##)Pgg [33m##........##'### a) +0 long sword...........#.##.##........)..... Throw: 3 darts (poison)...........#.##.##.......)##...........<.....##.##........##.................##.##........##.... .............+..##........##.... ....)........#####........##.... .........##### #.........#...#  _No target in view!  You are illuminated by a small divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 1.0 (and is slowed by your shield).  Your damage rating with your +0 long sword is about 14 (Base 10 x 110% (Dex) x _130% (Skill)).Pggg PgguPggXvPggwPggPggQPgg$ _Pgg,Pgg,PggjPggPgg,PggPggɗPgg,PggPggPgg*,PggPgg]Pgg,PggoPgg(Pgg,Pgg߱Pgg`Pgg ,PggPggPgg,PggPggPgg ,PggPggPgg,PggPggCPgg*,PggPggPgg,PggPggPggK,PggUPgg{Pgg,Pgg+PggWPgg,PggPgg{Pgg,PggZPggsPggg,PggPggJPgg ## #.#.#..#+##.### #...#..'..# #.#.#### ###......).........' ........#######.###.##.... ........# #.# #.##.... ........##### #.###.##.... ......#.....###.....##.... .........@...........+....- .........#...........#.... #.#......#.######....# .......#......#.... ......s#.####.#....' #......#.#..#.##...##gg~0;1ms   scorpion (asleep) #......#....#.##...##... ####'#####....##...##... ..............#...Pgg827004.7 (18.0)Pgg6s.sPgg!-Pgg%5.7 (19Pgg#Pgg'[ _A scorpion comes into view.Pgg}* ##  Pgg~ #.Pgg Pggp#.Pgg ###......) ....... ........# #.#  ........#####  ......#.....###.. .........@....... .........#....... #.#......#.###### ......s#..... .......#.####. #......#.#..#. #......#....#. ####'#####.... Pgg .....PggYPgg L ##  #. #. ###......) ....... ........# #.#  ........#####  Pgg ......#.....###.. .........@....... .........#....... #.#......#.###### ......s#.....Pgg  .......#.####. #......#.#..#. Pgg  #......#....#. ####'#####....Pgg8 O .....Pgg& Pgg(' Pgg. Pgg2 _ _A scorpion is nearby!Pgg]  ##  #. #. ###......) ....... ........# #.#  ........#####  Pgg/^ ......#.....###.. .........@....... .........#....... #.#......#.###### ......s#..... .......#.####. #......#.#..#. Pgg^ _#......#....#. ####'#####.... .....Pgg  ##  #. #. ###......) ....... ........# #.#  Pgg f........#####  ......#.....###.. .........@....... .........#....... #.#......#.###### ......s#.....Pgg  .......#.####. #......#.#..#. Pgg #......#....#. ####'#####....PggE O .....Pgg Pgg{ Pgg Pgg _ _A scorpion is nearby!Pgg  ##  #. #. ###......) ....... ........# #.#  ........#####  ......#.....###.. .........@....... .........#....... #.#......#.###### ......s#..... .......#.####. #......#.#..#. #......#....#. ####'#####.... .....Pgg/ ##  #. #. ###......) ....... ........# #.#  ........#####  ......#.....###.. Pgg{.........@....... .........#....... #.#......#.###### ......s#..... .......#.####. #......#.#..#. #......#....#. ####'#####.... .....Pgg'Pggj(Pgg/Pgg2_ _A scorpion is nearby!Pgg  #...##.'..#... #.#.##.#.######......).........'........#######.###.## ........# #.# #.## ........##### #.###.## ......#.....###.....## .....................+ #...........# #.#......#.######....# .s#......#....##.......#.####.#....'##......#.#..#.##...##Pgg{ #......#....#.##...## ####'#####....##...## #. ..............# ###......####.#PggPgg <s.Pgg 86.0) _PggPggPggw  You slash the scorpion!  The scorpion is heavily wounded.Pggzd5-==7.8 (1.1PggPgg. _The scorpion stings you.Pggџ<  You slash the scorpion!Pggr†Pgg  6/68-780 _You kill the scorpion!PggPggi _Your Fighting skill increases to level 5!PggD PggtE PggGL PggN H _No target in view!Pggn Pgg Pggh Pgg̕ Pggљ : _PggH Pgg %7PggP PggV ,PggÞ Pggݡ Pgg! PggJ PggS Pgg K8=Pgg- Pggj PggR ,Pgg Pgg Pgg ,Pgg! Pgg Pgg  #.#.##........#.##.######......).........'..........#######.###.## ..........# #.# #.## ..........##### #.###.## #.......#.....###.....## >......................+ #.#...........# ##.#..@..†#.######....#--15.8 (7 ...........#......#....####.......#.####.#....' ##......#.#..#.##...# #......#....#.##...# ####'#####....##...# Pggq #.............. ########## #...)..#.##Pgg+PggF--6.8 (8PggB%Pgg' PggA-_Found a stone staircase leading down.PggIIPggNPggOQPggTO=PggUPggWPgg#XPggXPggJ[Pgg@],Pgg<^PggEaPggtcPggcPggedPggHfPgggPggHhPgghPggjPggl,PgglPggoPggpPggpPggCqPggtPgguPggMvPggvPggyPggzPgg{Pgg{Pgg#~PggEPggPggBPgguPggPggPggPgg`PggPggPggPggPggPggoPggPgg>PggPggPgg,Pgg/PggܩPggPggPgg@PggR  There is a stone staircase leading down here.PggPgg _PggPggIPggPggPgg׶PggPggD,PggPggQPggBPggPggBPggPgg!BPggPggv,PggPggPgg,PggiPggdPgg]PggPggPggPgg,Pgg PggZPgg,PggPggPggQPggPggPggRPgg,Pgg;PggPgg,Pgg`PggPggPgg,PgghPggPggPggPggPggBPggBPggPgg(PgguPggPggPggEPggPggPggPggo,PggPggPgg,PggPggPgg,PggQPgg BPggk Pgg PggEPggsPggPgg-PggPgg=PggPggR  There is a stone staircase leading down here.PggPgg _PggPgg"Pgg!Pgg+"Pgg#PggI&Pggb(Pgg(Pgg)Pgg,PggU/,Pgg0Pgg3Pgg6,Pgg7Pgg:Pgg =PggC=Pgg>PggAPggC,PggEPgg?GPgg_IPggIPggJPggLPggpO,PggPPgg9YB  You see here a +0 chain mail.Pgg=ZPggZ _Pgg\Pgg_PggPbPggbPggcPggAfPggh,PggiPggkPgg5lPggelPgglPggnPggoPggoPgg pPggqPggr,PggrPggtPggEu,PgguPggvPggw,PggZxPgg]zPggf   Pgg#    ###########   #......O..# #  #@# #.# #.Pgg  #.# #.# #)  #.# ###.#######.  #.# ###..<.gg.....  #.# #....g...####  #.###.##++##.#.... O   ogre (asleep)  #...[.# #...###PggD  #####.# #.#.##. #.# #...##.Pggr!PggY8 74.8 (58.0)  PggbAn ogre comes into view. It is wielding a +0 giant club.Pggo~O.OPggk5==5.8 (59PggPgg& _The ogre shouts!Pgg: ###########  #.....O...#  #@# #.#  #.# #.# #) #.#  #.# ###..< #.# Pgg;i #.# #...[.#  #####.#  #.# PggWAPgg ###########  #.....O...#  #@# #.#  #.# #.# #) #.#  #.# ###..< #.# PggE #.# #...[.#  #####.#  #.# PggxPggPggwPgg\ _An ogre is nearby!Pgg+ ###########  #.....O...#  #@# #.#  #.# #.# #) #.#  #.# ###..< #.#  #.# #...[.#  #####.#  #.# Pgg_ ###########  #.....O...#  #@# #.#  #.# #.# #) #.#  #.# ###..< #.#  #.#Pgg #...[.#  #####.#  #.# PggPgg1PggPgg@\ _An ogre is nearby!Pgg R    Pgģ  ###########  #.@...O...# ### #.#######.# #.) #.# #.# #)# #.# ###.#######.# #.# ###..<.gg.....Pgg  #.# #....g...###### #.###.##++##.#..... #...[.# #...#### #####.# #.#.##.Pgg^ Pgg Pgg. 4O.Pgg{ 8--6.8 (1.0) Pgg _Pgg Pgg Pgg (((((((You throw a poisoned dart.Pggg&PggA0Q.O....Pgg0x--8.0 (1.22Pgg9Pgg>_ _The poisoned dart barely misses the ogre.PggV ((poisoned)You throw a poisoned dart. The poisoned dart hits the ogre.Pgg5~PggUO(PggLg9.2dart (poison) PggXPggZ+ _The ogre is poisoned.Pgg5 very poisoned)You throw a poisoned dart. The poisoned dart hits the ogre.  The ogre looks even sicker.Pggf  The ogre is lightly wounded.=PggI80.3 (1.1Nothing quiveredPggR _The ogre closely misses you.PggPgg)/  You hit the ogre but do no damage.The ogre is lightly wounded.Pgg/Pgg0!1.4PggcH _You block the ogre's attack.Pgg 6  You hit the ogre.Pggѹ (2.5Pgg Pggs 2 _The ogre is lightly wounded.Pgg  You slash the ogre!  The ogre is heavily wounded.Pgg `0---=3.6Pgg@ Pgg = _The ogre hits you with a +0 giant club!Pgg5  You hit the ogre.  The ogre is severely wounded.Pgg`1----4.7PggPggh2 _You block the ogre's attack.PggE  You hit the ogre.  The ogre is almost dead.PggB-5.8Pgg|Pgg:2 _You block the ogre's attack.Pgg* _You block the ogre's attack.  You hit the ogre.  The ogre is almost dead. _You block the ogre's attack.  You hit the ogre.  The ogre is almost dead.Pggge)Pgg1426.9PggPggq.  You hit the ogre.  The ogre is almost dead. _You block the ogre's attack.  You hit the ogre.  The ogre is almost dead. _You kill the ogre!Pgg{2Pgg¶XPggJK3=PggPggPgg?PggPgg5,Pgg^PggPgg=U4=PggPgg,Pgg Pgg,PggpPgg[PggPgg?PggPggB%5PggPgg-PggoPggPgg,PggPggxPggK6=PggPgg,PggPggPggPggPggPgg>#7Pggq2=Pgg<Pgg,Pgg)PggPggAPggfPgg\PggK8=PggZPggPgg Pgg Pgg Pgg  f - a poisoned dartPgg Pgg?b _You see here a +0 giant club.PggjPggPggPggPgg:=Pgg Pgg$n _f - 2 poisoned darts (gained 1)Pgg7'4Pgg(Pgg@+Pgg-,Pgg0PggC2Pgg4,Pgg6Pgg{8Pgg:Pgg;Pgg<PggK?PggAPggAPgggCPggKBPgg]n _f - 3 poisoned darts (gained 1)Pggh     ########### #..)......# ###### #.#######@# #.)..# -116.9 (30.0) #.# #.# #)##.# Pggi #.# ###.#######.##)##### Throw: 3 darts (poison) #.# ###..<.gg.....##...... #.# #........########..... #.###.##''##.#......+..... #...[.#≈≈≈≈#...##### #####.#≈.>§#.#.##........ #.# #...##........'Pgg]r;≈Pgg!sF-7.9 (31PggXzPgg|9 _Found an escape hatch in the floor.PggT PggdU PggV Pggm Pgg8v  ###########..)......#############.).. )##0.0)###.#######.##)#####Pggv ###..<.gg.....##...........##''##...#.  #.#≈_ß≈#...##........' ##Pgg~ Pgg +8.9 (1Pgg6 %_Pgg_ Pgg @ _Found a shimmering blue altar of Sif Muna.Pggm>Pgg>Pgg@PggUPgg^WPggWPgg]Pgg_Pgge,PgghPggMqPggu,PggwPgg}Pgg,Pgg<PggPgguPggPgg2PggPggPggۛPggoPggPggV,PggPggPggY,PggPggbPgg,Pgg$PggPggPgg?Pgg>PggJPggPggPggNPggPgg$,PggPgg@  There is an open door here.PggiPgg _PggPggPgg,PggPggKPgg,PggaPggPgg ,PggPgg Pgg_BPggPgg,PggPggPgg,PggPggPggPggPggq$Pgg(@  There is an open door here.Pgg*PggI+ _Pgg,Pgga.PggN0Pggx0Pgg1Pgg3Pgg6,Pgg7Pgg?nPgg-@Pgg\@PggAPggPgg&,PggPgg2PggPgg PggPgg Pgg",Pgg"Pgg#Pgg$Pgg$PggE%Pgg'Pgg(,PggP)Pgg1Pgg#2Pgg>3Pggc4,Pgg"5Pgg5Pgg6Pgg6PggI7Pgg8Pgg9,Pgg):Pgg;Pggb<Pgg<Pgg<PggBnPggBPggCPggCPgg.LPggN,PggKPPggSPggV,PggPXPgg [Pggg^,PggO`PggdPgg2h,Pgg&jPgglPggXoPggoPggpPggsPgg[uPgguPggvPggPgg,PggPggPggtPggPggPggٛPgg,PggPggâPgg0,Pgg PggPgg ,PggPggPggPggPgg,PggPggPggl,PggPggPgg\,PggPggPggRPgg{PggPggy@  There is an open door here.PggTPgg _Pgg#PggPgg,Pgg!PggPgg,PggPggPgg?,Pgg~PggPgg#!,Pggc"Pgg$%Pgg',Pgg)Pgg,Pgg.,Pgg0Pgg;<  You see here a +0 mace.Pgg=Pgg= _Pggy?PggjBPgg9E,PggFPggAIPggK,Pgg;MPggOPgg R,PggjTPggMXPgg#d#.# #.###.......#.####.#....'.... #.# #.# ##......#.#..#.##...##... #.# #.# #......#....#.##...##... #.# #.# ####'#####....##...##... #.###.# #................#... #.....# # ######......####.#... ####### ... #...)..#.##.#... .....####...#....##)##.. S......@.......#.##.##.. ...............#.##.##.. ...........<.....##.## .................##.## .................+..## Pggd$####....)........#####S   adder (asleep) #.........##### #.. #.........# #.. .........# #..Pggqk085.9 (67.0)Pggue.SSPggmv,6.9 (68Pgg"PggY _An adder comes into view.Pgg^ ' #.# . #.# ##.. #.# Pgg l.##. .... # .... ... #...).. .....####...#....##)Pgg*U .S.....@.......Pgg ............... ...........<... ............... ............... ####....)...... #.........##### PggP #.........#   Pggyx ' #.# . #.# ##.. #.# .##. .... # .... ... #...).. .....####...#....##) .S.....@....... ............... ...........<... ............... ............... Pggy####....)...... #.........#####  #.........#   Pgg4PggPggd] _An adder is nearby!PggA/Pgg0ZSave game and exit? Pgg0"Y - Yes Pgg1' N - NoPggS Pgg #.# #.###.......#.####.#....'.... deadiverson the Carver #.# #.# ##......#.#..#.##...##... Human of the Shining One **.... #.# #.# #......#....#.##...##... Health: 68/68 ======================== #.# #.# ####'#####....##...##... Magic: 9/9======================== #.###.# #................#... AC: 15Str: 17 #.....# # ######......####.#... EV: 10Int: 11 ####### ... #...)..#.##.#... SH: 13Dex: 14.....####...#....##)##.. XL:  9 Next: 42% Place: ggƪ 49mDungeon:6.S.....@.......#.##.##.. Noise: ---------  Time: 7186.9 (0.0)...............#.##.##.. a) +0 long sword...........<.....##.##.. Throw: 3 darts (poison).................##.##...................+..##..####....)........#####.. S   adder#.........##### #..#.........##...........##.. Pggu _There is an open door here. _There is an open door here. _You see here a +0 mace. _An adder comes into view. _An adder is nearby!Okay, then.Pggo Pgg Pgg8 . _PggmS #.# #.###.#.####.#....'  #.# #.# ##......#.#..#.##...##  #.# #.# #......#....#.##...##  #.# #.# ####'#####....##...##  #.###.# #.........# Pgg #.....# ##########......####.#  # ..... #...)..#.##.#.####...#....##)##s.S....@........#.##.##.#.##.##.<.....##.##.##.##.+..###....).#####. s   scorpion (asleep) #.##### #. S   adder #.# # .# #PggwPgg3PggPgg.s..SsPggc+7.9 (1Pgg3PggB_There is an open door here. _You see here a +0 mace. _comes into view. _An adder is nearby! _A scorpion comes into view.Pgg) #.# #.###.#.####.#....' #.# #.# ##......#.#..#.##...## #.# #.# #......#....#.##...## #.# #.# ####'#####....##...## #.###.# #.# #.....############......####.# ##...... #...)..#.##.##......####...#....##)###.s..S.#.##.###.#.##.###.<.....##.###.##.###.+..###....).##### #.##### # #.# # .# #PggPggPgg'PggGT..s.SPgg\<8PggPgg!9  You slash the adder!Pgg%Pgg/i.s†Pgg4?3==90.0 (1.1Pggk?PggCI _You kill the adder!Pggx #.# #.###.#.####.#....' #.# #.# ##......#.#..#.##...## #.# #.# #......#....#.##...## #.# #.# ####'#####....##...## #.###.# #.# #.....######......####.# ##......# #...)..#.##.#Pggĥo #......####...#....##) #....s.#.##. #.#.##. #.<.....##. #.##. #.+.. ######....). #.##### #.# .#PggJ-10PggPggƼ _You block the scorpion's attack. _You see here an adder corpse.PggV6  You hit the scorpion.  The scorpion is moderately wounded.-2Pgg= Pgg@ A _The scorpion stings you but does no damage.Pgg~  You hit the scorpion.  The scorpion is moderately wounded.You block the scorpion's attack.3Pgg Pgg A _The scorpion stings you but does no damage.Pgg  You slash the scorpion!  The scorpion is severely wounded.Pgg.=4PggPgg"!6 _You block the scorpion's attack.Pggd  You hit the scorpion.  The scorpion is almost dead.Pggd5-5.1 (1.1PggmPggqU _The scorpion barely misses you.Pgg&  You barely miss the scorpion.The scorpion is almost dead.PggF-60PggPgg:6 _You block the scorpion's attack.Pgg:  You hit the scorpion.Pgg(G†Pgg,>9/69467.0 (0.9Pgg3PggY6L _You kill the scorpion!Pgg 4Pgg Pggk H _No target in view!PggPgg-~Dungeon Crawl HelpManual Contents Press one of the following keys to*Table of contents obtain more information on a certain A.Overview aspect of Dungeon Crawl.PggpB.Starting Screen ?: List of commandsC.Attributes and Stats ^: Quickstart GuideD.Pgg,Exploring the Dungeon :: Browse character notesE.Experience and Skills #: Browse character dumpF.Monsters ~: Macros helpG.Items &: Options helpPgg$H.Spellcasting %: Table of aptitudesPggKI.Targeting /: Lookup descriptionPggqJ.Religion Q: FAQPggK.Mutations V: Version informationPggL.Licence, Contact, History !: Display diagnosticsPggM.Macros, Options, Performance Home: This screenPggKN.PhilosophyPgg'1.List of Character Species2.List of Character BackgroundsPggM3.List of Skills4.List of Keys and CommandsPggpM5.InscriptionsPggM6.Dungeon sprint modesPgg Movement: Game Saving and Quitting: To move in a direction or to attack, S: Save game and exit use the numpad (try Numlock off andCtrl-S : Save and exit without query on) or vi keys:Ctrl-Q : Abandon the current character 7 8 9 y k u  and quit the game \|/\|/ Pggy 4-5-6h-.-lPlayer Character Information: /|\ /|\@ : display character status 1 2 3 b j nm : show skill screen % : character overview Rest: Pgg ^ : show religion screen . : wait a turn (also s, Del)PggC A : show Abilities/mutations 5 : rest and long wait; stops when\ : show item knowledge  Health or Magic become full orM : show your spell library  something is detected. If Health } : show runes collected  and Magic are already full, stops [ : display worn armour  when 100 turns over (numpad-5)" : display worn jewelleryPggz !$ : display gold in possession Extended Movement:E : display experience info o: auto-explore Pgg G: interlevel travelDungeon Interaction and Information: Ctrl-F : Find itemsPgg O/C : Open/Close door Ctrl-W : set Waypoint</> : use staircase / Dir., Shift-Dir.: long walkPgg+ S;: examine occupied tile andYggpzShift-Tab, p : trigger quivered action; | : toggle view layers if targeted, aims at Ctrl-O : show dungeon Overview nearest monster Ygg A : toggle auto-pickup Item types (and common commands) Inventory management: ) : hand weapons (wield) i : show Inventory list ( : missiles (Quiver, fire, )/( cycle) , : pick up items (also g) [ : armour (Wear and Take off)  (press twice for pick up menu) ? : scrolls (read)d : Drop an item ! : potions (quaff)d#: Drop exact number of items = : rings (Put on and Remove)D : Drop the last item(s) you picked up" : amulets (Put on and Remove) % : talismans (eVoke) ItemYggЪ Interaction: / : wands (eVoke){ : inscribe item : : books (Memorise, zap, Zap, f : Fire the currently quivered actionpick up to add to library) F : select an item and Fire it | : staves (wield)Q : select action to be Quivered } : miscellaneous items (eVoke)] : swap between most recent quiver act$ : gold ($ counts gold)q : Quaff a potion 0 : the Orb of Zot r : Read a scroll  Carry it to the surface and win! w : Wield an item (- for none) ' : wield item a, or switch to b Other Gameplay Actions: (use = to assign slots) a : use special Ability (a! for help) v Yggį: attack with wielded itemYggl@  ]gg6 ]gg ]gg[ #.# #.###.......#.####.#....'. deadiverson the Carver#.# #.# ##......#.#..#.##...## Human of the Shining One **....#.# #.# #......#....#.##...## Health: 69/69 ========================#.# #.# ####'#####....##...## Magic: 9/9========================#.###.# #................# AC: 15Str: 17#.....############......####.# EV: 10Int: 11########......# #...)..#.##.# SH: 13Dex: 14#......####...#....##)# XL:  9 Next: 46% Place: Dungeon:6#....†@..........#.##.# Noise: = ]gg --------  Time: 7197.0 (0.0)#................#.##.# a) +0 long sword#............<.....##.# Throw: 3 darts (poison)#..................##.##..................+..#######....)........#####.........######.........#.........#You barely miss the scorpion.The scorpion is almost dead. _You block the scorpion's attack.  You hit the scorpion. _You kill the scorpion! _No target in view! ]gg ]gg ]gg ]gg ]gg ]gg ]gge ]gg"  The scorpion is almost dead. _You block the scorpion's attack.  You hit the scorpion. _You kill the scorpion!  ]ggVw_No target in view!Unknown command. ]gg۬  ]gg2  ]gg)  ]ggp F _Unknown command. ]ggK _ ]gge  ]gg $ _ ]ggu ]gg8 ]gg, ]gg ]gg> #...#.##...## ####'#####...##.# #....................############......####.#######......# #...)..#.## #......####...#....##) #....††........ ]gg5?0...........#.##..<....-9.0 (2.......+.#####....)# ###### #.....##########  ]ggf?! ]gg@8- ]ggE ]ggpGE _Done exploring. ]ggY 3 ]ggN  ]gg T†.0 ]gg  ]gg  ]gg&   ]ggC 7_Done exploring. ]ggf ]ggBg ]gg}h ]ggO ]gg ]gg ]ggE _Done exploring.]gg]gg4]gg]gg4]gg(]gg/Unknown command. __Done exploring.]gg ]ggE Where to? (Tab - D:5 @ (x,y), ? - help)  D - Dungeon  T - Temple ]ggT / ]ggY #.# #.# #......#....#.##...## deadiverson the Carver]gg" #.# #.# ####'#####....##...## Human of the Shining One **....]gg #.###.# #................# Health: 69/69 ========================]gg #.....############......####.# Magic: 9/9]ggX 2========================]gg ########......# #...)..#.##.# AC: 15]ggN .Str: 17]ggө #......####...#....##)# EV: 10]gg8 .Int: 11]gg #....††..........#.##.# SH: 13]gg2 .Dex: 14]gg #................#.##.# XL:  9 Next: 46% Place: Dungeon:6]gg 5#.....@......<.....##.# Noise: ---------  Time: 7199.0 (0.0)]ggo #..................##.# a) +0 long sword]gg #..................+..# Throw: 3 darts (poison)]ggV Q######....)........####]gg A#.........#####]gg =#.........#]ggD =#.........#]gg %########### ]gg _Unknown command. ]ggN 7_Unknown command. ]gg ,_Done exploring. ]gg 6_Done exploring. ]ggK 6_Done exploring. ]gg 0_Done exploring.]ggƱ ]gg7 ]gg ]gg ]gg ]gg  ]ggJ _]gg ]gg ]ggG ]gg4 ]ggD ]gg! ]gg ]gg ]gg ]gg ]ggT ]ggC ]gg[ ]ggj ]gg]gg]gg ]gg]gg]gg]ggY]gg`!]ggQ$]gg%]gg&]gg+]gg]/]gg!0]gg1]gg5]gg?]gg1A]ggB]ggZF]ggI]ggI]ggcK]ggN]ggQ]ggzR]ggAT]ggW]gg(Z]ggZ]gg\]ggv` ]gga_]gg`b9_Done exploring. ]ggb_]ggc There is an op]ggdc en door here.]gg2f]ggdg ]ggg_]ggCi]ggl]ggn]ggo]ggp]ggts]ggv]ggv]ggtx]gg{]gg<~]gg ]ggm]gg]gg]ggv]gg]ggp]gg]gg]gg#]gg]gg]gg]ggP]gg]ggI]gg]gg]gg ]gg٨ ]gg:4There is a stone staircase leading down here.]ggت]gg]ggî ]gg3_]gg1]gg<]gg=  You climb downwards.  You hear the roar of battle.]ggu/  --more--]gg9) ....... .... .. ....... #...#.## # .# .............# ..# 7.g#..#..#.........Y..........#........#.# Y   sky beast (asleep).#......#.. g   gnoll (asleep)######..#.]gg5]gg*gYYg]gg 1220.7 (21.7)]gg]gg'  There is an entrance to a bailey on this level. Hurry and find it before the _portal closes forever! _There is a stone staircase leading up here.]gg>Read which item? Scrolls  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 5 scrolls labelled MEYCSO REZEI  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]gg,7]gg7]ggGBdeadiverson the Carver.......Human of the Shining One **........ ..Health: 69/69 ========================.......Magic: 9/9========================#...#.## #AC: 15Str: 17.#......####.#EV: 10Int: 11.............#SH: 13Dex: 14............#XL:  9 Next: 46% Place: Dungeon:7.g.....@.#Noise: ---------  Time: 7220.7 (0.0).........#a) +0 long sword.........#Throw: 3 darts (poison).........Y..........#........#.#Y   sky beast.#]gg7Ch......#..g   gnoll######..#.# _There is a stone staircase leading down here.  You climb downwards.  You hear the roar of battle.There is an entrance to a bailey on this level. Hurry and find it before the _portal closes forever! _There is a stone staircase leading up here.]ggLP  Okay, then.]ggM]ggU]ggZ. _]ggr ]ggs ]gg{ ]ggL ]gg ]gg j.gY.]ggW 21.7 (1 _]gg ]ggc   #####.#≈.>≈#.#.##.....  #.#≈_ß≈#...##.....  #.#≈≈≈≈#.#.##.....  ##.######......)...  #...........#######  #...........# #  #...........##### #  ######.......#.....###6  #...............  #.#####.........#.....  #.# ####.#.....†#.####  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#  #.# #.# #..[]ggq 37m....#....#   #.# #.# ####'#####...   #.###.# #......... ]gg -3.2 (2.5]gg ]gg } _You climb upwards. _There is a stone staircase leading down here.]gg?9]gg=Read which item? Scrolls  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  t - 5 scrolls labelled MEYCSO REZEI  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]gg]gg׾]gg  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9]ggG======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7223.2 (0.0) ]gg/ #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison) ]ggE #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####...]gg   #.###.# #......... There is an entrance to a bailey on this level. Hurry and find it before the _portal closes forever! _There is a stone staircase leading up here. _Okay, then. _You climb upwards. ]ggFN_There is a stone staircase leading down here.]gg  As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify.]ggo/  --more--]gg]gg[8Identify which item? (\ to view known items) Scrolls (select first with ?)  g - 2 scrolls labelled XYD YCROOMM  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (select first with !)  i - a viscous pink potion[?] describe selected]gg@']ggW  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7223.2 ]ggX(0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####...   #.###.# #.........  _There is a stone staircase leading up here. _Okay, then. _You climb upwards. _There is a stone staircase leading down here.  As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify.4.2 (1 _[35]ggYAmg - 2 scrolls of vulnerability]gg;]gg;/Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU ]gg s - a scroll labelled EDWEOS VEXAt - 4 scrolls of identify  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]ggv ]gg1 ]gg   #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14 ]ggm  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7224.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####... ]ggj    #.###.# #.........  _Okay, then. _You climb upwards. _There is a stone staircase leading down here.  As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify. _g - 2 scrolls of vulnerability]ggy ]gg Identify which item? (\ to view known items) Scrolls (select first with ?)  m - 2 scrolls labelled JUDAXY DOSHAXE  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (select first with !)  i - a viscous pink potion[?] describe selected]gg ]gg ]ggf   #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15]gg *Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6 ]ggQ S #....@................ Noise: ---------  Time: 7224.2 (0.0) ]gg  #.#####.........#..... a) +0 long sword ]gg ^ #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####]gg n  #.# #.# ##......#.#..#   #.# #.# #......#....#]gg    #.# #.# ####'#####...   #.###.# #.........  _Okay, then. _You climb upwards. _There is a stone staircase leading down here.  As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify. _g - 2 scrolls of vulnerability]gg ]  As you read the scroll of identify, it crumbles to dust.]ggr +5.2 (1]gg% :_]gg( U _m - 2 scrolls of fear]gg,]gg#Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear ]ggo n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXAt - 3 scrolls of identify  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB ]gg z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]ggl ]gg: ]gg   #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== ]gg= #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14 ]ggh s ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7225.2 (0.0) ]gg  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#..... ]gg U #.# #.###.......#.####  #.# #.# ##......#.#..#  ]gg+  #.# #.# #......#....#  ]ggO  #.# #.# ####'#####...  ]ggs  #.###.# #.........  _There is a stone staircase leading down here.  ]gg As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify. _g - 2 scrolls of vulnerability]gg As you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fear]gg9 ]gg= nIdentify which item? (\ to view known items) Scrolls (select first with ?)  n - a scroll labelled DEGEUR JITS  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXA ]gg_= v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (select first with !) ]gg=  i - a viscous pink potion[?] describe selected]gg_]ggd]ggh5  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ]ggi`##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14]ggiX  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7225.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#..... ]ggi #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#]ggi<   #.# #.# ####'#####...   #.###.# #.........]ggi  _There is a stone staircase leading down here.  As you read the scroll labelled MEYCSO REZEI, it crumbles to dust.  It is a scroll of identify. ]gg%j_g - 2 scrolls of vulnerabilityAs you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fear]ggx _As you read the scroll of identify, it crumbles to dust.]gg*y+6.2 (1]gg~8_]gg+P _n - a scroll of immolation]gg| ]ggJ Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolation ]gg  r - a scroll labelled KIJ GOLAOPLU  s - a scroll labelled EDWEOS VEXAt - 2 scrolls of identify  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]gg r]ggz]gg  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14 ]gg. ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7226.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison) ]gg #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#]ggi   #.# #.# ####'#####...   #.###.# #......... It is a scroll of identify. _g - 2 scrolls of vulnerabilityAs you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fearAs you read the scroll of identify, it crumbles to dust. _n - a scroll of immolation]ggZ]gg Identify which item? (\ to view known items) Scrolls (select first with ?)  r - a scroll labelled KIJ GOLAOPLU ]ggBR s - a scroll labelled EDWEOS VEXA  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (select first with !)  i - a viscous pink potion]gg[][?] describe selected]gg ]ggL ]ggV   #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11]gg s #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7226.2 (0.0) ]gg  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#]gg/    #.# #.# ####'#####... ]gg[   #.###.# #......... It is a scroll of identify. _g - 2 scrolls of vulnerabilityAs you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fearAs you read the scroll of identify, it crumbles to dust. ]gg ;_n - a scroll of immolation]ggJ ]  As you read the scroll of identify, it crumbles to dust.]gg +7.2 (1]gg 8_]ggv - _r - a scroll of silence]gga ]gge Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  s - a scroll labelled EDWEOS VEXAt - a scroll of identify ]gg.f l v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]gg5Y ]gg^I  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ]gg>`##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time: 7227.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)[0;10]gg`Vm  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####...]gg a   #.###.# #......... As you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fearAs you read the scroll of identify, it crumbles to dust. _n - a scroll of immolation]ggEalAs you read the scroll of identify, it crumbles to dust. _r - a scroll of silence]ggc]gg gIdentify which item? (\ to view known items) Scrolls (select first with ?)  s - a scroll labelled EDWEOS VEXA  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY Potions (select first with !)  i - a viscous pink potion[?] describe selected]gg6 ]gg w  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10]ggB -Int: 11 #...........##### # SH: 13Dex: 14 ]gg^  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6 ]gg M #....@................ Noise: ---------  Time: 7227.2 (0.0)  #.#####.........#..... a) +0 long sword ]gg 5 #.# ####.#.....†#.#### Throw: 3 darts (poison) ]gg  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#]gg    #.# #.# ####'#####...  ]gg  #.###.# #......... As you read the scroll of identify, it crumbles to dust. _m - 2 scrolls of fearAs you read the scroll of identify, it crumbles to dust. _n - a scroll of immolationAs you read the scroll of identify, it crumbles to dust. _r - a scroll of silence]gg ]  As you read the scroll of identify, it crumbles to dust.]ggv +8.2 (1]ggį :_]ggE 4 _s - a scroll of enchant weapon]ggaz]ggRead which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls labelled EMPIFE WENU  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected]gg  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6  #....@................ Noise: ---------  Time:]ggd 7228.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####...   #.###.# #......... As you read the scroll of identify, it crumbles to dust. _n - a scroll of immolationAs you read the scroll of identify, it crumbles to dust. _r - a scroll of silence  As you read the scroll of identify, it crumbles to dust. _s - a scroll of enchant weapon _As you read th]gg+ e scroll labelled EMPIFE WENU, it crumbles to dust.  You hear a loud clanging noise!=========9.2 (1_ _It was a scroll of noise.]ggch ]ggk Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolation]gg1l r - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - 2 scrolls labelled CUTHEJ YHIB  z - a scroll labelled USSITH RYUGY ]ggl [!] read|quaff|evoke[?] describe selected ]gg_ ]gg]b ]gg>h  #####.#≈.>≈#.#.##..... deadiverson the Carver ]ggh> #.#≈_ß≈#...##..... Human of the Shining One **.... #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ]ggh ##.######......)... Magic: 9/9 ]ggyi======================== #...........####### AC: 15Str: 17 #...........# # EV: 10Int: 11 #...........##### # SH: 13Dex: 14  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6 ]ggKj~ #....@................ Noise: =========  Time: 7229.2 (0.0)  #.#####.........#..... a) +0 long sword  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#.....  #.# #.###.......#.####  #.# #.# ##......#.#..#  ]ggj #.# #.# #......#....#   #.# #.# ####'#####...   #.###.# #......... ]ggj  _r - a scroll of silence  As you read the scroll of identify, it crumbles to dust. _s - a scroll of enchant weapon  As you read the scroll labelled EMPIFE WENU, it crumbles to dust.  ]gg9k?You hear a loud clanging noise! _It was a scroll of noise. ]ggwf  As you read the scroll labelled CUTHEJ YHIB, it crumbles to dust. ]ggx---------30.2 (1Tele  ]gg|8_ ]gg~ _You feel strangely unstable. It was a scroll of teleportation.!]ggl!]ggn~Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise !]ggxoc x - a scroll of teleportation (cancels current teleport)  z - a scroll labelled USSITH RYUGY [!] read|quaff|evoke[?] describe selected!]gg" !]ggź !]gg a  #####.#≈.>≈#.#.##..... deadiverson the Carver #.#≈_ß≈#...##..... Human of the Shining One **....!]ggc f #.#≈≈≈≈#.#.##..... Health: 69/69 ======================== ##.######......)... Magic: 9/9======================== #...........####### AC: 15Str: 17!]gg  #...........# # EV: 10Int: 11!]gg  #...........##### # SH: 13!]gg <Dex: 14 !]gg  ######.......#.....### XL:  9 Next: 46% Place: Dungeon:6 !]gg S #....@................ Noise: ---------  Time: 7230.2 (0.0) !]gg*  #.#####.........#..... a) +0 long sword !]gg  #.# ####.#.....†#.#### Throw: 3 darts (poison)  #.# #...........#..... Tele   #.# #.###.......#.#### !]gg޽ J #.# #.# ##......#.#..#   #.# #.# #......#....#   #.# #.# ####'#####...  !]ggk  #.###.# #.........  _s - a scroll of enchant weapon  As you read the scroll labelled EMPIFE WENU, it crumbles to dust.  You hear a loud clanging noise! _It was a scroll of noise.  As you read the scroll labelled CUTHEJ YHIB, it crumbles to dust. _You feel strangely unstable. It was a scroll of teleportation.!]gg u _Okay, then.!]gg: !]gg 8_!]gg . _"]gg 8J"]gg9"]gg:"]gg=X"]gg?"]gg@"]gg@"]ggG:_"]ggLE_3.2 (3"]ggV  #.)..# #############.##  #)##.# #.........#....# ####.##)##########.#######.#.#..# .....##..........#.#.......#.### ########.......###.#.......#...'. #......'.......#...#.#.###.#####. ..######.......#.###.#.# #.# #... "]gg^W?#.##........#+##.###.#.###.# #. ..##........'..#@....#.#...# #.† #.##........#.##.......#.####### .....).........'................) ..#######.###.##....(..#.#######) ..# #.# #.##.......#.#....... ..##### #.###.##.......#.#.#.. #.....###.....##.......#.# "]ggW...............+.............. ...#...........#...........###### _You start waiting."]gg_"]ggg"]ggh34.2 (4"]ggo"]ggq@ _Your surroundings suddenly seem different.#]ggݰ3#]ggX#]ggB#]gg,#]gg##]gg8,#]ggż#]gg,#]gg\#]gg,#]ggJ#]gg\,#]gg#]gg!#]gg#]gg#]gg#]gg#]gg#]gg#]gg#]ggQ#]gg,#]gg#]gg#]gg#]gg#]gg #]ggP#]gg#]gg,#]gg#]gg#]gg#]gg#]gg#]gg#]ggm#]ggN#]ggp#]gg9#]gg,#]gg#]gg#]gg#]gg#]gg#]gg#]gg8#]gg,#]gg"#]gg2,#]gg#]gg,#]gg9#]gg2,#]gg#]gg,#]gg3#]gg_,#]gg5#]ggv,#]gg#]gg#]gg#]gg{#]gg,#]gg?#]gg1,#]gg#]gg,#]gg#]gg,#]gg#]gg^,#]gg#]gg#]gg #]ggu#]ggi#]gg#]gg#]gg,#]gg#]ggx#]gg#]gg0#]gg#]gg7#]gg2#]ggR#]gg#]gg#]gg ,#]gg #]gg ,#]gg #]gg. #]ggY #]gg #]gg#]gg#]gg>#]gg,#]gg#]gg7,#]gg&#]ggM,#]ggI#]ggf,#]ggc#]gg #]gg #]gg!#]gg#,#]gg$#]gg%#]gg%#]ggQ&#]ggA'#]ggv'#]gg'#]gg(,#]ggU)#]ggK*,#]gg*#]gg+,#]ggd,#]gg{-,#]gg/#]gg1#]ggB2#]gg 3#]gg4#]gg@4#]gg4#]gg5,#]gg6#]ggT8,#]gg'9#]gg$:,#]gg:#]gg<,#]ggP>#]gg!@,#]gg(A#]ggB,#]ggdC#]gghD,#]ggD#]ggE,#]ggSF#]gg|G,#]gg,H#]ggH#]ggI#]ggI#]ggSJ#]gg}J#]ggJ#]ggK#]ggL#]ggL#]gggM#]ggM#]ggN#]ggN#]ggO#]ggO#]gg~Q#]ggQ#]ggR#]ggS#]ggS#]gg]T#]ggmU,#]ggU#]ggTX,#]ggX#]ggZ,#]gg\#]ggS_,#]ggb#]ggd#]gg^d#]ggj#]ggRm,#]ggB#]gg-`#]gg#]ggA,#]ggʵn#]gg#]gg۷#]ggU#]gg#]ggB#]gg,#]gg#]ggB#]ggB#]gg,#]ggX#]gg#]gg#]gg#]ggJB#]gg 333.2 (99.0) _You start waiting.4.2 (100.0) _Done waiting.#]gg~ #]gg6 Level 6 of the Dungeon <<<<>>>>>__(Press ? for help) #.#   ############.#   #..)......# #######.##########   #.#######.# #.)..##############.## #######.......#   #.# #.# #)##.##.........#....# #...........###   #.# ###.#######.##)##########.#######.#.#..####...........#   #.# ###..<........##..........#.#.......#.###...............#   #.# #........########.......###.#.......#...'...............#   #.###.##§§##.#......'.......#...#.#.###.#####...............#   #...[.#§§§≈#...######.......#.###.#.# #.# #.................#   #####.#≈.>≈#.#.##........#+##.###.#.###.# #.####...)[#]ggʏ 40m....<...#  #.#≈_ß≈#...##........'..#@....#.#...# #.†.#.............#  #.#≈≈≈≈#.#.##........#.##.......#.#######.#............##  ##.######......).........'................))..>####'########  #...........#######.###.##....(..#.#######)##..............##  #...........# #.# #.##.......#.#.......##..####.##......#  #...........##### #.###.##.......#.#.#....###...#...#....#..#   ######.......#.....###.....##.......#.#.#....###...#...#.......#   #....>......................+..................#.....#.#....##.#   #.#####.........#...........#...........######....####.#....##.#   #.# ####.#.....†#.######....#......##.####...........#....#....#   #.# #...........#......#....#......##)).........#.##.###########   #.# #.###.......#.####.#....'........#..........#+##...........#$]ggj_@.$]ggl P_..$]gg Z_..$]ggKa F_..$]gg, 5.#$]gg< 5#.$]gg 5.#$]ggk; 5#.$]gg 5..$]ggr5..$]ggn5.#%]gg*5# %]gg9 #%]ggWZ_#.%]ggeH_.†%]gg57†.%]ggZ_.#%]ggsP_#.%]gg`F_..%]gg( :..%]gg`_.>&]gg/&]ggT> #.)..##############.## deadiverson the Carver#)##.##.........#....# Human of the Shining One **.... ####.##)##########.#######.#.#..# Health: 69/69 ======================== .....##..........#.#.......#.###. Magic: 9/9======================== ########.......###.#.......#...'. AC: 15Str: 17 #......'.......#...#.#.###.#####. EV: 10Int: 11 ..######.......#.###.#.# #.# #... SH: 13&]ggUDex: 14 #.##........#+##.###.#.###.# #.## XL:  9 Next: 46% Place: Dungeon:6 ..##........'..#@....#.#...# #.†. Noise: ---------  Time: 7334.2 (0.0) #.##........#.##.......#.#######. a) +0 long sword .....).........'................) Throw: 3 darts (poison) ..#######.###.##....(..#.#######) ..# #.# #.##.......#.#....... ..##### #.###.##.......#.#.#....#  #.....###.....##.......#.#.#....#&]ggSV  ...............+.................  ...#...........#...........######  _You feel strangely unstable. It was a scroll of teleportation. _Okay, then. _You start waiting. _Your surroundings suddenly seem different. &]ggVN_You start waiting. _Done waiting.&]gg1W&]ggX&]gge&]gg}g,&]ggk&]ggm&]gg:p&]ggup&]ggq&]ggt&]ggu,&]ggv&]ggy&]gg{&]ggV{&]gg@|&]ggE&]gg,&]gg=&]ggI&]gg),&]gg*&]gg܋&]ggۍ,&]ggN&]gg`&]gg“,&]ggJ&]gg&]gg,&]gg&]gg&]ggO,&]gg;&]gg)&]gg,&]ggߢ&]gg&]gg˥,&]gg&]ggL&]gg,&]ggk&]gg&]gg[,&]gg&]gg&]ggƳ,&]gg&]ggG&]gg,&]ggŸ&]ggڼY  Items here: )) [ ÷.&]gg&]ggB _&]gg:&]gge  Things that are here:  a +0 rapier; a +0 dagger; a +0 robe&]gg&]gg _&]gg*&]gg&]ggb,&]gg&]ggV&]gg,&]gg &]gg+######.#.#..####...........# .......#.###...............# .......#...'...............# #.###.#####...............# .#.# #.# #.................# .#.###.# #.####...)....<...# #.#...# #.÷.#.............# ...#.#######.#............## ............[)..@####'######## 520.0) (..#.#######)##.......## #.###..####.### .#.#.#....###...#...#....#..#.#.#.#....###...#...#.......#............#.....#.#....##.# .......######....####.#....##.###.####.....[39&]gg;49m......#....#....###))##.###########&]gg&]gg@c _There is a stone staircase leading down here.&]gg 4&]gg^ ,&]gg 85.2 (1.0) _&]gg &]gg7  You climb downwards.  You hear the roar of battle.&]ggf/  --more--']ggc    .... ..  .......  #######...#.## # ##.[...####.# ##..................# #.....# #.<.#7 #...@...........#  #...g.(Y#  #.....g..........  #.............# ##.............#.# ##g....#......#.. ggg 3 gnolls (asleep) ############..  There is an entrance to a bailey on this level. Hurry and find it before the  portal closes forever!']gg']gg; g.ggggg  You hear the faint creaking of a portcullis nearby.']gg_J====9 (1.7']gg _The gnoll shouts!  Found 4 stones and a pair of gloves. _There is a stone staircase leading up here.(]gg 1(]gg53Read which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolation(]gg3r - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportation  z - a scroll labelled USSITH RYUGY (]gg3[!] read|quaff|evoke[?] describe selected)]gge)]gg")]gg|*.......deadiverson the Carver.... ..Human of the Shining One **...........Health: 69/69 ========================#######...#.## # Magic: 9/9========================##.[...#......####.# AC: 15Str: 17##..................# EV: 10Int: 11#..................# SH: 13Dex: 14#.............<.#)]gg+XL:  9 Next: 46% Place: Dungeon:7#...@...........#Noise: ====-----  Time: 7355.9 (0.0)#...g.(........Y#a) +0 long sword#.....g..........Throw: 3 darts (poison)#................###.............#.###g....#......#..ggg 3 gnolls############..#.#There is an entrance to a bailey on this level. Hurry and find it before the  portal closes forever!  You hear the faint creaking of a portcullis nearby. _The gnoll shouts!  Found 4 stones and a pair of gloves. _There is a stone staircase leading up here.)]gg:k  As you read the scroll labelled USSITH RYUGY, it dissolves into smoke.)]gg;)]ggD#######.[..##....#.§§§§#.§§§§#.§§@§§.....§gg§.....§§§§...............g........##.....#... 2##########)]ggEk4--=---)]ggE$6.9 (1)]ggL)]gguOP _It was a scroll of fog. The gnoll hits you with a +0 whip.)]gg  ......§.....#.§#.§#..##You hit the gnoll but do no damage. You block the gnoll's attack.)]gg I---8.0 (1.1)]gg )]gg R _The gnoll barely misses you.)]gg-  You slash the gnoll!  The gnoll is severely wounded.)]gg##.#......§....§gg 3 gnolls)]gg_2---=)]gg9 (0.9)]gg֣)]gg4v _The gnoll barely misses you. The gnoll hits you with a +0 flail.*]gg7  You hit the gnoll.*]gg*]ggr .............§§§ 2  You kill the gnoll!*]ggUx57---7-9.9 (1.0*]ggv*]gg9 _The gnoll hits you with a +0 flail.*]gg7.....................§.g......Y.§........Y   sky beast (wandering)ggg 3 gnolls (1 wandering)*]gg8A-60*]gg@*]ggC _You barely miss the gnoll. The gnoll closely misses you. x2*]gg9  You slash the gnoll!*]gg*]gg"C g.Y..§§  The gnoll is almost dead.*]ggI&g8=-=1*]ggo-*]gg16 _You block the gnoll's attack. x2*]ggG9  You slash the gnoll!*]ggK  You kill the gnoll!The sky beast flickers out of sight!*]ggL*]gg8WX ....................§g..{..§g§.............gg 2 gnolls*]ggW  Deactivating autopickup; reactivate with Ctrl-A.*]ggZe2--8-2*]gga*]gg)d9 _The gnoll hits you with a +0 flail.*]gg 7  You hit the gnoll.*]gg h ..............§g.{§...........#...####The gnoll is lightly wounded.*]gg @-3*]ggɭ *]ggx R _The gnoll barely misses you.*]gg [  You completely miss the gnoll.The gnoll is lightly wounded.*]ggTh J§...Y..{...........Y   sky beast (invisible)gg 2 gnolls*]ggi \3--4.8 (0.9*]gg`o &.*]ggmr 6 _You block the gnoll's attack. x2+]gg@ +]gg +]ggp! +]gg% +]gg. ####.§....§.....Y....§....(§.....§§§....§§§............#...####+]gg. -5.8 (1.0+]gg5 +]gg  ######.#.#..####....# .......#.###...............# .......#...'...............# .#.###.#####...............# .#.# #.# #........... .#.###.# #.####...)....<...# .#.#...# #.÷.#.....# ...#.#######.#....## 6 ............[).g@####'######## (..#.#######)##g.............## ...#.#.......##..####.##......# ...#.#.#....###...#...#....#..# ...#.#.#....###...#...#.......# ..............#.....#.#....# .......######....####.#....##.# ..##.####...........#....#....# +]ggA ..##)).........#.##.########### _You block the gnoll's attack. x2+]ggE ?  You climb upwards.+]gg +]ggR 5-7.3 (2.5+]gg^ +]gg?` _Reactivating autopickup. _There is a stone staircase leading down here.+]ggP  You hit the gnoll.  The gnoll is heavily wounded.+]ggQ =4=8.3 (1.0+]ggU\ +]ggm_ p _The gnoll barely misses you. You block the gnoll's attack.,]ggB  You hit the gnoll but do no damage.The gnoll is heavily wounded.,]gg&9,]gg!,]gg$6 _You block the gnoll's attack. x2,]gg6h  You barely miss the gnoll.The gnoll is heavily wounded.,]ggDi'70,]ggTt,]ggv ,]ggvc_The gnoll closely misses you. You block the gnoll's attack.,]gg_  You barely miss the gnoll.The gnoll is heavily wounded.,]gg[5=1.4 (1.1,]gg ,]ggZ _The gnoll hits you but does no damage. You block the gnoll's attack.,]gg  You hit the gnoll.  The gnoll is almost dead.,]gg6-2.3 (0.9,]gg,]ggZ _You block the gnoll's attack. The gnoll hits you but does no damage.,]ggD 9  You slash the gnoll!,]ggN )   gnoll  You kill the gnoll!,]ggQ I=3.3 (1.0,]gg\ ,]gg=` 3 _You block the gnoll's attack.,]ggZ  You hit the gnoll.  The gnoll is moderately wounded.,]gg &4,]gg@ ,]gg S _The gnoll closely misses you.,]gg2  You hit the gnoll but do no damage.The gnoll is moderately wounded.,]gg3565.4 (1.1,]gg=,]ggk@R _The gnoll barely misses you.-]gg<  You hit the gnoll.  The gnoll is heavily wounded.4-6.5-]gg-]gg8 _The gnoll hits you with a +0 whip.-]gg`  You barely miss the gnoll.The gnoll is heavily wounded.-]gga,70-]ggj-]ggl3 _You block the gnoll's attack.-]gg  You hit the gnoll but do no damage.The gnoll is heavily wounded.-]ggT5=8-]gg-]ggS _The gnoll closely misses you.-]gg   You barely miss the gnoll.The gnoll is heavily wounded.-]gg[ -]gg T2-9.4 (0.9-]gg-]gg%8 _The gnoll hits you with a +0 whip.-]ggU   You hit the gnoll.  The gnoll is almost dead.49--80.4 (1.0-]gg` -]ggc 8 _The gnoll hits you with a +0 whip.-]gg 7  You hit the gnoll.-]gg D)-]gg d50-91.5 (1.1-]gg: -]gg I _You kill the gnoll!-]gg -]gg!-]gg*-]ggx,H _No target in view!.]ggg.......#.###....# #.#...'...# #.#.###.#####...# #.#.# #.# #.....# #.#.###.# #.####...)....<...# ..#.#...# #.÷.#.............# ....#.#######.#............##..........[).)>####'######## .(..#.#######)##@.............## ....#.#.......##..####.##......#.#.#.#....###...#...#....#..#.#.#.#....###...#...#.......#............#.....#.#....##.#######....####.#....##.###.####...........#....#....#.##)).........#.##.###########...#.#+##...........#.]gg.]ggI;-20 _.]ggI.]ggL  Things that are here: _a +0 whip; a gnoll corpse.]ggc.]ggc8-.]ggm.]ggo.]ggfd  ..'#.###.#####. #.# #....##.# #.####...)....< ..#.#...# #.÷.#............#.#######........#.........[).)>####'######## .(..#.#######)##).............## ....#.#.......##@.####.##......#....###...#...#....#..#..#'# ...#.#..............#####.####.#.]ggo .]ggp -3 _.]ggy .]gg2| 6]gg6]ggRLevel 6 of the Dungeon <<<<>>>>>__(Press ? for help)6]gg  #.# #.# #)##.##.........#....# #...........###   #.# ###.#######.##)##########.#######.#.#..####...........#   #.# ###..<........##..........#.#.......#.###...............#   #.# #........########.......###.#.......#...'...............# 6]ggO  #.###.##§§##.#......'.......#...#.#.###.#####...............#   #...[.#§§§≈#...######.......#.###.#.# #.# #.................#   #####.#≈.>≈#.#.##........#+##.###.#.###.# #.####...)....<...# 6]ggD #.#≈_ß≈#...##........'..#.....#.#...# #.÷.#.............#  #.#≈≈≈≈#.#.##........#.##.......#.#######.#............##  6]gg.3##.######......).........'................[).)>####'########  #...........#######.###.##....(..#.#######)##).............##  6]ggPs#...........# #.# #.##.......#.#.......##@.####.##......#  #...........##### #.###.##.......#.#.#....###...#...#....#..#   ######.......#.....###.....##.......#.#.#....###...#...#.......# 6]gguR  #....>......................+..................#.....#.#....##.#   #.#####.........#...........#...........######....####.#....##.#   #.# ####.#.....†#.######....#......##.####...........#....#....#   #.# #...........#......#....#......##)).........#.##.########### 6]gg  #.# #.###.......#.####.#....'........#..........#'##...........#   #.# #.# ##......#.#..#.##...##.....#.#..............#####.####.#   #.# #.# #......#....#.##...##.....#.#).....##.......## #......#   #.# #.# ####'#####....##...##.....#.#......##........# #.######   #.###.# #................#.....#.#......##........# #.#6]ggh< M@.7]gg@yK_..7]gg ;..7]gg3;..7]gg";..7]gg;.#7]ggC$;##7]gg͟;#.7]ggu ..   #.....############......####.#.....#.#....).##.....#..###.###7]gg8 _..   ########......# #...)..#.##.#.....#.#......##.....##..##...#7]gg{ _..  #......####...#....##)##........##'####.....##..####.#7]ggM  .#  #....††..........#.##.##........)...........##..# #.#7]gg ##  #................#.##.##.......)##..............####.#8]gg; ##  #............<.....##.##........##.....(.......>'....#8]gg ##  #..................##.##........##..............####.#8]ggO #.  #..................+..##........##..............# #.#8]gg .>  ######....)........#####........##..............# ###8]gg8]gg #.......#...'...............#deadiverson the Carver #.#.###.#####...............#Human of the Shining One **.... #.#.# #.# #.................#Health: 50/69 =================------- #.#.###.# #.####...)....<...#Magic: 9/9======================== ..#.#...# #.÷.#.............#AC: 15Str: 17 ....#.#######.#............##EV: 10Int: 11 .............[).)>####'########SH: 13Dex: 14 8]ggF.(..#.#######)##).............## XL:  9 Next: 49% Place: Dungeon:6 ....#.#.......##@.####.##......# Noise: ---------  Time: 7383.5 (0.0) ....#.#.#....###...#...#....#..# a) +0 long sword ....#.#.#....###...#...#.......# Throw: 3 darts (poison) ...............#.....#.#....##.# ........######....####.#....##.# ...##.####...........#....#....# 8]gg...##)).........#.##.########### .....#..........#'##...........# 8]gg...#.#..............#####.####.# _The gnoll hits you with a +0 whip.  You hit the gnoll. _You kill the gnoll! 8]gg6_No target in view!  Things that are here: _a +0 whip; a gnoll corpse8]gg8]gg8]gg"8]gg:+8]gg+%18]gg08]gg68]gg:8]gg5;8]gg=9]gg9]gg;9]gg9]ggd9]ggj 9]gg9]ggK2=9]gg9]gg9]gg,9]gg!9]gg%9]gg),9]gg{+9]gg.9]gg+1939]ggh12=9]gg?49]gg[8  You hit the gnoll. _You kill the gnoll!No target in view!  Things that are here: _a +0 whip; a gnoll corpse  There is an open door here.9]ggn:9]gg: _9]gg;9]gg>9]ggoA,9]gg.B9]ggF9]ggI9]gg;J9]ggK9]gg O9]ggQ;49]ggS9]ggV9]ggvY,9]ggZ9]gg\9]ggI^,9]gg^9]ggLa9]ggqc9]ggc9]ggcD5=9]ggd9]ggg9]ggxi,9]ggk9]ggn9]ggp9]ggp9]gg r9]gglt9]ggxk6=9]ggbz9]ggU).....##.......## ## ......##........# #.###### ......##........# #.# ....).##.....#..###.### ....##.....##..##...# ##'####.....##..####.# )9]gg@....##..# #.# )##..............####.# ##.....(.......@'....# 400.5 (17.0)9]ggޅ##..............####.# 9]gg@##..............# #.# ##........# ####...##.........##...##.......(.#9]ggd#...##.......####...##.......9]gg@#######9]gg#.#9]ggV9]gg9]ggc _There is a stone staircase leading down here.9]ggB7 9]gg7 9]gg A 9]ggI 9]ggI 81.0) _9]ggN 9]gg  You climb downwards.  You hear the roar of battle.9]gg /  --more--:]gg,' :]gg,- .....##l......  #............ ............#  :]ggQ-...........§#§ ............§ :]gg-m ...........#  :]gg-...# 7 .#  :]gg-.#  .#  .#:]gg.  ##:]gg;.+ ..?:]gg{.nl   iguana (asleep) ...:]gg.o ...  There is an entrance to a bailey on this level. Hurry and find it before the  :]gg.portal closes forever!:]gg0Q69=====:]ggt;1  HP restored.:]ggDr.l§§§l:]ggy-2.2 (1.7:]ggR:]ggo _The iguana hisses angrily.  Found a scroll of identify. _There is a stone staircase leading up here.;]gg .....##.......#......l..... ....§§#.§#§§ # # <.# ;]gg _#?.#;]gg ;]gg ..§l.§.§;]ggg *30 ;]gg _;]gg ;]gg ;]ggѸ ;#........§... .l.§.§#..§.§#§;]gg2 ..§§ # # <.# .#?l   iguana.........#.........#;]gg ;]gg .§.l§.§§...§;]gg &4;]ggP ;]ggO ;]ggA .§..§#l§.§§#§.§...§ ..§# # <.# .#? .##;]gg ;]ggf ...§.l.§§.§;]ggV F=====5;]gg ;]gg <]gge..§.#§l.§..§ ..§.# # <.# <]gg.##?...#.##......#.<]gg<]ggV....l§..<]ggT&6<]gg<]ggy _You hear the faint creaking of a very distant portcullis.<]gg..§ .l§..# ...# .<.# ..# <]gg=..# ..# .#####....#.##.....<]ggc.# .# .<]gg\.# <]gg.#<]gg, .<]ggF<]gg H.l<]gga!&7<]gg%<]gg*X _You see here a scroll of identify.<]ggY<]ggF.l<]gg&8<]ggT<]gg. _c - a scroll of identify<]ggOs <]gg{u Read which item? Scrolls  c - a scroll of identify  g - 2 scrolls of vulnerability <]ggu  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportation <]ggv [!] read|quaff|evoke[?] describe selected=]gg =]gg$ =]gg8 ............§deadiverson the Carver........§..#Human of the Shining One **..............#Health: 69/69 ========================.......l.#Magic: 9/9========================.........#AC: 15=]gg KStr: 17.........#EV: 10Int: 11.........#SH: 13Dex: 14........#####XL:  9 Next: 49% Place: Dungeon:7=]gg ........@...#Noise: ---------  Time: 7408.2 (0.0).........##.....a) +0 long sword=]gg .........# ...Throw: 3 darts (poison).........# ..........#.........#l   iguana=]gg1 ........#........ . _The iguana hisses angrily.  Found a scroll of identify. =]ggY _There is a stone staircase leading up here. _You hear the faint creaking of a very distant portcullis. _You see here a scroll of identify. _c - a scroll of identify=]gg =]gg1 qIdentify which item? (\ to view known items) =]ggU Potions (select first with !)  i - a viscous pink potion=]ggm ][?] describe selected>]gg1 >]gg: >]ggB ............§deadiverson the Carver........§..#Human of the Shining One **..............#Health: 69/69 ========================.......l.#>]ggFC Magic: 9/9========================.........#AC: 15Str: 17.........#EV: 10Int: 11.........#SH: 13>]ggnC Dex: 14........#####XL:  9 Next: 49% Place: Dungeon:7>]ggC -........@...#Noise: ---------  Time: 7408.2 (0.0).........##.....a) +0 long sword.........# ...>]ggC Throw: 3 darts (poison).........# ..........#>]ggC .........#l   iguana........#.>]ggD ....... . _The iguana hisses angrily.  Found a scroll of identify. _There is a stone staircase leading up here. >]ggUD _You hear the faint creaking of a very distant portcullis. _You see here a scroll of identify. _c - a scroll of identify>]ggN ]  As you read the scroll of identify, it crumbles to dust.>]ggX H<l>]gghY +9.2 (1>]ggb >]ggc \ _i - a potion of degeneration@]ggJ@]gg Drop what?23/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 long sword (weapon) @]gg< Missiles (select all with ()  b - 3 throwing nets  f - 3 poisoned darts (quivered) Armour (select all with [)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn) @]gg  A - a +0 pair of boots (worn)  B - a +0 chain mail (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (select all with /)@]gg o - a wand of acid (4)  y - a wand of digging (6) Scrolls (select all with ?) @]gg _ g - 2 scrolls of vulnerability  m - 2 scrolls of fear @]gg g n - a scroll of immolationr - a scroll of silence @]gg4 [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit @]gg[ Letters toggle [.|Space] toggle selected[top]@]ggRZ/(1 turn)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  B - a +0 chain mail (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p5 ring of evasion (left hand) Wands (select all with /)  o - a wand of acid (4)  y - a wand of digging (6) Scrolls ?)  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolation  r - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportation Potions (select all with !)  e - 2 potions of enlightenment  i + a potion of degeneration[Enter] accept (1 chosen) [66%@]gg#@]gg7/............§deadiverson the Carver........§..#Human of the Shining One **..............#Health: 69/69 ========================.......<.#Magic: 9/9========================.......l.#AC: 15Str: 17.........#EV: 10Int: 11.........#SH: 13Dex: 14........#####XL:  9 Next: 49% Place: Dungeon:7........@...#Noise: ---------  Time: 7409.2 (0.0).........##.....@]gg/a) +0 long sword.........# ...Throw: 3 darts (poison).........# ..........#.........#l   iguana........#........ . _There is a stone staircase leading up here. _You hear the faint creaking of a very distant portcullis. _You see here a scroll of identify. _c - a scroll of identify  As you read the scroll of identify, it crumbles to dust. _i - a potion of degeneration@]gg7L.l@]gg;8,10.2 (1@]gg>@]ggQB8 _You drop a potion of degeneration.@]ggZ/: §.#§ .....§ ....# ....# <.# @]gg/u...# l.# ..#  ##### !...# @]gg/ .##..... .# ...@]gg40 .# . .# @]ggc0..#.#........ .@]gg(1@]gg5@]ggr>L.l@]ggV?@]gg|?1A]gg3A]ggA]ggPEA]ggF5=2.1 (0.9A]gg MA]ggP _You barely miss the iguana. The iguana closely misses you.A]gg`  You barely miss the iguana.A]ggpA]gg&3.1 (1.0A]ggoA]gg> _The iguana bites you but does no damage.A]gg  You slash the iguana!  The iguana is moderately wounded.A]ggU6--4A]ggA]gg+ _The iguana bites you.A]gg  You slash the iguana!  The iguana is severely wounded.A]ggƄ -5.0 (0.9A]gg A]gga 4 _You block the iguana's attack.A]gg  You hit the iguana but do no damage.The iguana is severely wounded.A]ggl -6.0 (1.0A]gg A]gg< 4 _You block the iguana's attack.A]ggS- _You block's attack.  You hit the iguana but do no damage.  The iguana is severely wounded. _You block the iguana's attack.  You hit the iguana but do no damage.  The iguana is severely wounded.A]gg-b57-----=A]gg.7.1 (1.1A]ggT3A]gg6^  You hit the iguana but do no damage.The iguana is severely wounded. _You block the iguana's attack.  You hit the iguana but do no damage.The iguana is severely wounded. _The iguana bites you!B]gg{  You hit the iguana but do no damage.The iguana is severely wounded.B]gg{+-8B]gg{ 0B]ggB]gg4 _You block the iguana's attack.B]ggN  You hit the iguana.  The iguana is almost dead.B]gg  o   orc (wandering)oThe iguana bites you.B]gg^6----9B]ggB]ggHq _An orc comes into view. It is wielding a +0 club.B]ggւO  The orc shouts!  You hit the iguana.B]ggRB]gg.o   orco...#.B]gg@750=20B]ggۚB]ggžJ _You kill the iguana!B]gg  ...#.#.<.#...#B]gg{ E.#.#######.!...#..##......# ....# ..#o...#B]gg x....#....# B]ggQ B]gg <o.B]gg T8=--B]gg 1B]ggJ B]ggz B]ggA B##.<.##...#.#..# ######B]gg @.!...#..##.....#.# ...#.# .#o...#.....#....#######B]gg B]gg& <o.B]ggv' S61==B]gg' 2--2B]gg/ B]gg=4 B]ggW -..# <.# #....# ######B]ggaX g#!.....##..... o . .#....#######:....B]ggX (#B]ggk B]ggl #2B]gg%m C==3B]ggw B]ggf| k _Found a book of Geomancy. You block the orc's attack.C]ggC]gg-4.0 (0.9C]gg&C]gg* _You barely miss the orc. The orc barely misses you.C]gg  You hit the orc.  The orc is heavily wounded.5.1 (1.1C]gg֘C]ggc: _The orc hits you but does no damage.C]gg7  You slash the orc!C]gg^2)C]gg<3160C]ggC]ggG _You kill the orc!C]gg^4C]gg/gC]ggOjH _No target in view!C]ggx  <#...#..# ..# #C]ggxy ..######..!...# ..##..... #.# ... #)...# . #..........# ..#......######:....C]ggy 7##......C]ggt C]gg T8==-C]gg 7 _C]gg C]gg8 C]ggy #...# ..# ...# #..######..!...# ..##..... #C]ggP .# ... #)...# . #....@.....# ...#......######:....##.......#C]gg/ C]gg C]gg }9===-8C]gg C]gg! C]gg>{@ ..# ...# #..######..!...# ..##..... #.# ... #C]gg3|0)...# ..###..........# ....#......######:....##.......#.#C]ggZC]gg&9C]gg[C]gg,D]ggd .# #..######..!...# ..##..... #.# ... #D]gg)...# ...###..........# ....#......######:.......#D]gg){.####..###.#D]ggKD]ggD]gg3'30D]ggHD]ggD]ggn ######..!...# ..##...... #.# ..... #)...# .#..###..........# ....#......######: .......#>.#z   wight (dormant)###..###.#z. ##. .#D]gg#  A wight comes into view. It is wielding a +2 flail.D]ggc/{zz.D]gg<0&1D]ggh9D]ggN=; _Found a stone staircase leading down.D]gg*#.!...#.. ..##.....#.# #.# ...#... #)...# .##..###..........# .......#D]gg#......########: #...........#.#>.#..z###..###.#.. ##.# .#Z   hornet zombie (dormant)ZP ... .D]ggόD]ggD]ggD]gg=zZZ.D]ggB=2D]gg֧D]gg ` _A hornet zombie comes into view.D]gg B.. ..##.... #.#. #.#  #... #)...# .##..###..........# ........#......## ##### #:  #........... #.#D]gg! ..>.z.##..Z###..###.#.. ##.# .#z 2 wights (1 polearm, 1 dormant).P ... .zP ..D]gg15 D]gg8 D]gg : D]ggG zZ..z)z.D]ggH &3D]ggrS D]ggZ u _A wight comes into view. It is wielding a +0 halberd.F]ggG#.#. #.# #... #......)...# .##..###....# .........# .#.....## ####### F]ggx#......:....## #.....# #...z# ..>Z...# #...###..###.#.... ##.# .#.zP ... . .P #..  ...F]ggOF]gg}F]ggF]ggz..Zz.F]gg&4F]ggF]gg%F]ggz #... #......)...# . .##..###....# .........# .#.......## ####### F]ggc #......:....## #....z......# #.......@...# ..>.Z# #...###..###.# ..z. ##.# .#..P ... .P ##..    wight ... ..F]gg F]ggߖ F]gg F]gg .z.Zz.z 2 wights (1 polearm)F]gg¦ &5F]ggs F]ggf F]gg .##..###....# ..........# .F]gg .#........## ####### #......:....## #.....# #.....z.....# F]gg ..>..Z....@..# F]gg 6#..z###..###.# .... ##.# .# F]gg! Z..P ... F]ggB Z.P ##.. F]gga `... .. F]gg F]ggW F]gg F]gg_ F]gg .z..Zz.F]ggZ &6F]gg F]gg G]gg .##..###.# ...# ...#... .....## #.###### #......:....## #.G]ggw # #.# ..>.z..Zz..@.# #...###..###.# .... ##.# .# ..P ... ...P ##.. ...... ...#.. ####G]ggG]gg;G]ggH"_Z.z..G]gg"&7G]gg,G]gg1G]gg.........# ....#.........## ####### #......:....## #.....# #......Z....# ..>..z..z....# #...###..###@# .... ##.#...# ..P ....... .P ##..... .........#....####### .### G]ggG]ggMG]ggäG]ggG]gg.Z.z...zG]gg&8G]ggG]gg*H]gg y ... ...................## #............#### #......:....##  #...........# #.......Z...#..>...z...z..# #...###..###.# .... ##.#.@.# ..P #.............. .P #.##........... .H]ggy..###.#....########.####H]ggnH]ggT&9H]ggH]ggH]ggh+H]gg)1H]gg9zZz   wightZ   hornet zombieH]gg:'40I]ggI]ggI]ggl  You hit the hornet zombie.  The hornet zombie is lightly damaged.I]ggI]ggI]ggZzzz 2 wights (1 polearm)I]gg95=1.2 (1.1I]ggI]gg; _You block the hornet zombie's attack.I]gg}7  You hit the wight.I]ggTI]ggѹo..zI]ggt(2.3I]ggI]ggZ3 _The wight is lightly damaged.I]gg7  You hit the wight.I]gg ZZ   hornet zombie  The wight is lightly damaged.I]gg(3.4I]ggI]ggO6 _You block the wight's attack. x2I]gg h  You hit the wight but do no damage.I]ggV B  The wight is lightly damaged.I]gg֝ I]gg c57-----=4.5I]gg I]gg W _You block the wight's attack. The wight hits you with a +2 flail!I]ggg:A  You slash the wight!  I]gg:GThe wight is heavily damaged.I]ggJ.8=-----5.6I]ggtTI]gg@Wq _The wight closely misses you. You block the wight's attack.J]ggv  You slash the wight!  You destroy the wight!J]gg; Z   wight (Z   hornet zombie  The Shining One accepts your kill.J]gg =4-6.7 _You block the wight's attack. The hornet zombie closely misses you.J]ggJ]ggVi _Your Fighting skill increases to level 6!J]ggʲ  You hit the hornet zombie but do no damage.The hornet zombie is lightly damaged.7.8J]ggJ]ggǼq _The wight misses you. You block the hornet zombie's attack.J]gg  You slash the hornet zombie!  The hornet zombie is moderately damaged.The wight hits you from afar with a +0 halberd!J]gg c2--=80J]gg# J]gg ; _You block the hornet zombie's attack.J]gg ' heavihornet zombie hits you but does no damage.  The wight hits you but does no damage.  The hornet zombie hits you but does no damage.  The wight hits you from afar with a +0 halberd.J]gg P: 51/68 (69)---9.9 (1.1DrainJ]gg< J]ggF 2-J]gg> /  --more--K]gg?e _You partially resist. You feel drained.L]ggdYou hit the hornet zombie but do no damage.The hornet zombie is heavily damaged.L]gge)51.0L]ggamL]gg`qQ _You block the hornet zombie's attack. You block the wight's attack.L]gg%e>  You slash the hornet zombie!  The hornet zombie is severely damaged.The hornet zombie closely misses you. The wight closely misses you.L]gge82=2.1L]ggnL]gg(r; _You block the hornet zombie's attack.L]gg_n  You hit the hornet zombie but do no damage.The hornet zombie is severely damaged.L]ggXo4-30L]ggvL]ggzb _You block the hornet zombie's attack. The wight hits you but does no damage.L]ggJ  You hit the hornet zombie.  The hornet zombie is severely damaged.The hornet zombie hits you but does no damage.L]gg  @-4L]gg L]gg < _The wight hits you but does no damage.L]gg7 &  L]gg You barely miss the hornet zombie.The hornet zombie is severely damaged.The hornet zombie barely misses you. The wight hits you but does no damage.L]ggg T0-5L]gg L]ggp 1 _The hornet zombie hits you.L]ggThe hornet zombie barely misses you. The wight hits you but does no damage.hornet zombie hits you.  You block the hornet zombie's attack.  The wight hits you from afar with a +0 halberd.L]ggy46/67--6L]ggL]ggg _You partially resist. You feel drained.M]ggR~  The wight hits you from afar with a +0 halberd. _You partially resist. You feel drained.You hit the hornet zombie but do no damage.The hornet zombie is severely damaged.You hear the faint creaking of a distant portcullis.  The hornet zombie hits you!M]gg0b27--------=7M]gg/M]ggE _The wight hits you from afar with a +0 halberd!M]gg}  You slash the hornet zombie!  The hornet zombie is almost destroyed.M]gg}&8M]gg҇M]ggx _You block the hornet zombie's attack. The wight barely misses you.M]gg  You hit the hornet zombie but do no damage.The hornet zombie is almost destroyed.The hornet zombie hits you but does no damage.M]ggM|28=-------9.0 (0.9M]ggUM]ggY _You block the hornet zombie's attack. You block the wight's attack.N]ggg  You hit the hornet zombie.  The hornet zombie is almost destroyed.N]gghH-60.1 (1.1N]ggaqN]ggu _The hornet zombie closely misses you. The wight hits you but does no damage.N]gg  You hit the hornet zombie.  You destroy the hornet zombie!N]gg_ )  The Shining One accepts your kill.N]gg ealth: 29/71 -6010N]gg8N _The wight barely misses you.N]ggN]ggj$i _Your life force feels restored.N]gg & ...## #...#### #......:....##  #........... #.......Z...#..>.......z..#N]gg  #...###..###)# ......##.#...####. ..P #....z@........ .P #.##.. ..N]gg׹ ###.#....####### #.###N]gg 5 # N]gg= N]gg [32=2N]gg N]gg < _The wight hits you but does no damage.O]ggAo  You slash the wight!  The wight is severely damaged.O]ggp.=3O]ggyO]gg|S _The wight closely misses you.O]ggQ  You hit the wight.  The wight is severely damaged.O]ggغ5-4.2 (1.1O]ggO]gg3 _You block the wight's attack.O]ggl  You barely miss the wight.The wight is severely damaged.O]ggm{3==-5.3O]ggvO]ggoz3 _You block the wight's attack.O]ggE  You hit the wight but do no damage.The wight is severely damaged.O]gg #6O]gg 0O]gg O]gg 3 _You block the wight's attack.O]gg` > _You block the wight's attack.  You hit the wight but do no damage.  The wight is severely damaged. _You block the wight's attack.  You hit the wight but do no damage.  The wight is severely damaged.P: 30/70 (71)-7DrainO]gg7   You hit the wight but do no damage.The wight is severely damaged. _You block the wight's attack.  You hit the wight but do no damage.The wight is severely damaged. _The wight hits you with a +0 halberd. You partially resist. You feel drained.O]gg!  You slash the wight!  You destroy the wight!The Shining One accepts your kill.O]gg,C)O]ggH1 ealth: 34/71 =38.4 (1.1 _You feel better.O]ggp9O]ggR=i _Your life force feels restored.P]ggΓ .## #............###### #......:....## #...........# #.......Z...# ..>.......z..# #...###..###)# ......##.#...####. ..P #....P]gg. .P #.##. ..###.  #....#  #.### ##P]gg^P]ggY5=-9P]ggʢ0 _P]ggTP]ggj  Things that are here: _a +0 halberd; a +0 robeQ]ggQ]gg Your life force feels restored. _The wight hits you but does no damage.  You slash the wight!  The wight is severely damaged. _The wight closely misses you.You hit the wight.  The wight is severely damaged. _You block the wight's attack.  You barely miss the wight.The wight is severely damaged. _You block the wight's attack.  You hit the wight but do no damage.The wight is severely damaged. Q]ggO_You block the wight's attack.  You hit the wight but do no damage.The wight is severely damaged. _The wight hits you with a +0 halberd. You partially resist. You feel drained.You slash the wight!  You destroy the wight!The Shining One accepts your kill. _You feel better. _Your life force feels restored.Q]ggIThings that are here:  a +0 halberd; a +0 robeQ]ggb The hornet zombie is almost destroyed.The hornet zombie closely misses you. The wight hits you but does no damage.hit the hornet zombie.  You destroy the hornet zombie!  The Shining One accepts your kill. _The wight barely misses you.Q]gg Your life force feels restored.The wight hits you but does no damage.  You slash the wight! _The wight closely misses you.You hit the wight.barely miss the wight. _You block the wight's attack.  You hit the wight but do no damage.The wight is severely damaged. Q]gg B_You block the wight's attack.  You hit the wight but do no damage.  The wight is severely damaged. _The wight hits you with a +0 halberd. You partially resist. You feel drained.Q]gg7 -You slash the wight!R]gg R]gg* R]ggd5 ...................##deadiverson the Carver#............######Human of the Shining One **....#......:....##Health: 35/71 ===========-------------#...........#R]gg5 Magic: 9/9========================#.......Z...#AC: 15Str: 17..>.......z..#EV: 10R]gg*6 9Int: 11#...###..###)#SH: 13Dex: 14......##.#...####.XL:  9 Next: 63% Place: Dungeon:7R]ggW6 3..P #....@.........Noise: ---------  Time: 7469.4 (0.0)R]gg6 P.P #.##...........a) +0 long sword..........###.R]gg6 Throw: 3 darts (poison)#....########.###R]gg6 b##You destroy the wight!The Shining One accepts your kill. R]gg7 _You feel better. _Your life force feels restored.Things that are here: R]gg17 8_a +0 halberd; a +0 robeR]ggG? R]gg/@ R]ggG R]ggI R]gg N #...............## #............###### #:....## #...........# #...........# ..>.......z..# #...###..###)#  ......##@#...####R]ggn 8 ..P #....)..P #.##.................###....#....######### #.######R]gg R]gg i6=70.4 (1 _R]gg R]gg S]ggM.# ..#..........##......######:....###...# #...........#S]gg~..>..........##...###.@###)# ....##.#...####. .P #....).......P #.##................#...##### #.#S]ggfS]gg&1S]ggKS]gg?S]ggO,M##..###.# #.....S]gg, .....##......######:....## #...>.....@....##...###..###)# S]gg,r....##.#...####. S]gg-..P #....).........##...S]gg/-.##S]ggN-S]gg=S]gg>T7=2S]ggIS]ggLS]ggx)M #... ).##..###.# #..........##......######:....## #...>..........#...###..###)# S]gg......##.#...####..###S]ggvS]ggS]gg 3S]ggS]gg"S]gg# RM#... #... ).##..###.# #..........##......######:....## #.S]gg$ `..>..........#...###..###)#....##S]gg1 S]gg~2 &4S]ggV= S]ggA S]gga  .. #.##. #.#. #..........# . #... #)...# .##..###.#S]gg 3 ..#  #..........## #............###### #:....## #.# #S]gg' .# ..>..........#S]ggP  #...###..###)# ......##.#...####S]gg~  ..P #...)..P #.##.........S]gg Z.. ............###.S]ggt S]gg B85S]gg S]gg# S]gg Z ##!...#  ..#. #.##. #.#. #..........# .S]gg _# #... #)...##.##..###.#..# #...........##S]gg:  #....@.......###### #:....##S]gg  #.# #.# ..>..........##...###..###)#S]gg ......##.#...####..P##...)S]gg L..P #.##.....S]gg S]ggS]gg S]ggD V40=6S]gg$S]gg.T]ggjb #.######. ##.!...# ..#. #...##. #.#. #..........# # #... #)...###.##..###.#..# #............##..##............###### #:....## #.# #.# ..>..........# .#...###..###) .......##.#...####..P##....).T]ggsT]ggsg2==7T]ggyT]gg{T]gg ...# . #.. #........####.. ##........!. ..#.. #..........##. #.#.# #..........# # #...# #......)...#T]gg###.##..###.#..# #...........##...##............######. #:....## #.#T]gg #.# ..>..........# .#...###..###) .......##.#...####T]ggT]gg54=T]gg-8T]ggT]gg T]gg ; .# ... #..# #. ..##.. ##.! ..#.. #.## #.#.# #...T]gg0 .# # #...# #......)...##.##..###.#.#.#..##.######.. #......:....##T]ggZ . #..# #..#T]ggt { ..>..#T]gg  .#...###..#)# T]gg X .##.#...####.T]gg T]gg{ T]gg 66=T]gg 9T]gg T]gg T]gg  .# ... #..# #. ..##..###.! ..#.. #.# #.#.# #.#T]gg  #.#...# #......)...##.##..###.#.#.#..##.. #......:....##T]ggף .. #...#.. #...#T]ggY a. ..>...# .#...###..##)#  .##.#...####.T]gg T]gg '80T]gg T]gg U]ggRH ..... #..# #....##..###.!....#.. #. #.#.#.# #. #.#...# #......)...#.##..###...#.##... #......:....##.. #....#... #.#... ..>.#.... .#...###..###)# .##.#...####. U]ggPSU]ggSg9==1U]ggH[U]gg^U]gg  .... #..# #. ...##..###. ....#.. # #.#.#.# # #.#...# #......).######.##..###..##.. #......:....##.. #......#.. #..#.....>..#...#...###..###)# .##.#...####54===2U]ggU]ggZU]gg   ....##..# # ...##..### ....#.. # #.#.#.# # #.#...# #......).######.##..###.##..##..:....##.##........##..#...U]gg..##...>....##.#...###..###)# .##.#...U]ggU]ggCa6==3U]gg9"U]gg9U]gg....##..# # ...##..### ....#.. ~ #.#.#.# #~K #.#...# #)~..######.##..###......~...............~≈~##U]gg#.##......:.##...........##..#.....# #..>....# K   kobold (asleep) #U]gg#...###..###)# #.......##.#...## ...P##....).....U]gg  A kobold comes into view. It is wielding a +0 dagger.U]ggL  The kobold shouts! You hear a shout! x2U]ggH .KKU]ggqA kobold comes into view. It is wielding a +0 club.U]gg57=U]gg(==4U]ggU]gg3 _The kobold moves out of view.U]ggL  ...##..###.. ....#.. ≈~K #.#.#.# ##~.K #.#...# ##~K.######.##..###......g~...............#~#≈~##.....##......:.##...........##..#.# #..>.#U]ggM : ##...###..###)# K   kobold brigand (missile, wandering) #.......##.#...# g   goblin (polearm, wandering) ######....P##....).... KK 2 kobolds .P #.##.U]gga  A goblin and a kobold brigand come into view.The kobold brigand is wielding a +0 club and quivering poisoned darts.U]ggc U]ggd U]ggf U]ggg U]ggz , .U]ggI{ K..Kg~.KgK)U]gg{ jgg 2 goblins (polearms)The goblin shouts!U]gg| S60==U]gg| 5U]gg U]gg t _A goblin comes into view. It is wielding a +0 spear.U]ggN .. ....#..  ≈~.. #.#.#.# # #~K. #.#...# #g#~.K######.##..###gg~.K.............U]ggN - #g.#≈~≈~##.....##:#.##...........#.##..#. #..>..U]ggO V ##...###..###) #.......##.#... ######....P##....)...gg 4 goblins (polearms, 2 wandering) #..Pß #.##.U]gg,O E ....U]ggb h  2 goblins come into view.U]ggd U]gge U]ggg U]ggh U]gg=j U]ggy 7 ..#~K..gg..KK 3 goblins (polearms)The goblin shouts! x21=U]gg0z 6U]gg U]gg 3 _The goblin moves out of view.V]gg.. ....#.. #.≈~.. #.#.#.# #.#~.. #.#...# #..#~K.######.##..###..gg..K.#g.K.##≈...~≈~.##..##......:....#V]gg#.##.##.##.#.##.>..##.#...###..###)##.....##.#...#######....P##....).#..Pß##.##..V]ggV]ggV]gg V]gg6V]gg= V]ggQ V]gg..g.K..KKgV]gg/--7V]gg"+V]gg0V]gg j.. ....#.. #.≈~.. #.#.#.# #.#~.. #.#...# #......).#~..######.##..###...g.K.#g..K...##≈..K...~≈~.g......##.#.##......:....##.V]gg j##.# #.##.#.# #.#...##.##.#...#######....P##....).##..Pß##.##..V]gg5 V]ggw V]gg V]gg V]gg V]gg V]gg ~g.K~g...K..KgV]gg W2--8V]gg V]gg V]ggC .. ....#.. #.≈~.. #.#.#.# #.#~.. #.#...# #......)..#~..######.##..###...~g.K.....#~g....##≈...K.......~≈~...K....##.#V]ggmD .....g....@##......:....## #.##.# #.##.#.# #.#...#...##.#...#######....P##....).##..Pß##.##..#V]ggL V]ggM V]ggP V]ggS V]gg U V]ggEe .g.K.K..gKV]ggf &9V]ggyt V]gg2z W]ggpW]gg<W]gg)W]ggW]gghI≈~.. #.#.#.##~....#).#~..######.##..##..~.g.............. #~g..K.......##≈....K.....~≈~........####......gK:....## #............# ##.# .>#...###..###)W]gg......##.#...########....P##....)...... ##..Pß##.##.. ..ß.......#...#....######W]ggBW]gg'W]gg7W]ggHW]ggpW]ggW]gg2.g.g..KK..gKW]ggU4=90W]ggW]gg W]gg #.).#~..######.##..##..~..g............. #~.g..##≈....K~≈~.....K..####.........:....## #gK..##.....# ##......@.# .>....#...###..###)......##.#...########....P##....)...... ##..Pß##.##.. ..ß.......####...#....######## #.####W]ggg W]ggX W]ggk W]gga W]gg W]gg W]gg W]gg g....gg..KK..gKg 4 goblins (polearms)W]gg q6==1W]gg[ W]gg- W]ggǡ.#~..######.##..###....~g................#~...g............##≈..g.............~≈~.....K..##......###.........K.##......:....## #.##...........# #.##....gK..#...........#  #.......@.>..........# #.#...###..###)# #.......##.#...####W]gg######....P##....)....... ##..Pß##.##.....ß........#####...#....#######  3 ####.####  ##W]ggW]ggW]ggW]ggW]ggdW]ggPW]gg-W]ggr  The kobold attacks as it pursues you! The kobold hits you but does no damage.W]ggu.g...gg..KK..gKg 4 goblins (polearms)=2W]ggy _The goblin attacks as it pursues you! The goblin barely misses you.X]gg{.#~..######.##..###...~.................#~..g.............###≈....g..........~≈~...g....##....#.X]gg)|K.##......:....## #.K##..# #.##.#.# #.....gK.@>.# #.#...###..###)# X]ggm|#.............##.#...####.######....P##....).##..Pß##.##...ß....#X]gg|####...#....# #####.#### X]ggX]ggX]ggX]ggX]ggvX]gg^X]ggzX]gg.g..ggKKg..KX]gg &3X]ggX]gg<c _The goblin attacks as it pursues you! The goblin hits you but does no damage.X]gg.#~..######.##..###.#..~...........##~...........#.##≈...g.......~≈~....gg..##.#.K.##......:....## #.K##.# #.##......g.#.# #.K.@.# X]gg,#.#...###..###)# #.............##.#...####. ######....P##....).##..Pß##.##...ß..............###.####...#....# #####.#### X]gg>X]ggtX]ggϘX]ggĚX]gg?X]gg:..g..gK 3   koboldX]ggϧf7=-4X]gg^X]ggc _There is a stone staircase leading down here.X]ggM[~..~.................# #~..#..##≈...g.......#~≈~........########........g..##......:....## #.K##.....# #.##.#.#  #.gK># #.......#..@###..###)# #......##.#...####.######....P##....)........ ##..Pß##.##......ß........###.#####...#....#######  #####.####  2 ## X]gg}aX]ggbX]ggdX]ggeX]ggfX]ggkX]gglX]gg}.g.ggKK.Kgg 4 goblins (polearms)K 2 koboldsX]gg~>-5 X]gg~ _X]ggދX]ggY]ggXCi#~.#...##≈.............##~≈~.....g..##............######  ....##......:....##  #gK##...........#  #.##.K#...........#  #.g.>..........# #.#.K.###..###)# #...........@.##.#...####.######....P##....)........ ##..Pß##.##.... ...ß........###.#####...#....####### #####.####  ### Y]ggI,Y]ggIY]ggJY]ggKY]ggOY]ggPY]gg2RY]gg*g..gK..K.gK 36Y]ggoY]ggrY]gg#~.#... ##≈....## ~≈~........##...###### .g.##......:....## #.g##...# #.##......K.#...# #.K>..# #.#...###..###)# #.gK.@##.#...####. ######....P##....). ##..Pß##.##. ...ß............#####...#....#######Y]gg7#####.#### ### Y]ggu#Y]ggN$Y]gg$Y]gg%Y]gg *Y]gg+Y]gg6g..gK.K.gKg 4 goblins (polearms)Y]gg7.=7Y]gg@Y]ggyCc _The kobold attacks as it pursues you! The kobold hits you but does no damage.Y]ggS #≈..## ≈~.######## ........g.##......:....## g.##.....# .##.g#.#  #.K.K# #.#...###..###)# #...gK.##.#...####.######....P##.@..)........ ##..Pß##.##... ...ß........###. #####...#....####### #####.#### ###  gg 2Y]gg Y]gg Y]gg Y]gg. Y]ggS Y]gg Y]ggD, 5 .g..g>K.gK###g 3 goblins (polearms)Y]gg- .68Y]gg9 Y]gg> _ _The kobold attacks as it pursues you! The kobold hits you with a +0 club.Y]ggX ≈.## ~.##............###### g.##......:....## g##...........# ##.#...........#  #.g>..........#  #.#K..###..###)#  #.g.##.#...####.  ######....P##K.@.). ##..Pß##.##. ...ß..............###. #####...#....############.#######  2Y]gg Y]gg Y]gg Y]gg Y]gg) M.g.g.KK###K   kobold brigand (missile) ggg 3 goblins (polearms)Y]gg8* .-9Y]gg8 Y]gg= Z]gg #≈.## ≈~.##............######.g.##......:....##.##...........# .##.g#...........# #.g..........# #.#.KK###..###)# #.g.##.#...####. ######....P##K@..). ##..Pß##.##Z]gg. ...ß..............###. #####...#....### #####.#### ###Z]ggZ]gg%Z]gg&Z]ggV',Z]gg!4 g.g>..K###Z]gg4^5-=500Z]gg<Z]gg@X _The kobold hits you with a +0 club. You block the goblin's attack.Z]ggR≈.## ~.##............###### g.##......:....## ##...........# ##......g.#...........#  #.g>..........#  #.#...###..###)#  #.Kg.##.#...####.  ######....P##K.@.).Z]ggۮH ##..Pß##.##. ...ß..............###. #####...#....############.#######  2Z]ggXZ]gg2Z]gg=P  The kobold hits something with a +0 dagger.Z]ggeZ]gghZ]ggM.g.gK.gK###K   kobold brigand (missile) ggg 3 goblins (polearms)6=1Z]ggWZ]ggZ _The goblin attacks as it pursues you! You block the goblin's attack.Z]gg% 8  You hit the kobold.Z]ggN Z]gg Y  You kill the kobold!Z]gg Z]gg .g.gK)   koboldZ]gg I=2.3 (0.9Z]ggB Z]gg T _The goblin closely misses you.[]gg z&#≈.## ≈~.##............######.g.##......:....##.##...........# .##.#...........# #[]ggjz.g>..........# #.#..K###..###)# #.gK.##.#...####. ######....P##g@..). ##..Pß##.##. ...ß..............###. #####...#....### #####.#### ###[]ggv[]gg[]ggހ[]ggp[]gg.g.KgK3.3 (1.0[]ggÖ[]ggr _The goblin barely misses you. _You see here a +0 club.[]gg :  You slash the kobold![]gg@Y  You kill the kobold![]gg% .gg)  You block the goblin's attack.  The kobold brigand hits something with a +0 club.[]gg).74[]gg5[]gg94 _You block the goblin's attack.[]ggP"[]gg$  You completely miss the goblin. You block the goblin's attack.  The kobold brigand hits something with a +0 club![]gg4..g[]ggl5&5[]ggOA[]ggCE4 _You block the goblin's attack.[]ggt[]gg gg 4 goblins (polearms)You hit the goblin but do no damage. You block the goblin's attack.[]ggu&6[]gg []gg@ _The goblin hits you but does no damage. x2[]ggS :  You slash the goblin![]ggkV Y  You kill the goblin![]ggh .) 2You hear the creaking of a portcullis nearby.[]ggl 587.4 (1.1[]ggy []gg} r _The goblin barely misses you. You block the goblin's attack.[]gg x#≈.## ~≈~.##.######...##......:....## #.##..# #.##.#..# #.>..# #.#...###..###)# #.Kg)##g#...####. ######....P##@)..). ##..Pß##.##. ...ß..............###. #####...#....###### #####.#### ###[]gg []gg []gg g.gg 3 goblins (polearms)You block the goblin's attack. The goblin attacks as it pursues you![]gg 4680[]gg []gg _The goblin hits you from afar with a +0 spear. _You see here a +0 spear.\]gg:  You slash the goblin!\]gg Y  You kill the goblin!\]gg1j.K 2\]gg-9.5 (1.1\]gg+\]gg0@ _The goblin hits you but does no damage. x2\]ggɓm You kill the goblin!but does no damage. x2  You slash the kobold brigand!  The kobold brigand is moderately wounded.You block the goblin's attack.  The kobold brigand completely misses you.\]ggB6710.4 (0.9\]gg\]gg4 _You block the goblin's attack.\]ggQM The kobold brigand completely misses you. _You block the goblin's attack.heavi  The kobold brigand hits you with a +0 club.\]ggc5-=1.5 (1.1\]gg \]gg$S _The goblin barely misses you.\]gg'  You hit the kobold brigand.  The kobold brigand is severely wounded.You block the goblin's attack. The kobold brigand misses you.\]gg_4-20\]gg\]gg= _The goblin hits you but does no damage.\]ggx B  You slash the kobold brigand!\]ggD( )gg 2 goblins (polearms)  You kill the kobold brigand!\]gg7, P-7=3\]ggr9 \]gg#< 7 _You block the goblin's attack. x2\]gg D #~#...  ##≈...........##  ~≈~.##............######  .##......:....##  #..##...##.###...# #...>..........# ##..g###..###)#  #...........@)##.#...##########.....##))g.). ##..Pß##.##........... ...ß..............###.#####...#....#######\]gg̲ f#####.#######\]gg \]gg t g.  You block the goblin's attack. The goblin attacks as it pursues you!\]gg \6=-4\]gg \]gg _You block the goblin's attack. _Items here: ( )) †.]]gg:  You slash the goblin!]]gg{( )   goblin (polearm)You kill the goblin!]]ggf,c=-5.6 (1.1]]gg45]]gg74 _You block the goblin's attack.]]gg#~.#... ##≈....## ~≈~........##...###### ..##......:....## #.##...# #.##.#...# #.>..# #.#..)###..###)# #.)@##.#...####. ######.....##)g..). ##..Pß##.##. ...ß............#####...#....############.#### ###]]ggx]]gg,60]]gg]]ggu _You block the goblin's attack. _You see here a +0 dagger.]]gg  You hit the goblin.  The goblin is moderately wounded.]]gg577.5 (0.9]]ggܪ]]ggA4 _You block the goblin's attack.]]gg2  You hit the goblin but do no damage.The goblin is moderately wounded.]]gg-8.6 (1.1]]ggo]]ggy"= _The goblin hits you but does no damage.]]gg'  You closely miss the goblin.The goblin is moderately wounded.]]gg (9.7]]gg ]]ggu 4 _You block the goblin's attack.]]ggh8  You hit the goblin.]]ggvD)]]gg{=88200]]gg]]gghJ _You kill the goblin!^]gg{^]gg^]gg^]ggH _No target in view!^]gg1> #~.#...  ##≈....##  ~≈~........##...######  ..##......:....##  #.##...#  #.##.#...# #.>..# #.#..)###..###)# #.@)##.#...####. ######.....##))..)^]gg3. ##..Pß##.##. ...ß...........###. #####...#....###### #####.#### ###^]ggh@^]ggcA5-1 _^]ggL^]ggj_  f - 7 poisoned darts (gained 4)  Things that are here:^]gg`u-2.7 (27^]ggMi^]ggGl\ _a +0 club; a +0 spear; a goblin corpse^]ggBg #~.# ##≈................... ~≈~........##............###### ..##......:....## #.##...........# #.##.#.....# #.........>...#^]gg #.#..)###..###)# #))##.#...####. ######.....##))..). ##..Pß##.##..ß.............###. #####...#....####### #####.#### ###^]gg^]gghY9=3.7 (1^]gg^]gg^]gg & #~.# ##≈........... ~≈~..##...... .##......:....## #.##...........# #.##........#...........# #.........>....# #.#..)###..###)# #.))##.#...####. ######.....##))..). ##..Pß##.##.^]ggh k ....ß..............###. #####...#....# #####.####  ###^]gg ^]ggl &4^]gg+ ^]gg . ^]ggC; ..~. #~....# ##≈......... ~≈~.##............#### .##:....## #..........##...........##.##........#...........# #...>..........# #.......#@.)###..###)#  #...........))##.#...##########.....##))..) ##..Pß##.##......... ....ß..............########...#....############.#######^]ggH ^]gghI &5^]ggU ^]ggX ^]ggC .#~..######.##..###..~........... #~......... ##≈........... ~≈~.##............### .##......:....## #..#..##.###.# #.......@.>..........# ##..)###..###)# ^]gg #...........))##.#...##########.....##))..) ##..Pß##.##... ....ß..............#######...#....############.#######^]gg^]gg6$70^]ggc;=6^]gg^]gg_]gg 0 #~.. #.#...# #) .#~..######.##..###..~........ #~........ ##≈........... ~≈~.##............## .##......:....## #..#...........##.###...........# #...>..........# #.#..)###..###)#  #...........))##.#...###_]ggn ######.....##))..) ##..Pß##.##.. ....ß..............######...#....############.####_]gg_]ggz&7_]gg!_]gg0$_]gg؀y ≈~.. #.#.#.# #...... #Y.. #.#...# #) .#~..######.##..###..~... #~.._]ggρ ##≈.... ~≈~.##............# .##:....## #..#.##.###.....# #...>..........# ##..)###..###)# #...........))##.#...########.....##))..)Y   sky beast (wandering)_]ggW' ##..Pß##.##. ....ß..............#####...#....######_]ggI  The sky beast flickers out of sight!_]ggN^{{_]gg&8_]gg8~_]gg, _Deactivating autopickup; reactivate with Ctrl-A._]ggA .. ....#.. # ≈~.. #.#.#.# #...... #{.. #.#...# # .#~..######.##..###..~.... #~..... ##≈..... ~≈~.##............ .##:....# #..#.##.###..# #...>..........# #_]gg#..)###..###) #...........))##.#...#######.....##))..) ##..Pß##.## ....ß............._]gg_]gg7~_]gg'&9_]gg?_]gg2_]ggN4 - ...##..###.... ....#.. #~≈~.. #.#.#.# # #~.. #.#...# # .#~..######.##..###..~ #~.. ##≈..... ~≈~.##........... .##:.... #..#.#.###.. #...>.........._]gg4  ##..)###..###) #...........))##.#######.....##))..) ##..Pß##.##_]gg7 _]ggG YY   sky beast (invisible)_]ggJH U1=30_]ggR _]ggV _]ggl .##..# #. ...##..###..... ....#.. #~≈~.. #.#.#.# ## #~.. #.#...# ##~..######.##..###∩..~.. #~..Y ##≈....~~≈~.##........##:#..# #.###.. #...>.........# ##..)###..### #...........))##.#######.....##))..)_]ggWv <  Found a flagged portal._]ggv .=1_]gg| _]gg @ _The sky beast hits you but does no damage._]gg d  You hit the sky beast.  The sky beast is lightly wounded._]gg &2_]gg _]ggW _The sky beast closely misses you.`]gg  You hit the sky beast.  The sky beast is moderately wounded.`]gg/-3.6 (0.9`]gg1`]gg˾7 _You block the sky beast's attack.`]ggzd  You hit the sky beast.  The sky beast is moderately wounded.`]gg eI=4.7 (1.1`]ggen`]ggqG  You hit the sky beast.  The sky beast is moderately wounded. _You block the sky beast's attack.  You hit the sky beast.  The sky beast is moderately wounded. _You block the sky beast's attack.`]ggM _You block the sky beast's attack.  You hit the sky beast.  The sky beast is moderately wounded. _You block the sky beast's attack.  You hit the sky beast.  The sky beast is heavily wounded.`]gg_-5.6 (0.9`]ggU`]gg7 _You block the sky beast's attack.`]gg3 _You block the sky beast's attack.  You hit the sky beast.  The sky beast is heavily wounded. _You block the sky beast's attack.  `]gg kYou hit the sky beast.  The sky beast is heavily wounded.`]gg -6.7 (1.1`]gg `]gg> D  You hit the sky beast.  The sky beast is heavily wounded. _You block the sky beast's attack.  You hit the sky beast.  The sky beast is heavily wounded. _The sky beast hits you but does no damage.`]gg}  You hit the sky beast.  The sky beast is severely wounded.`]ggJ ,70`]ggG `]gg 7 _You block the sky beast's attack.a]gg  You hit the sky beast.  The sky beast is severely wounded.a]gg-8.6 (0.9a]gg@a]gg @ _The sky beast hits you but does no damage.a]ggv  You barely miss the sky beast.The sky beast is severely wounded.a]gg........## ##..)###..## #...........))##.#a]gg a]gg. .-2a]gg a]ggv b _Found a bloodstained robe.a]ggM#####.#..... .[......... ....##..# #..... ...##..###........ ....#.. # ~≈~...# #.#.#.# #### #~... #.#...# ##...#~..######.##..####.∩..~a]ggN[#...#~# ##≈.. ~~~≈~.##...... ...##:#.##..#. #.### ... #...>.......## ##..)###..#a]ggZa]gg,[@-3a]gg_a]ggab]ggɴ .# #. ##.....######.#......( .[......##..# #..... ...##..###.......... ....#.. # ~≈~...# #.#.#.# # ### #~...# #.#...# # #...#~@.######.##..### #.∩..~ #...#~#####≈.. ~~~≈~.##...... ...##: #.##..#b]ggڵ. #.### ... #...>......b]ggs<4b]ggAb]gg_% _Found 3 stones.b]gg+>#. ##..... .######.#......(  ..[........##..#  .... ...##..# ... ....#..  ~≈~...# #.#.#.# #### #~...# #.#...# # #...#~..######.##..###b]gg?? #.∩..@............... #...#~ #####≈ ~~~≈~## .....###.##.##...... . #.##..# ... #..> ## ##..)###b]ggLA  You enter the shallow water.b]ggM^5Water b]ggYb]gg[? _Moving in this stuff is going to be slow.b]gg] k #. ##.....  ######.#......(  ..[....##..# ....... ...##.. .......... ....#..  ~≈~...# #.#.#.#  #####~...# #.#...#  #...#~..######.##.. #.∩.@~ #...#~ #####≈ ~~~≈~.## .....## #.##..##b]gg] c . #.##.# ... #.> ## #.#..)###b]gg;j b]ggj 57.2 (1.6b]ggDq b]ggr b]gg  #. ##.....  ######.#......( ..[..............##.. ............. ...##.. .......... ....#.. ~≈~...# #.#.#.# #####~...# #.#...# #...#~..######.##.. #.∩@.~ #...#~ #####≈ ~~~≈~..##b]ggX  .............## #.##..........## . #.##........# ... #.........> ## #.#..)b]ggo b]gg ,80b]ggH b]gg b]gg(R #. ##..... ######.#......( ..[.......## .... ...##b]ggS .... ....# ~≈~...# #.#.#. #####~...# #.#... #...#~..######.##.. #.@..~ #...#~ #####≈. ~~~≈~........## .......##b]gg #.##..........## . #.##........# ... #.>b]ggw ## #.#..)b]gg;b]gg&9b]gg@ b]gg U _There is a flagged portal here.c]gg>n[?25h[?0c  Search for what [Enter for "armor", or ? for help]? d]ggj [?25l[?1cd]gg d]gg c2 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] a - a +0 long sword (weapon) Results elsewhere ([,] to cycle)  b - [D:6] a +0 long sword (1 further duplicate)e]gg# e]gg( #. ##.....deadiverson the Carver######.#......(Human of the Shining One **......[..............##. Health: 72/72 ========================............. ...##. Magic: 9/9========================.......... ....#. AC: 15Str: 17~≈~...# #.#.#. EV: 10Int: 11#####~...# #.#... SH: 13Dex: 14#...#~..######.##.. XL:  9 Next: 73% Place: Dungeon:7#.@..~............. Noise: ---------  Time: 7549.2 (0.0)#...#~............. a) +0 long sword#####≈.e]gg) [40m............ Throw: 7 darts (poison)~~~≈~........##................##...#.##..........##... . #.##........#... ... #.........>.. ## #.......#..)#  _Found a bloodstained robe. _Found 3 stones.  You enter the shallow water. _Moving in this stuff is going to be slow. _There is a flagged portal here.  Search for what [Enter for "armor", or ? for help]? long be]gg/ e]gg0 e]gg5 e]gg8 . _f]gg*f]gg f]ggɦf]ggf]gg,350.2 (1 _f]ggvf]ggf]ggu^ ##########.....### #.........## ...........## a Bailey...∩...@....# ...........## #.........## ###~~~~~####~~~~~##~~~~~#...............  The world spins around you as you enter the gateway.f]ggvf]gg>z:∩f]gg/-1.0 (1.8f]ggf]gg _You enter a bailey!  Found a gate leading back out of this place. _There is an empty arch of ancient stone here.f]gg<f]gg=f]gg=f]gg@f]ggTBf]ggF: _f]ggtFf]ggfHf]ggHf]ggIf]ggMf]gg U##########.....###.........###..##f]ggUm#....∩...∩....###...### ###~~~~~# #~~~~~# #~~~~~# .......O   ogre (polearm, asleep)..O#####f]ggUg##.f]gg` 3.0 (2.0  An ogre comes into view. It is wielding a +0 halberd.f]ggjO)O.f]ggj4==4.0 (3f]ggtq<∩f]ggzM _The ogre shouts! You hear two shouts! You hear a shout!h]ggD # ###.....### ##.## ##.## #....∩...∩....# ##.## ##.## ###~~~~~###  #~~~~~#  #~~~~~# . O.. ..#######..h]gg"h]gg{#h]gg4*OO 2 ogres (polearms, 1 wandering).Oh]gg*4--5.0 (1h]gg0h]ggZ8t _An ogre comes into view. It is wielding a +0 glaive.h]gg  #######  ###.....# ## ##...........## #....∩@..∩....#..##.........#####~### #~~~~~# #~~~~~#   ogre (polearm) O ........O#######..h]gg,h]ggZO.h]ggzA--6h]gg.h]ggh]gg#2 #######  ###.....###  #### ##....@......#....∩...∩....##..####.........########~~~~~##O~~~~#  .........h]gg5h]ggw:DO~h]gg:&7h]gg?=∩h]gghBh]gg: x #######  ###.....###  #### ##...........#....∩...∩....##..####.........#####~~~~~####O~~~~##~~~~~# h]ggڎ h]gg &8h]gg h]gg# i]ggi]gg "}∩O~9i]gg8&8∩i]gg(i]gg$i]ggc.a∩O~i]ggE/'60i]gg68∩i]gg8i]ggXi]ggVO.i]ggc&1i]ggi]ggi]ggY##########.....#####.........####..###....∩...∩....#....O......# ##.........## ###~~~~~###  #~~~~~#.........i]gg6∩i]ggU.=2i]gg;∩i]ggr2 _You block the ogre's attack.i]gg) @##########.....#####.........####..###....∩@..∩....#....O......# ##.........##  ###~~~~~### #i]gg@* #~~~~~#..........O#######..i]ggT4 i]gg4 &3i]gg: :∩i]gg< ; _The ogre hits you but does no damage.i]gg b  You slash the ogre!i]ggF .=4i]gg i]ggu \ _The ogre is heavily wounded.j]gg  You slash the ogre!  The ogre is almost dead.j]gg&5j]gg$:∩j]gg(2 _You block the ogre's attack.j]gg8  You slash the ogre!j]ggU∩)j]gg68-6j]gg:j]ggH _You kill the ogre!j]ggb- ##########.....#####.........####..##....∩...∩....##....@......# ##.........## j]gg-. ###~~~~~### .#######..j]gg2j]gg6;O   ogre (polearm, wandering)Oj]gg;O--7j]ggE:∩j]gg>L  Things that are here: _a +0 halberd; an ogre corpsek]gg (((((((You throw a poisoned dart.k]gg=n  The poisoned dart barely misses the ogre.k]gg?k]gg^MG .~~~.OO 2 ogres (polearms)OOThe ogre shouts! You hear a shout!k]ggMf==8.1 (1.16k]ggVk]gg^t _An ogre comes into view. It is wielding a +0 glaive.k]ggk]ggk]gg [O(k]gg,--9k]gg  0k]gg k]ggl]gg"[ #######  ###.....###  #### #...........##....∩@..∩....##....)......####.........########~~~~~##~~~~~# O .O........(#######..l]ggU(l]gg)l]ggV2ZO.l]gg2B--70l]gg,<l]gg?l]ggM #######  ###.....###  #### ##....@......#....∩...∩....##....)......####.........########~~~~~##O~~~~# Ol]gg4 .........l]ggWl]ggӞl]ggZO.l]gg&1l]ggl]ggl]ggP  #######  ###.....###  #### ##...........#....∩...∩....##....)......####.........#####~~~~~####~O~~~##O~~~~# l]ggV l]ggW l]gg` DO~l]ggHa &2l]ggi :∩l]ggvm m]gg\d (∩(((You throw a poisoned dart. The poisoned dart hits the ogre.m]ggm]ggm]ggl.∩.)OO(~m]ggN]3.2 (1.15m]ggY8∩m]ggp( _You hear a splash.m]gg5 (((, 1 poisoned)You throw a poisoned dart. The poisoned dart hits the ogre.m]gg ,m]ggT ..OO.~m]ggϽ ]4.4 (1.24m]gg m]gg# + _The ogre is poisoned.m]gg (((((((You throw a poisoned dart.  The poisoned dart closely misses the ogre.m]gg i m]ggj m]ggu .OO)..(~(m]gg5v X5.63m]ggi~ m]ggʂ ( _You hear a splash.m]ggS (∩You throw a poisoned dart. The poisoned dart hits the ogre.m]ggPm]ggT .O.The ogre is lightly wounded.=6.7 (1.12m]ggm]ggz2 _You block the ogre's attack.n]ggN ( very poisoned)You throw a poisoned dart. The poisoned dart hits the ogre.  The ogre looks even sicker.n]gg1x .The ogre is moderately wounded.n]gg:3g7.8dart (poison) n]ggU:n]gg>5 _You block the ogre's attack. x2n]ggje##########.....#####.........####..###....OO..∩....#....)......# ##.........## ###~(~~~### #~~~~~# #~(~~~#i   spriggan (polearm, wandering)......i..n]gg  A spriggan comes into view. It is wielding a +0 spear.The spriggan shouts!n]gg...........@.......)..........in]ggZN).n]ggY1-=8n]gg 0n]gg9n]gg*9 _The ogre hits you with a +0 glaive.n]ggOp  You hit the ogre.  The ogre is heavily wounded.n]ggfzNi~n]gg{D58-----n]gg9{9n]ggn]gg9 _The ogre hits you with a +0 glaive!n]gg:   You hit the ogre but do no damage.The ogre is heavily wounded.7-----80.7 (0.9n]ggq n]gg V _You block the ogre's attack. The ogre hits you with a +0 glaive.n]ggg 8  You slash the ogre!n]gg n]gg  )i~   ogre (polearm)You kill the ogre!n]gg >83=1.8 (1.1n]ggQ n]ggX 2 _You block the ogre's attack.n]ggH4n]gg5n]gg<Li~n]ggF=0-2.9n]ggCn]ggFu _You hit the ogre but do no damage. You block the ogre's attack.o]gg]  You slash the ogre!  The ogre is moderately wounded.6-=4.0o]ggo]ggaF _The spriggan hits you from afar with a +0 spear.o]gg  You hit the ogre but do no damage.The ogre is moderately wounded.o]gg'4-50o]ggo]gg _The spriggan completely misses you. The ogre hits you but does no damage.o]gg  You hit the ogre.  The ogre is heavily wounded.-6o]ggx o]gg s _The spriggan closely misses you. You block the ogre's attack.o]gg8  You hit the ogre.  The ogre is severely wounded.o]ggT7=7o]ggo]ggU _The spriggan barely misses you.p]gg8  You slash the ogre!p]gg ∩i   spriggan (polearm)  You kill the ogre!p]ggq8/73=8=8p]ggb;∩p]gg-? _The spriggan hits you but does no damage.p]gg ##########.....###.........##..## )..∩....# ##....).i....## ##..... ###~(~~~# #~~~~~# #~(~~~# ..........(#######..p]ggp]gg i.The spriggan attacks as it pursues you!  The spriggan hits you from afar with a +0 spear.p]gg]2---9p]gg'p]gg. _The spriggan misses you.There is a gate leading back out of this place, spattered with blood here. _You see here a +0 glaive.p]gg ##########.....#####.........##..#....∩)i.∩....# #......## .....## #~(~~~### p]gg  #~~~~~##~(~~~#....... ...(####### p]gg W-90p]gg p]ggT _The spriggan closely misses you.Things that are here: _a +0 halberd; an ogre corpseq]ggOQq]ggQU3--1q]ggdYq]gg1\u _You closely miss the spriggan. You block the spriggan's attack.q]ggp$  You slash the spriggan!  The spriggan is heavily wounded.q]gg$5=2.1 (1.1q]gg-q]ggy0V _The spriggan closely misses you.q]gg  You slash the spriggan!  The spriggan is almost dead.q]gge45---30q]ggy:∩q]gg< _The spriggan hits you with a +0 spear!q]gg <  You slash the spriggan!q]ggT [∩))q]gg׏ 6/74---9-4 q]gg ?_You kill the spriggan!q]gg q]ggf i _Your Fighting skill increases to level 8!q]gg ] ####### #.....### ## ##...........## #....∩)@.∩....# ##....)##.........###~(~~~####~~~~~##~(~~~#..........(#######..q]gg q]gg 7=--5 _q]gg! q]gg  N _You see here a +0 spear.r]gg$\ # ###.....### ##.## ##.## #....∩@).∩....# ##....)......## ##.##  ###~(~~~### r]gg\ #~~~~~#  #~(~~~#  . ..  .(#..r]gger]ggf>-6 r]ggf _r]ggemr]ggx  f - 3 poisoned darts (gained 2)  Things that are here:r]ggyj7.1 (23 darts (poison)r]gg߂r]gg@Q _a +0 glaive; an ogre corpses]ggs]ggY8=8.1 (1s]ggھs]gg}s]ggl( s]gg( s]gg* s]gg, s]gg0 Xs]gg2 s]gg5 s]gg6 99s]gg)8 s]gg; s]gg-< s]ggM= s]ggA ,s]ggC s]gg,H j50=s]ggI s]ggSM s]gg{M s]gg[O s]ggS ,s]ggV s]ggc[ s]gg[ K1=s]gg^ s]gga ,s]ggb s]ggf s]ggIf s]gg0g s]ggi s]gg.i 92s]ggaj s]ggl s]ggl s]ggMn s]ggq ,s]ggu s]gg,x s]ggcx s]ggXy s]gg{ s]gg{ N53=s]gg| s]gg ,s]gg s]gg ,s]gg s]gg s]gg W4=s]ggY s]gg ,s]gg. s]ggo ,s]gg} s]ggy s]gg %5s]gg s]gg ,s]gg s]ggɘ ,s]gg s]gg a6=s]ggU s]gg ,s]gg s]ggϨ ,s]gg s]gg k7=s]ggհ s]gg ,s]ggȶ s]gg ,s]gg s]ggN ;8s]gg4 s]gg ,s]gg s]gg ,s]gg s]gg8 s]ggi K9=s]ggj s]gg ,s]gg? s]gg ,s]gg s]ggp l60=s]gg s]ggG s]gg/  i   spriggan (polearm, wandering)i _You start resting.s]ggO 1635.1 (37.0)s]gg ,6.1 (38s]gg s]gg v _A spriggan comes into view. It is wielding a +0 spear.u]gg2 (((((((You throw a poisoned dart.u]ggr  The poisoned dart barely misses the spriggan.u]gg̽u]gg}..~~ii).u]ggfj==7.3 (1.2)2u]ggu]gga* _The spriggan shouts!u]ggc((((((u]gg0ju]ggs∩..~~i~.u]gg&t>1--8.4 (1.1u]ggKt?dart (poison) u]gg}:∩u]gg/w _You throw a poisoned dart. The poisoned dart misses the spriggan.u]gg ∩(((, poisoned)You throw a poisoned dart. The poisoned dart hits the spriggan.u]gg} ∩..~--9.5Nothing quiveredu]ggLJ u]ggߊ / _The spriggan is poisoned.u]gg J 4u]ggS u]ggKW G _Nothing quivered!v]ggǢv]ggMi~v]ggͮ4400 _v]ggѶ:∩v]ggv]ggDzv]gglb∩i~v]gg\2==1v]ggKv]ggU _The spriggan barely misses you.v]ggN ##########.....#####.........##..v]gg #....∩)).∩....# ##....)@.....## .i...## #~(~~~###  #~~~~~#v]gg #~(~~~#....... .......(v]gg! .(#######. v]gg v]gg _54---=2v]gg v]gg < _The spriggan hits you with a +0 spear!v]gg܊  You closely miss the spriggan.The spriggan is lightly wounded.-3.6 (1.1v]gg v]gg: 6 _You block the spriggan's attack.w]ggoJ  You hit the spriggan.  The spriggan is moderately wounded.w]ggKe5----4.5 (0.9w]gg(Rw]ggU6 _You block the spriggan's attack.w]ggXpj) _You block the spriggan's attack.  You hit the spriggan.  The spriggan is moderately wounded. _You block the spriggan's attack.  You hit the spriggan.  The spriggan is moderately wounded.w]gg-q535.5 (1.0w]ggyw]gg|e  You hit the spriggan.  The spriggan is moderately wounded. _You block the spriggan's attack.  You hit the spriggan.  The spriggan is moderately wounded. _The spriggan looks more healthy. The spriggan hits you with a +0 spear.w]gg  You closely miss the spriggan.The spriggan is moderately wounded.w]gga&6w]gg w]gg 6 _You block the spriggan's attack.w]gg  You slash the spriggan!  The spriggan is severely wounded.4=7.6 (1.1w]ggw]gg6 _You block the spriggan's attack.w]ggh8 <  You slash the spriggan!w]ggE D)w]ggF w]ggnQ deadiverson the CarverHuman of the Shining One **....Health: 55/75 =================-------#######Magic: 9/9========================###.....###AC: 15Str: 17##.........##EV: 10Int: 11##...........##SH: 13Dex: 14#....∩)).∩....#XL:  9 Next: 108% Place: a Bailey##....)@.....##Noise: =--------  Time: 7648.7 (1.1)##.....)...##a) +0 long sword###~(~~~###Nothing quivered#~~~~~#w]ggR 8#~(~~~#..............(..(#######..The spriggan is moderately wounded. _You block the spriggan's attack.  You slash the spriggan!  The spriggan is severely wounded. _You block the spriggan's attack.  You slash the spriggan!w]ggS - _You kill the spriggan!You have reached level 10!w]ggY /  --more--x]gg_H60/8210/1010 4% x]ggx]gg44 _x]gg4 x]ggq7 C  Skill  Level Cost  Apt Skill  Level Cost  Apt x]gg7 Za + Fighting8.5   9.0   0   j - Spellcasting   0.0   1.2  -1          x]gg7 , b - Unarmed Combat   0.0   1.0   0      x]gg8  c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0          x]gg8 h     f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0  x]gg9      h - Shields   5.4   6.0   0       i - Stealth   0.0   0.8  +1      x]ggb9             x]gg9 !            x]gg9             x]gg-:     The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  x]ggr: :[?] Helpx]gg: G[=] set a skill target  x]gg: }[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsy]ggz y]ggE y]gg $ deadiverson the CarverHuman of the Shining One **....Health: 60/82 =================-------#######Magic: 10/10 ========================###.....###AC: 15Str: 17##.........##EV: 10Int: 11##...........##SH: 13Dex: 14#....∩)).∩....#XL: 10 Next:  4% Place: a Bailey##....)@.....##y]gg$ Noise: =--------  Time: 7648.7 (0.0)##.....)...##a) +0 long sword###~(~~~###Nothing quivered#~~~~~##~(~~~#..............(..(#######..You slash the spriggan!  The spriggan is severely wounded. _You block the spriggan's attack.  y]gg$ You slash the spriggan! _You kill the spriggan! _You have reached level 10!y]gg- 4y]gg 5 y]gg6 y]ggr y]gg y]gg y]ggN y]gg $ _y]ggƟ Xy]ggE ;1y]gg y]gg ,y]ggצ y]gg- ,y]ggw y]gg y]gg K2=y]gg` y]ggJ ,y]ggܵ y]gg- y]gg_ y]ggK y]gg y]gg+ U3=y]gg* y]ggE ,y]gg y]gg< ,y]ggT y]ggl ;4y]gg y]gg ,y]gg y]gg ,y]gg y]gg y]gg0 K5=y]gg` y]gg ,y]gg y]ggx ,y]gg y]gg k6=y]gg y]gg ,y]gg y]ggI ,y]gg( y]gg( y]gg+ %7y]gg y]gg[ ,y]gg y]gg,y]ggoy]ggy]gg ;8y]gg$ y]ggp,y]ggy]ggZ,y]ggy]gg y]ggeK9=y]ggy]gg,y]gg"y]gg9&,y]gg(y]gg+y]gg,V70=y]ggn-y]ggU1,y]ggC4y]gg8,y]gg?y]ggqD;1y]ggIy]ggMy]ggNy]ggwQy]ggV,y]gg(Yy]gga]y]gg]D2=y]gg`y]ggkh,y]gg{ky]ggo,y]ggqy]ggvy]ggwN3=y]gg.zy]gg~,y]gg'y]gg,y]ggy]gg;4y]ggy]gg ,y]ggy]gg,y]ggPy]gg;5y]ggy]ggs,y]ggPy]gg,y]ggy]gga6=y]ggky]gg,y]ggy]ggy]ggy]ggjy]ggs97y]gg2=y]ggy]ggc,y]ggy]gg ,y]gg1y]ggfy]gg%8y]ggy]gg*,y]ggWy]gg+,y]ggy]ggy]gggK9=y]ggy]gg,y]ggy]gg_ ,y]gg+y]ggl80=y]ggy]gg>,y]ggy]gg!,y]gg$y]gg-;1y]gg1y]ggZ6,y]ggr8y]gg<,y]ggI?z]gg:z]ggK2=z]ggz]gg 1 _HP restored.z]ggF3z]ggLz]gg8z]ggA  You enter the shallow water.z]gg@Water z]gg!z]gg-'N _Moving in this stuff is going to be slow.z]gg'z]gg*z]gg2b _f - a poisoned dartz]gg6z]gg6:=z]gg9z]gg[=z]ggA,z]ggBz]gglK,z]ggiNz]ggwTn _f - 2 poisoned darts (gained 1)z]ggY<z]gg\z]gg8psz]ggSq,z]gghx,z]ggzz]ggzz]gg{z]gg,z]gg>z]ggn _f - 3 poisoned darts (gained 1)z]ggz]ggoz]ggz]gg9z]ggz]gg z]gg)z]ggz]gg,z]ggz]gg{z]ggz]gg_z]ggܸz]ggz]ggz,z]ggz]ggz]gg@,z]ggz]ggz]ggdz]ggz]ggz]gg,z]ggz]ggHn _f - 5 poisoned darts (gained 2)z]ggz]ggFz]ggz]ggxz]ggz]ggz]ggz]gg5z]gg z]ggU z]gg z]gglXz]gg@<##....)......####.....)...#####~~~~~####~~~~~# ##~~~~~## ##.......## ##.........## #..#######..## #..#♣ ##@.# -739.5 (90.8)#..# ##..# #..# #..# Throw: 5 darts (poison)#.. ..##. ..##. .# .# - _Key pressed, stopping explore.z]ggaIuz]ggJ$ _z]gg|PXz]ggS,z]ggVz]ggVz]ggYWz]gg-Yz]ggk[z]gg[z]ggz\z]ggaz]ggoz]ggpz]ggpz]ggt,z]ggC~#..#######..## #..#♣ ##..##  #..# ##..## z]gg~G#..# ♣#..# #.. ♣..# #. #..# #. ♣..# ♣..z]gg. #..#  ..##  z]gg..## ..# O.# O   ogre (polearm, asleep)..#z]ggI ###z]gg 47.5 (8.0)  An ogre comes into view. It is wielding a +0 halberd. ..#  The ogre shouts! You hear two shouts! You hear a shout!  The ogre moves out of view.===8.5 (9z]gg\z]ggƫ- _You hear an angry hiss.z]ggs&z]ggO'3z]gg+z]gg"1 #..#♣ ##..###..# ##..## #..#  ♣#..  ♣. #.♣. z]gg1 ♣.##..##..## O..#...#....# O   ogre (polearm)#### z]gg1 z]ggF5&0z]gg6z]gg@^.OOO   two-headed ogre (polearm)O   ogre (polearm)z]ggrE5---9.5 (1z]ggIz]ggmR _A two-headed ogre comes into view. It is wielding two +0 halberds.z]gg٦  #..#♣   #..# ##..## ♣#..# ♣..# #..# ♣..# ♣..# #..# #@.#z]gg  #..## #..## .O.# O..# ....# ####z]gg\>  #..#♣   #..# ##..## ♣#..# ♣..# #..# ♣..# ♣..# #..# #@.# #..## #..## .O.# O..# ....# #### z]ggnF P---z]ggK z]ggN d _There are monsters nearby!{]gg {]gg Evoke which item? Wands  o - a wand of acid (4){]gg& y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected|]gg}|]gg |]gg> #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#|]gg*AC: 15Str: 17 #.♣..#EV: 10Int: 11♣..#SH: 13Dex: 14#..#XL: 10 Next:  4% Place: a Bailey#@.#Noise: ---------  Time: 7749.5 (0.0)|]gg#..##a) +0 long sword#..##Throw: 5 darts (poison).O.#O..#....#|]ggBO   two-headed ogre (polearm)####|]ggeO   ogre (polearm)An ogre comes into view. It is wielding a +0 halberd.|]ggThe ogre shouts! You hear two shouts! You hear a shout!  The ogre moves out of view. _You hear an angry hiss. |]gg_A two-headed ogre comes into view. It is wielding two +0 halberds. _There are monsters nearby!}]ggt #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11}]gg% ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  4% Place: a Bailey #@.# Noise: ---------  Time: 7749.5 (0.0) #*.## a) +0 long sword #*.##}]gg[ Throw: 5 darts (poison) .O.# O..# ....# O   two-headed ogre (polearm) ####}]gg O   ogre (polearm) _You hear an angry hiss. }]gg_A two-headed ogre comes into view. It is wielding two +0 halberds. _There are monsters nearby!Aiming: Corrosive Bolt}]ggPress: ? - help, Shift-Dir - straight line, f - ogreAim: an ogre, wielding a +0 halberd (haloed, 91% to hit)}]ggomm O*}]ggT *O., f - two-headed ogreAim: a two-headed ogre, wielding two +0 halberds (86% to hit)~]gg9' #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11~]gg' ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  4% Place: a Bailey #@.# Noise: ---------  Time: 7749.5 (0.0) #..## a) +0 long sword~]gg( #..## Throw: 5 darts (poison) .O.# O..#~]ggL( ....# O   two-headed ogre (polearm) ####~]ggg( O   ogre (polearm)~]gg( ~]gg(CAiming: Corrosive Bolt~]gg(Press: ? - help, Shift-Dir - straight line, f - two-headed ogreAim: a two-headed ogre, wielding two +0 halberds (86% to hit)  ~]gg(BThe bolt of acid hits the ogre! The acid corrodes the ogre!  ~]gg(~The ogre is heavily wounded.The bolt of acid hits the two-headed ogre!~]gg./  --more--~]gg8S  #..#♣   #..# ##..## ♣#..# ♣..# #..#~]ggS ♣..# ♣..# #..# #@.# #*.## #*.## **.# *..# ....# , corroded)~]ggT #### , corroded)  The acid corrodes the two-headed ogre!~]gg9[The two-headed ogre is moderately wounded.~]gg~]gg~]gg2.O..OOO 2 ogres (polearms, 1 corroded)You hear a shout! x2  An ogre comes into view. It is wielding a +0 halberd.~]ggrK====50.5 (1~]gg ~]gg% _You hear an angry hiss.]gg]ggEvoke which item? Wands  o - a wand of acid (3)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected]gg]gg ]gg"S #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.♣..#EV: 10Int: 11♣..#SH: 13Dex: 14#..#XL: 10 Next:  4% Place: a Bailey#@.#Noise: ====-----  Time: 7750.5 (0.0)#..##a) +0 long sword#O.##]ggYThrow: 5 darts (poison)...#OO.#....#O   two-headed ogre (polearm, corroded)####OO 2 ogres (polearms, 1 corroded)The acid corrodes the two-headed ogre!  The two-headed ogre is moderately wounded.You hear a shout! x2  An ogre comes into view. It is wielding a +0 halberd. _You hear an angry hiss.]gg>: #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11 ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  4% Place: a Bailey #@.# Noise: ====-----  Time: 7750.5 (0.0) #*.##[3]gg6;4m a) +0 long sword #O.## Throw: 5 darts (poison) .*.# OO.# ....# O   two-headed ogre (polearm, corroded) #### OO 2 ogres (polearms, 1 corroded)An ogre comes into view. It is wielding a +0 halberd. _You hear an angry hiss.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - two-headed ogreAim: a two-headed ogre, wielding two +0 halberds (moderately wounded, covered  in acid, 86% to hit)]ggC #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 ]ggD#. ♣..# EV: 10Int: 11 ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  4% Place: a Bailey #@.# Noise: ====-----  Time: 7750.5 (0.0) #..## a) +0 long sword ]ggD#O.## Throw: 5 darts (poison) ...# OO.# ]ggE....# O   two-headed ogre (polearm, corroded) ####]gg;E OO 2 ogres (polearms, 1 corroded) ]ggdE_You hear an angry hiss.  Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - two-headed ogre]ggEAim: a two-headed ogre, wielding two +0 halberds (moderately wounded, covered  in acid, 86% to hit)  The bolt of acid hits the ogre!]ggG  Aiming: Corrosive Bolt  Press: ? - help, Shift-Dir - straight line, f/p - two-headed ogreAim: a two-headed ogre, wielding two +0 halberds (moderately wounded, covered  in acid, 86% to hit)  The bolt of acid hits the ogre!  You kill the ogre!]ggHN/  --more--]gg}.  #..#♣   #..# ##..## ♣#..# ♣..# #..# ♣..# ♣..# #..# #@.# #*.## #*.## ]gg/.*.# O*.# ..*.# ####O   ogre (polearm)  The bolt of acid hits the two-headed ogre!]gg(]gg޺XThe two-headed ogre is heavily wounded.]ggͻ]ggĽ]gg4.)OO.i.i   spriggan]gg361.5 (1]ggi]gg  A spriggan comes into view. It is wielding a +1 rapier of holy wrath and _wearing the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}.]gg`]ggbEvoke which item? Wands  o - a wand of acid (2)y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected]ggn[]gg c]gggmF #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.♣..#EV: 10Int: 11]ggnB♣..#SH: 13Dex: 14#..#XL: 10 Next:  6% Place: a Bailey#@.#Noise: ====-----  Time: 7751.5 (0.0)#..##a) +0 long sword#).##Throw: 5 darts (poison)OO.#.i.#....#O   two-headed ogre (polearm, corroded)####O   ogre (polearm)i   sprigganThe bolt of acid hits the two-headed ogre!  The two-headed ogre is heavily wounded.A spriggan comes into view. It is wielding a +1 rapier of holy wrath and _wearing the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}.]gg #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11 ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  6% Place: a Bailey #@.# Noise: ====-----  Time: 7751.5 (0.0) #*.##[3]gg 4m a) +0 long sword #*.## Throw: 5 darts (poison) OO.# .i.# ....# O   two-headed ogre (polearm, corroded) #### O   ogre (polearm)  i   sprigganA spriggan comes into view. It is wielding a +1 rapier of holy wrath and _wearing the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - two-headed ogreAim: a two-headed ogre, wielding two +0 halberds (heavily wounded, covered in  acid, haloed, 91% to hit)]ggR OO - ogre, p - two-headed ogren ogre, wielding a +0 halberd (86% to hit)]gg #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11 ♣..# SH: 13Dex: 14 #..# XL: 10 Next:  6% Place: a Bailey #@.# Noise: ====-----  Time: 7751.5 (0.0)]gg #..## a) +0 long sword #).## Throw: 5 darts (poison) OO.# .i.# ....# O   two-headed ogre (polearm, corroded) #### O   ogre (polearm)  i   sprigganAiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f - ogre, p - two-headed ogreAim: an ogre, wielding a +0 halberd (86% to hit)  The bolt of acid hits the two-headed ogre!  The two-headed ogre seems to be corroded for longer.  The two-headed ogre is severely wounded.]gg/  --more--]gg0  #..#♣   #..# ##..## ♣#..# ♣..# #..# ♣..# ♣..# #..# #@.# #*.## #*.## **.# *i.# ....#  #### , corroded)  The bolt of acid hits the ogre! The acid corrodes the ogre!]ggm]ggWPThe ogre is moderately wounded.]gg]ggK]gg]ggÕ.O.O.iii 2 spriggans (1 polearm)]gg+2.5 (1]gg]ggUp _A spriggan comes into view. It is wielding a +0 trident.]gg)3<Evoke which item? Wands  o - a wand of acid (1)y - a wand of digging (6) [!] read|quaff|evoke]gg3][?] describe selected]ggP ]gg[ ]ggh  #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== ]gg-i #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.♣..#]ggUi EV: 10Int: 11♣..#SH: 13]ggvi Dex: 14#..#XL: 10 Next:  6% Place: a Bailey]ggi #@.#Noise: ====-----  Time: 7752.5 (0.0)]ggi A#..##]ggi a) +0 long sword#O.##Throw: 5 darts (poison)]ggi Z.O.#]ggj }.ii#....#]ggj O   two-headed ogre (polearm, corroded)]gg*j "####]gg>j {O   ogre (polearm, corroded)]ggUj ii 2 spriggans (1 polearm)The bolt of acid hits the ogre! The acid corrodes the ogre!  ]gguj 9The ogre is moderately wounded. ]ggj c_A spriggan comes into view. It is wielding a +0 trident.]ggj ]gge  #..#♣ ##..## deadiverson the Carver  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..# Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11 ♣..#]ggV O SH: 13Dex: 14 #..# XL: 10 Next:  6% Place: a Bailey #@.# Noise: ====-----  Time: 7752.5 (0.0) #*.## a) +0 long sword #O.## Throw: 5 darts (poison) .O.# .ii# ....# O   two-headed ogre (polearm, corroded) ####]gg  O   ogre (polearm, corroded)  ii 2 spriggans (1 polearm)The ogre is moderately wounded. _A spriggan comes into view. It is wielding a +0 trident.Aiming: Corrosive BoltPress: ? - help, Shift-Dir - straight line, f/p - ogreAim: an ogre, wielding a +0 halberd (moderately wounded, covered in acid,  haloed, 91% to hit)]gg Oi - spriggan, p - ogre spriggan, wielding a +0 trident (43% to hit)]ggM  #..#♣ ##..## deadiverson the Carver ]gg  #..# ##..## Human of the Shining One **.... #..# ♣#..# Health: 82/82 ======================== #.. ♣..#]gg Q Magic: 10/10 ======================== #. #..# AC: 15Str: 17 #. ♣..# EV: 10Int: 11]gg _ ♣..#]gg$ u SH: 13Dex: 14]gg9 s #..#]ggS  XL: 10 Next:  6% Place: a Bailey ]ggi d#@.#]gg  Noise: ====-----  Time: 7752.5 (0.0)]gg _ #..##]gg l a) +0 long sword ]gg #O.## Throw: 5 darts (poison)]gg  ]gg x.O.# ]gg L.ii#]gg S ....#]gg*  O   two-headed ogre (polearm, corroded)]gg= ( ####]ggR  O   ogre (polearm, corroded)]ggg k  ii 2 spriggans (1 polearm)]gg{ ]gg CAiming: Corrosive Bolt]gg [Press: ? - help, Shift-Dir - straight line, f - spriggan, p - ogre]gg PAim: a spriggan, wielding a +0 trident (43% to hit)  ]gg 1The bolt of acid hits the two-headed ogre!  ]gg ;The two-headed ogre seems to be corroded for longer.  ]gg TThe two-headed ogre is almost dead.]gg /  --more--]gg   #..#♣   #..# ##..## ♣#..# ♣..# #..#]ggr!f ♣..# ♣..# #..# #@.# #*.## #*.## .*.# .*i#]gg! ..*.#  ####]gg!<   ]gg!pThe bolt of acid hits the ogre!  The ogre is severely wounded.]ggd]gggThe bolt of acid misses the spriggan. The now-empty wand crumbles to dust.  You block the two-headed ogre's attack.]ggi]ggu.OiiO...]ggv+3.5 (1]gg7]gg> _The two-headed ogre hits you but does no damage.]ggv]gg]gg]gg> _Unknown command.]ggO ]ggER yEvoke which item? Wands  y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected]ggu?]gg<]gg]gg> #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#]ggAC: 15Str: 17 #.♣..#EV: 10Int: 11♣..#SH: 13Dex: 14#..#XL: 10 Next:  6% Place: a Bailey#@.#Noise: ====-----  Time: 7753.5 (0.0)#..##a) +0 long sword#O.##]ggdThrow: 5 darts (poison)iiO#...#....#O   two-headed ogre (polearm, corroded)####O   ogre (polearm, corroded)ii 2 spriggans (1 polearm)The bolt of acid hits the ogre!  The ogre is severely wounded.The bolt of acid misses the spriggan. The now-empty wand crumbles to dust.  You block the two-headed ogre's attack. _The two-headed ogre hits you but does no damage. ]gg1_Unknown command.]gg-"P  Okay, then.]gg"]gg-]gg2. _]ggD]ggInventory: 21/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (go to first with [)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  B - a +0 chain mail (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) ]ggWands (go to first with /)y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  ]ggJs - a scroll of enchant weapon  v - a scroll of noise ]gg [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]]ggſ ]ggy #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.♣..#EV: 10Int: 11♣..#SH: 13Dex: 14#..#XL: 10 Next:  6% Place: a Bailey#@.#Noise: ====-----  Time: 7753.5 (0.0)#..##a) +0 long sword#O.##Throw: 5 darts (poison)]ggiiO#...#....#O   two-headed ogre (polearm, corroded)####O   ogre (polearm, corroded)ii 2 spriggans (1 polearm)The ogre is severely wounded.The bolt of acid misses the spriggan. The now-empty wand crumbles to dust.  You block the two-headed ogre's attack. _The two-headed ogre hits you but does no damage. _Unknown command. _Okay, then.]gg]gg]ggf]ggg]gg ]gg_Drink which item? Potions  e - 2 potions of enlightenment  k - 2 potions of mutation  q - a potion of attraction ]gg u - a potion of magic [!] read|quaff|evoke[?] describe selected]gg ]gg ]gg  #..#♣ ##..##deadiverson the Carver]ggT #..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.♣..#EV: 10Int: 11♣..#SH: 13]gg˓ Dex: 14#..#XL: 10 Next:  6% Place: a Bailey#@.#Noise: ====-----  Time: 7753.5 (0.0)#..##a) +0 long sword#O.##Throw: 5 darts (poison)iiO#]gg /...#....#O   two-headed ogre (polearm, corroded)####]ggO O   ogre (polearm, corroded)ii 2 spriggans (1 polearm)The ogre is severely wounded.]ggu The bolt of acid misses the spriggan. The now-empty wand crumbles to dust.  You block the two-headed ogre's attack. _The two-headed ogre hits you but does no damage. ]gg M_Unknown command. _Okay, then.]ggn  Okay, then. _]ggRead which item? Scrolls  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportation [!] read|quaff|evoke[?] describe selected]ggt ]gg{ ]gg  #..#♣ ##..##deadiverson the Carver#..###..##Human of the Shining One **.... #..#♣#..#Health: 82/82 ======================== #..♣..#Magic: 10/10 ======================== #.#..#AC: 15Str: 17 #.]gg ♣..#EV: 10Int: 11♣..#SH: 13Dex: 14#..#XL: 10 Next:  6% Place: a Bailey#@.#Noise: ====-----  Time: 7753.5 (0.0)#..##a) +0 long sword#O.##Throw: 5 darts (poison)iiO#...#....#O   two-headed ogre (polearm, corroded)####O   ogre (polearm, corroded)]gg iii 2 spriggans (1 polearm)The bolt of acid misses the spriggan. The now-empty wand crumbles to dust.  You block the two-headed ogre's attack. _The two-headed ogre hits you but does no damage. _Unknown command. _Okay, then. ]ggW 6_Okay, then.]ggL P  Okay, then.]gg" ]gg ]ggO . _]gg?  #..#######..##  #..#♣ ##..##  #..###..##♣#.♣# #.♣. #..]gg@ #..## #O.## iiO# ...#....#####   spriggan]ggQG]ggH]gg$J]ggsL]gg]O)O.iii 2 spriggans (1 polearm) _Unknown command. _Okay, then.Okay, then.  The two-headed ogre attacks as it pursues you!  You block the two-headed ogre's attack.]gg]`=---4.5 (1]gg l]ggQrF _The two-headed ogre hits you but does no damage.]gg[#.........##  #..#######..##  #..#♣ ##..##  #..###..##♣#.♣# #.♣]gg\ #.. #O.## #)O## .ii# ...#....#   spriggan (####]gg`]ggzb]ggd]ggh]ggki]ggsOi..]ggetQ----5]gg|]ggU]ggL a #### #.........##  #..#######..##  #..#♣ ##..##  #..#]ggۍ ##..##♣#.♣# #.♣ #.. #OO##]gg$ #)i## ...# ...#....#]gg ]gg[ ]gg ]ggΙ ]ggާ Oi.i 2 spriggans (1 polearm)-6]gg ]ggW ]gg}- G ##~~~~~##  #### #.........##  #..#######..##  #..#♣ ##..##  #..###..##♣#.]gg5. ♣# #.♣.. #Oi #O.## #)i## ...# ...#]gg6 ]gg|8 ]gg9 ]ggz: ]gg< ]ggwJ iOO.]gg)K &7]ggX ]ggs] ]gg}   ##~~~~~##  ##.......## #.........##  #..#######..##  #..#♣ ##..##  #..###..##♣#.♣# #.♣.i. #Oi #O.## #).##  ...#]gg"]gg]gg3ii...O]gg&8]gg]gg"]gg .#### #~~~~~#  ##~~~~~##  ##.......## #.........##  #..#######..##  #..#♣ ##..##  #..###..##♣#.♣#. #.♣i. #O. #.O## #).##]gg ]ggq ]gg ]gg i.OO.]gg ^78--=9]gg ]gg H _The spriggan hits you from afar with a +0 trident.]gg2D.....)...#####~~~~~### #~~~~~ ##~~~~~ ## ##....... #..##### #..#♣  #..###@.##  #..##..#  #.. ♣..#  #. #i.#  #. ♣i.# ♣..# #O.# #O.# #..##]ggL:]ggh>]gg@]ggD]ggG]gg[ii..OO.]gg\h9=--60]ggi]ggmp]gg )......##.....)...#####~~~~~### #~~~~~ ##~~~~~ ##.... ##....... #..##### #..#♣ #..###..## #..##..#  #.. ♣ii#  #. #..##. ♣..#ii 2 spriggans (1 polearm) ♣O.# #O.# #..#]gg]gg]gg\]gg]ggqZii..OO   two-headed ogre (polearm, corroded).ii 2 spriggans (1 polearm)]gg @-1]gg]gg|]ggK/]gg0]gg4c  You closely miss the spriggan.]ggGDti.OOO   ogre (polearm, corroded)ii 2 spriggans (1 polearm)=2.6 (1.1]ggP]ggTB _The spriggan hits you but does no damage. x2]gg(]gg]ggO..ii 2 spriggans (1 polearm)]gg1e80=30]ggJ]ggw _You barely miss the spriggan. You block the spriggan's attack. x2]ggz:  You hit the spriggan.]ggW}E  The spriggan is lightly wounded.]gg9OO.O   ogre (polearm, corroded)ii 2 spriggans (1 polearm)]gg-4.7 (1.1]ggܖ]ggǜ9 _You block the spriggan's attack. x2]gg  Ability - do what?CostFailure  Invocations -  X - Renounce ReligionNone0% a - Divine Shield3 MP, Piety-14% [?] toggle between ability selection and description.]gg`j]gg:w]ggC ##....)......##deadiverson the Carver##.....)...##Human of the Shining One **....###~~~~~###Health: 80/82 =======================-#~~~~~#Magic: 10/10 ========================##~~~~~##AC: 15Str: 17##.......##EV: 10Int: 11##.........##SH: 13Dex: 14#..#######..##XL: 10 Next:  6% Place: a Bailey#..#♣ ##@.##Noise: =--------  Time: 7764.7 (0.0)#..###ii##a) +0 long sword#..#♣#O.#Throw: 5 darts (poison)#..]gg ♣O.##.#..##.♣..#O   two-headed ogre (polearm, corroded)♣..#O   ogre (polearm, corroded)#O.#ii 2 spriggans (1 polearm)#..#You closely miss the spriggan. _The spriggan hits you but does no damage. x2 _You barely miss the spriggan. You block the spriggan's attack. x2  You hit the spriggan.  The spriggan is lightly wounded. _You block the spriggan's attack. x2]gg The spriggan is lightly wounded. _You block the spriggan's attack. x2  A divine shield manifests in front of you!block the two-headed ogre's attack. x2two-headed ogre is struck blind by the light of your shield.  ]gg OO.Oblind, unab…)Your divine shield fades away.]gg f7/10 --------5.7 (1]gg߮]gg]6 _You block the spriggan's attack.]gg  You slash the spriggan!  The spriggan is heavily wounded.]ggY ]gg .OOYou block the spriggan's attack.]gg% 61=6]gg ]gg ? _The spriggan hits you but does no damage.]gg  You slash the spriggan!  The spriggan is almost dead.]gg]ggs" O..OThe spriggan hits you but does no damage.]gg#-7.8 (1.1]ggU.]gg16 _You block the spriggan's attack.]ggz  You hit the spriggan but do no damage.The spriggan is almost dead.The spriggan hits you with a +1 rapier of holy wrath.]ggFO.]ggat798===------8.7 (0.9]gg]ggS _You block the ogre's attack. You block the spriggan's attack.]gg  You closely miss the spriggan.The spriggan is almost dead.You block the spriggan's attack.]gg ]ggP TOO]gg ^80-9.8 (1.1]gg ]gg ? _The spriggan hits you but does no damage.]ggFU   You completely miss the spriggan.The spriggan is almost dead.The two-headed ogre is no longer blind. The spriggan barely misses you.]ggeOO.Ocorroded)]gg6f)70.9]gg7r]ggw6 _You block the spriggan's attack.]gg  You hit the spriggan but do no damage.The spriggan is almost dead.The ogre is no longer covered in acid. You block the spriggan's attack. x2]gg} .O)The two-headed ogre hits you from afar with a +0 halberd. x2]gg?X7---2.0]gg]gg6 _You block the spriggan's attack.]ggN  You closely miss the spriggan.The spriggan is almost dead.]ggH' O. The spriggan hits you from afar with a +0 trident.  You block the two-headed ogre's attack.  The two-headed ogre hits you from afar with a +0 halberd!]ggM58-------====30]gg]gg~6 _You block the spriggan's attack.]gg <  You slash the spriggan!]gg [  You kill the spriggan!]gg9).O   spriggan (]gg; 59/83=---11-4.1 (1.1 _The spriggan hits you but does no damage.]gg]ggW$i _Your Fighting skill increases to level 9!]gg{#J.)...## #~~~~~###  #~~~~~# ##~~~~~###.......##......#..########..#♣ #..# i  #..# ♣#O.#  #.. O.#  #. #.]ggM1.#  #. ♣..# ♣..# #..# #..# #..##]gg?2  You block the two-headed ogre's attack. x2; The spriggan barely misses you.]gg2F-50]gg:]ggA _Your Fighting skill increases to level 9!block the two-headed ogre's attack. x2; The spriggan barely misses you. _You block the ogre's attack.  Things that are here:  a +1 rapier of holy wrath; the quicksilver dragon scales of the Indigo Skies _{rC+ Will+ Stlth+}]ggC  You slash the two-headed ogre!]gg p )O   ogre (polearm)i   spriggan (polearm)  You kill the two-headed ogre!]ggu60/84=29=6]gg]gg? _The spriggan hits you but does no damage.]gg  You slash the spriggan!  The spriggan is heavily wounded.]ggc19==7.0 (0.9]gg]ggS _You block the ogre's attack. You block the spriggan's attack.]gg=~  You closely miss the spriggan.The spriggan is heavily wounded.]ggP5-8.1 (1.1]gg3]gg{S _You block the spriggan's attack. You block the ogre's attack.]gg$  You hit the spriggan.  The spriggan is heavily wounded.-90]gg"]gg%6 _You block the spriggan's attack.]ggk U  You barely miss the spriggan.The spriggan is heavily wounded.280 _The ogre barely misses you. You block the spriggan's attack.]gg  You hit the spriggan but do no damage.The spriggan is heavily wounded.]ggϼ C==1]gg5 ]ggi r _You block the spriggan's attack. The ogre barely misses you.]gg#~~~~~###  #~~~~~# ##~~~~~###.......##..#..########..#♣  #..# )i #..# ]ggT♣#@.# #.. O.# #. #..# #. ♣..# ♣..##..# #..# #..###).##]gg]gg &2]gg- _You block the spriggan's attack.  Things that are here: _a +0 halberd; a +0 halberd]gg8  You slash the ogre!]gg )i   spriggan (polearm)  You kill the ogre!]gg?3/8532=3]gg+$]gg&V _The spriggan closely misses you.]gg    ##~~~~~####.......####.........##..#######..###..#♣ ##..##  #..# ##)i## #..#  ♣#).  ♣ #.]gg♣ ##..##).##...#]gg]ggUU4=-4]gg϶]ggx _You block the spriggan's attack. _You see here a +0 halberd.]ggu Y#### #~~~~~#  ##~~~~~##  ##.......## #.........##  #..#######..##  #..#♣ ##..##  #..###)i##♣#.]gg U♣)# #.♣ #.. #..## #).##]gg ]gg5 @-5]gg ]gg7 _You block the spriggan's attack.  Things that are here: _a +0 halberd; a +0 halberd]gg)d  You barely miss the spriggan.The spriggan is heavily wounded.]ggda10/10===6.0 (0.9]gg2l]ggtn6 _You block the spriggan's attack.]gg  You miss the spriggan.The spriggan is heavily wounded.]gge5=7.1 (1.1]gg]gg}6 _You block the spriggan's attack.]gg< _You block the spriggan's attack.  You miss the spriggan.  The spriggan is heavily wounded. _You block the spriggan's attack.  You barely miss the spriggan.  The spriggan is heavily wounded.]ggH=,80]ggC]ggRF? _The spriggan hits you but does no damage.]gg  You completely miss the spriggan.The spriggan is moderately wounded.]gg-9.2 (1.1]ggI]gg? _The spriggan hits you but does no damage.]ggX  You miss the spriggan.The spriggan is moderately wounded.]ggWZ 58--====90.1 (0.9]ggc ]ggf > _The spriggan hits you with a +0 trident!]gg  You slash the spriggan!  The spriggan is almost dead.1.2 (1.1]ggy ]ggc 6 _You block the spriggan's attack.]gg  You closely miss the spriggan.The spriggan is almost dead.]ggy4-20]gg]ggQ? _The spriggan hits you but does no damage.]gg  You barely miss the spriggan.The spriggan is almost dead.]gge9---3]ggD#]gg(6 _You block the spriggan's attack.]gg  You barely miss the spriggan.The spriggan is almost dead.]ggv-4.1 (0.9]gg]gg  You barely miss the spriggan.  The spriggan is almost dead. _You block the spriggan's attack.  You barely miss the spriggan.  The spriggan is almost dead. _You block the spriggan's attack.]ggb _You block the spriggan's attack.  You barely miss the spriggan.  The spriggan is almost dead. _You block the spriggan's attack.  You miss the spriggan.  The spriggan is almost dead.]gguc-5.1 (1.0]ggk]ggn? _The spriggan hits you but does no damage.]gg :  You hit the spriggan.]gg C)]gg| 6066.2 (1.1 _The spriggan hits you but does no damage.  You hit the spriggan. _You kill the spriggan!Training target 10.0 for Fighting reached!  Your Fighting skill increases to level 10!need to enable at least one skill for training.]gg, /  --more--]ggb]ggLfC  Skill  Level Cost  Apt Skill  Level Cost  Apt ]ggg a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0 ]ggXgz[39;49m  0              ]ggg6 f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0       h - Shields   5.4   6.0   0  ]ggg     i - Stealth   0.0   0.8  +1      ]gg(h            ]ggh                            ]gghYou need to enable at least one skill.[?] Help[=] set a skill target  ]ggi}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets]gg<> h + Shields 5.4]ggTargetTarget--  --  --  --  --  --  --  ]gg14.0 8.0  12.0 10.0 7.0  a-z] set[-] clear selected targetcost|targets]gg W=] set aall targets]gg]gg]gg ###~~~~~###deadiverson the Carver#~~~~~#Human of the Shining One **....##~~~~~##Health: 60/85 ================--------]ggw1##.......##Magic: 10/10 ========================##.........##AC: 15Str: 17#..#######..##EV: 10Int: 11]gg#..#♣ ##..##SH: 13Dex: 14  #..#]gg@##))##XL: 10 Next: 36% Place: a Bailey #..#♣#@.#]ggNoise: =--------  Time: 7796.2 (1.1) #..♣).#a) +0 long sword #.#..#Throw: 5 darts (poison) #.♣..#♣..##..#]gg#..##..##]gg#).## _The spriggan hits you but does no damage.  You hit the spriggan. ]gg_You kill the spriggan!Training target 10.0 for Fighting reached!  Your Fighting skill increases to level 10!You need to enable at least one skill for training.]gg]gg]gg. _]gg .....)...#####~~~~~### #~~~~~ ##~~~~~ ## ##....... #..##### #..#♣..  #..###@)##  #..##).#  #..]gg M ♣).#  #. #..#  #. ♣..# ♣..# #..# #..# #..##]gg ]gg ;-70 _]gg ]gg   Things that are here:  a +1 rapier of holy wrath; the quicksilver dragon scales of the Indigo Skies _{rC+ Will+ Stlth+}]gg2- ]gg/ jPick up what? 21/52 slots (_ for help) Hand Weapons (select all with ))  a - a +1 rapier of holy wrath Armour (select all with [) ]gg10  b - the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+} [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]]ggCy  b + the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}[Enter] accept (1 chosen)]ggb ]gg1m ]ggw  ##.....)...##deadiverson the Carver###~~~~~###Human of the Shining One **....#~~~~~#Health: 60/85 ================--------##~~~~~##Magic: 10/10 ========================##.......##AC: 15Str: 17##.........##EV: 10Int: 11#..#######..##SH: 13Dex: 14#..#♣ ##..##XL: 10 Next: 36% Place: a Bailey#..###@)##Noise: ---------  Time: 7797.2 (0.0)  #..#♣#).#a) +0 long sword#..♣).#Throw: 5 darts (poison)#.#[0;]ggw G10;1m..#  #.♣..#♣..##..##..##..##Training target 10.0 for Fighting reached!  Your Fighting skill increases to level 10! _You need to enable at least one skill for training.  Things that are here:  a +1 rapier of holy wrath; the quicksilver dragon scales of the Indigo Skies _{rC+ Will+ Stlth+}]gg ]ggM \61=8.2 (1]gg: ]gg _c - the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}]gg]gg +Wear which item? Armour (go to first with [)  l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  B - a +0 chain mail (worn)  c - the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}[?] describe selected ]gg [!] equip|wield|wear|put on[tab] equip|unequip ]gg ]gg ]gg%  ##.....)...##deadiverson the Carver###~~~~~###Human of the Shining One **....#~~~~~#Health: 61/85 =================-------##~~~~~##Magic: 10/10 ========================##.......##AC: 15Str: 17##.........##EV: 10Int: 11#..#######..##SH: 13Dex: 14#..#♣ ##..##XL: 10 Next: 36% Place: a Bailey#..###@)##Noise: ---------  Time: 7798.2 (0.0)  #..#♣#).#a) +0 long sword#..♣).#Throw: 5 darts (poison)#.#..[]gg mm#  #.♣..#♣..##..##..##..##Your Fighting skill increases to level 10! _You need to enable at least one skill for training.  Things that are here:  a +1 rapier of holy wrath; the quicksilver dragon scales of the Indigo Skies _{rC+ Will+ Stlth+} _c - the quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+}]gg ]ggl +9.2 (1]gg ]gg' d  You start removing your armour.]gg- -800.2 (2]gg2 ]gg: ]gg: 321.2 (3]gg@ ]ggG ]gggH +2.2 (4]ggN ]ggmT ]ggT +3.2 (5]ggZ ]ggQ\  63 _You continue removing your +0 chain mail. x4]gg] ]ggOc ]ggk  You finish removing your +0 chain mail.  You start putting on your armour.]ggl 334.2 (6]gg%s ]ggz ]gg;{ +5.2 (7]gg ]gg ]gg +6.2 (8]gg ]gg ]ggv Y4=7.2 (9]ggա ]gg ]ggv /8.2 (10.0)]gg ]ggձ 1  You continue putting on the quicksilver dragon scales of the Indigo Skies {rC+ _Will+ Stlth+}. x5]gg ]ggV ]ggȸ ]gg /  --more--]gg  You finish putting on the quicksilver dragon scales of the Indigo Skies {rC+ _Will+ Stlth+}.]gg ]gg FDrop what?22/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 long sword (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (select all with [) ]gg  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)B - a +0 chain mail Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (select all with /)y - a wand of digging (6) Scrolls (select all with ?)  g - 2 scrolls of vulnerability  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silence [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]]ggh(1 turn)  a - a +0 long sword (weapon)  B + a +0 chain mail[Enter] accept (1 chosen)]ggJ]ggԲ ##.....)...##deadiverson the Carver###~~~~~###Human of the Shining One **....#~~~~~#Health: 64/85 ==================------##~~~~~##Magic: 10/10 ========================##.......##AC: 16]gg%wStr: 17##.........##EV: 13Int: 11#..#######..##SH: 13]ggP7Dex: 14#..#♣ ##..##XL: 10 Next: 36% Place: a Bailey]ggy#..###@)##Noise: ---------  Time: 7808.2 (0.0)  ]gg#..#♣#).#]ggųa) +0 long sword#..♣).#]ggThrow: 5 darts (poison)#.#..#  #.]gg♣..#♣..#]ggv=#..##..##..##You finish putting on the quicksilver dragon scales of the Indigo Skies {rC+ _Will+ Stlth+}.]ggX+9.2 (1]ggh]gg' _You drop a +0 chain mail.]gg #~~~~~###  #~~~~~# ##~~~~~###.......##..#..########..#♣  #..# [) #..# ♣#@.# #.. ).# #. ]gg #..# #. ♣..# ♣..##..##..##..###).##]gg]ggy/510]gg]gg d  Things that are here: _a +0 halberd; a +0 halberd]gg-- -   ##~~~~~####.......####.........##..#######..###..#♣ ##..##  #..# ##[)## #..#  ♣#).  ♣ #.]gg- ♣...##...#]gg5 ]gg6 -1 _]gg; ]gg? H _You see here a +0 halberd.]ggx: ####.......####.........##..#######..###..#♣ ##..##  #..# ##[)## #..#  ♣#).  ♣) #♣ #..#...#]gg]gg߁$2 ]gg _]gg]ggN]gg93]gg]gg]gg;6]gg]gg]gg]gg]gg ]gg]ggQ]gg%7]gg]gg],]gg]gg,]ggO]ggr]ggK8=]gg@]gg+]gg]gg]gg]gg:]gg]gg]gg:]ggXN9=]gg]gg,]ggY]gg]gg]gg ]gg-<70]gg]gg+,]ggQ]ggq,]gg]gg]gg*K1=]gg]gg1",]gg#]gg&]gg&]gg )]gg,]gg,U2=]ggx.]gg 1]ggN1]gg'3]gg4]gg4]ggf5]gg6]gg6%3]gg7]gg9]gg79]gg#<]gg4?,]gg?]gguB;4]ggDC]ggD]ggD]ggF]ggI,]gg]gg͗,]gg]ggB,]gg]gg]ggۜD2=]gg]gg,]gg֠]ggP,]gg]gg{k3=]ggr]gg,]ggs]gg+]gg DD   steam dragon (wandering) _You start resting.]gg064.2 (52.0)]gg,5.2 (53]ggT]gg_ _A steam dragon comes into view.]ggl ##.......####..##..#######..###..#♣ ##..##  #..# ##[)## #..#  ♣#).  ♣) #.♣ #]ggDm 3#D.##).## ...#...#....#]ggCp ]ggz VD.]ggz 946.2 (1.0)]ggȂ ]gg4 ]ggk 9##..##..#######..###..#♣ ##..##  #..# ##[)## #..#  ♣#).  ♣) #.]gg ♣ #D#..##)]gg .##...# .]gg 2...####]gg !#]gg/ ]gg' D.D]gg' /==7]gg. ]gg1 6 _The steam dragon hisses angrily.]gg  (catching breath)You hit the steam dragon.  ]ggC QThe steam dragon is moderately wounded.]gg ***  The steam dragon breathes steam at you.]ggpG#.#####).#♣).#§§§§@]ggHG======8]ggP]gg!SS _The ball of steam misses you.]gg (catching breath)You barely miss the steam dragon.The steam dragon is moderately wounded.You are engulfed in a cloud of scalding steam.]ggF ***  The steam dragon breathes steam at you.]gghs§§@]ggiY65-----9]gg=q]gg]s1 _The ball of steam hits you!]ggD  You slash the steam dragon!  The steam dragon is severely wounded.You are engulfed in a cloud of scalding steam.]gg^==----70]gg~ ]ggF" _The steam dragon barely misses you. The steam dragon misses you.]gg;  (catching breath)You slash the steam dragon!  The steam dragon is almost dead.]gg ***  The steam dragon breathes steam at you.]gg~##§#.#§.]ggd§.@]gg p55--------======]gg 1]gg(]gg*1 _The ball of steam hits you!]gg8: .You barely miss the steam dragon.The steam dragon is almost dead.You are engulfed in a cloud of scalding steam.2----=-----2]ggA]ggC _The steam dragon completely misses you. You block the steam dragon's attack.]gg 9 ♣§.You hit the steam dragon but do no damage.The steam dragon is almost dead.You are engulfed in a cloud of scalding steam.]gg5 D-----3]gg ]gg) = _You block the steam dragon's attack. x2]ggb  ♣§§§§  You hit the steam dragon.  The steam dragon is almost dead.You are engulfed in a cloud of scalding steam.]gg7c -4.1 (0.9]ggg ]gg j  _The steam dragon closely misses you. You block the steam dragon's attack.]ggw  You hit the steam dragon.  You kill the steam dragon!]gg #.###§♣)...[.]ggl3-405.2 (1.1]gg͞]ggСH _The steam dragon scales are intact enough to wear.]gg; ..#######..###..#♣ ##..##  #..# ##[)## #..#  ♣#§.  ♣) #.♣ #.#..#......####)-60]ggC  Things that are here: _+0 steam dragon scales; a steam dragon corpse]gg|ZE #..#♣ ##..###..# ##[)## #..#  ♣#).  ♣) #.♣ #[#..##).## ......#]ggub]ggWcG-7 _]ggj]ggDl]gg ]ggD ]gg#" ]gg[% ]gg% S4=]ggd* ]gg+ ]gg+ ]gg. ]gg1 ]gg1 ]gg4 ]gg\7 ]gg7 #5]gg7 (=]gg: ]gg> ]gg> ]ggA ]ggD ]ggD ]ggE ]gg H ]ggtH 96]ggyJ ]ggtN ,]ggP ]ggGV ,]ggX ]gg.[ ]gg{[ #7]gg[ 0=]gg] ]gg` ]gg` ]ggb ]ggf ,]ggh ]ggk ]ggk K8=]gg^n ]ggq ]ggBq ]ggsr ]ggs ]ggt ]gg3u ]ggv ]gg"w #9]gg}w ]ggIx ]gg?{ ,]gg| ]ggR ,]ggh ]gg ]gg :60]ggb ]gg݈ ,]gg ]ggv ]gg 861=]gg ]ggΒ ]gg ]gg ]gg ]gg˜ ,]gg ]gg ]ggܝ %2]gg 2=]gg ]gg, ]gg\ ]gga ]ggѭ X]gg[ %3]ggt ]gg ,]gg* ]gg ,]gg ]gg ]gg@ K4=]ggH ]gg ,]gg ]gg, ]gg_ ]ggw ]ggx ]gg U5=]gg ]ggz ,]gg ]gg ,]gg ]gg ]gg@ %6]gg ]gg ,]ggX ]gg ,]ggT ]gg ]ggS %7]gg ]gg ,]gg* ]gg ,]gg  ]ggt ]gg D8=]gg ]ggY ,]gg ]gg  ,]gg ]gg 99]gg 2=]gg ]gg ,]gg ]gg ,]ggh ]gg- ]ggj &70]ggO" ]gg$ ]gg,$ ]gg % ]gg& ,]gg' ]gg) ]gg) K1=]ggj+ ]gg, ,]gg. ]gg/ ,]gg1 ]gg4 ]gg34 U2=]gg5 ]gg7 ,]gg8 ]gg9 ,]gg; ]gg2> ;3]gg@ ]gg[F ,]ggG ]gg5K ,]ggL ]ggJN ]ggzN %4]ggOO ]ggP ,]ggR ]ggS ]ggS ]ggU ]gg4Y ]gg6Z D5=]gg\ B]gg] ]gg_ ,]ggKa ]ggc k6=]ggf ]gg^i ,]ggj ]ggl ,]ggm ]ggao ;7]ggp ]ggs ]ggs ]ggt ]ggFv ]ggv ]ggv D8=]ggx ]ggg| ,]ggb} ]gg ,]ggf ]ggU ]gg U9=]gg ]gg^ ,]gg ]gg ,]gg+ ]gg ]gg &80]ggp ]ggt ,]gg ]gg ,]gg- ]gg ;1]ggN ]gg ,]gg ]gg ,]gg ]gg ]gg5 K2=]ggG ]gg ]gg ]gg1 ]gg ]gg ]gg ]gg ]ggʹ #3]gg 2=]gg1 ]gg ,]ggF ]gg ]gg ]gg@ ]gg\ ]gg %4]gg ]gg ,]ggU ]gg ]gg ]gg/ ]gg _ _You start resting.]gg 1968.2 (91.0)]ggE Z5=9.2 (92]ggW ]gg " _HP restored.]gg ##[)## ♣#).#  #.. ♣).#  # #..#  #. ♣..# ♣..# #[.##..#]gg]#@.##).....#### ]gg+]gg270.2 (1.0)]gg^]gg]gg1b- ♣#).# #.. ♣).# # #..#  #. ♣..# ♣..# #[.#]ggb$#..###..##.~~~.........##### ]ggqj]ggj&1]gg;p]gg9t  Things that are here: _a +0 halberd; an ogre skeleton]ggx #.. ♣).# # #..# #. ♣..# ♣..# #[.#]gg#..##..###♣#~####)..~~~.....###### ]ggN]gg1-2 _]gg]ggM]gg) \ #.. ♣).# #. #..# #. ♣..# ♣..# #[.# ##..# ##..##]gg ##♣#~####).##.~~~.@..##.###.####]gg ]gg B=3]gg ]gg ]gg5  #.. ♣).# #. #..# #. ♣..#. ♣..#.. #[.#..♣ ##..#.. ##..##.##♣#~####).##]ggJ6 $.~~~@...###.###.##  #]gg= ]gg> &4]ggNC ]ggD ]gg # #..# #. ♣..# . ♣..# .. #[.# ..♣♣♣ ##..# ... ##..##..##♣#~####)#....~~~... #..... ## ####### ]ggM ]ggH]gg&5]ggm#]gg$]ggoK #. #..# #. ♣..# . ♣..# .. #[.# ..♣♣♣♣ ##..#. .... ##..###..##♣#~####).## #....~~~....## #.## ##.## #]ggw]ggew]ggw6]ggA}]gg]ggt #. #..# #. ♣..# . ♣..# .. #[.#. ..♣♣♣♣♣ ##..##.. .... ##..## #..##♣#~####).## #....~~~....##]gg* #.## ##.## #]ggر]ggM&7]gg]gg]gg5"- #. #..# #. ♣..## ..♣..##. ....#[.##.. ..♣♣♣♣♣. ##..# #.. ..... ##..## #..##♣#~####).##]gg"R #....~~~....## #.## ##.## #]gg)]gg)&8]gg,]gg.]ggMa #.. ♣).# #. #..# #.  ♣..# #  .♣..#]ggƋ #. .. ..#[.#..♣♣♣♣♣. ##..# ..... ##..####♣#~####).##~~~....##..##.......###########]gg]ggl&9]gg]ggX]ggM #.. ♣).# #. #..# #. ♣..# #. . .♣..# #.. .. ..#[.# #..# ..♣♣♣♣♣. ##..# #..♣ ..... ##..##]gg\Ni #..##♣#~####).## #.@..~~~....## ##.## ##.## ##]ggoT]ggT'80]ggX]ggZ]ggk ]ggKl 3]ggUn ]ggo ]ggHo ]ggu ]ggu ]ggJv ,]ggv ]ggx ]gg z ,]ggz ,]gg{ ,]gg{ ]gg} ]gg ~ ]ggL~ ]gg ]ggƀ ]gg ,]ggg ]gg ]gg ]ggۄ ]gg] ]ggц ]gg ]gg. ]gg ]ggG ]gg ,]gg ]gg ]ggҌ ]gg ]gg׍ ]ggl ]ggs ]gg ]gg ]ggz ]ggL ]gg ]gg ]gg ]gg٘ ,]ggl ]ggZ ]ggm ]gg ]gg ]gg ]gg) ,]ggk ]gg ]gg] ,]ggΨ ]gg2 ]gg7 ,]ggë ]gg. ]gg{ ,]gg ]ggC ]ggE ,]gg˱ ]gg( ]gg6 ,]ggѴ ]gg) ]gg ,]ggQ ]ggĹ ]ggܺ ]gg ]gg ]ggȼ ]gg ,]ggF ]gg ,]gg, ]gg ]gg ]gg` ,]gg ]gg ]gg ,]gg ]gg ]gg A  You enter the shallow water.]ggK *Water ]ggm ]gg` ]gg N _Moving in this stuff is going to be slow.]ggt 4]ggX ]gg ]ggT ]ggw !]ggx ]gg ]gg ]ggF ]gg ]gg% ]gg< ,]ggx ]ggm ]ggr ,]gg ]ggN ]gg_ B]gg ]ggg ]gg ]ggY ]gg ]gg ]gg9 ]gg ]gg ]gg ]gg ]gg ]ggY ]gg ]ggA ]ggO ]ggy ]gg ,]gg{ ]ggf ]gg ]gg ]gg ]gg<$ ]gg8' ]ggk' ]gg-) ]gg, ]gg0 ]gg1 ]ggT6 ]gg9 ]ggG ##.....)...## ##~~~~~###  #~~~~~#  ##~~~~~## ##.......## ##.........## ##..#######..## ##..#♣.....##..## ##..#♣...@...##[)## 8024.4 (44.2)]ggH G#..##..♣#~♣♣..♣#).# #..#. ♣...♣♣..♣).#..♣ ♣÷.≈.÷♣..#..##..# #?≈≈≈!#..♣..##..#. ♣!?≈)!♣..♣..##..#..♣♣?.?♣♣..#[.##..#♣..♣♣♣♣♣..##..###..♣#.......##..##]ggT ]ggT ,5.4 (45]gg] ]gg'_ $ _Found a spear.]gg? ]gg ]gg ]gga& ]gg,  You enter the shallow water.Water ]ggJ1 ]gg|5 N _Moving in this stuff is going to be slow.]ggf: <]gg= ]ggB ]ggH ]ggI ]ggL ]ggR D  There is a cache of fruit here.]ggrY ]ggkZ  _]ggn[ ]ggb w##.......## ##.........## ]gg c ##..#######..####..#♣.....##..####..#♣.......##[)###..##..♣#~♣♣..♣#).#]gg@c #..#. ♣♣...♣♣..♣).#..♣ ♣÷.≈.÷♣..#..# #..# #?≈≈≈@#..♣..# #..#. ♣!?≈)!♣..♣..# ]ggqc #..#..♣♣?.?♣♣..#[.# #..#♣..♣♣♣♣♣..##..###..♣#.......##..####..##♣#~####).#]ggc ##....~~~....## ##.........## ##.......##]ggk 230.0 (4.6)]gg#l +1.0 (5]ggx ]gg{ Z _h - a bubbling ruby potion]ggJJ]ggJ]gg;M]ggT]ggoW,]gg[]ggE` ##..####..#######..####..#♣.....##..####..#♣.......##[)##..##..♣#~♣♣..♣#).]gg`^. ♣♣...♣♣..♣)♣ ♣÷.≈.÷♣..#.# #?≈≈≈.#..♣. ♣!?≈)@♣.♣♣?.?♣♣..#[♣..♣♣♣♣♣..##.#########]ggg-2.0 (1.0]ggfh+3.0 (2]ggp]gg)r2 _i - a potion of cancellation]gg,x]ggx]gg%|]gg]gg.]gg,]ggM#######..###♣.....##..##.......##[)## #..##..♣#~♣♣..♣#).#]gg& #..#. ♣♣...♣♣..♣).# #..♣ ♣÷.≈.÷♣..#..# #..# #?≈≈≈.#..♣..#]gg% #..#. ♣!?≈).♣..♣..# #..#..♣♣?.@♣♣..#[.# #..#♣..♣♣♣♣♣..##..# ##..♣#.....]gg׌# ##..##♣#~####) ##....~~~... ##..... ##]ggP ####### ]ggU+4.0 (1]ggړ+5.0 (2]ggΛ]gg0c _j - a scroll labelled JURAENK HUSIE]ggkw3]gg{]gg]gg>]gg]ggP]ggҋ]gg,]gg<]gg,]gg?]ggI$ ]gghK_m - 3 scrolls of fear (gained 1)]gg]gg,]ggF]ggZ ##.........## ##..#######..## ##..#♣.....##..## ##..#♣.......##[)## #..##..♣#~♣♣..♣#).#]gg! #..#. ♣♣...♣♣..♣).# #..♣ ♣÷.≈.÷♣..#..# #..# #?≈≈≈.#..♣..#]gg #..#. ♣!@≈).♣..♣..#]gg٩ #..#..♣♣...♣♣..#[.#]gg  #..#♣..♣♣♣♣♣..##..# ##..♣#.......##..## ##..##♣#~##]gg!Z##).## ##....~~~....##]ggB\ ##...## ##....]ggb...###########]gg]gg+9.0 (4]ggC,40.0 (5]gg]ggS _o - a scroll of fog]gg6r ]ggr ]ggwt ]ggw ]gg(z ]ggjz ]gg~ ]gg ]gg& ]gg^ ]ggΆ $ ]gg Q_h - 2 bubbling ruby potions (gained 1)]ggɈ ]gg ]gg ]gg* B]ggX n _o - 2 scrolls of fog (gained 1)]gg ]gg, ]gg5 ]gg9 ]gga ,]gg ]gg ]gg %  ]gg You enter the shallow water.]gg *Water ]gg% ]gg ]gg N _Moving in this stuff is going to be slow.]gg ]gg ]gg ]gg? ]ggˮ 0]gg{ ]gg ]ggQ ]ggv ]gg ]gg  ###~~~~~### #~~~~~#  ##~~~~~##  ]gg ##.......##  ##.........##  ##..#######..# ##..#♣.....##..##]gg!  ##..#♣.......##[)##]gg?  #..##.@♣#~♣♣..♣#).#50.6 (10.6)]gg^ #..#..♣♣...♣♣..♣).#]gg = #..♣..♣÷.≈.÷♣..#..# #..#..#.≈≈≈.#..♣..#]gg  #..#..♣..≈).♣..♣..#..#..♣♣...♣♣.]gg .#[.##..#♣..♣♣♣♣♣.]gg b.##..###..♣#....##..####..##♣#~]gg :####).##]gg ]gg ]gg  ]gg 7_Done exploring.]gg;2 3]gg:3 ]ggH ..~0.0).....]ggH ]ggO ]gg\Q E _Done exploring.]ggn3]gg]gg4]gg]gg E _Done exploring.]gg@]ggRead which item? Scrolls  g - 2 scrolls of vulnerability  j - a scroll labelled JURAENK HUSIE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise ]gg x - a scroll of teleportation [!] read|quaff|evoke[?] describe selected]ggC]gg5]ggUh###~~~~~###deadiverson the Carver#~~~~~#Human of the Shining One **....##~~~~~##Health: 85/85 ========================##.......##Magic: 10/10 ========================##.........##AC: 16Str: 17]gg.##..#######..##EV: 13Int: 11##..#♣.....##..##SH: 13Dex: 14##..#♣.......##[)##XL: 10 Next: 40% Place: a Bailey#..##.@♣#~♣♣..♣#).#Noise: ---------  Time: 8050.6 (0.0)#..#..♣♣...♣♣..♣).#a) +0 long sword#..♣..♣÷.≈.÷♣..#..#Throw: 5 darts (poison)#..#..#.≈≈≈.#..♣..#]gg#..#..♣..≈).♣..♣..##..#..♣♣...♣♣..#[.##..#♣..♣♣♣♣♣..##..###..♣#.......##..####..##♣#~####).## _o - 2 scrolls of fog (gained 1)  You enter the shallow water. _Moving in this stuff is going to be slow. _Done exploring. ]gg*f_Done exploring. _Done exploring.]ggw"  As you read the scroll labelled JURAENK HUSIE, it crumbles to dust.  Wisps of shadow whirl around you...]gg<>* g.ggoogoggo   orc warrior (polearm, summoned)]gg>o   orc wizard (summoned, wandering)gggggg 6 gnolls (2 polearms, summoned, 2…)o   orc (summoned)Your orc priest dissolves into shadows!]gg?+1.6 (1]gg(G]gg0Q3 _It was a scroll of summoning.]gg3]gg]ggG<0]gg]ggE _Done exploring.]ggB ]gg A bailey∩∩(Press ? for help) #....∩)).∩....#  ##....)......##  ##.....)...##  ]gg ###~~~~~###  #~~~~~#  ##~~~~~##  ##.......##  ##.........##  ##..#######..##  ##..#♣g.g..##..## ]gg K ##..#♣.go....##[)##  ]gg= #..##o@♣#~♣♣..♣#).#  #..#g.♣♣...♣♣..♣).#  ]gg^ #..♣og♣÷.≈.÷♣..#..#  #..#..#.≈≈≈.#..♣..# ]gg} Q #..#..♣..≈).♣..♣..#  ]gg c#..#g.♣♣...♣♣..#[.#  #..#♣..♣♣♣♣♣..##..# ]gg c ##..♣#.......##..##  ##..##♣#~####).##  ]gg :##....~~~....##  ##.........##  ]gg )##.......##]ggS.@]ggp A.#]gg @..]ggIb @#.]gg @##]ggw @##]ggRX {  ##...........##.#]ggQ4y  ##.........##..]gge  ###.....###∩.]gg]ggh###~~~~~###deadiverson the Carver#~~~~~#Human of the Shining One **....##~~~~~##Health: 85/85 ========================##.......##Magic: 10/10 ========================##.........##AC: 16Str: 17]gg##..#######..##EV: 13Int: 11##..#♣g.g..##..##SH: 13Dex: 14]gg P##..#♣.go....##[)##XL: 10 Next: 40% Place: a Bailey]ggp#..##o@♣#~♣♣..♣#).#Noise: ---------  Time: 8051.6 (0.0)#..#g.♣♣...♣♣..♣).#a) +0 long sword#..♣og♣÷.≈.÷♣..#..#Throw: 5 darts (poison)]gg#..#..#.≈≈≈.#..♣..##..#..♣..≈).♣..♣..#]gg#..#g.♣♣...♣♣..#[.#o   orc warrior (polearm, summoned)#..#♣..♣♣♣♣♣..##..#o   orc wizard (summoned, wandering)##..♣#.......##..##gggggg 6 gnolls (2 polearms, summoned, 2…)##..##♣#~####).##o   orc (summoned) _Done exploring.  As you read the scroll labelled JURAENK HUSIE, it crumbles to dust.  Wisps of shadow whirl around you...  Your orc priest dissolves into shadows! _It was a scroll of summoning. _Done exploring.]gg]gg]gg{]ggb]gg0]gg]gg $ _]gg. ]gg]gg9 ]gg;%]ggT(]gg-]gg0]gg5,]gg9]ggC5 _You swap places.]gg8K]ggL]ggP]ggU]ggY]gg[]gg[]gg$^]ggfi5 _You swap places.]ggq]gg8u]ggx]gg|]gg]gge]gg+]ggb]gg]gg^]gg]gg]gg]ggƢ]gg ]ggx]gg ]ggJ]gg0]gg]gg8]gg]gg]gg1,]gg]gg]gg]gg]gg]gg]gg]gg ,]ggp]ggg]gg]gg]gg]ggP]gg ]gg3 ]gg9 ]gg_]gguA  You enter the shallow water.]gg!]gg%]gg=)]ggI-]gga1]gg1*Water ]gg1]gg5]ggz:N _Moving in this stuff is going to be slow.]ggB4]ggC]ggwE]gg..  ## #.......#..)# ]ggP4]gg-9.4 (1.8]gg3 _Welcome back to the Dungeon! Your summoned allies are left behind. _There is an empty arch of ancient stone here.]ggnDungeon Crawl HelpManual Contents Press one of the following keys to*Table of contents obtain more information on a certain A.Overview aspect of Dungeon Crawl.B.Starting Screen ?: List of commandsC.Attributes and Stats ^: Quickstart GuideD.Exploring the Dungeon :: Browse character notesE.Experience and Skills #: Browse character dumpF.Monsters ~: Macros helpG.Items &: Options helpH.Spellcasting %: Table of aptitudesI.Targeting /: Lookup descriptionJ.Religion Q: FAQK.Mutations V: Version information]ggL.Licence, Contact, History !: Display diagnosticsM.Macros, Options, Performance Home: This screenN.Philosophy1.List of Character Species2.List of Character Backgrounds3.List of Skills4.List of Keys and Commands5.Inscriptions6.Dungeon sprint modes]gg:|Movement: Game Saving and Quitting: To move in a direction or to attack, S: Save game and exit use the numpad (try Numlock off andCtrl-S : Save and exit without query on) or vi keys:Ctrl-Q : Abandon the current character 7 8 9 y k u  and quit the game \|/\|/ 4-5-6h-.-lPlayer Character Information: /|\ /|\@ : display character status 1 2 3 b j n]ggm : show skill screen % : character overview Rest: ^ : show religion screen . : wait a turn (also s, Del)A : show Abilities/mutations 5 : rest and long wait; stops when\ : show item knowledge  Health or Magic become full orM : show your spell library  something is detected. If Health } : show runes collected  and Magic are already full, stops [ : display worn armour  when 100 turns over (numpad-5)" : display worn ]ggjewellery$ : display gold in possession Extended Movement:]gg?E : display experience info o: auto-explore G]gg4: interlevel travelDungeon Interaction and Information: Ctrl-F : Find itemsO/C : Open/Close door ]gg[Ctrl-W : set Waypoint</> : use staircase / Dir., Shift-Dir.: long walk]ggS;: examine occupied tile and^gg?^ggI^ggkR#. ##.....deadiverson the Carver######.#......(Human of the Shining One **......[..............##. Health: 85/85 ========================............. ...##. Magic: 10/10 ========================.......... ....#. AC: 16Str: 17~≈~...# #.#.#. EV: 13Int: 11#####~...# #.#... SH: 13Dex: 14#...#~..######.##.. XL: 10 Next: 40% Place: Dungeon:7#.@..~............. Noise: ---------  Time: 8089.4 (0.0)#...#~............. a) +0 long sword#####≈.[37^gg@Sm............ Throw: 5 darts (poison)~~~≈~........##................##...#.##..........##... . #.##........#... ... #.........>.. ## #.......#..)# You enter the shallow water. _Moving in this stuff is going to be slow.  There is a gate leading back out of this place, spattered with blood here. _You see here a +0 glaive. _Welcome back to the Dungeon! Your summoned allies are left behind. _There is an empty arch of ancient stone here.^gg;Z^ggZ^ggMd^gg ^ggU ^ggl ^gg  _Moving in this stuff is going to be slow.  There is a gate leading back out of this place, spattered with blood here. _You see here a +0 glaive. _Welcome back to the Dungeon! Your summoned allies are left behind. _There is an empty arch of ancient stone here.Unknown command.^gg^gg?^gg^ggU^gg(^gg$ _^gg,^gg^gg^gg^gg^ggA  You enter the shallow water.^gg@Water ^gg^gg?N _Moving in this stuff is going to be slow.^gg <^gg^gg^gg0^gg^gg^gg$,^gg0&^ggA)^gg/,^gg0^gg2^gg5,^gg6^gg&8^gg>^gg]>^gg@E^gg&J#.§§.§§§......... #..§§§...........# ##.g...........#.#. ##.....#^ggyJ#.. §§ ############..#.#P..P.  #.. ..§..  #.###..... ##########.#......( ^ggJ|......[@...##^ggJ...........#...####..........#^ggJo..#.~≈~~~≈~...#####.#.#...:~#####~...# #.^gg"K....~#...#~..######.##.... #.∩..~..........^ggvK.... #...#~.....#####≈......^ggR #.§§.§§§. #..§§§.# ##.g.#.#. ##.....#......#.. §§ #..#.#P..P. #.. ..§.. #.###.....^ggSSO#.#......(.@...##...#...###...#^ggSi.#.~≈~~~≈~...#####.#.#.:~#####~...# #.#^ggSM.~#...#~..######.##.~#.∩..~.≈#...#~. #####≈^ggO_.99.0 (9.6^gg_1100.0 (10.6)^gg2d^ggi _You see here the +1 robe "Rucaif Ixti" {+Inv rF- rCorr Dex+5}.^gg 3^gg( ^ggH ^gg ^gg : _^ggj ^gg ,^ggh ^gg) ^gg ,^ggx ^gg1 ^ggK ,^gg ^gg  ############..#.#P..P. #.. ..§.. #.###.....^gg`  #############.#......( .........[.............#..................#..######........................#.~≈~~~≈~...#####.~#####~...# #.~#...#~..######.........~#.∩..~......≈#...#~.........##..##..≈#####≈.......^gg  ##. ...~~~~~≈~........# # ..........# .....#.##..# . #.##You pick up Maxwell's Memoranda and begin reading...^gg 14.0 (4.0)^ggk +5.0 (5^gg ^ggQ  You add the spells Maxwell's Portable Piledriver, Magnavolt and Maxwell's _Capacitive Coupling to your library.^ggI 3^gg! ^gg( ^gg&  #.. ..§.. #.###.....#############.#......( .........[...... #.......########...........#.~≈~~~≈~...#####...~#####~...# #.~#...#~..######.~#.∩..~........≈#...#~###..##..≈#####≈ ##. ...~~~~~≈~ # .......... h   black bear (asleep) .....#.##. ..h##..##.##. ... #^gg+ u 0  A black bear comes into view.^gg?4 zhh.^gg4 4==6.0 (1^gg; ^gg> 4 _The black bear growls angrily. ^gg!P #..  #######( ...[... #........... #######........ .......#.~≈~~ .........~#  .......@.~# ^ggP .........~#.∩ .........≈# ###..##..≈# ##. ...~~ # ...... ..h..#.# ...##..# ...  ^ggj #..  #######( ...[... #........... #######........ ^ggh .......#.~≈~~ .........~#  .......@.~# .........~#.∩ .........≈# ###..##..≈# ##. ...~~ # ...... ^gg..h..#.# ...##..# ...  ^gg ^gg  ^gg@ ^ggla _A black bear is nearby! ^gg #..  #######( ...[... #........... #######........ .......#.~≈~~ .........~#  .......@.~# ^ggy .........~#.∩ .........≈# ###..##..≈# ##. ...~~ # ...... ..h..#.# ...##..# ...  ^gg" ^ggM#..  #######( ...[... #........... #######........ ^ggۂ.......#.~≈~~ .........~#  ^gg .......@.~# .........~#.∩ ^gg9.........≈# ###..##..≈# ^ggh##. ...~~ # ...... ..h..#.# ^gg ...##..# ...  ^gg݌ ^gg[ ^gg ^ggʗa _A black bear is nearby! ^ggm###...#############.#......(.........[...... #.########..........#.~≈~~~≈~...#####..~#####~...#  ^gg.~#...#~..#####∩..~........≈#...####..##..≈#####≈ ##. ...~~~~~≈~ # .......... ..h..#.##...##..##.#####.# ..... ##  ^ggu ^ggI:h. ^ggp6--7 _ ^gg ^gg ^ggK((( ^ggw ^ggx..h( ^ggvx--8.2 (1.24 ^gg ^ggۘW _You throw a poisoned dart. The poisoned dart hits the black bear. ^gg\D ((((((You throw a poisoned dart. ^ggG ^gg ^ggih.... ^gg]9.3 (1.13 ^gg? ^ggDe _The poisoned dart barely misses the black bear. ^ggs  ^gg f  You throw a poisoned dart. The poisoned dart hits the black bear. ^ggZ a=10.42 ^gg  ^gg w _You block the black bear's attack. x2; The black bear misses you. ^ggz  You hit the black bear.  The black bear is lightly wounded.  You block the black bear's attack. x2 ^gg%| (1.5 ^gg  ^gg; B _The black bear claws you but does no damage. ^ggblock the black bear's attack. x2 _The black bear claws you but does no damage.  The black bear barely misses you.   ^gg,20 ^ggU ^gg8 _You block the black bear's attack. ^gg:  You slash the black bear!  The black bear is heavily wounded.The black bear bites you but does no damage. ^ggi=.=3 ^ggD ^ggGz _The black bear barely misses you. You block the black bear's attack. ^gg{ bite _The black bear barely misses you. You block the black bear's attack.hit the black bear.  The black bear is severely wounded.You block the black bear's attack.  The black bear claws you but does no damage. ^ggc5-4.4 (0.9 ^gg ^gg8 _You block the black bear's attack. ^gg   You hit the black bear but do no damage.The black bear is severely wounded.The black bear barely misses you. You block the black bear's attack. ^ggG-5.4 (1.0 ^gg ^ggW _The black bear barely misses you. ^gg >  You slash the black bear! ^ggi f( ^ggt =3=6.5 (1.1 ^gg_  ^gg* N _You kill the black bear! ^ggJ  ^gg  ^gg  ^gg H _No target in view! ^gg ^gg ^gg< ^gg" ^gg~ ^gg: _ ^gg;  f - 3 poisoned darts (gained 1) ^gg ^ggf _You see here a black bear corpse. ^gg  ^gg  ^gg  ^gg  ^ggw ^gg ^gg ^ggJ ^ggK ^gg ^gg@ ^gg ^gg ^gg ^gg!$  ^gg"J_f - 4 poisoned darts (gained 1) ^ggO$3 ^gg$ ^ggF' ^gg@* ^ggo* ^gg$+ ^gg, ^gg/ ^gg0 ^gg0 ^gg5, ^gg\> ^ggOQ _f - 5 poisoned darts (gained 1) ^ggP ^ggQ ^gg4TB ^ggU ^gg)Y, ^gg~Y ^gg[ ^gg^, ^gg^_ ^gg` ^gg-c, ^ggc ^ggDe ^ggg, ^ggVh ^ggji ^gg:l, ^ggFm ^ggn ^ggq, ^ggq ^ggs ^ggxu ^ggu ^ggu ^ggw ^ggXy ^ggy ^ggy ^gg { ^gg| ^ggA} ^gg} ^gg~ ^ggɀ ^gg ^gg ^gg! ^ggB ^gg ^gg5, ^gg ^gg  ^ggˌ ^gg ^ggF ^ggS ^gg, ^gg# ^ggL ^gg , ^ggr ^ggn ^gg, ^gg% ^ggu ^ggũ, ^ggG ^ggL ^ggr ^gg ^gg ^ggG ^ggѵ, ^gg, ^gg ^gg, ^gg% ^ggY ^ggY ^gg ^gg ^gg# ^gg, ^gg ^gg ^ggH, ^gg ^gg ^gg, ^gge ^gg  ^gg, ^gg ^gg ^gg, ^gg  ^gg ^ggF, ^gg ^gg  Things that are here:  a +0 club; a +0 spear; a goblin skeleton ^gg9% ^gg% _ ^gg* ^gge-=  You see here a +0 spear. ^gg2 ^gg3 _ ^gg@5 ^gg=  Things that are here:  a +0 club; a +0 spear; a goblin skeleton ^ggYB ^ggB _ ^ggE ^ggJ ^gggQ, ^ggU ^ggTY ^gg^, ^gga ^ggjY  Things that are here:  a +0 robe; a +0 halberd ^gg(o5 _ ^ggfq ^ggt ^ggz, ^gg| ^gg<L......................#... ........................## .....##....###### .....##......:....## .....##...........# ......#...........#  ^gg.......>..........# .....#..)###..###[# .........))##.#.@.####. -- ###.....##))..[......... ####..Pß##.##........... 5  ^gg.....ß..............###. ######...#....############.#######  ^gg] ............#... ..................##............########......:....####...........# #...........# .>..........# #..)###..###@# ........))##.#...####. .....##))..[......... ###..Pß##.##.... ....ß..............###. #####...#....############.####### ^gg064.5 (48.0) ^ggG--5.5 (49 ^ggA ^gg  Things that are here: _a +0 robe; a +2 flail ^ggR ^gg ^gg ^ggG ^gg ^gg|$ _ ^gg ^gg ^gg%{###......###### ##......:....## ##...........# ...........# .>..........# #..)###..###[# P.))##.#...####.... #.....##))..[...@......z ##..Pß##.##............. ...ß..............###...#...#....####### .  #####.#### ###  ^ggJz   wight (dormant)  ^gg16.5 (1.0) ^gg2+7.5 (2 ^gg ^ggis _A wight comes into view. It is wielding a +0 flail. ^ggD ~ ...... :....##....#...#>..#)###..###[# P ))##.#...####.... ))..[...@......z ##............. .........###... ...####### .   ^gg  X#### ### ^gg  ...... :....##....#...#>..#)###..###[# P ))##.#...####.... ))..[...@......z ##............. .........###... ...####### .  ## ###  ^ggg  ^gg  ^gg  ^gg \ _A wight is nearby! ^gg@ ...... :....##....#...#>..#)###..###[# P ))##.#...####.... ))..[...@......z ##............. .........###... ...####### .  #### ### ^gg| ...... :....##....#...#>..#)###..###[# P ))##.#...####.... ))..[...@......z ##............. .........###... ...####### .  ## ###  ^gg ^gg ^gg, ^gg\ _A wight is nearby! ^ggZ## ##............###### ##......:....## ##....# #...# >..# P#..)###..###[# PP.))##.#...####. .....##))..[.z..Pß##.##.ß.###....#....# ..#####.#### .### z 2 wights (dormant) ^ggj, ^ggZvzz..zz ^ggw+8.5 (1 ^ggF ^gg5u _A wight comes into view. It is wielding a +0 war axe. ^gg%## ##.###### ##......:....## ###.# ..#.# ...>.# .ßPß .#..)###..###[# .PP.))##.#...####...z.##))..[. ^gg^&z..[ ..Pß##.##.ß.###....#....####### .  #####.#### ..### ... ^gg, ^gg/ ^ggg<Q.z ^gg<9 ^ggF ^ggK- _Found a leather armour.^ggA .## ..##.###### ..##......:....## # ..##.# ...#.# ....>.# .ßPß ..#..)###..###[# .PP...))##.#...####.......##))..[^gg:B q.zz..[ #..Pß##.##. ..ß.###.....#...#....####### .... #####.#### ... ### .. .^ggH ^ggI ^gg[ 5zz.^gg[ '70^ggg ^gg}k ^gg{ .##.##............######.##......:....## #.##....# ...#...# ....>..# .ßPß.#..)###..###[# .PP...))##.#...####...... #.....##))..[.zz...[#..Pß##.##..ß^gg .###.....#...#....# ... #####.#### ... ### ..  .^gg ^gg ^gg 5zz.^gg &1^gg ^gg ^ggq^.##.##............######.##......:....## #.##.....# ...#....# ....>...# .ßPß.#..)###..###[# .PP...))##.#...####...... ##.....##))..[..@...zz....[#..Pß##.##..ß^ggr.###.....#...#....# .... #####.#### ... ### ..  .^ggz^ggz^gg.5zz.^gg†&2^gg^ggI^gg>.##.##......######.##......:....## #.##....# ...#...# ....>...# .ßPß.#..)###..###[# .PP...))##.#...####......^ggR#.....##))..[.@...zz.....[#..Pß##.##..ß.###.....#...#.# .... #####.#### ... ### ..  .^gg^gg^ggw5zz.^gg&3^gg0^ggj^ggU7.##.##...######.##......:....## #.##.....# ...#...........# ....>..........# .ßPß.#..)###..###[# .PP...))##.#...####......#.....##))..[@...zz......[#..Pß##.##..ß.....###.....#...#..# ....  #####.#### ...^gg38 ### ..  .^ggRzz.4^ggW^gg[^gg.##.##............######.##......:....## #.##...........# ...#...........# ....>..........# .ßPß.#..)###..###[# .PP...))##.#...####......^gg#.....##))..@...zz.[#..Pß##.##..ß......###.....#...#...# ....  #####.#### ... ### ..  .^gg^gg^gg<zz.^gg(5^gg-!^gg&j  Things that are here: _a +0 robe; a +0 halberd^gg T ^ggT w.##.##......######.##......:....## #.##...........# .. #.#...........# ... #^ggGU 9.>..........# .ßPß #.#..)###..###[# .PP.. #.))##.#...####......#.....##)).@[..zz.[#..Pß##.##..ß......^ggU R.###.....#...#....# .... #####.#### ... ###^ggU p ..  .^gg`Z ^ggO[ ^ggi 5zz.^ggj -6 _^ggq ^ggOu ^ggq e≈.## ~.##............######.##......:....## #.##...........# .. ##.#...........# ...  #.>..........# .ßPß  #.#..)###..###[# .PP..  #.))##.#...####......  ######.....##))@.[.zz.[#..Pß##.##..ß........###.....#...#....# .... ^gg" # #####.#### ... ### ..  .^gg ^gg Zz.7^gg ^gg ^ggPX#≈.## ≈~.##............######.##......:....## #.##...........# .. .##.#...........# ... . #.>..........# .ßPß # #.#..)###..###[# .PP.. #.))##.#...####...... ######.....##)@..[z.z.[#..Pß##.##..ß..............###..... .^ggSY#...#....### .... ## #####.#### ... ### ..  .^gg_^gg2c^ggucz.8^gga^gg9  Things that are here: _a +0 club; a +0 spear; a goblin skeleton^gg^gg^gg I.z^gg-9 _^gg^gg^ggAe^ggh^ggv<zz.^ggw 80^ggB^gg^gg/^gg2^gg><zz[^gg~?&1^ggbG^ggI^ggx ;=^ggz 2.4 (0.9^gg ^ggӉ n _You barely miss the wight. You block the wight's attack.^gg^gg-3.4 (1.0^ggN$^ggb)n _You barely miss the wight. You block the wight's attack.^gg*D^ggD&4^ggEQ^ggUw _You hit the wight but do no damage. You block the wight's attack.^gg$  You slash the wight!  The wight is heavily damaged.^ggC%.=5^gg0^gg/53 _You block the wight's attack.^ggX  You hit the wight but do no damage.The wight is heavily damaged.^ggY5-6.5 (1.1^ggBh^ggk3 _You block the wight's attack.^ggp U _You block's attack.  You hit the wight but do no damage.  The wight is heavily damaged. _You block the wight's attack.  You slash the wight!  You destroy the wight!^ggA ^gg .   wight^gg] \ 5-7^gg R0 _The Shining One accepts your kill.^gg ^ggu h _Your Shields skill increases to level 6!^ggg c  You slash the wight!^ggh 5=8.4 (0.9^ggSr ^gglu ] _The wight is heavily damaged.^gg  You hit the wight.  The wight is severely damaged.^gg!5-9.4 (1.0^gg<^gg 3 _You block the wight's attack.^ggK/w  You slash the wight!  You destroy the wight!^gg<C)^gg@W6-90^ggJ^ggKX _The Shining One accepts your kill.^gg34^gg^gg$H _No target in view!^gg@ 3^gg. ^gg޶ ^gg, P _^gg^ W  Items here: )) [[.^gg ^gg  _^ggW ^gg ^gg ^gg ^gg ^gg Y  Things that are here:  a +0 robe; a +0 halberd^gg( ^gg  _^ggS ^gg ^gg ,^gg ^gg ^gg ,^gg ^gg ^gg ,^gg>" ^gg% ^gg+ ,^gg7. ^ggM1 ^gg: ,^ggw= ^gg? ^ggC ,^ggD ^ggG ^ggJ ,^ggK ^ggP ^ggT ,^ggU ^gg\ ^gg1b ,^ggDc ^gge ^gghh ,^ggOi ^ggo ^ggr ,^ggs ^gggu ^gg6x ^gggx ^gg@y ^gg| ^gg X^ggv ,^ggL ^gg ^ggf ,^gg> ^ggW ^gg ,^gg ^ggR ^gg̖ ,^gg ^gg ^gg .##### #.!...###># #.....#####  .##.........#   ......)...#..........#   ....#..........#  ...........#  ...#...........#  ...........## ##@# -^ggl 211.4 (21.0) ......###### #..# :....## ###.## .....# ###...# .....# #....##   .....# ##.ßPß.##^gg q    .###[# ##.PP....#   .#...####........#   ^gg .[............[..#  ^gg^ ^gg F-2.4 (22^gg ^ggְ  ^gg! 5_Found a stone staircase leading down.^ggUI^ggKJ^ggJ^ggP^ggS^ggT^ggPX^ggY[^gg_^gg_^gg`^ggc^gghB^ggAi^ggn,^gg?o^ggq^ggav,^gg;w^ggty^gg},^ggA~^ggj^gg",^ggЄ^ggR  There is a stone staircase leading down here.^gg^gg8 _^gg^ggǑ^ggF,^gg^ggљ^gg .§.#§  ....  P  # .Z  <.# .##  # ..##  # ..#  # ###.#  ##### #.. .!...###>## ........##.....##### ^gg...##.........# )...#..........# ...#..........#  Z   killer bee zombie (dormant).......#..........# ......#...........#  .........#####.##### ^gg 21.4 (9.0)  You can now channel blasts of cleansing flame.^gg'^gg_.ZZ^ggUK*2.4 (10.0)^gg0^ggd _A killer bee zombie comes into view.^gg&.#P ..<.# .## Z.##  ..#  ###.#  #..@# #>### ...##### .........# )...#..........# ..........# ..........# .....# .##### ^gg.#P ..<.# .## Z.##  ..#  ###.#  #..@# #>### ...##### .........# )...#..........# ..........# ..........# .....# .##### ^gg^ggh _A killer bee zombie is nearby!^ggF.#P ..<.# .## Z.##  ..#  ###.#  #..@# #>### ...##### .........# ^ggo)...#..........# ..........# ..........# .....# .##### ^ggj.#P ..<.# .##^gg  Z.##  ..#  ###.#  #..@# #>### ...##### .........# )...#..........# ..........# ..........# .....# .##### ^gg2^ggқ^ggg^ggѥh _A killer bee zombie is nearby!^gg6.#P ..<.# .## Z.##  ..#  ###.#  #..@# #>### ...##### .........# )...#..........# ..........# ..........# .....# .##### ^ggJ z.#P ..^gg k<.# .## Z.##  ..#  ###.#  #..@# #>### ...##### .........# )...#..........# ..........# ..........# .....# .##### ^gg ^gg# ^ggR ^gg h _A killer bee zombie is nearby!^ggyQ §..§# §.#§.. .##P ...# #.. <.# #..## .Z.# #..# ######## #...!...###>### .....####^gg>R ....##.....)..........#......#...........^gggU ^gg_ L.Z^gg` 9=3.0)^gg s ^ _The killer bee zombie hits you but does no damage.^gg  You slash the killer bee zombie!  The killer bee zombie is severely damaged.^gg.=4^gg^gg? _You block the killer bee zombie's attack.^gg  You hit the killer bee zombie.  The killer bee zombie is severely damaged.-^gg45.5 (1.1^gg^ggԝB _You block the killer bee zombie's attack. x2^gg9  You hit the killer bee zombie.  The killer bee zombie is almost destroyed.You block the killer bee zombie's attack.^gg:F-60^gg@^ggC^ _The killer bee zombie barely misses you.^gg  You hit the killer bee zombie but do no damage.The killer bee zombie is almost destroyed.The killer bee zombie completely misses you.^gg&7^ggw^ggKH _The killer bee zombie hits you but does no damage.^ggO  You barely miss the killer bee zombie.The killer bee zombie is almost destroyed.The killer bee zombie hits you but does no damage.^gg &8^gg ^ggC ? _You block the killer bee zombie's attack.^ggB  You barely miss the killer bee zombie.The killer bee zombie is almost destroyed.4^ggȳ 8-9.4 (0.9^gg ^gg 5 _The killer bee zombie hits you.^gg'  You slash the killer bee zombie!  You destroy the killer bee zombie!The Shining One accepts your kill.^ggK3o.^gg>z5=730.4 (1.0^gg?& _You feel better.^gg^gg^gg6^ggH _No target in view!^ggm ^ggʵ Inventory: 24/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) ^gg7 Wands (go to first with /)y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon ^ggj [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]^ggXc - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+}.The scales of a quicksilver dragon. Although it does not provide its wearer withas much protection as the scales of some heavier dragons, it is somewhat lighterand less encumbering. The armour repels both attacks on the wearer's willpower and magical modification of itself - it cannot be enchanted. Base armour rating: 9 Encumbrance rating: 7 rC+: It protects you from cold. Will+: It increases your willpower. ^gg̚Stlth+: It makes you more stealthy. If you take off this armour: Your AC would decrease by 10.2 (16.5 -> 6.3). Your EV would increase by 0.9 (13.1 -> 14.0). This ancient artefact cannot be changed by magic or mundane means. You took it off a spriggan in a bailey. Stash search prefixes: {inventory} {artefact} {artifact} {body armour} {body armor} (t)ake off, (d)rop, (=)adjust, or (i)nscribe.^gg=G Inventory: 24/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+}^ggG d l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  m - 3 scrolls of fear  n - a scroll of immolation ^gg>H  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon ^ggH [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]^ggrA o - 2 scrolls of fog. A scroll that surrounds the reader with a dense cloud of fog, which can block vision temporarily. The fog takes a short time to fully spill out. It is an uncommon scroll. Stash search prefixes: {inventory} {scroll} ^ggjMenu/colouring prefixes: identified emergency_item good_item scroll “Calvin: I used to hate writing assignments, but now I enjoy them. I realized that the purpose of writing is to inflate weak ideas, obscure poor reasoning, and inhibit clarity. With a little practice, writing can be an intimidating and impenetrable fog!”  -Bill Watterson, _Calvin and Hobbes_. February 11th, 1993. (r)ead, (q)uiver, (d)rop, (=)adjust, or (i)nscribe.)^gg(J KInventory: 24/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) )^ggMK 5Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top])^gg"7 )^gg> )^ggE .......§..§#  deadiverson the Carver .........§.#§  Human of the Shining One ***... ............  Health: 85/85 ======================== )^ggsF ..........##P  Magic: 10/10 ======================== .........# #..  AC: 16Str: 17 ......<.# #..##  EV: 13Int: 11 ........# ...##  SH: 13Dex: 14 )^gg'G w........# #..#  XL: 10 Next: 47% Place: Dungeon:7 ........# ###@#  Noise: =--------  Time: 8230.4 (0.0) .......##### #...#  a) +0 long sword .......!...###>###  Throw: 5 darts (poison) ........##.....##### ........##.........#)^ggG  ....)...#..........#   ........#..........#   ........#..........#   .......#...........#   _The killer bee zombie hits you.  You slash the killer bee zombie!  You destroy the killer bee zombie!The Shining One accepts your kill. _You feel better. _No target in view!)^ggK )^ggNL )^ggdO )^ggP *^gg*^gg%Inventory: 24/52 slots Hand Weapons (go to first with ))  a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 5 poisoned darts (quivered) Armour (go to first with [) *^gg c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)y - a wand of digging (6) Scrolls (go to first with ?) *^ggd g - 2 scrolls of vulnerability  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]+^gg"  g - 2 scrolls of vulnerability  v - a scroll of noise  x - a scroll of teleportation +^gg Potions (go to first with !)e - 2 potions of enlightenment  h - 2 bubbling ruby potionsi - a potion of cancellation  k - 2 potions of mutation  q - a potion of attraction  u - a potion of magicbot,^gg=-^ggU a - a +0 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets -^ggPy f - 5 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)11%-^ggF-^ggM-^gg S.......§..§#  deadiverson the Carver .........§.#§  Human of the Shining One ***... ............  Health: 85/85 ======================== ..........##P  Magic: 10/10 ======================== .........# #..  AC: 16Str: 17 ......<.# #..##  EV: 13Int: 11 -^ggS........# ...##  SH: 13Dex: 14 ........# #..#  XL: 10 Next: 47% Place: Dungeon:7 ........# ###@#  Noise: =--------  Time: 8230.4 (0.0) .......##### #...#  a) +0 long sword .......!...###>###  Throw: 5 darts (poison) ........##.....##### ........##.........# ....)...#..........# -^gg/Tz  ........#..........#   ........#..........#   .......#...........#   _The killer bee zombie hits you.  You slash the killer bee zombie!  You destroy the killer bee zombie!The Shining One accepts your kill. _You feel better. _No target in view!-^ggaX-^ggX-^gg\-^gg@^/^gg [?25h[?0c  You slash the killer bee zombie!  You destroy the killer bee zombie!The Shining One accepts your kill. /^gg _You feel better. _No target in view!  Search for what [Enter for "long b", or ? for help]? /^gg [?25l[?1c/^gg@0^gg 2 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] a - a +0 long sword (weapon) 0^ggResults elsewhere ([,] to cycle)  b - [D:6] a +0 long sword (1 further duplicate)0^ggr; 0^ggB 0^gg.J .......§..§#  deadiverson the Carver .........§.#§  Human of the Shining One ***... ............  Health: 85/85 ======================== ..........##P  Magic: 10/10 ======================== .........# #..  AC: 16Str: 17 0^ggJ h......<.# #..##  EV: 13Int: 11 ........# ...##  SH: 13Dex: 14 ........# #..#  XL: 10 Next: 47% Place: Dungeon:7 ........# ###@#0^ggK g  Noise: =--------  Time: 8230.4 (0.0) .......##### #...#  a) +0 long sword .......!...###>###  Throw: 5 darts (poison) ........##.....##### ........##.........# ....)...#..........# 0^ggRK R  ........#..........#   ........#..........#   .......#...........#  0^ggK You slash the killer bee zombie!  You destroy the killer bee zombie!The Shining One accepts your kill. _You feel better. _No target in view!  0^ggK [Search for what [Enter for "long b", or ? for help]? long b0^ggQ 0^ggQ 0^ggRW 0^ggY . _0^gg 0^gg߱ 0^gg 0^ggk F _Unknown command.0^ggԨ 0^gg 0^gg֩ 0^gg 0^gg #..§... §...# §.#§ ...z ..##P ....# #..  <.# #..# .# #...##0^ggn  .# #@.# ..# ###.# .##### #...# !...###>###  .##.....##### .....##.........# z   wight (dormant))...#....#  .#....# 0^ggָ  ..#.#  0^gg 0^gg 3-1.4 (10^gg 0^gg: _A wight comes into view. It is wielding a +2 morningstar of freezing.1^gg&2..#.#§.z#P #..<.# #..###  #...##  #@.#  ###.#  #...# >###   )   1^gg..#.#§.z#P #..<.# #..###  #...##  #@.#  ###.#  #...# >###   )   1^gg5N-1^gg?1^gg\ _A wight is nearby!1^gg*..#.#§.z#P #..<.# #..###  #...## 1^gg #@.#  ###.#  #...# >###   )   1^ggqt..#.#§.z#P #..<.# #..###  #...##  #@.#  ###.#  #...# >###   )   1^gg{41^gg1^gg\ _A wight is nearby!1^ggK..#.#§.z#P #..<.# #..###  #...##  #@.#  ###.#  #...# >###   )   1^gg0b..#.#§.z#P #..<.# #..###  #...##  #@.#  ###.#  #...# >###   )   1^ggbi1^ggi1^ggo1^ggs\ _A wight is nearby!1^ggo 1^ggp 1^ggnx 1^gg{ R _No reachable target in view!1^ggr 1^gg6 1^gg 1^gg( R _No reachable target in view!2^gg  .....##.......  #......  §...###  §.#..  ...z. #..##PZ 2^gg 4....# #..  <.# #..# .# #.@.## .# ###..# ..# ###.# #.##### #...# #!...###>###  .##.....##### .....##.#   Z   killer bee zombie (dormant))...#.# .#.# 2^ggƑ H##..§2^gg &22^gg 2^ggS _is nearby!No reachable target in view! _A killer bee zombie comes into view.3^gg)  .....##....... ##  #...... .#  §...###.##  §.#...ß#  ...z.§.#  #3^gg*s..##PZz.# ....# #.§P.# <.# #.@## #.# ##...## .# ###..# ...# ###.#  #3^gg+Q.##### #...# ##!...###>###  zz 2 wights (dormant) #3^gg+.##.....##### #..........##.# #)...#.#3^gg@3^gg}M##.#.##.ß#..§§§   wight3^gg### ####....##3^gg ##.§ZzzZ3^ggW .=43^ggL 3^gg < _The wight hits you but does no damage.4^gg,f##.#.§§.§ _comes into view. It is wielding a +0 antimagic mace. _The wight hits you but does no damage.  You barely miss the wight.  The killer bee zombie hits you but does no damage.  The wight hits the withered plant with a +2 morningstar of freezing!  thered plant begins to crumble. The withered plant begins to die.4^gg /==54^gg}4^ggY _The wight freezes the withered plant! You block the wight's attack.4^ggeN ##.####..§.§.4^ggN.You hit the wight but do no damage.You block the killer bee zombie's attack. x2  The wight hits the withered plant with a +2 morningstar of freezing!!4^ggO&64^ggtW4^gg[Y _The wight freezes the withered plant! You block the wight's attack.4^ggw§##§ß#..z.You block the killer bee zombie's attack. x2  hits the withered plant with a +2 morningstar of freezing!! _The wight freezes the withered plant! You block the wight's attack.  You hit the wight but do no damage.  You block the killer bee zombie's attack. x2  The wight completely misses the withered plant.--74^gg;4^gg<3 _You block the wight's attack.4^gg-2###§§##§@P§#§§###The wight completely misses the withered plant. _barely miss the wight.  The killer bee zombie hits you.  The wight completely misses the withered plant.4^gg2h0----84^gg:4^gg{>R _The wight barely misses you.4^ggO §###.§..The wight completely misses the withered plant. _The wight barely misses you.You barely miss the wight.  The killer bee zombie barely misses you.The wight hits the withered plant with a +2 morningstar of freezing!!4^gg 6==9.3 (0.94^gg 4^ggE Y _The wight freezes the withered plant. You block the wight's attack.4^gg' 4^ggW-  You hit the wight but do no damage. The withered plant crumbles away.The killer bee zombie hits you but does no damage.4^gg9 ##..§§z.You block the killer bee zombie's attack.4^gg: U1----4^gg7; 40.3 (1.04^ggC 4^gg7H 3 _You block the wight's attack.4^ggwe##.#§§You block the killer bee zombie's attack. _You hit the wight.  The wight is moderately damaged.  The killer bee zombie hits you but does no damage.4^ggA--14^ggx4^ggR6 _You block the wight's attack. x25^ggm? ##5^gg§§§§§.#.You slash the wight!  The wight is severely damaged.You block the killer bee zombie's attack. x25^gg&25^gg _You block the wight's attack. The wight closely misses you.5^gg1`###.##..§ß#§.@P.#.###You barely miss the wight.The wight is severely damaged.You block the killer bee zombie's attack.  5^gg`6  The wight hits you with a +0 antimagic mace!5^gg\a774--5^ggad8/10 -----=3.4 (1.15^gg0j5^ggk5^gg}w/  --more--5^gg _ _You feel your power leaking away.5^ggnxYou slash the wight!  You destroy the wight!The Shining One accepts your kill.5^gg ##.####§§§.ß#5^ggO.§..§§   wightYou feel your power returning.  You block the killer bee zombie's attack.  You block the wight's attack.5^gge9==---8-45^gg| 05^gg~5^gg2-5^gg/  --more--6^ggF _The killer bee zombie hits you but does no damage.6^ggT r##.####§#.§.ß#.§§.)§@P.You hit the wight.  The wight is lightly damaged.6^gg f5=-5.5 (1.16^gg 6^gg$ _The killer bee zombie misses you. The wight closely misses you.6^gg  #§ß#.§ You slash the wight!  The wight is severely damaged.You block the killer bee zombie's attack.  The killer bee zombie hits you but does no damage.=6.66^ggW6^gg3 _You block the wight's attack.7^gĝ- §Zz.§§You hit the wight but do no damage.The wight is severely damaged.You block the killer bee zombie's attack. x27^gg5-7.5 (0.97^gg7^gg3 _You block the wight's attack.7^gg2?#§##..§§#§.§§.#..##You block the killer bee zombie's attack. x2  The wight hits you with a +0 antimagic mace.7^ggP: 75/84 (85)=P: 9/10 ==-7^gg.8.4Drain7^gg17^gg 7^ggXY_You partially resist. You feel drained.7^gg ###§##§.§ß#§§§§#)..§###7^gg You hit the wight.  The wight is almost destroyed.The killer bee zombie closely misses you.7^gg [3-9.5 (1.17^ggA7^gg9v _The wight completely misses you. The killer bee zombie hits you.7^gg..u  You hit the wight.  You destroy the wight!7^ggP< #.§Z§§#§@P§#§§###.###Z   killer bee zombie  The Shining One accepts your kill.7^gg?6505007^ggE7^ggF? _You block the killer bee zombie's attack.7^gg U ##§#...#..##You hit the killer bee zombie.  The killer bee zombie is lightly damaged.  The killer bee zombie hits you but does no damage.7^gg 4=10/10===17^gg 7^gg b _The killer bee zombie completely misses you.7^ggց S ##§§. You slash the killer bee zombie!  The killer bee zombie is heavily damaged.The killer bee zombie hits you but does no damage.7^gg 5=2.6 (1.17^ggJ 7^gg׌ ? _You block the killer bee zombie's attack.8^gg{ ##.####..§.#.@P.##You barely miss the killer bee zombie.The killer bee zombie is heavily damaged.8^gg5-3.5 (0.98^ggO8^ggB _You block the killer bee zombie's attack. x28^gg .......... ##...... .#.....###.##...#.§§§§§#8^gg*.§§.You closely miss the killer bee zombie.The killer bee zombie is heavily damaged.You block the killer bee zombie's attack.8^gg5=-4.6 (1.18^gg8^ggrW _The killer bee zombie misses you.8^gg< .##...#.....###...§#§...§§.)§#§###You hit the killer bee zombie but do no damage.The killer bee zombie is heavily damaged.You block the killer bee zombie's attack.8^ggJ===508^gg8^ggH _The killer bee zombie hits you but does no damage.8^gg  .##...#.....###.##..§#§..ß#.§§§§.§Z§§# 8^ggYou slash the killer bee zombie!  The killer bee zombie is almost destroyed.8^gg.=68^gg8^ggH _The killer bee zombie hits you but does no damage.8^gg / ...............###.##...#§..ß#..§§§§##.#.§###You barely miss the killer bee zombie.The killer bee zombie is almost destroyed.6-78^gg 8^gg B _You block the killer bee zombie's attack. x28^ggr  You slash the killer bee zombie!  You destroy the killer bee zombie!8^ggT| M§§8^gg ^41-88^gg 8^gg X _The Shining One accepts your kill.9^gg;9^ggл9^gg9^gg 9^gg:_No target in view!9^gg\#M ... .....##....... ###... .# .....###.##.....#§.§ß# ......§§§§#  #.##§@§§#...# #§§P. .<.# #§§### ###...# ...........# ###..##..##9^gge-##.###.§...P§#.§#####..###9^gg#g5-9 _9^ggDn9^ggo9^gg:# ....... .....##....... ## #.... .# ..###§## .#§§§ß# .§§§# #.##@§§§#  .# #..P§#  .<.# #.§### .#.# ##...##.# ###..#  .# ###.# # #.##### #...##.!...###>###  #.##.....#####9^gg]3 #).#.##9^gg#4 g8=-609^gg4; 9^gg6@  Things that are here: _a +2 morningstar of freezing; a +0 robe:^gg:^gg:^gg:^gg':^ggI; _:^gg1,:^gg:^ggl9=:^gg:^ggA,:^gg:^ggB:^ggc=80:^gg:^ggs,:^gg:^ggk,:^gg:^gg b1=:^gg:^gg7,:^ggD:^gg>:^gg:^gg{:^gg:^ggV2=:^gg:^gg,:^gg=:^ggC:^gg:^gg.:^gg :^ggH!&3:^gg":^gg),:^gg,:^gg1b4=:^gg;3:^gg81 _HP restored.:^gg6<4:^gg=:^ggPCF.... .... .....##....... ## #.... .# ..###§## .#§§.ß# .§§§§#  #.##§@§§# .# #..P§# .:^ggC<.# #.§### #.# ##...## # ###..# .# ###§#  #.##### #...#.!...###>### :^ggH ....  ....  .....##....... ##  #..... .#  ..###§##  .#§§.ß#  .§§§§#  #.##§.@§#  :^ggIA# #..P§#  <.# #.§###  .# ##...##  # ###..#  # ###§#    #.##### #...#    #.!...###>###    .##.....#####   :^ggPK.....##....#§§§....§§.#§§788.0)§.P..:^ggQQ,9.6 (19:^ggT:^ggX{  Things that are here: _a +0 antimagic mace; a +0 robe:^gg:^ggM:^gg3:^ggt:^ggO:^gg; _:^gg:^gg$:^gg:=:^gg:^gg:^gg,:^gg`:^ggI:^gg6,:^ggB:^gg:^gg,:^gg:^gg:^gg:^gg/:^gg:^ggG:^gg,:^gg:^gg:^gg :^gg :^gg:^gg,:^gg,:^gg:^ggn:^gg\:^gg:^gg :^ggE ;^ggK ;^ggeO a _A killer bee is nearby!;^ggV  #### #######  ....##.....##  ............##  .............#  .............#  y............#  .............##  .......@.......  ...............  ;^gg ...................#  ...................#  ###.##............##  ......##........##  #.#...............#  #.............###§##   ;^gg @ #### #######  ....##.....##  ............##  .............#  .............#  y............#  .............##  .......@....... ;^gg} ` ...............  ...................#  ...................#  ###.##......... ......##........##  #.#............ #.............# ;^gg ;^ggֺ ;^gg ;^gg@ ;^ggK v ##### ########.#..#y.# y......#########.......#....##...#.#........#.###.##....##y 2 killer bees (asleep) ......#### #.#...............#.###§## _A killer bee is nearby!;^gg ;^ggq ;^gg _..yy1 asleep);^gg +5.6 (1;^gg ;^gg _is nearby! _comes into view.<^gg9# ########.....##.....##.##.#.#y.y.#.y.#.#....# #.#...# #.# #......#.###.##.##y 3 killer bees (2 asleep). ......##....## #.#...........#  #.###§##<^ggշ<^gg˸<^gg\..y<^ggQ&6<^gg<^ggP _comes into view.=^ggɩ((((((( _comes into view.  You throw a poisoned dart.=^gg7&  =^gg7The poisoned dart completely misses the killer bee.The killer bee buzzes angrily. You hear an angry buzzing noise.=^gg : =^gg:0 You hear a shout!=^gg;=^gg<=^gg>=^gg~?=^ggxA =^ggAf A killer bee comes into view.=^ggO=^gg{Pyyy......yyyy 4 killer bees (1 wandering)=^ggP=^gg)Qb==7.7 (1.14=^ggZ=^gg^W _The killer bee barely misses you.=^gg  ((((((You throw a poisoned dart.=^ggA u  The poisoned dart closely misses the killer bee.=^gg =^ggЙ G  You block the killer bee's attack.=^ggL =^gg* =^gg =^ggW R  The killer bee stings you but does no damage.=^gg ..yy..y..yy=^ggq c-8.83=^gg( =^ggź 8 _You block the killer bee's attack.=^ggU =^ggV =^gg"W =^ggf .yYou hit the killer bee but do no damage.=^ggf G-9.7 (0.9=^gg0p =^ggt X _The killer bee closely misses you.>^ggf  You hit the killer bee.  The killer bee is lightly wounded.>^gg>^ggg R  The killer bee stings you but does no damage.>^gg >^gg>^gg>^gg"/ ..yO...yyO   ogreyyyy 4 killer bees  You block the killer bee's attack.>^ggI$/300.7 (1.0>^gge/>^ggx< _An ogre comes into view. It is wielding a +0 giant spiked club.>^ggS###### ########.....##............... .# ....y# O...y.y#########....y.....#....# ......#...#  ...#  .#  ..###.####. ......#### yyyy 4 killer bees #.#.......#.............###§# #...ß#>^ggl,>^ggL>^gg>^ggA>^ggN>^gg>^gg)K.(O.....yyyO   ogreyyyy 4 killer bees>^ggr*&1>^gg5>^gg1:8 _You block the killer bee's attack.>^ggּ ?###### ########.....##............... .# .>^ggD # (O....y#########......y..#....# ......y..#...# ..>^ggp ..# .# ..###.##>^ggн .## . ......##..## #.#....... >^gg yyyy 4 killer bees#.............###§##>^gg( ............#...ß#.§§§§#>^gg4 >^gg %  >^gg )The killer bee attacks as it pursues you!>^ggd >^gg9 >^gg >^gg >^ggc >^ggq >^ggF >^gg .O......y.yyy>^gg\ O   ogreyyyy 4 killer bees>^gg &2>^gg >^ggI P _The killer bee misses you.>^gg+ #.....##............... .# .# (.O#########........y..#....# >^gg=, .yy.#...# ....# ..# ..###.#### >^gg, y. ......##>^gg, +## >^gg- ~ #.#.......#>^gg2. W#.............###§#yyyy 4 killer bees.............#...ß#..............§§§§>^ggt. `##.##§.§§#>^gg4 >^gg5 >^gg 6 >^gg6 >^ggt7 >^gg8 >^ggv; >^ggJ .O......yyyO   ogreyyyy 4 killer bees>^ggK &3>^ggV >^ggf[ 8 _You block the killer bee's attack.?^ggTx.......... .# .# (#########...O..#....# ........yy#...# .yy...# ...# ..###.#### . ......#### ?^gg.y #.#....... #.............###§#.............#...ß# yyyy 4 killer bees..............§§§§##...........##).§§#...# #.§P§#?^gg?^gg?^gg?^gg?^ggo?^gg?^gg0?^gg`8.O..y..yyyO   ogreyyyy 4 killer bees?^gg&4?^ggԡ?^ggL8 _You block the killer bee's attack.?^gg(w. .# .# (#########....O..#....# ..........y#...# .y...# .y.# ..###.##..y.## . ......##.##  #.#....... #.............###.#.............#...ß#?^gg;.......§§§§# yyyy 4 killer bees#...........##).§§#............###..P§#.<.# #§.###?^gg?^gg[N  The killer bee attacks as it pursues you!?^ggK ?^gg ?^ggW"?^ggt$  The killer bee misses you. You block the killer bee's attack. x2?^gg6.O.......yy.yyO   ogreyyyy 4 killer bees§§5?^ggsC?^gg7GP _The killer bee misses you.?^gg .# .# (#########....#....# .....O#...# .........# .yy# ..###.##...y..## ?^ggё. ......##y.##  #.#........ #.......###.#.....#...ß# .§§§§####).§§# yyyy 4 killer bees...###§§P§#.<.## #§.###.#?^ggF.# ##...?^ggy?^gg?^ggN  The killer bee attacks as it pursues you!?^ggޝx  You block the killer bee's attack.  The killer bee attacks as it pursues you!?^ggp   The killer bee barely misses you.The killer bee attacks as it pursues you!  You block the killer bee's attack. x2; The killer bee completely misses you.?^gg::.O...yy.yyO   ogreyyyy 4 killer bees?^ggP&6?^gg6?^gg?^gg/  --more--@^gg^[ _The killer bee barely misses you. x2@^ggj.# (#########....#....# ......O#...# ....# .# ..###.##....yy## . ......##.y......## @^gg4 #.#.......y. #......###.##.#...ß# .§§§§# ###).§§#...###§§P§# yyyy 4 killer bees.<.## #§.###.#@^gg.# ##......# ###..#@^ggq@^gg@^ggFThe killer bee attacks as it pursues you!@^gg(@^gg~You block the killer bee's attack. x3; The killer bee misses you.@^gg.O...yy.yy..O   ogreyyyy 4 killer bees  The killer bee barely misses you.@^gg-&7@^ggf @^ggi; _The killer bee stings you but does no damage.@^gg֜(#########....#....#  .O#...#  ....#  .#  ..###.####  . ......##..yy....##  #.#........y......# #...y.@###.##...#...ß# .§§§§# ###).§§# ...@^gg###..P§#.<.## #§.### yyyy 4 killer bees.#.# ##...##...# ##### §#@^gg@^ggFThe killer bee attacks as it pursues you!@^gg4@^gg@^gg  The killer bee attacks as it pursues you!  You block the killer bee's attack.  The killer bee attacks as it pursues you!  You block the killer bee's attack.  The killer bee closely misses you.@^ggھ:.O...yy.yyO   ogreyyyy 4 killer bees@^gg&8@^gg8@^gg@^gg/  --more--A^gga: _stings you but does no damage.A^gg....#....O# ....# .####.##..## ......##.##  #.#.........yy....#..###.## ...ß....§§§###)§).#..###..P.#<.## #§.###A^gg.#..# ##...##..# ###.. ..# ###. ..# ###### #...A^ggA^ggtJThe killer bee stings you but does no damage.A^gg ~.O.y§.#A^gg>R§P.###9A^ggA^ggz _You block the killer bee's attack. x3; The killer bee closely misses you. x2A^gg .#...# .O.....# ............# ..###.##....## . ......##........##  #.#..........y....# #...yy###.##.y.#.§.ß# ..@.§§§# ###)§§.# ...###.§P.# .<.## #..###  .#.# ##........# ###..# ...# # .# #........##### #...####.!...###>###A^gg A^gg| The killer bee stings you but does no damage.A^gg .O.....#.y###§##y#.§§ß#yA^ggx b.§§§#A^gg2 '10A^gg A^gg 0 _You block the killer bee's attack.B^gg  You barely miss the killer bee.The killer bee is lightly wounded.B^gg) B^ggq  The killer bee closely misses you. x2; The killer bee stings you.B^ggf B^ggݱ .O.yy@§§§§..###..##.B^gg޲ (#..#B^gga [2-1.6 (0.9B^gg B^gg X _The killer bee closely misses you.B^ggd  You hit the killer bee.  The killer bee is moderately wounded.B^gg  You block the killer bee's attack. x2; The killer bee misses you.B^gg^B^gg.O.).##B^gg-2.6 (1.0B^ggB^gg8 _You block the killer bee's attack.C^gg   You slash the killer bee!  The killer bee is almost dead.C^ggt!C^ggH"C^gg#C^gg$C^gg/3.O#.#§.C^gg3 §.#.P§#.##.#.#..#C^gg=4\3-=3C^gg;C^gg@8 _You block the killer bee's attack.C^gg>  You slash the killer bee!C^ggC^ggRG  You kill the killer bee!C^ggC^ggbC^ggC^gg\.#O.###.#§ 3C^gg62-4C^ggsC^gg} _The killer bee barely misses you. You block the killer bee's attack. x2C^gg  You hit the killer bee but do no damage.The killer bee stings you but does no damage.  You block the killer bee's attack. x2C^ggX.O§.##C^ggU7.#.#..#C^gg9G-5.5 (0.9C^ggC^gg>!C _The killer bee stings you but does no damage.C^gg You block the killer bee's attack. x2 _The killer bee stings you but does no damage.  You hit the killer bee.is lightly wounded.  The killer bee closely misses you.  C^gg O.)§§..##..##.#..#C^gg6 C^ggɘ #4C^gg 3=6.4C^gg; C^gg s _The killer bee misses you. You block the killer bee's attack.C^gg >  You slash the killer bee!C^gg ]  You kill the killer bee!C^gg C^gg # .O..# 2  You block the killer bee's attack. The killer bee closely misses you.C^ggG =3=7.4 (1.0C^gg'# C^gg+( 8 _You block the killer bee's attack.C^ggi  You slash the killer bee!  The killer bee is severely wounded.C^ggu §.Oy@..§§.##C^gg_vSThe killer bee stings you. You block the killer bee's attack.C^ggv[3-8.3 (0.9C^ggрC^ggP _The killer bee misses you.D^gg\ §§§§P.#..####..##.#..#You miss the killer bee.The killer bee is severely wounded.You block the killer bee's attack. x3; The killer bee barely misses you.D^gg S4=-D^ggm9.4 (1.1D^ggeD^ggSC _The killer bee stings you but does no damage.D^gg ...#..##.D^gg#..#You closely miss the killer bee.The killer bee is severely wounded.D^gg;!-D^ggk'20.3 (0.9D^ggD^ggo} _You block the killer bee's attack. The killer bee barely misses you. x2D^ggP* §#You barely miss the killer bee.The killer bee is severely wounded.D^gg*-1.3 (1.0D^gg4D^ggs8} _The killer bee barely misses you. You block the killer bee's attack. x3D^gg  #.##..ß#You barely miss the killer bee.The killer bee is severely wounded.You block the killer bee's attack. The killer bee barely misses you.D^gg -2.2 (0.9D^gg# D^gg' 8 _You block the killer bee's attack.D^ggt  #.##§§ß#.).#.P.#..###You closely miss the killer bee.The killer bee is severely wounded.=3.2 (1.0D^ggÕ D^ggp ~ _You block the killer bee's attack. x3; The killer bee barely misses you.D^gg>  You slash the killer bee!D^gg  You kill the killer bee!The killer bee stings you but does no damage.D^ggjz#.#O.y@.§.§§#§P.###   killer beeD^gg  ealth: 84/85 -54 D^gg! J_The killer bee barely misses you.D^ggD^ggEi _Your life force feels restored.E^ggP #.##§...#§§§#§§P.#..####..##.#..#You hit the ogre.  The ogre is lightly wounded.  You block the killer bee's attack. The killer bee barely misses you.E^gg{QT5=5E^ggDYE^gg\2 _You block the ogre's attack.E^gg #§..## You slash the ogre!  E^ggYFThe ogre is heavily wounded.E^gg5=6.1 (0.9E^ggE^gg{ _You block the killer bee's attack. The killer bee closely misses you.E^ggo #.##..ß#..#.#. #..#E^gg:You slash the ogre!  The ogre is severely wounded.You block the killer bee's attack. The killer bee misses you.E^gg5-7.2 (1.1E^ggE^ggD2 _You block the ogre's attack.E^gg 8  You slash the ogre!E^gg%  #.##)#§§§ß#.§.y   killer bee  You kill the ogre!The killer bee barely misses you. You block the killer bee's attack.E^gg) 88=8.3E^ggP1 E^ggC4 [ _The killer bee completely misses you.E^gg*  §.§)§§§§.#.#..#You closely miss the killer bee. You block the killer bee's attack.E^gg* P=-90E^gg2 E^ggU6 C _The killer bee stings you but does no damage.F^ggeh..###F^gg#H-30.2 (0.9F^ggF^ggNy _You closely miss the killer bee. You block the killer bee's attack.F^gg{.#.#F^ggJ(1.1F^ggF^gg={ _You barely miss the killer bee. You block the killer bee's attack. x2F^ggH ##.§.#).#..#. #..#You hit the killer bee.  F^ggIOThe killer bee is moderately wounded.F^ggI(2.0F^gg:TF^ggYZ _The killer bee barely misses you. x2F^gg- ##§§.#.§§#.You hit the killer bee but do no damage.The killer bee is moderately wounded.F^gg-3.0 (1.0F^gguF^ggs _You block the killer bee's attack. The killer bee misses you.F^gg> #.##§..ß#§§§P.#F^gg §.#### You slash the killer bee!  The killer bee is almost dead.The killer bee stings you but does no damage.F^gg 5=4.1 (1.1F^gg F^gg# W _The killer bee barely misses you.F^gg;>  You slash the killer bee!F^ggJ-#§##.§§ß#†§.§#..##..##..#F^ggO=9-5.0 (0.9F^ggWF^ggZN _You kill the killer bee!G^ggRjG^ggk8-G^gg_xG^ggI{H _No target in view!G^gguG^ggaG^ggZG^ggH _No target in view!_gg;P I_ggc _ggo  .#....#  ...#...#  ......#  .............#  ..###.##............##. ......##........## #.#.....#..###§## .@#.§§ß# .†.§§§.# #..##§§§§# ....###§.P.# <.## #§§# .#.....Z....# ##...##Z   wyvern zombie (wandering)....#..#  ...........# ###.# ..# #.##### #...#_ggu &0_gg §.#.Z-6.0 (1_ggɅ _gg $ _A wyvern zombie comes into view.Things that are here: _a +0 giant spiked club; a killer bee corpse; a killer bee corpse_ggq    ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.#  #...........##§§§§#  ......#_gg  ...<.##   .....#   .Z...#   .....# ###.#   #...# _gg1%   ..........#...#  .............#  .............# _gg%  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.# _gg&G #...........##§§§§#  ......#  ...<.##   .....#   .Z...#   .....#  _gg& _gg._ggq/8-_gg6_gg:d _A wyvern zombie is nearby!_ggW   ..........#...#  _ggB.............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.# _ggW #...........##§§§§#  ......#  _gg1...<.##   .....# _gg O  .Z...#   _gg7T.....# ###.#   #...# _ggb~   ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.#  #...........##§§§§#  ......#  ...<.##   .....#   .Z...#   .....#   _gg_gg{_gg%_ggg)d _A wyvern zombie is nearby!_gg|   ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.#  #...........##§§§§#  ......#  ...<.##   .....#   .Z...#   .....# ###.#   #...# _gg'   ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.# _ggW #...........##§§§§#  ......#  ...<.##   .....#   .Z...#   .....#   _gg'4_ggO)_gg,d _A wyvern zombie is nearby!_gg   ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.#  #...........##§§§§#  ......#  ...<.##   .....#   .Z...#   .....# ###.#   #...# _ggy   ..........#...#  .............#  .............#  ...........##  . ......##........##  ............#  ........###§##  ............@#.§§ß#  ............†§§§§.#  #...........##§§§§#  ......#  ...<.##  _gg/ .....#   .Z...#   .....#   _ggʪ_ggx_ggP_ggd _A wyvern zombie is nearby!_gg .# ..  ...# ..###.##..# . ......## #.#.......# #._gg###§## )#§§§ß# †§§§§.# #.##§§§§#.#§.P.# <.## #§§####...# ##...## .Z...# ###..# .....# ###.# #..# #..##### #...# #..###.!...###>###_ggi!_gg-L.Z_gg.-7 __gg:_ggI>_ggM + . ..# ..###.##..# . ......## #.#.......# #.###§## )#§§§ß# .†§§§§.# #.##§§§§#.#§.P.# <.## #§§####...# ##...## ..# ###..# Z..# ###.# ##..# #........##### #...# ##..###..!...###>### .#.. ..##.....#####Z.Z8_gg@U _gg e .# ..###.##..# . ......## #.#.......# #.###§## )#§§§ß# .†§§§§.# #.##§§§§#.#§.P.# <.## #§§####...# ##...## .Z.# ###..# ...# ###.# .##..# #..##### #...# .##..###..!...###>### ..#.. ..##.....##### #.#.# #.##.........##...Z.9_gg .  You hit the wyvern zombie but do no damage.=40.1 (1.1_gg_gg E _The wyvern zombie bites you but does no damage._ggE .§§You slash the wyvern zombie!  The wyvern zombie is lightly damaged._gg 5=1.0 (0.9_ggI_gg; _You block the wyvern zombie's attack._gg| #§#§§§. You slash the wyvern zombie!  The wyvern zombie is moderately damaged.4--2.1 (1.1_ggP _ggGX _You block the wyvern zombie's attack. The wyvern zombie bites you._gg=  You hit the wyvern zombie.  The wyvern zombie is heavily damaged._ggAl5=-30_ggظ_ggn _ggѼ-_You block the wyvern zombie's attack._gg:  .....§§#§§†§§You hit the wyvern zombie.  The wyvern zombie is heavily damaged._gg &4_ggw _gg S _The wyvern zombie misses you._ggYY #)§ You slash the wyvern zombie!  The wyvern zombie is severely damaged._gg@Z .=5_gga _gge > _You block the wyvern zombie's attack. x2_ggSY ........§§.†§ You slash the wyvern zombie!  The wyvern zombie is almost destroyed._gg9&6_gg_gg- [ _The wyvern zombie closely misses you._gg  You hit the wyvern zombie.  You destroy the wyvern zombie!_ggu)..†§..._gg:# =61-7 _The Shining One accepts your kill._gg&_gg(h _Your Shields skill increases to level 7!_gg_gg}8-_gg=_ggH _No target in view!_gg _ggh C  Skill  Level Cost  Apt Skill  Level Cost  Apt _gg ] a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1          _gg  , b - Unarmed Combat   0.0   1.0   0      _gg  c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0               f - Armour   3.0   4.0   0  _gg]      g - Dodging   0.0   1.0   0      h + Shields7.0   8.0   0       i - Stealth   0.0   0.8  +1              _gg                                 _ggP The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets_ggѬ _gg̲ .....................#deadiverson the Carver..###.##............##Human of the Shining One ***.... ......##........##Health: 85/85 ========================#.#...............#Magic: 10/10 ========================_gg#.............###§##AC: 16Str: 17............)#§§§ß#EV: 13Int: 11............†§.§§.#SH: 14Dex: 14#...........##§§§§#XL: 10 Next: 61% Place: Dungeon:7..........@.###§.P.#Noise: =--------  Time: 8347.1 (0.0).........<.## #§§###a) +0 long sword.#..........# ##...##Throw: 3 darts (poison)............# ###..#...........# ###.# .##..# #........##### #...# .##..###........[34_gg\m!...###>### ..#.. #..........##.....##### #.#.# #..........##.........# _The wyvern zombie closely misses you.You hit the wyvern zombie.  You destroy the wyvern zombie! _The Shining One accepts your kill. _Your Shields skill increases to level 7! _No target in view!_ggƸ_gg_ggl_gg_ggs_ggs_ggt_gg{_ggf __gg _gg_gg_ggd_gg? ....# .......z..........#...# ................# .....................# ..###.##............## ###........## #.#........# #_gg....###§## #....)#.§§ß#- .......†§§.§.# ^#.....##)§§§# § ....###§.P.# P. ...<.## #§§### .. .#..........# ##...##z   wight (wandering). ....# #..# .( ....# .# ....##..# #..##### #...#_gg+9.1 (2_gg.z§.z-50.1 (3_gg_ggW _A wight comes into view. It is wielding a +4 falchion of freezing._gg   .................  ........z............#  _gg"'.....................#  ..###.##............##  . #......##........##  #.#...............#  #.............###§##  #......@.....§#.§§ß#  .............†.§.§.#  ^#...........##)§§§#  ............##  .........<.##   .#..........#   ............#  .( ...........# ###.#   #...# _ggΪ   .................  ........z............#  .....................#  ..###.##............##  . #......##........##  #.#...............#  #.............###§##  #......@.....§#.§§ß#  _gg.............†.§.§.#  ^#...........##)§§§#  ............## .........<.##  .#..........#   ............# ( ...........#   _gg_gg_ggƻ_ggƾ\ _A wight is nearby!_ggh   .................  ........z............#  _gg'.....................#  ..###.##............##  . #......##........##  #.#...............#  #.............###§##  #......@.....§#.§§ß#  .............†.§.§.#  ^#...........##)§§§#  ............##  .........<.##   .#..........#   ............#  .( ...........# ###.#   #...# _ggې *   .................  ........z............#  .....................#  ..###.##............##  . #......##........##  #.#...............#  #.............###§##  #......@.....§#.§§ß#  .............†.§.§.#  ^#...........##)§§§# _gg Y ............## .........<.##  .#..........#   ............# ( ...........#   _ggV _ggڝ _gg _gg \ _A wight is nearby!_gg (########......#...............#...#......z...............###.##....##. #......####....# .###§##.....§#.§§ß......†.§.§. ^#...##)§§§ § ...###§.P. P .<.## #§§### ###...# .....# ###. ._gg ( ...# ###_ggG _gg[ \.z)_ggI _gg +1.1 (1 __gg _gg _gg>. (......########........#..........#...#..................z......###.##.....##. #......####.#....# .###§##)#.§§ß..†.§.§. ^#.##)§§§ § ...###§.P. P .<.## #§§######...# ...###._ggd?_gg$FB._ggF&2_ggK_ggM_ggB_ggC_ggK_gguMH _No target in view!_ggIr .# .......#  (.......######### ..........#....# ............#...# ............_gg9s.# .............# ..###.##.z..##. #.....@##........## #.#..... #..###§## #.)#.§§ß##..†.§..# #^#..##)§§§#z   wight §§#.....###§.P.# ._ggsP. <.## #§§# §.. .#.# ##...##_gg_ggA.=3_gg_gg3 _You block the wight's attack._gg<4_gg_ggn _You barely miss the wight. You block the wight's attack._ggV  You hit the wight.  The wight is lightly damaged.5_ggK_gg3 _You block the wight's attack._ggP  You slash the wight!  The wight is severely damaged._gg7 .=6_gg> _gg 3 _You block the wight's attack._gg{ Z  You hit the wight but do no damage._ggl| HThe wight is severely damaged._gg| %-_gg| 7_gg _gg < _The wight hits you but does no damage._gg  You hit the wight but do no damage.The wight is severely damaged._ggG-8.0 (0.9_gg _gg 3 _You block the wight's attack._gg*u  You hit the wight.  You destroy the wight!_ggڔC)_ggO.29_ggў_ggݟX _The Shining One accepts your kill._gge.# ...# ....# _ggf(....######### ......#........#........# ........... ..###.##.@........ #......##_ggf## #.#...............# #.............###§##_gg(g......)#.§§ß##.............†.§.§.# _ggag#^#...........##)§§§# § #......###§.P.# _gggP. .<.## #§§###_ggSq_ggr5-9.9 (1.0_ggx_gg~  Things that are here: _a +4 falchion of freezing; a +0 robe_ggg_ggiPick up what? 25/52 slots (_ for help) Hand Weapons (select all with )) _gg~j? a - a +4 falchion of freezing Armour (select all with [)b - a +0 robe [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]_gg)  a + a +4 falchion of freezing[Enter] accept (1 chosen)_gg _gg[ _gg ...............#deadiverson the Carver...............#Human of the Shining One ***..................#Health: 85/85 ========================_ggW (..............#########Magic: 10/10 ========================..................#....#AC: 16Str: 17..................#...#EV: 13Int: 11.....................#_gg NSH: 14Dex: 14.....................#XL: 10 Next: 62% Place: Dungeon:7..###.##.@..........##Noise: ---------  Time: 8359.9 (0.0). #......##........##a) +0 long sword#.#...............#Throw: 3 darts (poison)_ggU #.............###§###............)#.§§ß##.............†.§.§.##^#...........##)§§§# §#............###§.P.# P..........<.## #§§### _You block the wight's attack.  You hit the wight.  _gg You destroy the wight! _The Shining One accepts your kill.Things that are here: _a +4 falchion of freezing; a +0 robe_gg _gg _gg0 %60.9 (1_gg( _ggI, S _t - a +4 falchion of freezing_ggY  Adjust (i)tems, (s)pells, or (a)bilities? _gg _ggAdjust which item? Hand Weapons (go to first with ))  a - a +0 long sword (weapon)  t - a +4 falchion of freezing Missiles (go to first with ()  b - 3 throwing nets  f - 3 poisoned darts (quivered) _gg>CArmour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability _ggQ j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]_gg' _gg; =...............#deadiverson the Carver...............#Human of the Shining One ***..................#_gg= !Health: 85/85 ========================(..............#########Magic: 10/10 ========================..................#....#AC: 16Str: 17..................#...#EV: 13Int: 11.....................#SH: 14Dex: 14.....................#XL: 10 Next: 62% Place: Dungeon:7..###.##.@..........##Noise: ---------  Time: 8360.9 (0.0). #......##........##_gg= a) +0 long sword#.#...............#Throw: 3 darts (poison)#.............###§###............)#.§§ß##.............†.§.§.##^#...........##)§§§# §#............###§.P.# P..........<.## #§§###Things that are here: _a +4 falchion of freezing; a +0 robe _t - a +4 falchion of freezingAdjust (i)tems, (s)pells, or (a)bilities? t - a +4 falchion of freezing  Adjust to which letter? (? for menu, Esc to quit)_ggt Ot_gg _gg  _a +4 falchion of freezing; a +0 robe _t - a +4 falchion of freezing(i)tems, (s)pells, or (a)bilities?   t - a +4 falchion of freezing  _gg Adjust to which letter? (? for menu, Esc to quit) _a - a +4 falchion of freezing; t - a +0 long sword (weapon)_gg[_ggaInventory: 26/52 slots Hand Weapons (go to first with ))  t - a +0 long sword (weapon)  a - a +4 falchion of freezing Missiles (go to first with ()  b - 3 throwing nets  f - 3 poisoned darts (quivered) _ggsbArmour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation _ggb! o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]_ggx9`a - a +4 falchion of freezing. A long single-edged sword with a slightly curved blade. Base accuracy: +2 Base damage: 8 Base attack delay: 1.3 This weapon's minimum attack delay (0.6) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.9 XLs.  Current attack delay: 0.8. Damage rating: 16 (Base 8 x 110% (Dex) x 141% (Skill) + 4 (Ench)). Freeze: It freezes victims, dealing an additional one-quarter of any damage that pierces defenders' armour. It may also slow down cold-blooded creatures. This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. You took it off a wight on level 7 of the Dungeon. Stash search prefixes: {inventory} {ego} {branded} {Long Blades} {one-handed} {freeze} {melee weapon} Menu/colouring prefixes: identified enchanted ego melee weapon (w)ield, (d)rop, (=)adjust, or (i)nscribe._gg} Inventory: 26/52 slots Hand Weapons (go to first with ))  t - a +0 long sword (weapon)  a - a +4 falchion of freezing Missiles (go to first with ()  b - 3 throwing nets  f - 3 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog [Up|Down] select [PgDn|>_ggg [39;49m] page down [PgUp|<] page up [Esc] exit[top]_gg >t - a +0 long sword (weapon). A sword with a long, slashing blade. Base accuracy: +1 Base damage: 10 Base attack delay: 1.4 This weapon's minimum attack delay (0.7) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.9 XLs.  Current attack delay: 0.9. Damage rating: 15 (Base 10 x 110% (Dex) x 141% (Skill)). This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. Stash search prefixes: {inventory} {Long Blades} {one-handed} {melee weapon} Menu/colouring prefixes: identified melee equipped weapon “While we were at grips with this great army and their dreadful broadswords _gg P (maquahuitl [made of obsidian]), many of the most powerful among the enemy  seem to have decided to capture a horse. They began with a furious attack, and  laid hands on a good mare well trained both for sport and battle. Her rider, (u)nwield, (d)rop, (=)adjust, or (i)nscribe._gglInventory: 26/52 slots Hand Weapons (go to first with ))  t - a +0 long sword (weapon)  a - a +4 falchion of freezing Missiles (go to first with ()  b - 3 throwing nets  f - 3 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)  y - a wand of digging (6) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [[0;10;1_ggmmPgUp|<] page up [Esc] exit[top]_gg{_gg_ggq...............#deadiverson the Carver...............#Human of the Shining One ***..................#Health: 85/85 ========================(..............#########Magic: 10/10 ========================..................#....#AC: 16Str: 17..................#...#EV: 13Int: 11.....................#SH: 14Dex: 14.....................#XL: 10 Next: 62% Place: Dungeon:7..###.##.@..........##Noise: ---------  Time: 8360.9 (0.0). #......##........##t) +0 long sword#.#._ggE..............#Throw: 3 darts (poison)#.............###§###............)#.§§ß##.............†.§.§.##^#...........##)§§§# §#............###§.P.# P..........<.## #§§### _a +4 falchion of freezing; a +0 robe _t - a +4 falchion of freezingAdjust (i)tems, (s)pells, or (a)bilities? t - a +4 falchion of freezing  Adjust to which letter? (? for menu, Esc to quit) _a - a +4 falchion of freezing; t - a +0 long sword (weapon)_ggN_gg'_gg _gg Drop what?26/52 slots (_ for help) Hand Weapons (select all with ))  t - a +0 long sword (weapon)  a - a +4 falchion of freezing Missiles (select all with () _gg 2 b - 3 throwing nets  f - 3 poisoned darts (quivered) Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (select all with /)y - a wand of digging (6) Scrolls (select all with ?)  g - 2 scrolls of vulnerability  j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation _gg [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]_gg(1 turn)+[Enter] accept (1 chosen)_gg _gg! ...............#deadiverson the Carver...............#Human of the Shining One ***..................#Health: 85/85 ========================(..............#########Magic: 10/10 ========================..................#....#AC: 16Str: 17..................#...#EV: 13Int: 11.....................#SH: 14Dex: 14.....................#XL: 10 Next: 62% Place: Dungeon:7..###.##.@..........##Noise: ---------  Time: 8360.9 (0.0). #......##........##t) +0 long sword#.#._gg ..............#Throw: 3 darts (poison)#.............###§###............)#.§§ß##.............†.§.§.##^#...........##)§§§# §#............###§.P.# P..........<.## #§§### _a +4 falchion of freezing; a +0 robe _t - a +4 falchion of freezingAdjust (i)tems, (s)pells, or (a)bilities? t - a +4 falchion of freezing  Adjust to which letter? (? for menu, Esc to quit) _a - a +4 falchion of freezing; t - a +0 long sword (weapon)_gg h1.9 (1-) Nothing wielded_gg _ggy d _t - a +4 falchion of freezing  Adjust (i)tems, (s)pells, or (a)bilities? t - a +4 falchion of freezing  Adjust to which letter? (? for menu, Esc to quit) _gg _a - a +4 falchion of freezing; t - a +0 long sword (weapon) _You are now empty-handed. You drop._gg'_ggWield which item (- for none)?  - - Unarmed (current attack) _ggInventory Items Hand Weapons (go to first with ))  a - a +4 falchion of freezing Floor Items ([,] to select) Hand Weaponsa +0 long sword [*] show all_ggdM[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip _gg_gg˕_ggџ...............#deadiverson the Carver...............#Human of the Shining One ***..................#Health: 85/85 ========================(..............#########Magic: 10/10 ========================..................#....#_ggsAC: 16Str: 17..................#...#EV: 13Int: 11.....................#SH: 14Dex: 14.....................#XL: 10 Next: 62% Place: Dungeon:7..###.##.@..........##_ggwkNoise: ---------  Time: 8361.9 (0.0). #......##........##-) Nothing wielded#.#...............#Throw: 3 darts (poison)#.............###§###............)#.§§ß##.............†.§.§.##^#...........##)§§§# §#............###§.P.# P..........<.## #§§### _t - a +4 falchion of freezingAdjust (i)tems, (s)pells, or (a)bilities? _ggánt - a +4 falchion of freezing  Adjust to which letter? (? for menu, Esc to quit) _a - a +4 falchion of freezing; t - a +0 long sword (weapon) _You are now empty-handed. You drop a +0 long sword._ggl_  Your +4 falchion of freezing glows with a cold blue light!_gg2.4 (0.5a) +4 falchion (freeze)_gg_gg < _a - a +4 falchion of freezing (weapon)_ggV3_ggE_gg3_gg_ggB_ggӭ,_gg_gg_gg,_gg_ggD_gg  ############## ##.....##.....## ##_ggA...##  #.#  #.#  ##  ..(####### ........#...5.4 (3.0# >_gg%.....#... #.#.#.............# ..#.................# .#.#..###.##.)..........## ...##......##........##  ..# #.#...............#  .. #.............###§##  #............)#.§§ß# _gg_gg+6.4 (4_gg_gg&; _Found a stone staircase leading down._gg= 3_ggB ,_gg`F _ggF _ggJ ,_ggL ,_ggM _gg~N _gg"Q ,_ggQ _ggR _ggT ,_ggWU _ggV _gg[ ,_gg] _gg` _gg a _ggb _ggg n _f - 5 poisoned darts (gained 2)_gg>k _ggk _ggl _ggo _ggr ,_gg-t _ggNv _ggy _ggz ,_gg~~ _gg ,_ggC _ggt R  There is a stone staircase leading down here._gg _gg  __gg _ggO _gg ,_gg _ggǔ _gg ,_ggߚ _gg) _gg _gg _gg` _gg _gg ,_gg¬ _gg? _ggG ,_gg _gg _gg ,_gg _gg! _gg ,_gg _gg _gg ,_ggA _gg _gg ,_ggg _gg _gg ,_gg _gg _gg ....<.# ..#.........##......##... ......# #.##.......###.#......... .....Y# ......§...# #........... ....... # §.......## #........... .......##.§§..§...# #............ .....#.#§§§§.§.§..# #^#.......... _gg .....#....§§.§...## #............ ####..#.#P§§P...### .........<.#.. .# .#..........# #.###.....o.o........# #####.#......(.....5[.......##..#### ............#...##..###.!. .................#..##....# o   orc wizard (wandering) ≈~~~≈~...#####.#.#.###...# o   orc (wandering) #####~...# #.#...# #......)...# #...#~..######.##..###..........#_gg 87.4 (21.0)  An orc and an orc wizard come into view._gg. _gg  ..§§§§§.....§.....§.§...§.o.  The orc shouts!_gg 6===8.4 (22_gg^ _gg 0 _The orc moves out of view._ggc^<.# . #.##....... ..........#  #§§§......## .......# .§.......# #^.§.....## .§P...### _gg_<  #.. ..§.....@.#  #.###.............o.....(.......... .[.......##..###....#...##..#........#..######.#.#.## #.#...# )_gg+<.# . #.##....... ..........#  #§§§......## .......# .§.......# #^.§.....## .§P...### <  #.. ..§.....@.#  #.###.............o.....(.........._ggE[.......##..###....#...##..#........#..######.#.#.## #.#...# )_gg64_gg_ggEb _An orc wizard is nearby!_gg#<.# . #.##....... ..........#  #§§§......## .......# .§.......# #^.§.....## _gg .§P...### <  #.. ..§.....@.#  #.###.............o.....(.......... .[.......##..###....#...##..#........#..######.#.#.## #.#...# )_ggc<.# . #.##....... ..........#  #§§§......## .......# .§.......# #^_gg .§.....## .§P...### <  #.. ..§.....@.#  #.###.............o.....(..........[.......##..###....#...##..#........#..######.#.#.## #.#...# )_gg_gg^_gg_ggb _An orc wizard is nearby!_ggk<.# ..#..##......##.# #.##.......###.#.Y# ..........# #. #§§§......## #._ggBJ##§§.......# #.#.#§.§.......# #^#.#...§.§.....## #.#..#.#P.§P...### .<.##.. ..§.# .#.# #.###.o.o# .#......(.# [.##..###.#_gg{G#...##..###.!......#..##.# ~~~≈~...#####.#.#.###._gg## o   orc (wandering)~...# #.#...# #......)...#. ...#~..######.##..###.#._gg  An orc comes into view. It is wielding a +0 dagger._ggO(I .§.§§§.§o.o.ooo_gg?-ooo 3 orcsThe orc wizard shouts! The orc shouts! You hear a shout!9.4 (1.0)_gg0_gg6u _An orc comes into view. It is wielding a +0 falchion._ggW.# #.####.#......._ggY# ....# #.... #§.§## #....)##§§§......# #.....†#.#§..§......# #^#...##...§§§.....## #....._gg?n## ##..#.#P§§P...####..........<.##  #.. ..........#..#o.........# #.###.§o.o.oo.# ###.#......(......# ......_gg..##..####### .#...##..###..!.......#..##..## _gg~~≈~...#####.#.#.###.##. o   orc warrior (polearm, wandering) _gg###~...# #.#...# #......)...#.. o   orc wizard ..#~..######.##..###....#.. ooo 3 orcs ∩..~................._gg#._gg  An orc warrior comes into view. It is wielding a +0 glaive._gg_gg_gg[<  The orc warrior shouts!_gg*m.§§§.._gg....o.ooo.......)_gg'90_ggf_gg| 1 _You block the orc's attack._gga K  You slash the orc! You freeze the orc._gg$ _ggE _gg _ggN .§o§.).o..oo 2 orcs_gg! 6--1.3 (0.9_ggl _ggN G _You kill the orc!_gggl|# #.##.###.#.Y# ._ggJmj# #.....# #§.## #....)###§§§§.....# #....†.#.#§..§§§....# #^#.##...§§§§....## #.....# #_ggm..#.#P§§P...####.o........<.## ##.. ...§......#..#.# ##.###.§..o.# .#......(._gg noo.# ##..###._ggUn6##...##..###........!...#....#..##..........##. ~_ggn:≈~...#####.#.#.###.##.~...# #.#...# #......)...#. .#~..######.##..###._gg8o3#. ..~.#._gg>zY  The orc warrior hits you from afar with a +0 glaive._ggb|_gg}_gg.§.oooo.._gg^79----2.3 (1.0-Potion _gg_ggH _You feel threatened and lose the ability to drink potions!  Things that are here: _a +0 whip; a +0 leather armour; an orc corpse_ggǢ_ggn .. You slash the orc wizard! You freeze the orc wizard._ggfe80--=3.2 (0.9_gg@_ggȞ^ _The orc wizard is almost dead._gg  You barely miss the orc wizard.The orc wizard is almost dead._gg~H  You block the orc warrior's attack._gg]o.o.o_ggP5-4.0 (0.8_gg _gg A _The orc wizard hits you but does no damage._ggV  You barely miss the orc wizard.The orc wizard is almost dead._gg:h o.You block the orc warrior's attack._ggp}  The orc wizard gestures at you while chanting._ggS  The puff of flame hits you but does no damage._gg^3=9 (0.9_gg _gg| 1 _You block the orc's attack._gg  You closely miss the orc wizard.The orc wizard is almost dead.You block the orc warrior's attack. The orc closely misses you._gg81-5.8_ggN_gg _The orc wizard barely misses you. The orc barely misses you._ggK 1  You hit the orc wizard. You freeze the orc wizard. )oo 2 orcs  You kill the orc wizard!_gg{X X3-6.7_ggZ _gg^ w _The orc warrior barely misses you. You block the orc's attack. x2_ggW I  You hit the orc. You freeze the orc._gg7 V  You kill the orc!_ggF .   orc_gg h64----==7.7 (1.0_gg _ggJ _The orc warrior hits you from afar with a +0 glaive!_gg}  You hit the orc but do no damage. You block the orc warrior's attack._gg|59--------8.6 (0.9_gg_gg7: _The orc hits you with a +0 falchion._gg|   You completely miss the orc. You block the orc warrior's attack._ggZ C--9.5_gg_gg 1 _You block the orc's attack._ggi  You hit the orc. You freeze the orc.  The orc is moderately wounded._ggj*400.4_ggtt_ggxU _You block the orc warrior's attack. You block the orc's attack._gg( I  You hit the orc. You freeze the orc._gg&8 )  You kill the orc!_gg(= `60--1.3_gg~I _ggN 9 _You block the orc warrior's attack._gg# #.##.###.#. .Y# .# #......# #§.## #.....)#.##§§§§.....# #.....†.§ .#.#§..§.§....# #^#.._gg'##)#...§§§.....####......###§ ..#.#P§§P...####..........<.## #§ #.. ...§......#))#.# # #.###.§.)@o.# # #.#......(.# ##..###.##### #...##..###..!...#....#..##..........##. _gg≈~...#####.#.#.###..........##. #~...# #.#...# #......)...#. #~..######.##..###.#. .~.#._gg_ggy-2.3 (1.0_ggv_gg;9 _You block the orc warrior's attack._ggk5_gg96-3.2 (0.9_gg?_ggC_ _You hit the orc warrior but do no damage._gg( _ggW You slash the orc warrior! You freeze the orc warrior.  The orc warrior is moderately wounded._gg861=_ggI&4.2 (1.0_gg_gg)Y _The orc warrior closely misses you._ggt  You slash the orc warrior! You freeze the orc warrior.  The orc warrior is severely wounded._gg n53---=5.0 (0.8_gg _gg @ _The orc warrior hits you with a +0 glaive!_gg߱  You hit the orc warrior but do no damage.The orc warrior is severely wounded.You can drink potions again._gg ;-9 (0.9_ggۻ _ggƿ 9 _You block the orc warrior's attack._gg  You hit the orc warrior but do no damage.The orc warrior is severely wounded._ggn B-6.8_ggC _gg( 9 _You block the orc warrior's attack._ggO}  You closely miss the orc warrior.The orc warrior is severely wounded._ggv~h4=--7.8 (1.0_gg]_ggX _The orc warrior barely misses you._ggQ _ggr  You hit the orc warrior but do no damage.The orc warrior is severely wounded.8_gg3_ggCB _The orc warrior hits you but does no damage._gg>  You hit the orc warrior. You freeze the orc warrior.  The orc warrior is almost dead._gg? -9.6 (0.8_ggG _gg/K 9 _You block the orc warrior's attack._gg   You hit the orc warrior but do no damage.The orc warrior is almost dead.5=10.4_gg& _ggW 9 _You block the orc warrior's attack._gg  You barely miss the orc warrior.The orc warrior is almost dead._gg-1.3 (0.9_gg_gg!B _The orc warrior hits you but does no damage._ggde  You barely miss the orc warrior._gg(2.2_ggm_ggo_ _The orc warrior is almost dead._ggeXY  You hit the orc warrior. You freeze the orc warrior._gg~ge)_ggClL663.1_ggxu_gguxO _You kill the orc warrior!_gg# #.##.###.#. Y# .# #.......# #§.## #......)#.§##§§§§.....# #......_ggP†.§. #.#§..§.§....# #^#...##)§ #...§§§.....####....###§. .#.#P§§P...####....<.## #§ .. ...§......#))#.# ##. .###.§.).@.# # .#......(.# ###..###.##### #_gg3s#...##..###..!...##..##....##. ~...#####.#.#.###..........##. ~...# #.#...# #......)...#. ~..######.##..###..........#. ~.#._gg_ggm_gg 5-4.1 (1.0_gg~ _gg0  Things that are here: _a +0 glaive; a +0 chain mail; an orc corpse_ggk 3_gg _gg _gg! ,_gg& _gg' S7=_gg* _gg60 ,_gg0 _gg2 ,_gg3 _gg5 _ggB6 K8=_gg8 _gg; _gg; _gg{> _ggKB ,_ggrD _ggG O9_gg&_gg(,_gga*_gg,_gg-%7_gg._gg00_gg0_ggw2_gg5,_ggc7_gg\:a8=_gg;_gg?,_ggA_gg*F,_ggH_ggMk9=_ggcO_ggEQ,_ggAS_ggfT_ggU_ggaV_ggY<80_ggZ_ggO],_gg^_ggy`_gg`_ggPb_gge_gg6f%1_gg+h_ggl,_ggn_ggs,_ggv_gg{_gg|K2=_gg}_gg'B_gg,_gg_gg}k3=_gg_ggJ,_ggh_ggP,_ggL_ggҜ_ggG%4_gg_gg,_gg:_gg8,_gg_ggڱ - _You start resting._ggr098.1 (84.0)_ggZ5=9.1 (85_ggH_gg9" _HP restored._ggI3_gg_gg_gg_ggd_gg`_gg"+_gg._gg%/_gg0_gg9  Things that are here:  a +0 glaive; a +0 chain mail; an orc corpse_gg<_ggs= __ggE?_ggE_ggJ_ggK9=_ggN_ggW  Things that are here:  a +0 whip; a +0 leather armour; an orc corpse_gg[_gg8\ __gg^_ggc_ggh,_ggl_gg4r_gg\v_ggv_ggx_ggO}_ggŁ_gg_gg%_ggZ_ggm,_gg_gg_gg,_gg_gg_gg_ggB_ggQX_gg _gg,,_gg_gg_gg,_gg<_gg_ggsB_gg_ggV,_gg_gg_ggk,_ggL_ggF_ggh_gg_gg _ggO _gg} ,_gg_ggB_gg_gg_gg!_gg "_gg"_ggr(_gg*_gg+_gg+_gg1_gg3,_ggg4_gg6_gg8,_gg9_gg/<_gg=_gg>_gg>_ggA_ggB,_ggC_ggE_ggHG,_gg;H_ggL_ggN_gg!O_ggO_gg.Z_gg\,_gge^_ggb_gge,_ggf_ggj_gg>m,_ggYn_ggq_gg t,_ggiu_ggNx_ggz,_ggQ{_gg~_gg/_gg_ggł_gg܅_gg{,_gg_gg_gg,_gg_gg_gg,_gg_gg _gg_ggP_gg~_gg_ggz,_ggN_gg_ggX,_gg_gg[_gg,_gg_gg_gg[,_gg:_gg _gg_gg,_gg_ggd_gg,_gg[_ggI_gg,_gg_gg_gg4,_gg`_gg_ggw,_gg_gg_gg_ggH_gg"_gg_ggG,_gg_gga_gg,_gg_gg _gg[ _gg _gg _gg _gg ,_gg _gg^ _ggM ,_gg _gg  You see here the +1 robe "Rucaif Ixti" {+Inv rF- rCorr Dex+5}._gg _gg-  __ggR" _gg$ _gg' ,_ggi) _gg+ _gg/ B_ggO6 _gg8 ,_ggN: _gg< _ggF? ,_gg@ _ggC _ggE ,_ggG _ggI _ggL ,_ggM _gg$T _ggW ,_ggvW _gg[ _gg/^ _gg^ _gg_ _gg1b _ggd ,_ggUf _gg$h _ggj _ggk _gg6l _ggao _ggnq ,_ggLr _gggt _ggv _ggv _ggv _ggw _ggy ,_ggy _ggPz _gg%{ _gg`{ _gg{ _ggk| _gg+} _gga} _gg} _gg _gg _gg _gg _gg _gg՘ _gg _gg _ggӞ _gg ,_gg _gg _gg _gg̨ _ggo _gg7 _gg _ggU _ggh _gg& _gg ,_gg _gg! _gg ,_gg0 _gg5 _gg ,_gg _gg _gg B_gg _gg{ ,_ggT ,_ggg _gg _gg _gg$ _gg ,_gg _ggk #..≈#####≈......... ...~~~~~≈~........##......_gg ................##......:....##..#.##..........##....# ..##..##.##........#...# ##.....##.........>...# _ggA #.#########.......#..)###..###[# #.# #...........))##.#...## ._gg .# ######@....##))).[.....586.1 (87# ##########..Pß##.##....... .#######..........ß_gg b.........##########...#....### ########## #####.#### #### _gg_ _gg _gg _gg T _Key pressed, stopping explore._ggSQ  __ggsT _ggc X_ggt n_gg} B_gg _gg _ggw X_gg _gg _gg _gg _gg _gg{ _gg ,_gg _gg _gg ,_gg _gg _gg _gg _ggZ _gg _gg _gg( _ggn _ggl _gg _gg _gg _gg# _gg ,_gg4 _gg' _gg3* ,_gg&/ _gg/ _gg 4 ,_gg5 _gg*9 _gg< _ggH= _gg@ _ggC _ggF _gg9G _ggI _ggN _gg ,_gg%? _gg@@ _ggA ,_ggB _ggE _ggF ,_gg1G _gg^b   ######### .##.....## ......##_ggMc  ........# ..........# ..........# ..........#########  ...........#..@.#  648.1 (62............#...##  ................##  .......#  .##.)..........##  ....##........##    ...............#   ...........###.## _ggc   ..........)#.§§ß#  _ggdd _gg?g _ggh E _Done exploring._gg I_ggĝ 0.0).......§_gg _gg _ggw E _Done exploring._gg3bI_gg_gg_ggK_ggp _ggݕ7_Done exploring._gg_ggA  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1          _ggu  b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0  _gg2             f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0      h + Shields7.2   8.0   0       i - Stealth   0.0   0.8  +1          _gg^                                    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  _gg[!] training|cost|targets_ggB_ggC_ggL  deadiverson the Carver #########  Human of the Shining One ***... .##.....##  Health: 85/85 ======================== .........##  Magic: 10/10 ======================== ..........#  AC: 16Str: 17 ..........#  EV: 13Int: 11 ..........#  SH: 14_ggMDex: 14 ..........#########  XL: 10 Next: 66% Place: Dungeon:7 .............#..@.#  Noise: ---------  Time: 8648.1 (0.0) .............#...##  a) +4 falchion (freeze) ................##  Throw: 5 darts (poison) ................# .##.)..........## ....##........##   ...............#   ...........###.##   _ggMM..........)#.§§ß#   _There is a stone staircase leading down here.  Things that are here: _a +0 antimagic mace; a +0 robe _Done exploring. _ggFNf_Done exploring. _Done exploring._ggT_gg*U_ggZ_gg\_ggf_gg93_gg_gg_gg _ggZ E _Done exploring._ggyX _ggXY 3_gg) 4_gg _ggv E _Done exploring._gge _ggS 3_gg 4_gg$ V _Done exploring._gg>-3_ggA._gg\kJ_ggym_gg  You are illuminated by a divine halo. You are glowing.  Your movement speed is average.  Your attack delay is about 0.8 (and is slowed by your shield)._gg_gg[_gg6  Your damage rating with your +4 falchion of freezing is about 16 (Base 8 x 110%_(Dex) x 141% (Skill) + 4 (Ench))._gg_gg _gg;&_gg(F _Unknown command._ggw_gg53_gg_gg_gg_ggE _Done exploring._ggG _ggG _gg(H _ggs _ggt _gg'z _gg } E _Done exploring._ggT _gg 3_gg>4_gg$_gg&E _Done exploring._gg5k_ggk3_gg_gg_gg_ggڧE _Done exploring._gg/_gg03_ggg4_ggFj_ggmE _Done exploring._gg|I_gg_gg/_gg#_gg(& Done exploring._gg _ggĦ 3_gg 4_gg9 _gg0 _ggR _ggS 3_gg _ggE _gg _gg _ggWF_ggGWhere to? (Tab - Bailey @ (x,y), ? - help)  D - Dungeon  T - Temple _gg"_gg7p  deadiverson the Carver #########  Human of the Shining One ***... .##.....##  Health: 85/85 ======================== .........##  Magic: 10/10 ======================== ..........#  AC: 16Str: 17 ..........#  EV: 13Int: 11 _gg:9..........#  SH: 14Dex: 14 ..........#########  XL: 10 Next: 66% Place: Dungeon:7 .............#..@.#  Noise: ---------  Time: 8648.1 (0.0) .............#...##  a) +4 falchion (freeze) ................##  Throw: 5 darts (poison) ................# .##.)..........## ....##........##   ...............#   ...........###.##   ..........)#.§§ß#   _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _gg:c_Done exploring._gg)H_ggJ: __ggO_gg=P_ggS,_ggT_ggX_ggO_gg_gg_ggտ_gg_gg_ggv_gg_gg_gg%,_gg _ggW_ggv_gg_ggY_gg~_ggI_gg_gg#_gg_gg_ggM_gg_gg_gg:_gg_gg_gg_gg/_gg_gg_ggV_ggT_gg_gg_gg` _gg _ggs _gg-_ggX _ There is a stone staircase leading down here._gg_gg_ggR$ __gg_gg4 8_gg _ggn ,_gg _gg  ### ..# _ggL F#.## ##.. #66.9 (18.8) ......?# ....###  .##  _You climb downwards.  Found a scroll of teleportation._gg _gg w _There is a stone staircase leading up here._gg)w3_gg;x_ggwz_gg_ggP __gg`,_gg]_gg,_gg_ggx _x - 2 scrolls of teleportation (gained 1)_gg_gg_gg_ggY_gg,_gg_ggh_gg*_gg_gg_gg@_gg_ggޚ_ggJ_gg_ggl### ##### ..# #....# #.## ......# ##..# #.....####.<.# _gg'{.#....@....### 73.9 (7.0) #.......####  ##...####  #...#........(.#... _gg _gg_gg+4.9 (8_gg_gg|% _Found 7 stones._ggU_ggI_ggF_gg_ggq_gg_gg,_ggz_gg_gg_ggW_gg1_gg_gg_gg__gg<_gg{_ggl_ggh,_gg_gg#####..###....## #.##_gg@ #......## ##..##.#.....####.<.# #.#.........### #.......## ##...####  #....#  #..@.# .......)..# _gg;##..(......###.....##...#...## ##... ##.. ##. #.# #._gg ##....## #.##......## ##..#.#.....####.< #.#.........##_ggr #.......#### ##...####  #....# #####.......@..###..(......# ##.....##...##..o   orc (asleep).o_gg6,81.9 (7_gg+2.9 (8_gg] _gg _An orc comes into view. It is wielding a +0 whip. _You see here a +2 heavy war axe._gg  #.##  #......## ##..#  #.#.....####.<.#  #.#.....  #.....  _gg##...####  #....# #####....##  .......@..#  _gg ##..(......# _ggG$ ##.....##...# _ggtZ ##...## ##...  ##.. ##.  #.#_gg #. _ggV.o_ggq   #.##  #......## ##..#  #.#.....####.<.#  #.#.....  #.....  ##...####  _ggq >#....# #####....##  .......@..#  ##..(......#  _gg#r ##.....##...#  _ggSr ##...## ##... ##.. ##. _ggtr #.# #._ggr : .o _ggr _gg| _ggX} _ggj _gg [ _An orc is nearby!_gg ` #......## ##..# #.#.....####.<.# #.#.........### #.......####  ##...####  #....# .#####....##.......)..## ##..(.@....# ##.....##...#_ggL  ##...## ##... ##..# ##. #.## #.o   orc priest (asleep) .ooo 2 orcs (asleep) _gg :oo_gg w  An orc and an orc priest come into view._ggb _ggX _gg #ooo.oo1 wandering).o_gg 4==3.9 (1_gg# _gg' N _The orc shouts! The orc priest shouts! You hear a shout!_gg #.###.<.# .#.........### .......#### ##...#### #....# .#####....#_gg #.......)##..(......# ..@##...### ##...# ##. .##_ggN #oo. oo 2 orcs (1 wandering)_gg z#.o#._gg _gg _gg _gg+ _gg  o.ooo   orc priesto._gg@ nooo 3 orcsThe orc shouts!_gg/ .=4_ggQ _gg"% _An orc comes into view. It is wielding a +0 whip._gg% _gg0 _gg4 _ggz3 #.#.........### #.......####  ##...####  #....# .#####....##_gg3" #.......)..## ##..(......# ##.....##...# ##..@## ##... ##..# ##. #o## _gg3 #. oo#o. #.. #.._gg9_gg;_gg8<_gg =_ggND}o.ooo._gg(E0---5_ggYP_ggT_ggd ####  ##...#### # #....# .#####....## #.......)..## ##..(......# ##.....##...# ##...## ##... ##@o# ##. #.##  #o_ggeJ oo##..# #... #..) ##.._gg2k_ggdl_gg[n_ggdzuoo.o_ggzP=--6_gg_ggGY _Found a dagger. The orc misses you._gg- I  You hit the orc. You freeze the orc._gg< l) 2 orcs_ggA -7.8 (0.9_ggO _ggrR G _You kill the orc!_ggG I  You hit the orc. You freeze the orc._gg=Y )   orcYou kill the orc!_gg]  The orc priest calls down the wrath of Beogh upon you._gg _gg2 (8.7_ggi _gg0 ( _You easily resist._gg#...#### # #....#  .######.......)..## ##..(...... ##.....##...# ##...## ##... ##.)# ## #@## o# .o#..#...)#.. #..._ggC9.7 (1.0_gg_ggn _The orc priest hits you but does no damage.  Things that are here: _a +0 dagger; a +0 scale mail_ggP  You slash the orc priest! You freeze the orc priest!  You kill the orc priest!_ggYQ_ggKS_gg[6o._gg\}o   orc_gga>7=90.6 (0.9_ggh_gg|lX _The Shining One accepts your kill._gg_gg\0-1.5_gg/_gg;j _You barely miss the orc. You block the orc's attack._ggc_ggeG-2.3 (0.8_ggi_ggBmj _You barely miss the orc. You block the orc's attack._gg K  You slash the orc! You freeze the orc._gg D)_ggu -3.2 (0.9_ggM _gg G _You kill the orc!_ggPC _ggD _gg}N _ggoQ H _No target in view!_ggƺ3_gg_gg<_gg_gg4: __gg  Things that are here:  a +0 whip; a +0 club; an orc corpse_gg_gg __gg_ggu_gg_gg_ggl_ggs_gg,_ggi_gg_ggg_gg_gg_gg[_ggM,_gg_gg >  You see here a +0 dagger._gg _gg __gg_gg_gg7_ggb_gg_gg'_gg_gg_ggz _gg"_ggn%_gg%_gg'_gg?+_gg/,_gg0_gg8_gg;,_gg'=_gga@_ggK,_gg_gg_gg,_ggE _ggt>  You see here a +0 dagger._gg_gg __ggS_gg_gg,_gg_ggv!_ggP$_gg}$_ggN&_gg@)_gg@-_ggt-_gg/_gg6  Things that are here:  a +0 whip; a +0 club; an orc corpse_gg:_gg/; __gg?_gg[F _You see here a +0 dagger. _You see here a +0 dagger.  Things that are here: _a +0 whip; a +0 club; an orc corpse  a +0 dagger; a +0 scale mail_gg0J_ggJ __ggL_ggRz  Things that are here:  a +0 whip; an orc corpse_ggeV_ggFW __gg Y_gg__ggc_ggTc_gge_ggh_ggl_ggl_ggn_ggq_gg  _gg/##.....##...###...# _ggU ##...#####@.....# _ggk(-721.2 (28._gg 0)_gg|##.)# ###...##_gg _ggT#)## ####_ggɭO ##)# _gg _gg=#..# _ggO #..## _gg"  _gg3. _ggD=#...# _ggT  _gg}l #..)## _gg9  _gg%##...### _ggE _ggJ_ggF-2.2 (29_gg_gg9 _Found an escape hatch in the floor._gg+_gg',_ggC._ggk3_gg6_gg7_ggW;,_gg<_gg=_ggN>_gg?_gg+B_ggVB_ggHC_ggeH_ggJ_ggJ_ggWK_gggM_gg6O,_ggO_ggwQ_ggTS_ggS_gg T_gg:W_ggX,_ggX_ggJZ_ggk[_gg[_gg[_gg&^_gg_,_gg0a_ggb_gg^d_ggd_gge_ggg_ggMi_gg{i_ggi_gg _ggj _gg. _ggG _ggR ,_gg _gg _gg& _ggJ _gg\ _gg{ _gg _gg _gg _gg' _gg ,_gga _gg _gg ,_gg _gg: _gg/ ,_ggN _ggi _gg ,_gg+ _gg# _gg' ,_gg) _ggK, _ggP. ,_gg/ _gg2 _gg4 ,_ggQ5 _gg6 _ggW8 ,_gg79 _gg*< _ggB . ###..#####..(.....# ##..# ##..... ..# #..# ##...#  #.## ##.)# #.. #.## #)## #.)# #..# ##)#_gg2C  ##...## #..# #..##.....####..# #.......@..#...# #...#8108.0)_ggXC ...............# #..)#..............# ##..>#######.)....# #.._ggC  #......# ## ##..#..## #..##..# #.####.###.# #.#_ggK _ggrL ,1.2 (19_gg(S _ggV ; _Found a stone staircase leading down._gg_ggF_gg߅_gg_gg_ggɑB_ggP_gg_gg_ggǙ_ggt_gg_gg._ggԠ_gg_gg>_gg_ggRB  You see here a +0 long sword._gg_gg __gg,_gg_gg,_gg0_gg._gg_gg_gg_gg_ggW_gg_ggx_gg_gg,_gg_gg_ggJY #### ### ### #..## #.#.#  #.#... #..# _gg.#####.^.####.# K..... #.#.#.#..###....# #.....##... #..## ###..#####. #.@## ##..# # ##..## #..#  _gg##..## #.##  ##..# #.##_gg #.)## #..##...## #..# K   kobold demonologist (asleep).##.....####..#...........#...#................#_gg 20.2 (9.0)  A kobold demonologist comes into view. It is wielding a +0 dagger._gg X .  The kobold demonologist shouts!_gg|8==1.2 (10.0)_gg_ggd@ _The kobold demonologist moves out of view._gg_ggN_gg_gg f # # ### ##..# #..## #.#.# #... #..##.#####.^.####.# #......#.#.#..##...K. #.....##.###..###--#..#.. #..#..## #.###..# #.## #.)## #..#K   kobold demonologist ##...## #..# .##.....####..# #...#2.0)_ggTM.K_ggOF--3.2 (2_ggf_gg_ggdd ###  #..## #.#.#  .  #..#  #.##### #..^  #......  ....K..##  #.@##  ##..## ##..#  ##..## #..#  ##..## #.##  ##..# #.## _gge #.)## #..#  ##...## #..#  .##.....   _gg ###  #..## #.#.#  .  #..#  #.##### #..^  #......  ....K..##  #.@##  _ggB##..## ##..#  ##..## #..#  ##..##  ##..#  #.)## #..#  ##...##  .##..... _gg _gg( _gg _ggo j _A kobold demonologist is nearby!_gg H  ###  #..## #.#.#  .  #..#  #.##### #..^  #......  ....K..##  _ggH !#.@##  ##..## ##..#  ##..## #..#  ##..## #.##  ##..# #.##  #.)## #..#  ##...## #..#  .##.....   _gg  ###  #..## #.#.#  .  #..#  #.##### #..^  #......  _gg ....K..##  #.@##  ##..## ##..#  ##..## #..#  ##..##  ##..#  _gg #.)## #..#  ##...## _gg = .##....._gg# " _gg` _gg- _gg+ _gg5 j _A kobold demonologist is nearby!_gg   ### ##.. #..## #.#.#.# #.#... #..# #.#####. #..^.####.##......# #.#.#.#...K..## #.....## #@.## ###.. ##..## ##..#  ##..## #..# _gg ##..## #.## ##..# #.## #.)## #..# ##...## #..# .##.....####..#  .#...#_ggV_gg2G.K_gg%)4.2 (1 _ggY __gg_gg_gg~  55   white imp (summoned)You closely miss the kobold demonologist.==_gg  5_gg_ggw _The kobold demonologist gestures wildly while chanting._gg  You hit the kobold demonologist. You freeze the kobold demonologist.  The kobold demonologist is lightly wounded._gg _gg _gg .-6.1 (0.9_gg" _ggH& } _The kobold demonologist casts a cantrip, but nothing happens._gg8u  You hit the kobold demonologist but do no damage.The kobold demonologist is lightly wounded._gg .5The white imp sputters._gg B-7.0_gg _gg A _You block the kobold demonologist's attack._gg   You hit the kobold demonologist. You freeze the kobold demonologist.  _ggXThe kobold demonologist is moderately wounded._gg+8 (0.8_gg߳_ggRW _The white imp closely misses you._ggy  You hit the kobold demonologist but do no damage.The kobold demonologist is moderately wounded.You block the kobold demonologist's attack._ggz(8.6_gg_gg7 _You block the white imp's attack._ggWE  33   soul eater (summoned)K   kobold demonologist5   white imp (summoned)You hit the kobold demonologist. You freeze the kobold demonologist.  The kobold demonologist is heavily wounded.The kobold demonologist gestures wildly while chanting._gg@F 6==9.6 (1.0_ggN _ggPS @ _The white imp hits you but does no damage._gg   You hit the kobold demonologist but do no damage.The kobold demonologist is heavily wounded._gg_gg˝  The kobold demonologist looks braver for a moment._gg7--30.5 (0.9_ggp_ggzW _The white imp closely misses you._gg3S  You hit the kobold demonologist but do no damage._gg[ K3The kobold demonologist is heavily wounded._gg}\C--1.4_gg?d_ggf7 _You block the white imp's attack._ggW  You hit the soul eater. You freeze the soul eater._gg K.The soul eater is lightly wounded._gg(2.3_ggH_ggQO _The white imp misses you._gggA_ggBVEvoke which item? _gg"CWands _gg9C y - a wand of digging (6) [!] read|quaff|evoke_ggOC][?] describe selected_gg _ggDdeadiverson the Carver### Human of the Shining One ***...### ##..# Health: 85/85 ========================#..## #.#.# Magic: 10/10 ========================_ggh..# #.#... #..# AC: 16Str: 17#.#####. #..^.####.# EV: 13Int: 11##....K.# #.#.#.#..# SH: 14Dex: 14_ggJ......35## #.....##. XL: 10 Next: 67% Place: Dungeon:8#@.## ###..#### Noise: =--------  Time: 8832.3 (0.0)##..## ##..#a) +4 falchion (freeze)##..## #..#Throw: 5 darts (poison)##..## #.##_gg8b##..# #.###.)## #..#3   soul eater (summoned)_ggm*##...## #..#K   kobold demonologist.##.....####..#_gg5   white imp (summoned)...........#...#You hit the kobold demonologist but do no damage.The kobold demonologist is heavily wounded. _ggք_You block the white imp's attack.  You hit the soul eater. You freeze the soul eater.  The soul eater is lightly wounded. _The white imp misses you._gg _ggP  Okay, then._gg1_gg_gg#. __gg_ggrEvoke which item? Wands _ggy y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected_gg+_ggQ _gg0 deadiverson the Carver### Human of the Shining One ***...### ##..# Health: 85/85 ========================#..## #.#.# Magic: 10/10 ========================..# #.#... #..# AC: 16Str: 17#.#####. #..^.####.# EV: 13Int: 11##....K.# #.#.#.#..# SH: 14Dex: 14......35## #.....##. XL: 10 Next: 67% Place: Dungeon:8#@.## ###..#### Noise: =--------  Time: 8832.3 (0.0)##..## _ggk1 ##..#a) +4 falchion (freeze)##..## #..#Throw: 5 darts (poison)##..## #.####..# #.###.)## #..#3   soul eater (summoned)##...## #..#K   kobold demonologist.##.....####..#5   white imp (summoned)...........#...#The kobold demonologist is heavily wounded. _You block the white imp's attack.  You hit the soul eater. You freeze the soul eater.  The soul eater is lightly wounded. _The white imp misses you. _Okay, then._gg: n  Okay, then._ggQA _ggE . __gg"D}Evoke which item? Wands  y - a wand of digging (6) [!] read|quaff|evoke[?] describe selected_ggx _ggO _gg" vdeadiverson the Carver### Human of the Shining One ***...### ##..# Health: 85/85 ========================#..## #.#.# Magic: 10/10 ========================..# #.#... #..# AC: 16Str: 17#.#####. #..^.####.# EV: 13Int: 11##....K.# #.#.#.#..# SH: 14Dex: 14......35## #.....##. XL: 10 Next: 67% Place: Dungeon:8_gg #@.## ###..#### Noise: =--------  Time: 8832.3 (0.0)##..## ##..#a) +4 falchion (freeze)##..## #..#Throw: 5 darts (poison)##..## #.####..# #.##_gg #.)## #..#3   soul eater (summoned)##...## #..#K   kobold demonologist.##.....####..#_gg 5   white imp (summoned)...........#...# _You block the white imp's attack.  You hit the soul eater. You freeze the soul eater.  The soul eater is lightly wounded. _The white imp misses you. _Okay, then. _Okay, then._gg+ P  Okay, then._gg _gg _gg . __gg A_Okay, then. _Okay, then. _Okay, then.You hit the soul eater but do no damage.  The soul eater completely misses you._gg _ggp  The kobold demonologist begins to cast a cantrip, but forgets the words!_ggq#2_ggq6-3.3 (1_ggz_gg~T _The white imp hits you. The white imp freezes you. You resist._gg)%M55   iron imp (summoned)5   white imp (summoned)  The kobold demonologist begins to cast a cantrip, but forgets the words! _The white imp hits you. The white imp freezes you. You resist.  You block the soul eater's attack.casts a spell.3-4.2 (0.9 _The white imp completely misses you._gg  You hit the soul eater but do no damage.The soul eater is lightly wounded._gg8M.K_ggP: 69/83 (85)----=5.1Drain_ggx_ggǙ _The soul eater hits you! You partially resist. You feel drained._gg!,  You hit the soul eater but do no damage.The soul eater is lightly wounded.  The white imp hits you. The white imp freezes you. You resist._gg88 .5The soul eater hits you!_gg= _ggN _gg u53--------6.1 (1.0_gg _gg v _The kobold demonologist looks encouraged for a moment._gg9  You barely miss the soul eater.The soul eater is lightly wounded._ggB *The white imp gestures at you._gg/  ###  #..##  .. #   #.#####. #..^ ##....5K#  ......35## _ggU #*.##  ##..## ##..#  ##..## #..#  ##..## #.##  ##..# #.##  #.)## #..#  ##...## #..#  ..   The puff of frost misses you._gg ###  #..##  .. #   #.#####. #..^ ##....5K#  ......35##  #*.##  ##..## ##..#  ##..## #..#  ##..## #.##  ##..#  #.)## #..#  ##...## #..#  ..     The soul eater draws from the surrounding life force!.5@49-----7.0 (0.9 _gg)_The soul eater is healed._gg _ggu _gg6 _gg F _Unknown command._ggJ####### ##..#..## #.#.# ..# #.#... #..# #.#####. #..^.####.# ##.....K# #.#.#..#.....535#_gg?KU....##.. #..###..###### ##..# ..# #.##  #.## _ggsKh.)## #..###...## #..# .##.....####..# _ggK...........#...# .....# _ggd^_gg3f *The white imp gestures at you._gg<_ggr  You block the puff of frost.  The soul eater attacks as it pursues you!_ggA_ggS5..K3._gg30/81-------=8.0 (1.0_gg_gg0 _The soul eater hits you! You partially resist. You feel drained._ggK _ggeN URead which item? _ggN Scrolls  g - 2 scrolls of vulnerability  j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog_ggN Wr - a scroll of silence  s - a scroll of enchant weapon _ggN & v - a scroll of noise _ggN  x - 2 scrolls of teleportation [!] read|quaff|evoke_ggN G[?] describe selected_gg _gg` _ggR #### deadiverson the Carver### ##..## Human of the Shining One ***...#..## #.#.# HP: 30/81 (85) ========----------------..# #.#... #..# MP: 10/10========================_gg #.#####. #..^.####.# AC: 16Str: 17##....5.# #.#.#.#..## EV: 13Int: 11......K5## #.....##.. SH: 14Dex: 14#3.## ###..##### XL: 10 Next: 67% Place: Dungeon:8##@.## ##..# # Noise: ===------  Time: 8838.0 (0.0)_gg /##..## #..#a) +4 falchion (freeze)##..## #.##_gg Throw: 5 darts (poison)##..# #.##Drain_gg5 U#.)## #..###...## #..#3   soul eater (summoned).##.....####..#K   kobold demonologist...........#...#5   iron imp (summoned)................#5   white imp (summoned) _ggJ X_The soul eater is healed. _Unknown command._ggh The white imp gestures at you.You block the puff of frost.  The soul eater attacks as it pursues you! _The soul eater hits you! You partially resist. You feel drained._gg| _gg  As you read the scroll of teleportation, it crumbles to dust.  You feel strangely unstable._ggx ***The white imp gestures at you._ggx  ###  #..## #.#.#  .. #  #..#  #.#####. #..^  _gg1y ##....5.#  ......K5##  #3*##  ##*.## ##..#  ##*.## #..#  ##..## #.##  ##..# #.##  _ggky F#.)## #..#  ##...## #..#  ..#_ggy   ..._ggy   _ggy = The puff of frost misses you._gg!k ###  #..## #.#.#  .. #  #..#  #.#####. #..^  ##....5.#  _gg!......K5##  #3*##  ##*.## ##..#  _gg!9##*.## #..#  ##..## #.##  _gg:"##..# #.##  #.)##  _gg"##...## #..#  ..#  ...   _gg+l.@._gg+*25-_gg+h-9.0 (1Tele Drain_gg3_gg6K _The soul eater draws from the surrounding life force!_gg_gg8-_gg _gg F _Unknown command._ggw3### ##..#..## #.#.# ..# #.#... #..# #.#####. #..^.####.# ##....5.# #.#.#..###......K5#....##... _gg4\#3.###..#######. ##..# ..# #.##  #.## .)## #..# ##....##.....####..# ...........#...# ..........# .# _gg9_gg:_gg;_gg=_ggE..5K53_gg_Gc6---40 __ggP_ggU_ggB ,#..## #.#.# ..# #.#... #..# #.#####. #..^.####.# ##......# #.#.#..####.......5#....##.... #K5###..#######3. ##..# ...# #.##  #.## .)## #..# ###...## #..# #.##.....####..# #...........#...# #................# #.........# #..>#######.)....# _ggA .5.53_ggɤ A--1_gg| _gg _ggCg_ggjDrink which item? Potions  e - 2 potions of enlightenment _ggk h - 2 bubbling ruby potionsi - a potion of cancellation  k - 2 potions of mutation  q - a potion of attraction  u - a potion of magic _gg?k[!] read|quaff|evoke[?] describe selected_ggI _gg_gg"c#..## #.#.# ## deadiverson the Carver..# #.#... #..# # Human of the Shining One ***...#.#####. #..^.####.#HP: 26/81 (85) =======-----------------##......# #.#.#.#..#### MP: 10/10========================........## #.....##.... AC: 16Str: 17#K5## ###..#####.. EV: 13Int: 11_gg###.5## ##..# ##. SH: 14Dex: 14##3.## #..# ## XL: 10 Next: 67% Place: Dungeon:8##@.## #.## # Noise: ---------  Time: 8841.0 (0.0)##..# #.##a) +4 falchion (freeze)#.)## #..# # Throw: 5 darts (poison)##...## #..# # Tele Drain.##.....####..# #...........#...# # 3   soul eater (summoned)................# # K_gg#   kobold demonologist................# # 5   iron imp (summoned)..>#######.)....#5   white imp (summoned)As you read the scroll of teleportation, it crumbles to dust.  You feel strangely unstable.The white imp gestures at you.The puff of frost misses you. _The soul eater draws from the surrounding life force! _Unknown command._gg+P  Okay, then._gg+_gg2_gg_5. __gg4..# #.#... #..# #.#####. #..^.####.# ##......# #.#.#..#####........#....##..... #K5###..#####..(##.5 ##..# 3._ggѬt..# .#.##  #.## .)## #..# ####...## #..# #..##.....####..# #............#...# #...........# #........# #_gg..>#######.)....# ..# #......# #_gg_gg+# #.## ##.)# ###...## # #.## #)## ##### ## #..# ##)# .## #..# #..# ..####..# #..## _gg/....#...# #...# ........# #..)## ........#.### ##.)....# #.@...##  #......# ###....#  ##..#..# ###..#  #..##..# #.##  #.####.# #.# ##.# #.# #.# #.## #.# #.# #.# ### ### #.#_gg_gg_gg;2.0 (1Drain_gg_gg@ _Your surroundings suddenly seem different._ggcG #.## #)## ##### #..# ##)# #..# #..# ##..# #..#.#...# #...# ...# #..)## ##...### _ggcx#.)....# #...........# ###@...# ##..#..# ###..# #..##..#  #.## #.####.# #.# #.#  .# .# ### ### .##_ggho_ggpR7=3_ggx_ggz_gg#.## #)## #####  #..# ##)#  #..# #..# ####..# #..## #...# #...# # #..)## # ##...### _ggC.)....# #.....## ......# ###.@..# ..#..# ###..# ..##..# #.## .####.# #.# .# #.# #.# ## #.# #.# # ### ### # _gg_ggٺ&4_ggx_gg_ggO#..# ##)# #..# #..# ##..# #..# _ggC.#...# #...# ...# #..)## ##...### )....# #.........# ###....# #..# ###@.# _gg^,.##..# _ggv #.## ####.# _gg#.# # #.# _ggP#.# _ggZ# #.# #_ggv.#  ### _gg4### _ggX_gg_gg&5_gg_gg_gg  .. ### .#.#....#..)##_gg ##...### ) #.....## .###....# #### #@## ####  _gg I  _gg _gg; \8=6_gg _gg _ggV3,### .#.#... ....)###...### ) #.....## .##...._gg34# ###..# .# #.## ####   ### _gg3L_gg;_gg<&7_gghC_ggED_ggC.#.. ..)###...### ) #.....## .##....## ###..# .# #.# ####  _ggw ###_gg_gg4&8_ggp_ggY_ggW0.)###...### ) #.....## .##....## ###_ggW# #.# ####   ###_ggXM_gg`_gga@99_ggIg_ggTi_gg>=_gg=_ggB_ggD_gg _ggo _ggӉ _ggT ,_gg X_gg _gg 930_gg[ _ggG _ggo _gg֖ _ggǘ _gg _ggh _gg _ggћ 41=_gg _ggW _ggu _gg _gg/ _gg _gg _gg~ _gg _ggW >2=_ggy _ggϣ _ggs _gg _gg _gg _ggV _ggƨ _gg^ _gg 83_gg _ggg _gg _gg _gg| _gg _gg _gg. _ggY $34_ggv 1=_gg۲ _ggJ _ggx _ggܴ _gg} _ggĶ _gg4 _ggB _gg 65=_gg _gg _gg _gg _ggļ _gg _gg5 _gg _gg[ _gg :6_gg3 _ggw _gg _gg/ _gg _gg _gg _ggl _gg :7_gg6 _gg _ggJ _gg _ggk _gg _gg _gg _gg >8=_gg _ggE _gg _gg _ggl _gg} _gg _gg _gg _ggF 69=_ggf _gg _gg _gg5 _gg _gg" _ggH _ggc _ggE _ggf %40_gg _gg _gg _gg _gg _ggg _gg _gg _gg _gg #1_gg< 1=_gg _gg _gg _gg9 _gg _gg _gg} _ggP _gg 62=_gg _gg" _gg _gg) _gg] _gg( _ggJ _ggx _gg _gg9 _gg _gg _gg :3_gg9 _ggk _gg _gg _gg _gg _gg. _gg _gg #4_gg- 1=_gg _gg _gg _ggH _gg _ggF _gg _gge _gg 65=_gg _gg6 _gg _ggg _gg _gg _gg& _gg _gg _gg :6_ggJ _gg ,_ggO _gg: _ggg _gg _ggP _ggv :7_gg _gg _gg _gg _ggQ _gg _gg _gg _gg  >8=_gg( _gg _gg _gg _gg* _gg _gg _ggp _gg _gg 69=_gg  _gg _ggV _gg _gg _gg _gg _gge! _gg# _ggn# ;50_gg# _gg% _gg% _gg<& _gg( _gg;( _gg) _gg* _gg* >1=_gg+ _gg+ _gg^, ,_gg, _gg- _gg- _gg- _gg. _gg/ L2=_ggO/ _ggQ0 _gg0 ,_gg1 _gg1 _gg1 _gg3 _gg,3 :3_ggu3 _ggX4 _gg4 _gg4 _ggK6 _ggx6 _gg6 _ggT8 _gg8 T4=_gg!9 _gg: ,_gg; _gg; _gg; _gg; _gg= _gg4= L5=_ggs= _ggX> ,_gg> _gg? ,_gg0@ _gghA _ggA 36_ggA _ggB ,_ggB _ggC ,_ggC _ggD _ggD :7_ggE _ggE _ggE _ggE _ggG _ggLG _ggG _gg^I _ggI O58=_ggJ _ggK ,_ggNK _gg8L ,_ggyL _gg O _ggKO %9_ggiO 3=_ggO _ggR _ggER _ggR _ggHT _ggpT _ggT _gg~V _ggV '60_ggW _ggX _ggX _ggtY _ggsZ ,_gg] 1=_gg^ 2=_ggM_ _gg(` ,_ggo` _gg _gga '80_gg _gg _gg _gg _ggc _gg _gg _gg _ _You start resting._gg 3900657.0)_ggf #1_gg 7=78_gg$ _gg " _HP restored._gg_ggQ_gg_ggP_gg*n_gg,_gg\_ggN_gg:=_gg_ggv _gg _gg _gge ,_gg _gg`,_gg_ggK_ggz_gg*_gg _ggM_gg_gg_gg_gg_gg_gg&_gg_gg9_gg}_gg_gg_gg9_gg_ggx _gg _ggW!_gg#_ggQ#_gg#_gg%_gg&_ggr&_gg|(,_gg(_gg*,_gg+_gg-_gg-_gg:._gg/_gg/_ggL0_ggS2_gg~2_ggJ3_ggn4_gg4_gg4_gg6_gg7_gg~7_gg49_ggq9_gg9_gg;,_gg;_gg>,_gg>_ggI@_ggw@_ggA_ggy,_gg_gg,_gg_ggj_gg/,_gg=_ggp_gg_gg _gg. _gg,_ggp_gg_gg0_gg_ggq,_gg_gg,_ggA_gg_gg"_gg}_ggA,_gg_gg,_gg_gg,_gg-_gg- _ggX _gg _ggY!,_gg!_gg_",_gg"_gg#,_gg#_gg7%B_gg',_ggg'_gg)_ggI)_ggi)_ggn+_gg+_gg+_gg-_gg-_gg,._ggL0_ggz0_gg0_gg 3_gg`3_gg3_gg5_gg5_ggD6_gg8_ggg8_gg8_gg:_gg;_ggs;_gg=,_gg>_gg@,_ggA_ggEC,_ggC_ggF_ggEF_ggF_ggH_ggH_gg1I_ggK_ggL_ggL_ggnN_ggN_ggO_ggP_ggP_gg%Q_gg S_ggJS_ggS_ggbU_ggU_ggU_ggX_ggLX_ggX_ggZ,_ggZ_gg]_ggY]_gg]_ggk__gg__gg`_gg_gg_gg'_gg_gg,_gg_gg_gg_gg_gg3_gg_gg_gg%_gg_gg_gg_gg_gg_gg_gg_gg_gg_ggD _gg ,_gg_ggv_gg,_gg_gg_gg_ggQ_gg_gg_gg)_ggY_gg_gg_gg9_gg|_ggO_gg!_gg"_gg"_gg0#_gg$_gg9%_ggQ%_gg%_ggm'_gg(_gg(_gg(_gg)_gg*_gg*_gg*_gg+_ggJ-_gg{-_gg ._ggY3_gg4,_gg4_gg7_gg`8,_gg8_gg6:_gg;_gg;_gg<_gg9>_gg?,_gg@_gg/EX_ggF_ggH_ggH_ggI_ggK_ggM_ggM_ggN_ggP_gg\R,_ggS_ggT_ggV_gg W_ggW_ggY_ggH\,_gg]_gg__ggkb_ggb_ggc_gge_gg h_ggih_ggi_ggl_gg`n_ggn_ggo_ggq_ggt_gg6t_ggv_ggy_gga{_gg{_gg}_ggb_gg_gg6_gg_gg_gg׊_gg_ggc_ggg_ggq_gg_gg_gg!_gg,_gg_gg@_gg_ggޜ_gg_gg_gg_gg_gg_ggj_gg,_gg_gg(_gg,_gg_gg_gg˶_gg_gg_gg_ggm_gg_gg_gg_gg/ ........## ##.....## F.. #K5## ###..### _gg$... ##..## ##..# .... ##..## #..# ..... ##..## #.## .....# ##..# #.##_ggS  ....# #.)## #..# #..#####...## #..# #.@.##.....####..# #............#...#.....................#_gg .....................#........>#######.)....# _ggo........## #......# F   bullfrog (wandering) ######..# ##..#..#_gg ##.# #..##..# #. #.####.#_gg 68.0 (61.0)  A bullfrog comes into view._ggs.FF_gg5==9.0 (62_gg_gg _gg._The bullfrog gives a loud, deep croak!_ggS &  ##..... ... #K5## ###.. .F.  ##..#  ....  #..#  .....  #.##  .....# ##..# #.##  ....# #.)## #..#  #..###_ggT g #..#  #.@.#..#  #............#...#  .....................#  ..............  ........>#######.)....#  ........##   ######..#   ##.#   #.  _gg   ##..... ... #K5## ###.. .F.  ##..#  ....  #..#  .....  #.##  .....# ##..# #.##  ....# #.)## #..#  #..### #..#  #.@.#_gg_ ..#  #............#...#  .....................#  ..............  ........>#######.) ........##   ######..#  ##.#  #. _ggE _gg; _gg" _gge _ _A bullfrog is nearby!_gg`V   ##..... ... #K5## ###.. .F.  ##..# _ggV h ....  #..#  .....  #.##  .....# ##..# #.## _ggV ' ....# #.)## #..#  _ggV #..### #..# _ggV 1 #.@.#..# _ggW  #............#...# _ggW $ .....................# _gg*W # .............. _gg;W  _ggLW $........>#######.)....#  _ggdW $........##   _gg}W ######..#  _ggW  ##.#  _ggW  #.  _ggW _gg  ##..... ... #K5## ###.. .F.  ##..#  ....  #..#  .....  #.##  .....# ##..# #.##  ....# #.)## #..#  _gg)#..### #..#  #.@.#..#  #............#...#  .....................#  ..............  ........>#######.)_ggi ........##   _gg######..#  ##.# _gg@ #. _gg_gg__gg_gg_ _A bullfrog is nearby!_ggg;  ##..... _ggx... #K5## ###.. .F.  ##..#  ....  #..#  _gg".....  #.##  _ggؑA.....# ##..# #.##  ....# #.)## #..# _gg #..###_gg #..#  _gg1#.@.#..#  _gg0 #............#...#  _ggB.....................# _ggS .............._ggd _ggu _gg........>#######.)....# _gg$ ........##  _gg ######..# _gg  _ggʒ##.#  _ggے _gg#.  _gg_gg*V  ##..... ... #K5## ###.. .F.  ##..#  .... _ggz*} #..#  .....  #.##  .....# ##..# #.##  _gg*....# #.)## #..#  _gg/+T#..### #..#  #.@.#..#  #............#...#  .....................# _gg\+r ..............  _gg+#........>#######.) ........##   ######..# _gg+r ##.#  _gg+;#. _gg54_gg4_ggzN  ##......#.#.#.#................ #K5###..###.F..#..## #..#.# #.##..#..# #.##<......## #.)## #..######...## #..##...##.....####..# #......#...# .....# .....................# ........>#######.)....# ........## #......#######..# ##..#..##.# #..##..# _A bullfrog is nearby!_ggR.F--70.0 (1.0)_gg W_ggY _gg5Y-_Found an escape hatch in the ceiling._gg_ggP.F_gg A--1_gg_gg_gg0 #.#####..^.###.###......#.##..............# #K5# #.....#..#..... #..!......# #.......F#..# #.<.....@## #.)## #.._gg1.....##..#####...## #..... ##...##.....####... #............#... ...... ..................... ........>#######.).... ........## #......######..# ##..#.._gg  Found a potion of heal wounds. The bullfrog hits you._gg775--_gg'=2_ggw_gg _gg1_The bullfrog hits you but does no damage._gg:8  (slow)You hit the bullfrog. The bullfrog seems to slow down. You freeze the bullfrog.The bullfrog is heavily wounded._gg 9U6--3_gg>_gg7AV _The bullfrog closely misses you._gg   You hit the bullfrog. The bullfrog seems to slow down. You freeze the bullfrog.The bullfrog is heavily wounded.8 (0.8_ggN&_ggt)6 _You block the bullfrog's attack._gg U  You slash the bullfrog! You freeze the bullfrog._ggo._gg =294.7 (0.9_gg3_gg{L _You kill the bullfrog!_gg '.. # #.#.... #.#####..^.#.###......#.##............## #K5# #.....##_gg ..#.....# #.!......# #.#.#..# ##.<......## #.)## ##.....##..#####...## ##..... ##...##.....####..... #......#...............................>........>#######.) ........## #..._gg _gg e82==-5.7 (1.0_gg& _ggF( ; _Found a stone staircase leading down._ggu .. # #.#..... #.#####. ##..^..###......# ##.#.# #..#........## ## #.....## #K5## ###. #.....# ##..## ##.#.....# ##..## #_ggvK#.!......# ##..## # #.## ##..# # #.<......## #.)## # #.....##..#####...## # #..... ##...##.....####.. #....._gg w.#...............>........>#.) .## #_gg߃_gg@-6_gg_ggƍ_gg .. # #.# .... #.#####. ##..^. ....###......# ##.#. #..#........## ##. #.....## #K5## ###_gg{.. #.....# ##..## #...#.....# ##..##  #.!......# ##..##  #.## ##..#  #.<......## #.)##  #.....##..#####...## _gg #.....###...##..... .. #..#_gg..............>........>#######.)_gg$l .## #_gg_ggV&7_gg_ggJ_gge: .. # #.# .... #.#####. ##..^. ....###......# ##.#.. #..#........## ##.. #.....## #K5## #... #.....# ##..##  #...#.....# ##..## #.!......# ##..## #.## ##..# #.<......## #.)## #.....##..#####...##_gg3; #.....###...##..... . #... ......#......#....>........>#.) .## #_ggC_ggkD&8_ggJ_ggM_gg  .. # #.##. .... #.#####. ##..#......###......# ##._ggΙ#...#..#........## ###...##.....## #K5##  #...##.....# ##..## #...#.....# ##..## #.!......# ##..## #.## ##..#_ggm #.<......## #.)## #.....##..#####...## #.....###...##..... .. #.. .. #.. #....>........>#._ggl .## #_ggy_ggK$==_gg9_gg_gg>_gg  .. # #.# #...... #.#####. ## #......###......# ## #...#..#........##  #...##.....## #K5##  #...##.....# ##..## #...#.....# ##..## #.!......# ##..## #.## ##..# #.<......## #.)## #.....##..#####... #.....###...##..... ..##_gg  ... #... #....>..># .## #_gg _gg '80_ggY _gg _gg  #. ##. .. #  #...... #.#####. #......###...... #...#..#.............## #K5#.....#..#.....#..###.#.. #.<......## #.) #.....##..##### ##...## .## .._gg  #............#....>.>#####_gg _ggN &1_gg _gg^ _gg +2.7 (2_gg_ _gg [ _t - a potion of heal wounds_ggp/`_gg0_gg 1_ggC3X_gg3_gg4_gg5,_gg+6_gg6_gg7_gg7_gg.8_ggs9_ggR:_gg:_gg:_ggD<_ggI=,_gg=_gg?_ggA_ggA_gg^B_gg`D_ggJi...K...   ..!... #....# ....## ## _ggK8 ....###.#  .......#  ##.....#.. # # #.#####. ......###......# #...#..#........## #...##.....## #K5####...##.....# ##..# ##...#.....# ##K   kobold (missile, wandering) ##........# ##. _ggK##.......## ## #.<......## _ggR\ K9.7 (7_ggRK)A kobold comes into view. It is wielding a +0 dagger._gg+V$((_ggKV0((((_gg~!....._gg51-_gg-=90.7 (8_gg_ggD _The kobold throws a stone. The stone hits you._ggU ...K... ..!... #....# ....## ##  ....###.#  .......#  ##.....#.. #  _gg8 #.@....#   #......#  #...#..#  #...##.....##  ##...##.....#  ##...#.....#  ##........#  ##..  #.< _gg  ...K... ..!... #....# ....## ##  ....###.#  .......#  ##.....#.. #  #.@....#   #......#  #...#..#  #...##.....##  ##...##.....#  ##...#.....#  ##........#  _ggF ##..  #.< _gg3% _gg% _gg* _gg, ] _A kobold is nearby!_ggv ~ ...K... ..!... #....#_ggew  ....## ##  ....###.#  .......#  ##.....#.. #  #.@....#   #......# _ggw # #...#..#  _ggw 6#...##.....##  ##...##.....#  _ggw 1##...#.....#  ##........# _ggw  ##.. _gg x 0 #.< _gg  ...K... ..!... #....# ....## ##  ....###.#  .......#  ##.....#.. #  #.@....#   #......#  #...#..# _gg  #...##.....##  _gg] ##...##.....#  ##...#.....#  ##........# _gg  ##..  #.< _gg4 4_gg _gg ] _A kobold is nearby!_ggfP U ...K... _ggP m..!... #....# ....## ##  ....###.#  _gg?Q .......#  ##.....#.. #  #.@....#   #......#  #...#..#_ggQ Z  #...##.....##  ##...##.....#  ##...#.....# _ggQ N ##........#  ##..  #.< _ggR _gg~ ...K... ..!... #....# _ggIt....## ##  ....###.#  .......#  ##.....#.. #  #.@....# _ggX  #......#  #...#..#  #...##.....##  ##...##.....#  _ggG##...#.....#  ##........#  ##.._ggO  #.< _gg_ggt_gg_gg]] _A kobold is nearby!_gg......###...K..!...##....# ##.....## ####.......###.............# _gg ##.. #.....# #.#####......### ..#..#........## ...##.....## #K5###...##.##..#_gg1##...#..##.##........# ##.##.......## #_gg_gg#I.K#_gg$h2=-1.7 (1 __ggz)_gg+`ggO!K-2`ggk.K3`ggw`ggL.K`gg &4`ggq`gg`ggO `ggV L.K`ggW B=5`gg_ `gg)b `ggQ  You slash the kobold! You freeze the kobold.`gge)`gg5=6.6 (0.9`gg `gg\ J _You kill the kobold!`gg1`gg$2`ggK8`gg;H _No target in view!`gg `gg5 `gg `gg} `gg UK.# ####...... ..!... ##....#  ## ####.......###.#.......@).....# .....###.....#.. #... #......# #.#####.. #......###...... #...#..#........ #...#`ggW # #K5# K   kobold (missile, asleep)##...##.....##.....#.`gg &0`gg˽ 3-7.6 (1`gg `gg  A kobold comes into view. It is wielding a +0 dagger and quivering poisoned _darts.`gg< ...K.# .....####  ........  ..!... ##....# ##.....## ##  .##.......###.#  .......@).....#  .....###.....#.. #  ... #......#   . #......#  #...#..# #...##.....##  ##...##.....#  ##...#.....#   `gg2 ...K.# .....####  ........  ..!... ##....# ##.....## ##  .##.......###.#  .......@).....#  .....###.....#.. #  ... #......#   . #......#  #...#..#`gg3 #...##.....##  ##...##.....#  ##...#.....#   `gg^=N-`ggF`ggJ] _A kobold is nearby!`gg`ggĬ-8 _`gg`gg`gg]i ((((((K)You throw a poisoned dart. The poisoned dart hits the kobold.`ggN`gg..K.....`ggli==9.7 (1.14`gg;`gg( _The kobold shouts!`gg#.....#K.####..... !... ##....# ##.....## ##.##..#.# ........).....# .....###@....#..#... #......# #.#####. `ggO$. #......###......#  #...#..#........##...##.....## #K5##...# ##..##...#.....# .....# #`ggs(`gg@2H.K#`gg27--2000`gg:`ggn>`gg`ggI.K#`ggڷA--1`gg`gg]`gg} `gg N((((`ggy X...)`ggj .=2`gg~ `gg U _The kobold throws a poisoned dart. You block the poisoned dart.`gg@ `gg B!K`gg .-3`ggұ `ggv `gg `gg`ggK.KK 2 kobolds (missiles, 1 wandering)`ggb@-4`ggR`gg(z _A kobold comes into view. It is wielding a +0 short sword.`gg`gg;B((`gg`ggȧ|.K.)`gg.=5`gg`ggU _The kobold throws a poisoned dart. You block the poisoned dart.`gg9`ggO>B((`gg`ggQK..)`gg&6`gg`ggU _The kobold throws a poisoned dart. You block the poisoned dart.`gg '.....# ..K...####...........!... ##....#  ##....K## ####.......###.......@.....#  ....###.. #.. # #.#####.....### `ggz ..#........##...##.....## #K5###...####..###...#.##.##. ##.`gg `gg (The kobold throws a poisoned dart. The poisoned dart hits you!`ggpQ `gg!Y pK..`ggY ==7Pois Drain`ggab `ggSf _You are poisoned.Things that are here: _a +0 dagger; 4 stones`gg+; ..# K..# ......####`gg; J...........!... ##....#  ##....K## #######.#...).....#  ...###`gg; ].. #... # #.#####... #......####..#........## ...##.....## #K5###...##.....# ##..###...###.`gg; `gg? `gg I =K.`gg|I T0-8`ggO `ggS C _You feel sick. You block the kobold's attack.`ggi  The kobold shouts!  You hit the kobold. You freeze the kobold.`gg@Y  You kill the kobold!`gg.K)   kobold (missile)`gg;O-=9.5 (0.8`ggj`gg*$ _You feel sick.`ggO..K..# !#####.........# #..!.... ##....#  ##...@)## ## .##.......###.# ........).....#  .....###.....#.. # ....# #......# #.#####..... #......###......... #...#..#........#$ #...## #K5#.....#`gg}  Found a metallic yellow potion and 11 gold pieces.`gg3  You feel sick.`gg{&  `ggA kobold brigand comes into view. It is wielding a +0 dagger and quiveringpoisoned darts.`ggIKK.KK   kobold brigand (missile, wandering)KK 2 kobolds (missiles)`gg?1--10.5 (1.0`gg`gg  A kobold comes into view. It is wielding a +1 vampiric short sword and _quivering poisoned darts.`ggn.....KK..#`gg#......## #!..K...#####..........#.. #..!......#`gg?] ##.@..#  ##....)## ## .##.......###.# ........).....# `gg..###.....#.. #.# #......# #.#####... #......###........... #...#..#........#$ # #K5`gg3  You feel sick.`gg`gg`gg..KK.KK)`gg/==1`ggP`ggQ0 _The kobold brigand shouts!`gg E#...... `gg HKK.# ......## #!......##### #....K......#..#..@......# ##....###..  ##....)## #`gg# ##.......### ........).....#`ggH ......###.....#.. ## #.#####....###`ggo 3.......#........#`gg `gg_ ,`ggV }..KK.K`gg /--2`gg. `gg _You feel sick. _You see here 2 potions of mutation.`gg`   k - 4 potions of mutation (gained 2)  You feel sick.`gg1 .KYou are no longer poisoned.`ggѷ H((`ggsD@ .`ggD].The kobold throws a poisoned dart. You block the poisoned dart.`ggE0==-3`ggEDrain`ggM`ggyQT _The kobold closely misses you.`gg..#......... #.....## #....K.## #!...K..##### #...........#.. #.K.......#`gg# ##@...###..##....)## ##....###.# ..).....####.....#... #......# #.####. #......###.....#..... #...#..#.. #$ #...##.....## #K`ggm`gg`gg;h..KK`gg.14`ggi`gg4 _You block the kobold's attack.`ggm`gg`gg/h..KK`gg[2=5.4 (0.9`gg`gg\} _You completely miss the kobold. The kobold hits you but does no damage.`gg9  You slash the kobold brigand! You freeze the kobold brigand.  The kobold brigand is moderately wounded.`gghK. `gg`5=6.4 (1.0`gg`ggE[ _You block the kobold's attack. You block the kobold brigand's attack.`gg0  You hit the kobold brigand. You freeze the kobold brigand.  The kobold brigand is heavily wounded.`gg S.K`gg 5-7.3 (0.9`ggz `gg { _You block the kobold's attack. The kobold brigand closely misses you.`gge ;  You slash the kobold brigand! You freeze the kobold brigand.  The kobold brigand is almost dead.You block the kobold's attack. The kobold misses you.`gg G-8.1 (0.8`gg `gg < _You block the kobold brigand's attack.`gg_  You hit the kobold brigand. You freeze the kobold brigand.`gg  $KK 2 kobolds (missiles)  You kill the kobold brigand!`gg!d3-719.0 (0.9`gg=`gg^\ _You block the kobold's attack. The kobold hits you but does no damage.`ggЯO  You hit the kobold. You freeze the kobold.`ggU )   kobold (missile)You kill the kobold!`ggs&9`ggv`gg4 _You block the kobold's attack.`gg7O  You hit the kobold. You freeze the kobold.`gge)`gg )20.8`gg`ggJ _You kill the kobold!`ggD4`ggz`ggH _No target in view!`gg`ggR`ggp`gg=H _No target in view!`gg 4`gg `gg `gg L3=`gg `gg &-`ggſ  #... . ....... #.....## #......## #!......##### #...........#.. #))@......# ##....###..  )## ## .##.###.# ..).....#.##.....#.. ......# #......# #.#####...... #......#####..... #...#..#........# _HP restored.`gg -1.8 (1.0`ggc E-2.8 (2`ggV `gg  You now have 255 gold pieces (gained 16).  f - 9 poisoned darts (gained 5)`gg ^3.8 (39`ggG `gg / _You see here a +0 dagger.`ggZ`gg`gg`gg`gg!`gg2%,`gg. .#... . . #.....## #......## #!......##### #.#.. #)@)......# ##....###.. ##....)## ## .##`gg..###.# ........)....# ......###.....#..  ......# #......# #.##### ...... #......###...... #..... #...#..#.Things that are here:`ggb4$ .#...#.# .# #.....## #......## #!......##### #.#..`gg4g #@))......# ##....###.. ##....)## ## .##.......###.# ........).....# ......###.....#.. ......# #......# #. ...... #......### #..... #...#..#a +0 short sword; 5 stones`gg;+4.8 (1`gg<N=5.8 (2 _`ggXB`ggKo  f - 16 poisoned darts (gained 7)`ggmLn6.8 (316 darts (poison)`ggP`ggeR] _You see here a +1 vampiric short sword.`gg`gg`ggʩ`gg`gge`ggж`gg̻,`gg`ggP`gg`gg`gg`gg$`gg`ggx{........#.......# #.....## #......## #!......######.....#.. #)))......#  ##....###.. ##...@)## ## .##.......###.# .........).....# ......###.. #......# #......# #.#####....... #......###......#`gg#..... #...#..#........##$. #...##.....## #K5# ##...##.....# ##`gg.# .# #.....## #......## #!......##### #...#.. #)))......# ##....###.. `ggFf##....@## ## .##.###.# .).....# ......###.....#.. # ......# #............ #......###......# #..... #...#..#.## ##$. #...##.....## #K5###...##.....# ##..#`gg&9`ggE,30.8 (4`gg`gg  f - 20 poisoned darts (gained 4)  Things that are here:`gg_1.8 (520`gg`ggR _a +0 dagger; a kobold corpse`ggAA4`ggB`gg*M`ggiYX`gg]B`gga>  You see here a +0 dagger.`ggd`ggod _`ggf`ggi`ggsm`ggm`ggo`ggw`ggz`gg({`gg~`gg`gg`ggA`ggP`ggQ`ggh,`gg;`gg`gg<`ggq`gg`ggKU    ..## #....   ....###...#  `ggȥ' #.....#...#   #........#   #.......#   #.....##   #......## `ggKK  #@......##### #   #...........#..#   #...##)))......#   #..####....###..   #...###....)## ## `gg  .....##.......###   .............)   ..........###.....#..  ......# #......# #.`ggի+9.8 (8`gg4,40.8 (9`ggd`gg\ _z - a metallic yellow potion`ggTJ`gg`gg`gg`gg_,`gg[,`ggE`gg`gg-,`gg`gg`gg,`gg`gg`gg,`gg`gg`gg,`gg`gg`ggA`gg`gg`gg`gg,`gg`gg8 `gg `gg! `gg `gg `ggj `gg `ggc `ggu `gg `gg `gg `gg ,`ggB `ggW N _You now have 266 gold pieces (gained 11).`ggG `ggy `gg `gg `gg `gg `ggn `gg `gg `gg `gg  `gg `gg `gg `gg `gg `gg `gg `gg `gg6! `gg" `gg" `ggN# `gg% `ggQ' ,`gg' `ggO) `gg* `gg+ `gg+ `gg, `gg- `gg- `gg. `gg. `gg/ `gg/ `gg/ `gg1 `gg2 B`gg63 `gg3 `gg4 `gg4 `gg7 `gg_9 `gg9 `gg9 `gg,; `gg; ,`gg8< `gg< `gg= `gg> `gg\> `gg? `gg@ ,`ggA `gg(B `ggB ,`ggkC `ggZD `gg E `gg7E `ggE `ggF `ggG `ggG `gg H `ggmM R  There is a stone staircase leading down here.`gg1N `ggwN _`ggN `ggP `ggP ,`gg`Q `ggOR `ggS ,`ggS `ggT `ggOU `ggU `ggU `ggW `ggW `ggX `ggFX `gg=Z `gg:[ `ggw[ `gg[ `gg] `gg_ `gg` `gg` `gga `ggb `ggb `ggyc `ggf `ggg `ggg `ggh `ggh `ggi ,`ggi `ggj `gg2k `gghk ,`ggl `ggl `ggm ,`ggn `ggo `ggo `gg p `gg+z `gg8{ `ggr{ `gg{ `ggr~ `gg ,`ggr `ggׂ `gg `gg+ `ggЄ `gg `gg ,`ggĆ `gg `gg `ggЈ `gg `ggY `gg ,`gg `ggG `ggj `gg `ggL `gg `ggb ,`gg `gg@ R  There is a stone staircase leading down here.`gg `gg _`gg `gg6 `ggn ,`ggB `gg `gg ,`gg `gg `gg9 `ggi `gg `gg `ggd ,`gg `gg `ggS ,`gg `gg `gg `gg4 `ggʶ `gg `gg `gg7 `gg `gg `gg[ `gg `gg `gg `ggܽ `gg0 `ggj `ggk `gg `gg `gg `gg `ggx ,`gg `gg `gg ,`ggb `gg `gg ,`gg `gg `ggl ,`gg `gg `gg ,`gg `ggn `gg `gg1 `ggX `ggi `ggR `gg `gg `gg `ggz ,`gg `gg `ggq ,`ggr `gg_ `gg `ggm `gg `gg `gg `gg `ggm `ggS `gg4 `gg `gg/ `gg `gg `ggO `gg `gg `gg `ggO `gg `gg `gg ,`ggC `gg `gg `gg- `gg `gg `gg> `gg `gg `gg' `gg ,`gg `gg `gg ,`gg `gg `ggO `gg} `gg! `gg `gg ,`gg # `gg|% `gg& `gg' `gg' `gg( `gg) `gg) `gg7* `gg. `gg/ ,`gg0 `gg@2 `ggp3 ,`ggZ4 `gg_6 `gg8 ,`gg: `ggV= `gg@ ,`ggA `ggD `ggG ,`ggSH `ggtJ `ggL `ggDL `ggM `ggP `gg% _Found a dagger.`gg_ `ggM `ggi `ggd `ggQ X.K..`gg .K.KKK)K)`gg `ggj 1===70`gg& `ggi V _The kobold brigand shouts! The kobold shouts! You hear a bellow!`ggv O  You hit the kobold. You freeze the kobold.`gg-x `gg>z `gg .K.KThe kobold is severely wounded.`gg 6--1.6 (0.8`ggE `gg 4 _You block the kobold's attack.`gg=O  You hit the kobold. You freeze the kobold.`ggn`gg0`ggip.K 2`ggtH--2.5 (0.9`gg`ggQJ _You kill the kobold!`gg^8O  You hit the kobold. You freeze the kobold.`ggD )   kobold (You kill the kobold!`ggL (((((((The kobold brigand throws a poisoned dart.`gg,)@.....`gg523.5 (1.0`ggD`gg[ _The poisoned dart closely misses you.`gg### .)# ...##......#KK# ##  ##.# .## #..# ..## ## #..### ##...# ##...### #....#  ##....###...###.....#`ggr...###.`ggf`gg&4`gg`gg _The kobold brigand barely misses you. _Items here: )) ††.`ggO  You hit the kobold brigand. You freeze the kobold brigand.  The kobold brigand is moderately wounded.`ggH&5`gg%`gg(E _The kobold brigand hits you but does no damage.`gg0w  You barely miss the kobold brigand.The kobold brigand is moderately wounded.`ggw [0-6.3 (0.8`gg `gg A _The kobold brigand hits you with a +0 whip.`gg##  You slash the kobold brigand! You freeze the kobold brigand.  The kobold brigand is severely wounded.`gg?% -7.3 (1.0`gg, `gg(1 E _The kobold brigand hits you but does no damage.`gg  You slash the kobold brigand! You freeze the kobold brigand.  The kobold brigand is almost dead.`gg-8.1 (0.8`ggY"`gg%< _You block the kobold brigand's attack.`ggma  You slash the kobold brigand! You freeze the kobold brigand.`ggtx )K   kobold (missile)  You kill the kobold brigand!`gg}8(`gg8)`ggg _1/84-49`gg`gg&E _The kobold throws a stone. You block the stone.`gg14### ..### ...)# #?...#.......#.......K# ##)### # `gg26 ##.# ## #..# .## # ..### ##...# #...### #....# ##....###...###.....#...#`gg~?`gg@&9.9 (1.0`ggZK`ggR _Found a scroll of identify. The kobold hits you with a +0 dagger.  Things that are here: _a +0 whip; 8 poisoned darts; a kobold corpse`gg_PQ  You slash the kobold! You freeze the kobold.`ggZC)`ggu^.80.7 (0.8`ggUe`gghJ _You kill the kobold!`gg+ 4`ggD `gg H _No target in view!`ggo} `gg} `gg `ggt `gg ; _`gg= <2`gg& `ggs ,`gg `gg ,`gg `ggܛ <3`ggY `gg 4= -8f - 28 poisoned darts (gained 8)  Things that are here:7.7 (7.0-8.7 (8`gg f _a +0 whip; a kobold corpse`gg`gg{`gg`gg`gg`gg2`gg`gg5W  Things that are here:  a +0 dagger; 2 stones`gg`ggH _`gg|`gg `gg`ggX:=`gg`gg!`gg`gg `gg`gg!`gg`%,`gg'`gg2h#.. ##.. #... #... #...### #.....### #.....)# #.#.@...#... ##.....# #.....# ##..#### ##))## ##)### ##`ggt3.## # ###..# ## ##...##`gg:,93.7 (5`ggv;+4.7 (6`ggN?`ggA. _B - a scroll of identify`gg`gg:`ggG`gg `gg B`ggy`gg`ggE`gg`gg `gg`gg`gg`ggY`ggF,`gg`gg=`gg`gg`gg`gg`gg`ggֽ`gg~`gg`gg`gg `gg`ggC`gg,`ggG`gg`gg,`ggk`gg`gg`gg`gg`gg`gg`gg0`gg`gg`gg>,`gg`gg`gg8`ggr`ggO`gg`gg`gg>`gg`gg`gg,`ggl`gg`gg`gg`ggD`ggM`gg[`gg`gg`ggw`gg[,`gg`gg`gge`gg`ggi`gg`gg,`gg`gg`gg,`gg`gg)`gg`ggE`gg`gg`gg,`ggw`gg`gg ,`gg] `gg `gg ,`ggQ`gg`gg,`gg&`gg`gg,`gg`gg`gg`gg`gg`gg`gg,`gg`gg`gg`gg`gg`gg`ggU`gg,`ggt`gg!`ggV,`gg2"`ggJ#`gg#`gg#`gg&`gg&`gg&`gg&'`gg'`gg9),`gg)`gg3*`gg*,`ggP+`gg,`gg,`gg,`gg*-`ggO.`gg/`gg0`gg0`gg2`gg5`gg;5`gg5`gg6`gg7`gg7`ggP8`ggx9`gg:`gg:`gg?;`gg7<`gg=,`gg >`gg>`gg)@`ggV@`gg@`ggA`ggC,`ggD`ggvE`ggR4`ggS`ggT`ggV,`ggFW`gg_n`ggb`ggb`ggTd`gg9f`ggh`ggh`ggi`gg#k`ggoB`ggfs`gg@u,`ggrx`ggy`gg{`ggL#...##...##...#####......#########.....####...####...####.....### ##.##.....)# #..Y###.....#...# ##...@.# #.....# ##..#### ##))## ##)####.## Y   yak (wandering)###..# ##...##`ggt1448.7 (54.0)`gg,9.7 (55`gg`gg!V _A yak comes into view.`ggvJ  ...##...###  ##......  #.....### #...### #...### #.....### ##.  ##.....)# #..Y#  `gg0K ##.....#...#  ##...@.# #.....# ##..#### ##))## ##)### ##.## ###..#  # `gg  ...##...###  ##......  #.....### #...### #...### #.....### ##.  ##.....)# #..Y#  `gg ##.....#...#  ##...@.# #.....# ##..#### ##))## ##)##`gg  ##.## ###.  `gg 4`gg* `gg Z _A yak is nearby!`ggb[ h ...##...###  ##......  #.....### #...### #...### #.....### ##.  ##.....)# #..Y#  ##.....#...#  ##...@.# #.....#`gg[  ##..#### ##))## ##)### ##.## ###..#  # `gg  ...##...###  ##......`gg 1  #.....### #...### #...### #.....### ##.  ##.....)# #..Y#  `gg, ##.....#...#  ##...@.# #.....# ##..#### ##))## ##)##`gg  ##.## ###.  `gg `gg `gg?`ggZ _A yak is nearby!`gg``ggRead which item? Scrolls  g - 2 scrolls of vulnerability `gg~ j - a scroll labelled YVENIXT ADDEE  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportationB - a scroll of identify `gg[!] read|quaff|evoke[?] describe selected`gg `gg `ggC! #...##...##...###deadiverson the Carver##......########Human of the Shining One ***...#.....###HP: 84/84 (85) ========================#...###MP: 10/10========================#...###AC: 16`gg! 7Str: 17#.....### ##.EV: 13Int: 11##.....)# #..Y#SH: 14Dex: 14##.....#...#`gg! XL: 10 Next: 74% Place: Dungeon:8##...@.#Noise: ---------  Time: 9449.7 (0.0)#.....#`gg" a) +4 falchion (freeze)##..####Throw: 28 darts (poison)`ggh" ##))##Drain##)#####.##Y   yak (wandering)###..#`gg" ?##...## # ##...##`gg" Things that are here: _a +0 dagger; 2 stones _B - a scroll of identify _A yak comes into view. _A yak is nearby! _A yak is nearby!`gg" `gg? `gg@ qIdentify which item? (\ to view known items) `gg@ Scrolls (select first with ?)  j - a scroll labelled YVENIXT ADDEE `gg>A Potions (select first with !)  h - 2 bubbling ruby potions  z - a metallic yellow potion[?] describe selectedaggKaggagg#...##...##...###deadiverson the Carver##......########Human of the Shining One ***...#.....###HP: 84/84 (85) ========================#...###MP: 10/10========================#...###AC: 16Str: 17#.....### ##.EV: 13agg{Int: 11##.....)# #..Y#SH: 14Dex: 14##.....#...#XL: 10 Next: 74% Place: Dungeon:8##...@.#aggxNoise: ---------  Time: 9449.7 (0.0)#.....#a) +4 falchion (freeze)##..####Throw: 28 darts (poison)agg##))##Drain##)#####.##Y   yak (wandering)###..###...## # ##...##Things that are here: _a +0 dagger; 2 stones _B - a scroll of identify _A yak comes into view. _A yak is nearby! _A yak is nearby!agg  As you read the scroll of identify, it crumbles to dust.  j - a scroll of blinkingagg-~Y.Yagg5==50.7 (1aggagg9 _The yak bellows! You hear a bellow!aggT#...##...##...### ##......# #.....### #...### #...### #.....### ##.##.....)###.Y.# ##.....#...# ##....@# #.....# ##..#### ##))## ##)###aggـ##.## ###..# aggagg9aggYY.Y 2 yaks (1 wandering)aggߋ/--1aggaggV _A yak comes into view.agg5 ########...........##...##...#####......#########.....####...### #...### ##.....### ##.Y.##.....)###Y..###.....#@..#agg6 ##.....#..##.....####..####)))### ##.##..#agg{: agg < agg@E ~Y..YaggF A--2aggEN aggKQ agg0X# #...##...##...##......########  #.....###  #...###  #...#### #.....### ##Y.. ##.....)###...#  ##.....#.Y.#  ##....@#..# #.....######..#### ))## aggY)#.## ###.....##agg^agg`5  The yak bellows!agg;aagguk.YYY.YY 3 yaksaggIl/==3agguaggxV _A yak comes into view.aggK  You slash the yak! You freeze the yak.agg!aggx Y.Y.  aggHThe yak is moderately wounded.agg-4.6 (0.9aggG aggY1 _You block the yak's attack.aggI  You hit the yak. You freeze the yak.aggagg ..YYThe yak is heavily wounded.agg0-5.5aggsaggt1 _You block the yak's attack.aggj I  You hit the yak. You freeze the yak.aggEk agg_y Y.. 2 yaks _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is heavily wounded. _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is heavily wounded.-6.4agg( agg ?  You hit the yak. You freeze the yak.  The yak is heavily wounded. _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is heavily wounded. _You block the yak's attack.aggԻ 8The yak is heavily wounded. _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is heavily wounded. _You block the yak's attack.  You hit the yak. You freeze the yak.agg agg Y.YY 3 yaks _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is heavily wounded. _You block the yak's attack.  You hit the yak. You freeze the yak.  The yak is severely wounded.agg (7.3agga agg Q _The yak closely misses you.agga"  You barely miss the yak.  The yak is severely wounded.8.2agg11 _You block the yak's attack.aggňK  You slash the yak! You freeze the yak.aggagg.†YY 2 yaksagg4 ealth: 84/85 -8=9.1 _You kill the yak!aggaggi _Your life force feels restored.agg########...........##...##...#####......#########.....####...###  #...### # #.....### ##...##.....)###...###.....#@YY# ##.....#..# #.....####..####)))### ##.##..#agghagg O.Yagg 6-60.1 (1.0aggxagg _You block the yak's attack. _You see here a yak corpse.aggkl  You hit the yak. You freeze the yak.  The yak is lightly wounded.aggG-1.0 (0.9agg$aggt&4 _You block the yak's attack. x2aggҭ X #...##...##...##......########  #.....###  #...###  #...####aggR  #.....### ##... ##.....)###...#  ##.....#†Y.#  ##....@#Y.# #.....####agg ##..#### ))##)#.##    yak###.....##agg/ agg aggS Y.Y 2 yaksagg [5=2.0 (1.0agg agg0 T _The yak attacks as it pursues you! You block the yak's attack.aggw?  You slash the yak! You freeze the yak.  The yak is heavily wounded.aggG$.aggHq   yakaggaH&3aggROaggjR1 _You block the yak's attack.aggg  You slash the yak! You freeze the yak.8 (0.8 _The yak is severely wounded.aggEf  You slash the yak! You freeze the yak.  The yak is almost dead.YY 2 yaks=4.7 (0.9 _You block the yak's attack.agg  You hit the yak but do no damage.The yak is almost dead.agg.   yakagg6Q=-5.5 (0.8aggagg!I _The yak misses you.agg?  You hit the yak but do no damage.The yak is almost dead.aggJ sYY 2 yaksaggK G-6.4 (0.9agg"U aggGX 1 _You block the yak's attack.agg K  You slash the yak! You freeze the yak.agg agg .   yakagg r 837.3 _You kill the yak!agg agg h _Your Shields skill increases to level 8!aggI  You slash the yak! You freeze the yak.  The yak is moderately wounded.aggXJ(8.2aggQaggT; _The yak gores you but does no damage.aggG  You hit the yak. You freeze the yak.  The yak is moderately wounded.aggܸ(9.1aggSaggP _The yak barely misses you.agg   You hit the yak. You freeze the yak.  The yak is moderately wounded.agg )70.0aggagg"1 _You block the yak's attack.aggSXI  You hit the yak. You freeze the yak.aggX&9agg^agg`[ _The yak is heavily wounded.agg~  You hit the yak. You freeze the yak.  The yak is heavily wounded.1.7 (0.8aggagg1 _You block the yak's attack.agg  You slash the yak! You freeze the yak.  The yak is almost dead.aggY 0=2.5agg agg( ; _The yak gores you but does no damage.aggU I  You hit the yak. You freeze the yak.agg E†agg =7-3.4 (0.9aggݻ aggP G _You kill the yak!aggnzagg~  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0      aggY? c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0      agg7         f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0      h + Shieldsagg8.3   9.0   0      aggG; i - Stealth   0.0   0.8  +1      aggt        agg        agg                    agg    The relative cost of raising each skill is in cyan.  aggESkills enhanced by cross-training are in green.  [?] HelpaggnG[=] set a skill target  agg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsaggMy agg% agg #...##...##...###deadiverson the Carver##......########Human of the Shining One ***...#.....###Health: 85/85 ========================#...###Magic: 10/10 ========================#...####AC: 16Str: 17#.....### ##...EV: 13aggt xInt: 11##.....)###...#SH: 14Dex: 14##.....#†..#XL: 10 Next: 87% Place: Dungeon:8##....@#..#Noise: =--------  Time: 9473.4 (0.0)#.....####agg a) +4 falchion (freeze)##..####Throw: 28 darts (poison)agg ##))####)#####.##aggՊ (###..###...####...## agg _You block the yak's attack.  You slash the yak! You freeze the yak.  The yak is almost dead. agg _The yak gores you but does no damage.  You hit the yak. You freeze the yak. _You kill the yak!agg$ agg9 agg aggΘ agg- agg% 4aggh* agg . H _No target in view!agg!/agg/aggS7agg`:H _No target in view!aggnwaggxaggTaggH _No target in view!agg2aggt4  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1  agg4         b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1      agg4 l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0  aggE5             f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0      h + Shieldsaggt5=8.3   9.0   0       i - Stealth   0.0   0.8  +1      agg5                                agg,6        The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  aggW6}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsaggd agg'$ agg- #...##...##...###deadiverson the Carver##......########Human of the Shining One ***...#.....###Health: 85/85 ========================#...###Magic: 10/10 ========================#...####AC: 16Str: 17#.....### ##...EV: 13Int: 11##.....)###...#agg- -SH: 14Dex: 14##.....#†..#XL: 10 Next: 87% Place: Dungeon:8##....@#..#Noise: =--------  Time: 9473.4 (0.0)#.....####a) +4 falchion (freeze)##..####Throw: 28 darts (poison)##))####)#####.#####..###...##agg4. A##...## _The yak gores you but does no damage.  You hit the yak. You freeze the yak. _You kill the yak! _No target in view! _No target in view! _No target in view!agg2 agg93 agg9 agg; aggp aggp agg } Bagg} $ _agg> aggс _  You see here a yak corpse.agg agg  _aggl agg agg[ ,agg^ aggF agg Bagg agg ,agg agg( aggӗ agg! aggǘ agg? agg ,agg agg agg agg@ agg aggɦ aggm agg aggV agg aggs Bagg agg׮ ,agg7 agg aggZ Bagg2 agg agg߻ agg aggS agg^ agg{ agg agg agg> agg_ agg aggu agg ,agg agg aggp agg agg agg agg agg5 agg agg _  You see here a yak corpse.agg agg-  _agg agg agg agg agg agg\ agg, aggb agg agg aggY agg agg agg agg agg agg agg0N _No target in view! _aggk_You see here a yak corpse. _You see here a yak corpse.  Things that are here:  a +0 dagger; 2 stonesaggagg[ _aggFagg= B  Things that are here:  aggq :a +0 whip; a kobold corpseagg" agg  _aggagg[  Items here: )) ††.aggaggt _agg%aggFagg"aggY"agg#agg&agg*),agg-aggL.agg1aggw1agg2agg5agg`9,agg:agg>agg-?aggQ?agg?aggAaggCagg 9 _The acid dragon is lightly wounded. aggԿ  You barely miss the acid dragon.The acid dragon is lightly wounded.  The acid dragon bites you but does no damage. aggy-1.7 (0.9 aggl aggL9 _You block the acid dragon's attack. aggM )You hit the acid dragon but do no damage.The acid dragon is lightly wounded. agg%(2.6 agg aggL u _You block the acid dragon's attack. The acid dragon misses you. aggH  You hit the acid dragon. You freeze the acid dragon.  The acid dragon is moderately wounded. agg6 1703.5 agg  aggk \ _The acid dragon closely misses you. x2 agg&  You hit the acid dragon. You freeze the acid dragon.  The acid dragon is severely wounded. agg'(4.4 agg1 agg4` _The acid dragon looks more healthy. You block the acid dragon's attack. x2 agg  (catching breath)You hit the acid dragon. You freeze the acid dragon.  The acid dragon is almost dead. agg *******The acid dragon spits acid at you. agg:......@ agg;I======5.3 aggF aggHT _The splash of acid misses you. agg  You hit the acid dragon. You freeze the acid dragon.  The acid dragon is almost dead. agg/ 66-=-----6.2 agg  _The acid dragon barely misses you. The acid dragon claws you. aggX  You hit the acid dragon but do no damage.The acid dragon is almost dead. agg\ K-----7.0 (0.8 agg  agg < _You block the acid dragon's attack. x2agg~  You hit the acid dragon but do no damage.The acid dragon is almost dead.9 (0.9aggԁagg| _You block the acid dragon's attack. The acid dragon barely misses you.aggCn  You hit the acid dragon but do no damage.aggDV7-8.8agg^agg`_ _The acid dragon is almost dead.aggx7  You slash the acid dragon! You freeze the acid dragon.  You kill the acid dragon!aggJf[aggQ1919.7aggZagg^G _The acid dragon scales are intact enough to wear.agg^H  ##.#  ###.....##  #......##  #.......####### #...........#..  #...##))).... #..####....###. ###...#)### #.@...##.......###.  ......(...........).....  ..aggu..###  ##.(.# ...# #......# ##.....# #...#..  ####..# ###...# #...##.  ##. #...# ##...##  ##..# ##...#agg agg` d8=-30.7 (1.0aggR agg   Things that are here: _+0 acid dragon scales; an acid dragon corpseagg -  ###.....##  #......##  #.......###### #.....#.  #...##))).... #..####....###. ###...#)###  #######.[...##.......##agg{ W  .......@...........)... ###  ###.(.  #....# #...... ##.....# #...#..agg  .####..#####...# #...##.agg  ##. #...# ##...## aggT  #. ##..# ##...#  #..## ##..agg agg# $72aggf g==-1 _agg4 aggz agg ^2.7 (24agg agg ` _f - 24 poisoned darts (gained 1)agg *%  #......##  #.......##### #.....  #...##))).... #..####....### ###...#)###  ########.[...##.......##  #.............)... ###  ####.(  #...agg+..# # ##.....# #...#  #.####..#####...# #...##  # ##.# #...# ##...#  #.# ##..# ##...[16;6H  #.# #..## ##..  ##..## ##agg{7agg8v7==3.7 (1aggEaggLaggM8==4.7 (25aggUaggqX` _f - 25 poisoned darts (gained 1)agg  #.......#### #.....  #...##))).... #..####....## ###...#)aggϥ  ########.[...##.......  ##.............)..  .###  ####.(  #....# # ##.....# #...#agg E  #.####..#####...# #...#  # ##.# #...# ##...  #.# ##..# ##.. agg #.# #..## ##  .# ##..## ##  ##..## #aggaggWc9=5.7 (1aggaggTagg^6.7 (26aggagg` _f - 26 poisoned darts (gained 1)agg3 aggF deadiverson the Carver (Human Fighter)Turns: 9373, Time: 00:18:53 Health: 79/85agg QAC: 12 Str: 17 XL: 10 Next: 91% Magic: 10/10EV: 13 Int: 11 God: the Shining One [***...] Gold: 266SH: 14 Dex: 14 Spells: 9/9 levels left rFire . . .a - +4 falchion (freeze) rCold + . . l - +0 kite shield rNeg + . . aggR c - quicksilver dragon scales of the Indigo Skies {rC+ WillrPois .(no helmet) rElec .w - +2 cloak {Stlth+} rCorr .(no gloves) SInv .agg A - +0 pair of boots Will +....d - amulet of faith Stlth +p - +5 ring of evasion HPRegen 0.34/turn (no ring) MPRegen 0.12/turn agg %: faith @: corroded, glowing A: explore regen, iridescent scales 1, large bone plates 1, inability to drink after injury 1agg$aggg'U #.......#### deadiverson the Carver ##........... Human of the Shining One ***... agg'#...##))).... Health: 79/85 ======================-- ##..####....## Magic: 10/10 ======================== ###...###....)## AC: 12  Str: 17  ########.[...##.......# EV: 13Int: 11 agg,( ##...................).. SH: 14Dex: 14 agg(W ..................###... XL: 10 Next: 91% Place: Dungeon:8  ####.(@.........###.... Noise: ---------  Time: 9536.7 (0.0)  #.............# #.... a) +0 falchion (freeze)  #.......##.....# #...# Throw: 26 darts (poison)agg)  #.####..#####...# #...# Corr (-4)   # ##.# #...# ##... aggG)#.# ##..# ##..  aggv)#.# #..## ##.  .# ##..## ##agg)  ##..## #  _The acid dragon scales are intact enough to wear.  agg$*[Things that are here: _+0 acid dragon scales; an acid dragon corpse _f - 24 poisoned darts (gained 1) _f - 25 poisoned darts (gained 1) _f - 26 poisoned darts (gained 1)aggC+aggQ3agg5agg#~ agg! agg~ agg agg2 X8016 agg $ agg M_You are no longer corroded.agg, agg^ aggX ,agg agg> agg %1agg agg$ ,agg agg aggz aggr agg aggE K2=agg aggݧ ,agg# agg7 ,agg aggZ aggʯ U3=aggʰ aggȲ agg aggA agg aggB agg agg agg %4agg agg ,aggh aggR agg agg agg' agg K5=agg agg agg ,aggz agg' agg agg aggS o _f - 27 poisoned darts (gained 1)agg 3aggJ agg( aggH agg 9=agg agg agg. ,agg agg agg aggS ,aggA aggS ,agg agg agg agg4 agg agg agg agg5 agg agg agg agg agg[ agg agg` agg aggs agg agg ,agg4 agg agg agg agg agg aggw agg agg agg- aggb ,agg# agg  agg@ ,agg aggK! agg" agg+# agg# aggt% agg& agg ' aggp' agg) agg* agg* aggs+ agg5- agg. agg. aggA/ agg0 aggQ2 agg2 agg'3 agg4 aggH6 agg6 agg"7 agg9 aggR; ,agg; aggP= agg> agg? agg\? aggxA aggC aggkC aggC aggE aggF agg2G aggG aggI agg?K ,aggK agg........>###+4 falchion (freeze) aggR J#..##.........## 7 #.##########..#agg  #.# ##.# #.# #.# K   kobold demonologist (wandering)agg  #.# #.# #.# ##.#agg ^ #.# ##.##agg agg agg̼ j _A kobold demonologist is nearby!agg?  #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..## agg / #.# ##..## #.<......##  ##.# ##..## #.......# ##..###..... #..## ##......... ..## ##........ .## #@....... #....>........> #..##....  #.#######  agg^ #.# ##.#  #.# #.#  #.# #.#  #.# ##.#  #.# ##.## agg, #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..##  #.# ##..## #.<......##  ##.# ##..## #.......# ##..###.......## ##......... agg...## ##........ .## #@....... #....>........> #..##....  #.####### #.#  #.# #.#  #.#  #.#  #.# agg. agg7agg7agg1?aggBj _A kobold demonologist is nearby!agg>g #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..##  #.# ##..## #.<......##  ##.# ##..## #.......# ##..###..... #..## ##......... ..## ##........ .## #@....... #....>........> #..##....  #.#######  #.# ##.#  #.# #.#  #.# #.#  #.# ##.#  #.# ##.## aggrF #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..##  #.# ##..## #.<......##  ##.# ##..## #.......# ##..###.......## ##......... ..## ##........ .## #@....... #....>........>aggmt #..##....  #.####### #.#  #.# #.#  #.#  #.#  #.# aggm|agg}aggaggj _A kobold demonologist is nearby!aggۥg #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..##  #.# ##..## #.<......##  ##.# ##..## #.......# ##..###..... #..## ##......... ..## ##........ .## #@....... #....>........> #..##....  #.#######  #.# ##.#  #.# #.#  #.# #.#  #.# ##.#  #.# ##.## aggAF #.# ##..#   #.# #..## ##........#  #.# ##..## ##....K..##  #.# ##..## #.<......##  ##.# ##..## #.......# ##..###.......## ##......... ..## ##........ .## #@....... #....>........>aggB #..##....  #.####### #.#  #.# #.#  #.#  #.#  #.# aggLaggrMaggAVaggvZj _A kobold demonologist is nearby!agg ((((((Kpoisoned) _A kobold demonologist is nearby! _A kobold demonologist is nearby!  You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.  The kobold demonologist is poisoned.agg $(K.....==9.8 (1.1)6aggY K _The kobold demonologist shouts!aggI (((((very poisoned)You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.agg% .....The kobold demonologist looks even sicker.aggg(b--10.95aggD.agg2f _The kobold demonologist casts a spell.agg (((((You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.aggUaggNWaggYXaggb;3(aggbf.K...3   sun demon (summoned)K   kobold demonologist (very poisoned)agg*cx--2.1 (1.24agg*laggoA _The kobold demonologist is lightly wounded.aggb (((You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.  The kobold demonologist looks even sicker.aggagg,agg(3(K..agg+X3.33aggaggA _The kobold demonologist is lightly wounded.agg ((You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.agg-aggagg.3(.Kagg]4.4 (1.12aggCaggA _The kobold demonologist is lightly wounded.agg(extremely poison…)You throw a poisoned dart.poisoned dart hits the kobold demonologist.  looks as sick as possible!agg agg" agg, u.3.(KaggG- X5.51agg5 agg; A _The kobold demonologist is lightly wounded.aggi  You hit the kobold demonologist. You freeze the kobold demonologist.aggh .3 The kobold demonologist is moderately wounded.aggc5=6.3 (0.8aggaggYA _You block the kobold demonologist's attack.aggv  You hit the kobold demonologist but do no damage.agg .3The kobold demonologist is moderately wounded.agg(7.1aggaggaJ _The kobold demonologist hits you but does no damage.agg+   very poisoned)You slash the kobold demonologist! You freeze the kobold demonologist.  The kobold demonologist is severely wounded.agg,-8.0 (0.9agg5agg7O _The sun demon misses you.aggO ~  You hit the sun demon. You freeze the sun demon.  The sun demon is lightly wounded.aggY agg  The kobold demonologist looks satisfied for a moment.agg Y68-----9agg# agg I _The sun demon hits you. You are engulfed in flames!agg  You hit the sun demon. You freeze the sun demon.  The sun demon is lightly wounded.  You block the sun demon's attack.agg-9.7 (0.8aggaggA _You block the kobold demonologist's attack.agg>  You hit the sun demon but do no damage.The sun demon is lightly wounded.  You block the sun demon's attack.9-----20.6 (0.9agg%DaggFA _You block the kobold demonologist's attack.aggO  You hit the kobold demonologist but do no damage.The kobold demonologist is severely wounded.The sun demon barely misses you.aggpP (1.5aggZ aggB^ A _You block the kobold demonologist's attack.aggEp The kobold demonologist is severely wounded.  The sun demon barely misses you. _You block the kobold demonologist's attack.  You closely miss the kobold demonologist.  The kobold demonologist is severely wounded.  The sun demon barely misses you.aggSz agg/  The kobold demonologist begins to cast a cantrip, but forgets the words!aggH(2.4aggagg7 _You block the sun demon's attack.aggx  The kobold demonologist begins to cast a cantrip, but forgets the words! _You block the sun demon's attack.  You hit the kobold demonologist. You freeze the kobold demonologist.  The kobold demonologist is almost dead.You kill the kobold demonologist!  The Shining One accepts your kill.aggxaggf§)agg>7093.2 (0.8agg_aggb _The sun demon disappears in a puff of smoke!agg agg} aggK aggվ agg: agg Xagg agg D1=aggc agg` Xagg agg aggV agg U2=agg aggc ,aggC agg }3aggv agg ,agg3 agg ,agg agg aggI %4agg agg, ,agg agg ,agg aggm agg K5=agg agg ,agg agg aggO agg agg agg U6=agg aggO ,agg  agg ,agg agg }7aggF agg ,agg( agg9 agg K8=agg agg! ,aggC aggB ,agg agg3 agg U9=agg$ agg ,agg aggS! ,agg" agg$ agg% &80agg>& agg) ,agg@+ agg- ,agg'/ aggj2 ;1agg4 aggK6 ,agg8 agg; 92agg,< (=agg8> agg@ ,agg{C aggG BaggdI aggI #3aggBJ 2=agg;K aggTN aggN agg)P aggWR aggR aggxT agg W aggtW %4agg Y agg[ ,aggI\ agg^ ,agg_ agga agg@b K5=aggd aggh aggIj aggj aggl aggTr Bagg?s aggc  _f - 22 poisoned darts (gained 1)=agge aggϢ aggk agg agg o _f - 23 poisoned darts (gained 1)agg 3agg- aggӸ ,aggP agg> o _f - 24 poisoned darts (gained 1)agg 3agg agg agg ,agg~ agg] ,agg0 agg o _f - 26 poisoned darts (gained 2)agg agg8 agg agg ,aggm agg o _f - 27 poisoned darts (gained 1)aggs agg agg$ agg agg aggc agg agg agg: agg agg agg8agg,agg?aggaggN ,agg agg agg,aggnagg  Things that are here:  a +0 dagger; a +0 robe; a kobold corpseaggKagg _aggaggQ aggw",agg~#agg&&aggv(,agg)aggy=aggs?,agg@aggEaggGagg5HaggHagg[MaggO,aggPaggWaggY,agg[agg5`aggFb,aggcaggpiaggk,agg maggqaggot,aggPvagg3{agg},aggOaggagg,aggaggagg=aggaggaggaggaggvaggagguaggbaggaggaggwaggGaggaggšaggagg,aggagg°aggP,aggaggaggNaggaggaggʾagg,aggiaggagg ,aggagg)aggqaggaggnaggaggaggaggagg|agg,agg.aggagg ,aggaggagg,aggEaggDagg,aggaggagglaggaggaggagg,aggaggagg,agg/aggagg ,agg aggaggz,aggaggagg},aggaggagg,aggagg/agg!,agg7#agg$aggQ&,aggC'agg)aggg,,agg-agg71agg3,agg4aggF7agg3=,aggX?aggBagg,aggaggagg_ agg agg aggagg,aggaggyagg,aggaggagg`,agg agg!!agg#,aggL%agg&agg',agg)aggx*agg,,aggo.agg0agg2,aggo4aggX7agg8,agg9agg<agg.@,agg@aggZBaggfCaggCaggagg@aggBaggCaggCaggFaggGagg'HaggIaggM;  You see here 3 stones.agg\OaggO _aggPaggRaggT,aggsUaggQXaggY,aggZagg\agg^aggf^aggZ_aggbaggc,aggeagghaggi,agg kaggmaggoaggioaggpaggraggtagg/uaggjvaggxaggz,agg{agg~agg,aggagg߃agg,aggaggagg,aggaggagg"aggmaggaggaggʒ,agghaggagg,agg~agg agg̘aggA,aggšagg/agg=,aggaggpaggaggaggvaggagg,aggaggagg,aggeaggaggaggPaggagg|aggaggagg aggaggƲ,agg8aggaggܵ,aggaaggaggϸaggaggaaggaggpBaggagg~aggagg,aggLaggagg*,agg|aggaggq,aggaggagg,aggDaggagg,aggaggagg,,aggaggTaggagg aggQaggagg,agg>agg,agg,aggBaggaggBaggagg### #  ######## ### ####...## #.# .)###...#...# <.###### ..#†..#..#..### .## #....### ...#..#.#####..##..# ##....... ...#####..# ##..###### #### ### #.##.### #87.2 (48.0) # #..#.## ##.##  ####..###.##  #........# #..#.##### ######  ### # #.###[aggPm ##...aggnagg,8.2 (49aggagg9 _Found a stone staircase leading up.agg 3aggagg aggaggagg`aggBagg,agg,aggagg,aggoaggagg,agg aggagg@agg,agg9aggaggLaggaggagg,aggagg2aggS,aggaggagg,aggnaggaggaggJaggagg7agg,aggxaggagg,aggFaggagg ,agg agg} agg ,aggaggnagg,aggRaggagg,aggaggaggaggagg aggw"agg#agg9$agg%agg 'aggn(agg(agg{)agg+agg,agg-agg-agg5#..# #.# .# #..### #..# .# ....##..# .# .......# agg[6## #.....# # ##...## ###.....###...  #########.....@.......  #.....................  ##..######....########.  #..## ######  #..#  agg6#..##  ###.##<.# ###### # #.## #....######agg;.811.2 (23agg<,2.2 (24agg(@aggaG2 _B - a wand of mindburst (22)aggtagg_u3aggWxaggy,agg}Xagg~aggagg,aggyaggɂaggӃ,aggZaggAagg?,agg߇agg.Xaggnaggaggaggagg?agg%,aggaggXaggTaggaggaggkagg^aggagg agggaggaggaggzaggɞagg՟aggaggaggaggaggragg|,aggHaggaggN,aggaggBagg(naggagg6,aggagg5agg5,aggܹaggJagg],aggaggaggɿ,aggaggagg,aggaggwaggjaggaggaggagg,aggaggagg',aggaggEagg,aggYaggagg,aggagg$aggD,aggaggagg ,aggaggagg,aggaggagg#,aggaggaggaggagg6aggaggaggU,aggaggraggaggaggaggagg agg[aggagg,aggaggaggagg#aggaggDagg(aggaggaggaggaggaggmaggaggaggaggaggRaggaggVaggaggaggR,aggaggaggBaggbaggaaggaggagg9 agg ,agg agg agg$,aggagg,agg,aggaggaggaggPaggaggZaggCaggagg5aggagg,aggdaggagg &#..## ##.##..#  ##..#####..# ###.##  #....##..## ###...#  ##.......# ###....##  ##.....####....###  ##...#####...##  ###.....###....#  ###..............#  ................@#  64.2 (52 ###....########...#   ###### ##...#   #....#  #....#  #[40agg&-m....#   ######......   #....###### ..<....    ##.........##   agg*agg+,5.2 (53agg/agg29 _Found a stone staircase leading up.aggm Iaggm aggs  #..#####.###.# #....##..## ###...# #.......# ###....# ##.....####....### agg6u ..#####...### ###.....###....# ###.............. .................## ###....########.@.#0.0)  ###### ##...# #....#.... >......###..######...#  aggy aggu} +6.2 (1agg~ aggk ; _Found a stone staircase leading down.aggSY aggY aggfZ agg] agg^ ,aggc ,agg8d agghd aggd aggg aggh aggi aggi aggOk agg^l aggl aggm aggn agg!p ,aggp aggr aggs ,agg[t aggw aggx ,aggx agg{ agg| agg| agg} agg_ agg ,aggl agg agg> ,agğ aggH aggv agg aggG agg aggH ,agg agg agg agg aggv agg aggݗ agg aggV agg aggo ,aggK agg agg ,agg aggM aggf agg agg aggo agg ,aggK agg> agg ,aggs agg agg ,aggy agg aggӭ ,agg agg aggȱ ,agg agg agg aggU aggt aggw agg ,agg[ agg agg ,agg agg agg" ,agg` agg agg agg˺ agg agg agg agg- aggU agg aggg agg agg aggP agg ,agg8 agg agg; ,agg agg> agg agg agg agg agg ,aggJ agg agg agg agg aggS agg agg agg& agg aggB agge agg aggf P  There is a stone staircase leading up here.agg agg%  _agg[ agg ,agg ,agg agg1 ,agg} aggK agg ,agg agg agg] ,agg agg agg agg agg5 agg agg6 ,agg agg ....### ##..######.... ....### #..## ##### ..####.. ..### ##### #..## ....### ####...## ###.# .....)###...#...# #<.# #### #.....#†..#..#..#####.## #... ##.....#..#.#####..##..# ##...  #..# #@##...## ##..##909.2 (43.0) ##..### ####..## ##.### #))## #..#.## ##.## )### ####..###.## ## #........# #  #..#.##### #######  # #[11;agg 76Hagg\ agg{ agg E _Done exploring.agg\agg\agg]agg.....<...##...0.0)aggaggagg}E _Done exploring.aggIaggIaggIaggo4aggvaggvE _Done exploring.agg6aggBy  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0  agg r     c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0               f - Armour   3.0   4.0   0      agg^ g - Dodging   0.0   1.0   0  agg    h + Shields8.8   9.0   0       i - Stealth   0.0   0.8  +1                          aggx                    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  agg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsagg*aggagg$9......######## ##..######.... deadiverson the Carver ....####..## ##### Human of the Shining One ***... ..####..#Health: 85/85 ======================== ..######## #..##aggU%Magic: 10/10 ======================== ....### ####...## ###.#AC: 16Str: 17 .....)###...#...# #<.# #### EV: 13Int: 11 #.....#†..#..#..#####.## #... SH: 14Dex: 14 agg' ##.....#..#.#####..##..# ##... XL: 10 Next: 99% Place: Dungeon:8  #.....#####.# #@##...## ##..## Noise: ---------  Time: 9909.2 (0.0) ##..#### ### ####..## ##.### a) +4 falchion (freeze) #))###..#.## ##.##Throw: 27 darts (poison) )#######..###.## ###........# ##..#.##### ######## #  _Found a stone staircase leading up. _Found a stone staircase leading down. _There is a stone staircase leading up here. _Done exploring. _Done exploring. _Done exploring.agg9,agg,agg12aggQ4aggCIaggaggMagg?aggE _Done exploring.aggqagg+ragglraggdaggaggΠaggޣE _Done exploring.agg agg/ eWhere to? (Tab - D:8, ? - help) aggZ D D - Dungeon  T - Temple aggyagg ......######## ##..######.... deadiverson the Carver ....####..## ##### Human of the Shining One ***... ..####..#Health: 85/85 ======================== ..######## #..##Magic: 10/10 ======================== ....### ####...## ###.#AC: 16Str: 17 .....)###...#...# #<.# #### EV: 13Int: 11 #.....#†..#..#..#####.## #... SH: 14Dex: 14 ##.....#..#.#####..##..# ##... XL: 10 Next: 99% Place: Dungeon:8  #.....#####.# #@##...## ##..## Noise: ---------  Time: 9909.2 (0.0) ##..#### ### ###[40aggm#..## ##.### a) +4 falchion (freeze) #))###..#.## ##.##Throw: 27 darts (poison) )#######..###.## ###........# ##..#.##### ######## #  _There is a stone staircase leading up here. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring.aggtaggagg _aggagg,aggaggaggV,aggaggaggagg*aggTaggagg#,aggoagg@agg,aggaggnaggyaggaggaggagg,aggIaggaggA,aggaggaggX,aggaggagg2,agg{aggagg,aggaggaggaggaggWaggaggagg2aggaggpaggaggaggOaggagg=agg_aggaggaggj,aggaggagg(,aggagg agg9 ,agg aggx agg agg4 agg aggd aggagg-aggeagg!agg,agg4aggagg,agg^agg%agg,agg@aggagg,aggaggBagg"agg$agg%agg.&agg&aggr(agg),aggp*aggB,agg-agg.agg.agg}2aggY3,agg3aggJ5agg7Baggs9agg:agg:agg;agg@Xagg%Bagg agg9aggagg)agg!aggWaggaggGaggDaggiaggagg0 = _Done exploringaggX F. _ There is a stone staircase leading down here.agg agg aggz $ _agg agg>29agg2aggd3agg3aggZ4agg;  .#  ##########...#  .......@...<.# aggp;{49.0 (39.8) ...............  ...............  #..###########. #.# agg;G_You climb downwards.  Found a stone staircase leading up.agg;agg>agg@a _There is a stone staircase leading up here.agg agg[ agg\ agg F _Unknown command.agg agg> agg agg agg agg : _agg agg aggW aggٲ agg aggT agg aggN agg% aggS agg agg agg: agg agg agg agg agg4 aggg agg aggb agg agg agg ,agg agg agg aggV aggW agg agg ,aggB agg agg ,agg aggqaggaggJagg aggagg,aggHagg(agg.,agg0agg4agg*:agg_:aggX<aggBagg|DaggDaggEaggIaggN,agg8Qagg6UaggXY,aggZagg^agg3bagg[baggbdaggjaggnaggnaggpaggtaggy,agg {agg"aggM,aggaaggFaggaggagg/aggaggaggZaggBaggagg,aggmaggagg.....<...<.#####..≈≈≈~.. .................~~~≈~~. ...................~≈~.. .###########......~≈≈~..#......~~≈~..#......~~~~~.#......~~~≈.........≈~P~~~~≈≈~~.~≈≈≈~aggU~~≈≈~~...!......P≈≈≈P..........~≈≈≈~..........~≈≈≈Po   orc (wandering).......#.~~≈≈≈~....... .~~≈o≈≈agg5/76.0 (27.0agg ~An orc comes into view. It is wielding a +0 club.agg2,7.0 (28agg<agg0 _The orc moves out of view.aggNagg*aggagg<agg.............~~~≈~~...........~≈~..###########......~≈≈~.. . #......~~≈~.. #......~~~~~. #......~~~≈..####.......≈~P~~.........~~≈≈~~.agg!E..~≈≈≈~..~~≈≈~~!......P≈≈≈P..~≈≈≈~.~≈≈≈P#.~~≈≈≈~o   orc (wandering)aggN.#.~~≈~≈≈.....o~agg ,0.0)agg8 uoo.agg 4==8.0 (1agg aggx 7 _The orc shouts! You hear a shout!agg  ........~≈~.. #......~≈≈~.. . #......~~≈~..  #......~~~~~.  #......~~~≈..  ####.......≈~P~~  .........~~≈≈~~.  .......@..~≈≈≈~.  ..........~~≈≈~~  ....!......P≈≈≈P  ...........~≈≈≈~  ...........~≈≈≈P  ........#.~~≈≈≈~  ........#.~o≈~≈≈  .............~≈ agg i ........~≈~.. #......~≈≈~..  #......~~≈~..  #......~~~~~.  #......~~~≈..  ####.......≈~P~~  agg= .........~~≈≈~~.  .......@..~≈≈≈~.  ..........~~≈≈~~  ....!......P≈≈≈P  ...........~ agg ...........~ ........#.~~≈≈≈~  ........#.~o≈~ .............~ agg(aggagg}agg [ _An orc is nearby!agg.~≈~.. ###########~≈≈~..  #......~~≈~..  #......~~~~~. #......~~~≈.. ####.≈~P~~ .........~~≈≈~~. .aggZ3.~≈≈≈~. .~~≈≈~~ ....!P≈≈≈P ...........~≈≈≈~ .~≈≈≈Pagg.#.~~≈≈≈~.agg#.~o≈~≈≈ ......agg~≈≈####### ..~.~≈aggpagg+ SS   electric eelo   orc--9agg1agg4` _An electric eel comes into view.aggk6###########~≈≈~..  #......~~≈~.#......~~~~#......~~~≈..####.≈~P~~.........~~≈≈~~...≈≈≈~..aggC7}~~≈≈~~~....!P≈≈≈P............~≈≈≈~~.~≈≈≈P.#.~~≈≈≈~~.#.~o≈~≈SP.....~≈≈~#######...~.~≈≈~aggb7H .....~agg<agg&KSo~aggQ *******The electric eel shoots out a bolt of lightning at you!agg.@.~≈≈≈===80aggagg8Y _The bolt of electricity misses you.agg>1~.#......~≈≈~.. #......~~≈~... #......~~~~~.. #......~~~≈... ####.≈~P~~. .~~≈≈~~.. .~≈≈≈~.. agg1.~~≈≈~~~ ....!...@..P≈≈≈P. .~≈≈≈~~ .~≈≈≈P~ .#.~o≈≈≈~~ agg1 .#.~~≈~≈SP .....~≈≈~agg2 #######...~.~≈≈~ .....~~≈≈agg9agg/IRo~agg]QW *******aggQWThe electric eel shoots out a bolt of lightning at you!agg@..~≈≈≈aggW76---1aggagg7 _The bolt of electricity hits you!aggt.#......~≈≈~.. . #......~~≈~... #......~~~~~.. #......~~~≈... ####.≈~P~~. .~~≈≈~~.. .~≈≈≈~.. .~~≈≈~~~ ....!..@...P≈≈≈P. .~≈≈≈~~ .o~≈≈≈P~ .#.~~≈≈≈~~ .#.~~≈~≈SP ......~≈≈~o   orc#...~.~≈≈~ .....~~≈≈aggyagg[{aggK=o.S≈S   electric eelo   orcagg>`7------2aggaggagg i#..#......~≈≈~.. #. #......~~≈~... # #......~~~~~.. #......~~~≈...#.≈~P~~..~~≈≈~~...~≈≈≈~...~~≈≈~~~.!.@....P≈≈≈P..o.~≈≈≈~~.~≈≈≈P~......#.~~≈≈≈~~.#.~~≈~S≈P....~≈≈~o   orc.#...~.~≈≈~ .....~≈≈agg&8=---3agg4aggY #..#......~≈≈~..  #. #......~~≈~...  # #......~~~~~.. #......~~~≈...#.≈~P~~..~~≈≈~~...~≈≈≈~...~~≈≈~~~.!@.....P≈≈≈P.agg٦.o.~≈≈≈~~.~≈≈≈P~.#.~~≈≈≈~~.#.~~≈~S≈Pß.....~≈≈~.#...~.~≈≈~.. .....~~≈≈aggGaggragg׷Jo.agg^9=4aggaggeagg%  #..#......~≈≈~.. #. #......~~≈~... # #......~~~~~.. #......~~~≈...#.≈~P~~..~~≈≈~~...~≈≈≈~...~~≈≈~~~.@..o...P≈≈≈P.P.~≈≈≈~~P.~≈≈≈P~.#.~~≈≈≈~~.#.~~≈~S≈Pß.....~≈≈~aggC' .#...~.~≈≈~_.. .....~~≈≈agg1 aggO= Ko._aggN> V85==5aggG aggM _Found an ornate altar of the Wu Jian Council. _You see here a potion of curing.aggy = #..#......~≈≈~.. #. #......~~≈~... # #......~~~~~.. #......~~~≈...#.≈~P~~..~~≈≈~~...~≈≈≈~...~~≈≈~~~!.o....P≈≈≈P.P.~≈≈≈~~P.~≈≈≈P~.#.~~≈≈≈~~.#.~aggU 5~≈~S≈Pß.....~≈≈~.#...~.~≈≈~._.. .....~~≈≈agg agg Uo._agg -6 _aggT ;_agg aggN #..#......~≈≈~.. #. #......~~≈~... # #......~~~~~.. #......~~~≈...#.≈~P~~..~~≈≈~~..#.~≈≈≈~...~~≈≈~~~.!o.....P≈≈≈P.P.~≈≈≈~~P.~≈≈≈P~.#.~~≈≈≈~~.#.~~≈~S≈Pß....~≈≈~ß....#.~.~≈≈~ß._.. .....~~≈≈agg\Sagg[Ko._agg#\&7agg`aggHcaggx #..#......~≈≈~.. #. #......~~≈~... # #......~~~~~.. #......~~~≈... #.≈~P~~. .~~≈≈~~.. #.~≈≈≈~.. .~~≈≈~~~ .o......P≈≈≈P. PPP.~≈≈≈~~ PPP.~≈≈≈P~ .#.S.#.~ßßßß....~≈≈~ S   electric eelagg}y Fß....#...~.~≈≈~ o   orcß._.. ...agg׉ :_agg! ******* The electric eel shoots out a bolt of lightning at you!agg @o....._The bolt of electricity hits the orc. The bolt of electricity hits you.agg {3=-===8agg& C_aggt* 1 _You block the orc's attack.agg I  You hit the orc. You freeze the orc.agg v)_agg< 4--8 (0.8agg{' ;_aggb+ G _You kill the orc!agg@#. #......~~≈~.# #......~~~~~..  #......~~~≈... #########.≈~P~~. ..............~~≈≈~~.. #agg≈≈≈~.. ..~~≈≈~~~ .)P≈≈≈P. PPP......~≈≈≈~~ PPP.~≈≈≈P~ ....#.S~≈≈≈~~ .#.~~≈~S≈Pßßßß....~≈≈~ß....########...~.~≈≈~ ß._.. .....~ .. #aggagg_oo   orc wizard4----agg&9.8 (1.0agg;_agg#z _An orc wizard comes into view. It is wielding a +0 dagger. agg#. #......~~≈~...  # #......~~~~~.. #......~~~≈... #.≈~P~~. .~~≈≈~~.. #.~≈≈≈~.. .~~≈≈~~~ .)......P≈≈≈P. PPP.~≈≈≈~~ PPP.~≈≈≈P~ .#.S~≈≈≈~~ .#.~ßßßß.....~≈≈~ß....# aggY...~.~≈≈~ ß._.. o....~~≈≈ .. ..#. agg% agg4]o_. agg< *******The electric eel shoots out a bolt of lightning at you! agg .)@...._The bolt of electricity hits you. agg`79-===90 agg:_ agg& _You hear a howl! aggj # #......~~~~~.. #......~~~≈...#########.......≈~P~~. ........~~≈≈~~.. #..~≈≈≈~.. .~~≈≈~~~ )......P≈≈≈P. PPP.......~≈≈≈~~ PPP.~≈≈≈P~ ..#.S~≈≈≈~~  aggj.#.~~≈~S≈P ßßßß......~≈≈~ ß....########o..~.~≈≈~ ß._.. .....~~≈≈  ..#.  agg:_ agg* ***The orc wizard gestures at you while chanting.!aggm} ...The magic dart hits you!!aggv *******The electric eel shoots out a bolt of lightning at you!!aggY.@....._!agg]`1---1!aggs!agg7 _The bolt of electricity hits you.!aggf #......~~~≈...#########.......≈~P~~. ........~~≈≈~~.. #..~≈≈≈~.. .~~≈≈~~~ )......P≈≈≈P. PPP.......~≈≈≈~~ PPP.~≈≈≈P~ ..#.S~≈≈≈~~ .#.~~≈~S≈P ßßßß......~≈≈~ ß....########o..~.~≈≈~!aggHg ß._.. .....~~≈≈ . ..#. o   orc wizard  . !aggUx:_!agg}  The orc wizard gestures at you while chanting.!agg !agg0---2!agg!aggS7 _You resist with almost no effort.!agg##########.......≈~P~~. ........~~≈≈~~.. #..~≈≈≈~.. .~~≈≈~~~ )......P≈≈≈P. PPP.......~≈≈≈~~ PPP.~≈≈≈P~ ..#.S~≈≈≈~~ .#.~~≈~S≈P ßßßß......~≈≈~ ß....########o..~.~≈≈~ ß._.. .....~~≈≈ ß. ..#.  #!agg!aggqo._!agg_3-----3!aggC_!agg !agg-  #.≈~P~~. .~~≈≈~~..#.~≈≈≈~...~~≈≈~~~.)......P≈≈≈P.P.~≈≈≈~~P.~≈≈≈P~.#.S~≈≈≈~~.#.~~≈~S≈P.ßßßß.o.....~≈≈~.ß....#...~.~≈≈~.ß._.. .....~~≈≈.ß... ..#.... ..#.....!agg3 !agg%A 9o.!aggA T6=4!aggK !aggP !aggr 7 ........~~≈≈~~..###..~≈≈≈~.....~~≈≈~~~)......P≈≈≈P.PPPPP.......~≈≈≈~~P.~≈≈≈P~....#.S~≈≈≈~~.#.~~≈~S≈Pßßßß!agg }o......~≈≈~.ß....########...~.~≈≈~.ß._.. .....~~≈≈.ß.... ..#....... #....  .....##....!agg,!agg io._!aggps83===5!aggt8_!agg"aggi###..~≈≈≈~....~~≈≈~~)......P≈≈≈PPPPPPP.......~≈≈≈~P.~≈≈≈P....#.S~≈≈≈P.#.~~≈~S≈P..ßßßßo.......~≈≈P..ß...@########...~.~≈≈P..ß._..# .....~~≈.ß..... ..#. "aggrii........ #..#.......#. .........# ##......... #.........."aggp"agg#8o."aggڀr5===6"aggc;_"agg$"agg....~≈≈~~)......P≈≈≈PPPPPPP.......~≈≈≈~...P...............#.S~≈≈≈~......#.~~≈~S≈ßßßß.....o........~≈....########...~_.@# .....~~...ß.....(..... ..#. ............ . #..#"agg..........###... #...."agg"agg&7"aggX"agg$% _Found 2 stones."agg^.)P≈≈≈P.PPPPPP.............~≈≈≈~~PPPPPP.............~≈≈≈PP...............#.S~≈≈≈~~P.........#.~~≈~S≈PP..ßßßß.....o........~≈≈~P..ß....########...~.~≈≈~P..ß._..########.....~...ß....@(........#. ..........."agg^Q . #..# #....#### #....."aggg"aggh&8"aggTm:_"aggo"agg "aggT "aggn "agg "aggV "agg "aggJ "agg 9="agg "agg "agg ,"agg "agg! o_o   orc wizard"agg(  ) PPPPPP.. PPPPPP.. P....... P....... P..ßßßß. P..ß... "agg) P..ß._..######## ...ß....@(........#. 10001.8 (3.0) ................ .  #..#............  "agg0) i#...............  ####............  #............ "aggX) E .............  .............. "agg) S _You start waiting."agg8 K ) PPPPPP.. PPPPPP.. P....... P....... P..ßßßß. P..ß... P..ß._..######## ...ß....@(........#.  ................ .  #..#............  #............... ####............ "agg #............  ............. .............. "agg "agg :_"agg b _An orc wizard is nearby!#agg- .~~≈≈~~ ............)......P≈≈≈P PPPPPP.............~≈≈≈ PPPPPP.............~≈≈≈P P.........#.S~≈≈≈~ P...............#.~~≈~S≈ P..ßßßß.....o........~≈≈ P..ß...o########...~.#aggz- P..ß._.@########.....~~≈ ...ß.....(........#. .... . #..#. #...####. #. ...............#agg?#aggM@3=2.8 (1#aggkK#aggsOA _The orc wizard hits you but does no damage.#agg8Y  You slash the orc wizard! You freeze the orc wizard.#aggaG)#agg..................~~≈≈~~ deadiverson the Carver............)......P≈≈≈P Human of the Shining One ***...PPPPPP.............~≈≈≈~ Health: 85/85 ========================PPPPPP.............~≈≈≈P Magic: 10/10 ========================P...............#.S~≈≈≈~ AC: 16Str: 17P...............#.~~≈~S≈ EV: 13Int: 11P..ßßßß.....o........~≈≈ SH: 14Dex: 14P..ß...)########...~.~≈≈ XL: 10 Next: 100% Place: Dungeon:9P..ß._.@########.....~~≈ Noise: ==-------  Time: 10003.7 (0.9)...ß.....(........#.a) +4 falchion (freeze)#agg................ .Throw: 27 darts (poison)#..#............#...............####............#....................................... _You resist with almost no effort. _Found 2 stones. _You start waiting. _An orc wizard is nearby! _The orc wizard hits you but does no damage.  You slash the orc wizard! You freeze the orc wizard.#agg _You kill the orc wizard!You have reached level 11!#aggc/  --more--$aggY-F90/901/111 0% $agg8:_$agg;4 _$agg\$agg$agg$agg>$aggcM ###≈≈≈~.......~~≈≈~~......)......P≈≈≈P...~PPPPP.............~≈≈≈P..o...#.S~≈≈≈~.............#.~~≈~Sßßß..............~.~≈P..ß._..########.....~~≈ß.....(........#........... .#....#...............o   orc (polearm, wandering)#...............$agg&0$aggKj.o_$agg4--4.7 (1$agg;_$agg _An orc comes into view. It is wielding a +0 trident.Things that are here: _a +0 dagger; a +0 robe; an orc corpse$aggf I ............... ............).. PPPPPP......... PPPPPP......... P.............. P..........o... P..ßßßß........ P..ß...@# P..ß._..# ...ß.....(  .......... .  #..#............  #...............  ####............  #............   $agg[  ............... ............).. PPPPPP......... PPPPPP......... P.............. P..........o... P..ßßßß........ P..ß...@# P..ß._..# ...ß.....(  ..........  #..#....... #...............  ####......... #.......... $agg'i o_.--$aggv $aggy [ _An orc is nearby!%agg$%aggZ.o_%agg-5 _%agg<,%agg.%aggS%agg*co.o)%aggc&6%aggt%aggy%agg %agg Jo._.%aggM &7%agg ;_%agg$ %agg% %agg` Do.%agg &8%aggf %agg &aggܡ ..~~≈≈~~.###~≈≈≈~........~~≈≈~~~............)P≈≈≈P.PPPPPP.~≈≈≈~~PPPPPP..~≈≈≈PP.#.S~≈≈≈~~P...............#.~~≈~S≈PP..ßßßß.@o...........~≈≈~&aggMP..ß...)########...~.~≈≈~P..ß._..########.....~~≈≈...ß.....(..#................ .#..#............ #...............####............#&agg7&agg.=9&agg@_&agg: _The orc hits you but does no damage.&aggpK  You slash the orc! You freeze the orc.&aggm~`)_&agg)'10&agg&aggdG _You kill the orc!&aggŪ&agg&agg@_&agg̹H _No target in view!&aggj (.~~≈≈~~.. ###.~≈≈≈~.. .~~≈≈~~~ .)......P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP.~≈≈≈P~ P.#.S~≈≈≈~~ P.#.~~≈~S≈P P..ßßßß..@.~≈≈~ P..ß...)#&aggc ...~.~≈≈~ P..ß._..#.....~~≈≈ ...ß............#..#....#.......####.... &aggԙ &aggJ 5-1 _&agg 8_&aggp o  Things that are here: _a +0 trident; a +0 ring mail'agg .~~≈≈~~.. ###.~≈≈≈~.. .~~≈≈~~~ .)......P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP.~≈≈≈P~ P.#.S~≈≈≈~~ P.#.~~≈~S≈P P..ßßßß..)~≈≈~ P..ß...)#'aggx...~.~≈≈~ P..ß._..#.....~~≈≈ ...ß.......#..# 'agg:_'aggvG-2 _'agg(8_'agg+'aggj.~~≈≈~~.. ###.~≈≈≈~.. .~~≈≈~~~ .)......P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP.~≈≈≈P~ P.#.S~≈≈≈~~ P.#.S~≈~S≈P P..ßßßß..).~≈≈~ P..ß...)#...~.~≈≈~ P..ß._..#.....~~≈≈ #..#. S   electric eel 'agg{:_'agg&3'agg'aggl'agg.~~≈≈~~.. ###.~≈≈≈~.. .~~≈≈~~~ .)......P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP..~≈≈≈P~ P.#.S~≈≈≈~~ P.#.S~≈~S≈P P..ßßßß..).~≈≈~ P..ß...)#'aggI_...~.~≈≈~ P..ß._..#.....~~≈≈ #..#. 'agg`_4'aggN'agg(agg (((((You throw a poisoned dart.  The poisoned dart hits the electric eel.(agge[.....(agg]5.8 (1.16(agg(aggɘ( _You hear a splash.(agg^ (((((_(poisoned)  You throw a poisoned dart.  The poisoned dart hits the electric eel.  The electric eel is poisoned.(agg;d....._(aggi<]7.0 (1.25(agg9G8_(aggqL( _You hear a splash.(agg)z(((((very poisoned)electric eel is poisoned(aggO*I.looks even sicker.  The electric eel is lightly wounded.(aggR ..... You hear a splash.(agg ******The electric eel shoots out a bolt of lightning at you!(aggOf.@....(aggP8---===8.1 (1.14(agg[8_(agg](aggf/  --more--)agg5 _The bolt of electricity hits you!)agg(((((((You throw a poisoned dart.  The poisoned dart closely misses the electric eel.)agg:.S(...._You hear a splash.)agg$******_The electric eel shoots out a bolt of lightning at you!)aggf.@....)agg5e7------9.2)aggu03)aggD)agg-/ _The bolt of electricity hits you!)agg(((((_You hear a splash.  The electric eel shoots out a bolt of lightning at you!The poisoned dart hits the electric eel.  The electric eel is heavily wounded.)agghH ..... You hear a splash.)agg7U ******_The electric eel shoots out a bolt of lightning at you!)aggf.@....)aggo59------20.3)agg02)aggR8_)agg97 _The bolt of electricity hits you!)agg h(((((The electric eel shoots out a bolt of lightning at you! _The bolt of electricity hits you!  The electric eel looks even sicker.  The electric eel is severely wounded.)agg ( u .....You hear a splash.)aggf/ ******The electric eel shoots out a bolt of lightning at you!)agg߽ f.@....)agg n48------1.4)agg 01)agg 8_)aggQ )agg" /  --more--*agg*5 _The bolt of electricity hits you!*aggt3#########.≈~P~~.  ..~~≈≈~~.. ###~≈≈≈~.. *agg3......~~≈≈~~~ ............)P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP*agg3..~≈≈≈P~ P.#.S~≈≈≈~~ *agg"4NP............@..#.S(≈~S≈P P..ßßßß..)...........~≈≈~ *aggG4P..ß...)########...~.~≈≈~ *agg4qP..ß._..########.....~~≈≈...ß.....(.#....... . .#..##...*agg4O###*aggA50=-----*aggYB20*aggJB_*aggL*agg #......~~~≈... #########.≈~P~~.  ..~~≈≈~~.. ###~≈≈≈~.. ......~~≈≈~~~ ............)P≈≈≈P. PPPPPP.~≈≈≈~~ PPPPPP*agg8[..~≈≈≈P~ P.#.S~≈≈≈~~ P...............#.S(≈~S≈P P..ßßßß..)...........~≈≈~ P..ß...)########...~.~≈≈~P..ß._..########.....~~≈≈...ß.....(..#.......*agg .....#..# .....#...*agg*agglp1=---3*aggb:_*agg*aggL2 #......~~~≈... #.≈~P~~. .~~≈≈~~.. ###.~≈≈≈~..  .~~≈≈~~~  .*agg2 )......P≈≈≈P.  PPPPPP.~≈≈≈~~  PPPPPP.~≈≈≈P~  P.#.S~≈≈≈~~  P.#.S(≈~S≈P  P..ßßßß..).....~≈≈~  P..ß...)#...~.~≈≈~  P..ß._..#*agg+3 .....~~≈≈  ...ß.....(........#...  .*aggj3 t......  #..#..*agg3 ..... *agg= *aggR> &4*aggF :_*aggfI +agg.X ########.≈~P~~+aggB..............~~≈≈~~.###.~≈≈≈~....~≈≈~~~)......P≈≈≈P.PPPPPP.......~≈≈≈~~..~≈≈≈P.....#.S~≈≈≈~(≈~S≈Pßßßß..).....~≈≈~+agg...)########...~.~_..~~+agg ..#...~.P~+agg^[.......  ####............+agg+aggd4=55+agg:_+aggT. _You feel a bit more experienced.+aggr ..............~~≈≈~~..  ###..~≈≈≈~.. .......~~≈≈~~~ .)......P≈≈≈P. PPPPPP+agg]s Y......~≈≈≈~~ PPPPPP....~≈≈≈P~ P......#.~~≈≈≈~~ P.#.((≈~≈≈P P..ßßßß..)+aggs ....~≈≈~ P..ß...)########...~.~≈≈~ +aggs !P..ß._..########.....~~≈≈ ...ß.....(........# +aggs :......................P #..#h.......~h   howler monkey (wandering) #....+agg t \.......... ####+aggNt .....  +agg { +agg1 z.  A howler monkey comes into view.+agg9 T6=6+agg +agg 2 _The howler monkey moves out of view.+aggV .~~≈≈~~.. ###..............~≈≈≈~.. .......~~≈≈~~~ )......P≈≈≈P. .......~≈≈≈~~ ......~≈≈≈P~ ..#.~~≈≈≈~~ .#.((≈~≈≈P +agg< ..ßßßß..).~≈≈~ ..ß...)#...~.~≈≈~ ..ß._..##.....~~≈≈ ß.....(........#...~~≈h.P~ ..#...~P~h   howler monkey (wandering) .+agg| ............P.... +agg +agg ]_h...+agg &7+agg+agg,agg-#########.≈~P~~.  ........~~≈≈~~. ##......~≈≈≈~........~~≈≈~~~ ..........)......P≈≈≈P...............~≈≈≈~~. PPPP.............~≈≈≈P~......#.~~≈≈≈~~~............#.@(≈~≈≈P.ßßßß..)...........~≈≈~,agg].ß...)########...~.~≈≈~ß._..########.....~~≈≈~ß.....(.....h..#...~~≈≈.....P~~FF   marrowcuda#....~P~~h   howler monkey (wandering) .........P~ ##.........,agg4iYou enter the shallow water.  Moving in this stuff is going to be slow.,agg6,agg8,aggHh.~F,agg:I60==8Water ,aggjI,aggqV,agg\ _A marrowcuda comes into view. _You see here 5 poisoned darts.,agg 2 ........~~≈≈~~... ###........~≈≈≈~... .........~~≈≈~~~.)......P≈≈≈P.. PPPPP.............~≈≈≈~~.P.............~≈≈≈P~. ...............#.~~≈≈≈~~~......#.((≈~≈≈P.,agg ßßßß..).......@...~≈≈~~ ..ß...)########...~.~≈≈~≈ ..ß._..########h....~~≈≈~ ..ß.....(........#...~~≈≈ .............P~~~#,aggK B.....~P~~h   howler monkey (wandering)........PF ,agg} g###........  #,agg ,agg gh.h,aggM >=30.0 (1.6,agg :_,aggо D _The howler monkey hits you but does no damage.,agg?_ (catching breath)hits you but does no damage.hit the howler monkey. You freeze the howler monkey.  The howler monkey is moderately wounded.  The howler monkey hoots and howls with incredible vigour!  You hear an angry buzzing noise. x6; You hear a shout!  You hear an angry buzzing noise. You hear a shout! x3,agg@#1,agg>AY===========9 (0.9-agg@ -agg 6 _You hear an angry buzzing noise.-aggZ _You hit the howler monkey. You freeze the howler monkey.  The howler monkey is heavily wounded.-agg[X=--------1.8-agg4h4_-aggk[ _The howler monkey closely misses you.-aggT _ You hit the howler monkey. You freeze the howler monkey.  The howler monkey is severely wounded.-aggǷ-agg\(---------agg!2.7-agg<_-agg; _You block the howler monkey's attack.-agg]  You hit the howler monkey. You freeze the howler monkey.-agg/X._-agg5< 13.7 (1.0 -agg6D_You kill the howler monkey!-agg?-aggBh _Your Shields skill increases to level 9!-aggb -agg -agg 4_-aggҠ H _No target in view!-agg. 9_-agg. -aggX8 -agg: H _No target in view!.agg ^#########.≈~P~~.  ........~~≈≈~~... ##......~≈≈≈~... .....~~≈≈~~~. ..........)......P≈≈≈P.. .............~≈≈≈~~. .agg^[PPPP.............~≈≈≈P~. .....#.~~≈≈≈~~~ ............#.@(≈~≈≈P. ßßßß..)...........~≈≈~~ .agg^ß...)########...~.~≈≈~≈ ß._..########.....~~≈≈~ß.....(#...~~≈≈..agg^e....P~~~#.agg9_....~P~~ .........P~ ##..........aggnt _You enter the shallow water..agg7o2-4Water .aggt:_.agg _ _Moving in this stuff is going to be slow..aggx-5.7 (26.agg:_.agg` _f - 26 poisoned darts (gained 5).agg#.≈~P~~. .~~≈≈~~...<.~≈≈≈~..agg ~~≈≈~~~.)......P≈≈≈P..............~≈≈≈~~.......~≈≈≈P~.#.~~≈≈≈~~~.#.~@≈~≈≈P. ßßßß..).~≈≈~~P ß...)#.agg, ...~.~≈≈~≈~ ß._..##.....~~≈≈~ .aggHß.....(........#...~~≈.........P~~~≈ #..aggi..........~P~~≈......P~ .aggS<_.agg^67=7.3 (1.6.aggB_.agg4$H _Found a stone staircase leading up..agg0(.aggL2_FF   marrowcuda (wandering).agg2H8.3 (27.agg2.agg9:_.agg?` _f - 27 poisoned darts (gained 1).agg ^ ........~~≈≈~~...< ##.......~≈≈≈~.... ........~~≈≈~~~...)......P≈≈≈P... PPPP.............~≈≈≈~~..P.......~≈≈≈P~.. ........#.~~≈≈≈~~~..agg .....#.~~≈~≈≈P.. .ßßßß..)........@..~≈≈~~P .ß...)########...~.~≈≈~≈~ .ß._..########.....~~≈≈~~ .ß.....(........#...~~≈≈≈ ............P~~F≈ .#..aggJ ....~P~~≈ .......P~~ ##.......  #.agg .aggF o_~F.agg T8==.agg ,9.9 (1.aggV :_.agg .agg  .~~≈≈~~...<#.......~≈≈≈~.....aggG H........~~≈≈~~~....)......P≈≈≈P...P.............~≈≈≈~~..P.............~≈≈≈P~...agg ...#.~~≈≈≈~~~..#.~~≈~≈≈P.. ..ßßßß..).~≈≈~~P ..ß...).agg #...~.~≈≈~≈~ ..ß._...agg ##.....~~≈≈~~ ..ß.....(........#...~~≈≈≈.aggR R..........P~≈ ..#.agg ............~P~F≈..............P~~.agg (#...agg [.~  #..agg 9_.agg .agg &400.agg .agg /aggm+ .~~≈≈~~...<  ###..............~≈≈≈~............~~≈≈~~~../agg+.)......P≈≈≈P...P.......~≈≈≈~~..P......~≈≈≈P~.. P/agg,..#.~~≈≈≈~~~. P/agg;,.#.~~≈~≈≈P.. P..ßßßß..).~≈≈~~P P..ß...)/aggg,#...~.~≈≈~≈~ P..ß._../agg,##.....~~≈≈~~.ß.....(........#.~~≈≈≈../agg,F.P~~≈ #..#/agg,R...~P~F≈ #/agg-].............P~~#/aggs-]....~  #./aggG__1/agg\Q<_/aggS/agg .~~≈≈~~...< ###...~≈≈≈~....  /agg,...~~≈≈~~~..  .)......P≈≈≈P...  PPPPPP....~≈≈≈~~..  PPPPPP....~≈≈≈P~.. /aggw. P.#.~~≈≈≈~~~.  P.#.~~≈~≈≈P.. /agg< P..ßßßß..).~≈≈~~P  P..ß...)#...~.~≈≈~≈~ /agg P..ß._..##.....~~≈≈~~ /agg1 ...ß.....(........#...~≈≈≈  ........P/aggS~~~≈  #..#.........~P~F≈  #/aggm..........P~~  ####...../aggT..~  #./aggӣ9_/aggN^9=2/agg>4_/aggl/aggJ3 .~~≈≈~~...< ###.~≈≈≈~.... .~~≈≈~~~../agg3 .)......P≈≈≈P... PPPPPP...~≈≈≈~~.. PPPPPP/agg3m...~≈≈≈P~.. P.#.~~≈≈≈~~~. P.#.~~≈~≈≈P../agg&4 P..ßßßß..).~≈≈~~P P..ß...)/agg[4#...~.~≈≈~≈~ P..ß._..#.....~~≈≈~~/agg4y ...ß.....(........#...~~≈≈≈ .......P~~~≈ #..#.......~P~F≈ #......./agg5..P~~ ####..........~  #./agg85/aggM9_/aggN&3/aggeW/aggY/aggN .~~≈≈~~...< ###.~≈≈≈~..../aggOZ .~~≈≈~~~.. .)......P≈≈≈P... PPPPPP..~≈≈≈~~.. PPPPPP/aggGO...~≈≈≈P~.. P.#.~~≈≈≈~~~./aggqO P.#.~~≈~≈≈P.. P..ßßßß..)/aggO.~≈≈~~P P..ß...)/aggOF#...~.~≈≈~≈~ P..ß._..#.....~~≈≈~~ ...ß.....(/agg#P.#..~~≈≈≈ ...P~~~≈ #..#..~P~F≈ /aggkP #.P~~  ####.~  #./aggg9_/aggh&4/aggp/aggs/agg f .~~≈≈~~...< ###.~≈≈≈~.... .~~≈≈~~~.. .)......P≈≈≈P... PPPPPP.~≈≈≈~~.. PPPPPP..~≈≈≈P~.. P/aggL .#.~~≈≈≈~~~. P.#.~~≈~≈≈P.. P..ßßßß..).~≈≈~~P P..ß...)#...~.~≈≈~≈~ P..ß._..#.....~~≈≈~~ ...ß.....(/agg S.#...~~≈≈≈  .P~~~≈  #..#.~P~F≈  #.P~~  ####.~  #./agg /agg &70/agg 5/agg= @_/agg8 /aggU  .~~≈≈~~...< ###.~≈≈≈~.... .~~≈≈~~~.. .)......P≈≈≈P... PPPPPP/agg=V L.~≈≈≈~~.. PPPPPP..~≈≈≈P~.. P.#.~~≈≈≈~~~. P.#.~~≈~≈≈P.. P..ßßßß..).~≈≈~~P P..ß...)/agg\V #...~.~≈≈~≈~ P..ß._..#.....~~≈≈~~ /aggV  ...ß.....(.#...~~≈≈≈  .P~~~≈  #..#/aggV .~P~F≈  #.P~~  ####.~  #./aggol :_/aggl /aggm 6/agg:u /aggw /aggG .~~≈≈~~...< ###.~≈≈≈~.... .~~≈≈~~~.. .)......P≈≈≈P... PPPPPP.~≈≈≈~~.. PPPPPP.~≈≈≈P~.. P.#.~~≈≈≈~~~. P/agg.#.~~≈~≈≈P.. P..ßßßß..).~≈≈~~P P..ß...)#...~.~≈≈~≈~ P..ß._..#.....~~≈≈~~  ...ß.....(.#...~~≈≈≈  /agg_.P~~~≈  #..#.~P~F≈  #.P~~  ####.~  #./agg!/aggh"&7/aggR*/agg,0agg7k .~~≈≈~~... ###.~≈≈≈~ .~~≈≈~~~ .)......P≈≈≈P PPPPPP.~≈≈≈~~ PPPPPP.~≈≈≈P~ P.#.~~≈≈≈~~~ P.#.~~≈~≈≈P P..ßßßß...~≈≈~~ P..ß...)#...~.~≈≈~≈ P..ß._..#.....~~≈≈ ...ß.....(.#...~~ ......P~~~ #..#.~P~F #.P  ####.~  #.0agg}0agg5~.180agg]8_0aggo  Things that are here: _a +0 trident; a +0 ring mail0agg .~~≈≈~~ ###.~≈≈≈~ .~~≈≈~~~ .)......P≈≈≈P PPPPPP.~≈≈≈~~ PPPPPP.~≈≈≈P~ P.#.~~≈≈≈ P.#.~~≈~≈≈P P..ßßßß.@).~≈≈ P..ß...)#...~.~≈≈~ P..ß._..#.....~~≈≈ ...ß.....(.#...~~ .........P #..#....0aggA.~P~ #........P ####.....  #.0agg:_0agg-9 _0agg0aggg0aggƘ###..~≈≈≈~....~~≈≈~~ )......P≈≈≈P PPPPPP.......~≈≈≈~ PPPPPP.~≈≈≈P P....#.~~≈≈≈ .#.~~≈~≈≈ P..ßßßß..)...........~≈≈ P..ß...@########...~.~≈≈0aggV P..ß._..########.....~~≈ ...ß.....(........#...~~ ...............P~ #..#........~P #.............. ####.......... #............ .0aggd0agg4KK   kobold (missile, wandering)0agg='500aggں0agg* _A kobold comes into view. It is wielding a +0 dagger.Things that are here: _a +0 dagger; a +0 robe; an orc corpse0aggDF ....~~≈≈~)......P≈≈≈PPPPPPP.......~≈≈≈P.~≈≈≈....#.~~≈≈≈K....#.~~≈~≈.P..ßßßß..)...........~KP..ß...)########...~.~0agg"G @P..ß._@.##.....~~....ß.....(........#...~....................P##..#........... #........ ####...K 2 kobolds (1 missile, wandering) #.... ....0agg ^  A kobold comes into view. It is wielding a +0 dagger.The kobold shouts! You hear a shout!0aggjd 0aggre 0aggx 3.K..P..ß._K   kobold (missile)0aggz ^5====10agg :_0agg U _A nearby fungus withers and dies. The kobold moves out of view.0aggĉ )......P≈≈PPPPPPP.......~.P.~.PP....#.~~K.....#.~~≈~K.PK.ßßßß..)...........~K.P..ß...)########...~.~.P..ß._..########.....~....ß.@...(........#...............###..#. #... #### # KKKK 4 kobolds (2 missiles, 3 wandering) ....... 0aggp h  2 kobolds come into view.0agg 0agg 0agg 0agg 0agg& `..P...P.K...ß._KK 2 kobolds (1 missile, 10agg _7==--0agg8 20agg| 0agg X _A nearby fungus withers and dies. The kobold moves out of view. x21aggB1aggJ0Inventory: 28/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 27 poisoned darts (quivered) Armour (go to first with [) 1aggK c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)y - a wand of digging (6)  B - a wand of mindburst (22) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]1aggO Wands /  y - a wand of digging (6)  B - a wand of mindburst (22) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear 1aggP n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  v - a scroll of noise  x - a scroll of teleportation Potions!e - 2 potions of enlightenment  h - 2 bubbling ruby potions  i - a potion of cancellationk - 4 potions of mutation  q - a potion of attractiont - a potion of heal wounds  u - a potion of magic  z - a metallic yellow potionbot2agg~  g - 2 scrolls of vulnerability  n - a scroll of immolation4agg. 4agg.............)......P≈≈ deadiverson the Carver.PPPPPPP.............~≈≈ Human of the Shining One ***....PPPPPPP.............~≈≈ Health: 77/90 ====================----.PP...............#.~~≈≈ Magic: 11/11 ========================.P................#.~~≈~ AC: 16Str: 17K.P..ßßßß..)...........~ EV: 13Int: 11..P.Kß...)########...~.~ SH: 15Dex: 14.....ß._..########.....~ XL: 11 Next:  1% Place: Dungeon:9.....ß.@...(........#... Noise: ---------  Time: 100524aggP.9 (0.0)........................ a) +4 falchion (freeze)###..#.................. Throw: 27 darts (poison)#.....................####..................#............KK 2 kobolds (1 missile, 1 wandering)........................... _a +0 dagger; a +0 robe; an orc corpseA kobold comes into view. It is wielding a +0 dagger.The kobold shouts! You hear a shout! _A nearby fungus withers and dies. The kobold moves out of view.  2 kobolds come into view. _A nearby fungus withers and dies. The kobold moves out of view. x24aggs4agg4agg:_4agg 4aggnPPPPPPP.......~.P.~K.PP....#.~~4agg+K......#.~~KK.P..ßßßß..)..............P.Kß...)########...~.....ß._..########......ß.....(........#....@.....####..# #.. #### #4agg.... .KKK 5 kobolds (3 missiles, 4 wandering)..... [4aggd  The kobold shouts! You hear a shout! _A nearby fungus withers and dies. The kobold moves out of view.  2 kobolds come into view.x2  A comes. It is wielding a +0 short sword.  Found a ring mail.4aggv4agg4aggO4agg4aggpE.K.K..KK.P..Kß._KKKK)4aggc81===3.9 (14agg7 4aggk + _The kobold shouts! x44agg .P.~.P.~.KPP.#.~~K.KP......#.~~.KP..ßßßß..)#.K.P..ß...)##...~#.....Kß._..#.ß.....(.##..# #... #### #..... ..K 6 kobolds (3 missiles, 1 wandering) ....... ......[..4aggW%  4agg_A kobold comes into view. It is wielding a +0 dagger.4agg1. .K_)The kobold shouts!4agg9Y_((5agg}&  5agg~The kobold throws a stone. The stone barely misses you.The kobold hits the fungus with a +0 dagger.5aggF  The fungus begins to die.  5aggD1The kobold hits the fungus with a +0 short sword.5agg9...KK5agg d_.@5agg R3==5agg45agg5agg'3_5aggɵ5agg/  --more--5aggo 0 _The fungus begins to die.6agg............)P≈KP.~≈...PPPPPPP..~≈..KP#.~~≈...P................#.~~≈6aggJ.KKKP..ßßßß..)...........#..KP..ß...)########...~#.....Kß._..########.....ß@....(#.........#####..#.#....####..........#. K   kobold brigand (missile, wandering).. KKKKKK 6 kobolds (3 missiles)....................[..6agg 7A kobold brigand comes into view. It is wielding a +1 vampiric whip andquivering curare-tipped darts.6aggY.K.6aggK..KK..K)6agg/--56aggZ#6aggR)? _The kobold hits the fungus with a +0 short sword.6agg#..PPPPPPP.......~KP.~ ...PP....#.~~ ..K.#.~~ ...KP..ßßßß..).......... #..KP..ß...)########...~ #..KK..ß._..########... ......Kß.....(........# .......@...... #####..# #... #### #..... ..... ......[. 6aggK-6aggM/6agg06agg26agg'76agg/86aggN96agggM.KK..K..ß._KK6aggN4==-66agg\6aggYb, _You block the kobold's attack.6aggC 6aggs 6agg 6agg .K...ß._K6agg -7.8 (0.96agg 6agg h _You barely miss the kobold. You block the kobold's attack.7agg/7agg7aggɌ7aggX7aggJ7agg7aggq  You barely miss the kobold. A nearby fungus withers and dies. x27agg.KK..K.Kß._..K7aggd(8.77aggU7agg7 _You block the kobold's attack. x27aggx7agg\7agg  You barely miss the kobold. The kobold closely misses you.7agg>.K.K.K7aggY059.67agg+:_7agg2= _The kobold hits you but does no damage.7agg7agg7agg7agg  You barely miss the kobold. The kobold hits you but does no damage.7agg .KK.K7aggQ .60.4 (0.87agg7agg$7 _You block the kobold's attack. x27aggx Q  You slash the kobold! You freeze the kobold.7agg Y  You kill the kobold!7agg% 7agg 7agg= 7agg& .K.K..ß._. 5 kobolds (27aggn -1.3 (0.97aggl 7agg W _The kobold closely misses you. x27agg O  You hit the kobold. You freeze the kobold.7agg Y  You kill the kobold!7agg 7agg 7agg .K...ß._K. 4 kobolds (1 missile)7agg (2.27agg :_7agg s _The kobold closely misses you. You block the kobold's attack.7aggVO  You hit the kobold. You freeze the kobold.7aggbY  You kill the kobold!7aggd7agge7aggR{.Kß._K)K 37agg063.17agg7agg4 _You block the kobold's attack.8agg  You slash the kobold brigand! You freeze the kobold brigand.  The kobold brigand is moderately wounded.8agg8agge.K 8aggҝ(4.08agg8:_8agg~= _The kobold hits you but does no damage.8agg._  You hit the kobold brigand. You freeze the kobold brigand.8agg]  The kobold brigand is heavily wounded.A centaur comes into view.8aggD' c_.Kc   centaur (wandering)KKK 3 kobolds (1 missile)The kobold misses you. You block the kobold brigand's attack.8agg}(-5.0 (1.08agg*7:_8aggA4 _You block the kobold's attack.8aggl|  The centaur shouts!  You slash the kobold brigand! You freeze the kobold brigand.8agg .c_ cThe kobold brigand is almost dead.8agg a7==9 (0.98aggː8agg{ _You block the kobold brigand's attack. The kobold closely misses you.8agg q  You hit the kobold brigand but do no damage.8agg q  The kobold brigand is almost dead.8agg, H..c8agg- 0-6.88agg: :_8aggK> T _The kobold closely misses you.8agg˜   You closely miss the kobold brigand.The kobold brigand is almost dead.You block the kobold's attack. The kobold brigand closely misses you.8agg i.c_8agg B-7.78agg 8agg" 4 _You block the kobold's attack.8agga  You slash the kobold brigand! You freeze the kobold brigand.8agg"8agg5Z .c8aggb6_)c   centaurKKK 3 kobolds (1 missile)  You kill the kobold brigand!You block the kobold's attack. The kobold hits you but does no damage.8aggA\_(8agg8)8aggh8=28.68aggD:_8aggsE _The kobold throws a stone. You block the stone.9aggvO  You hit the kobold. You freeze the kobold.9agg"|n  The kobold is severely wounded.9agg|9agg-._c.K9.59aggP:_9aggX _The kobold misses you. The kobold closely misses you.9aggHO  You hit the kobold. You freeze the kobold.9agg5RY  You kill the kobold!9agg__.c 29aggc9aggSd'70.3 (0.89aggIp:_9aggu7 _You block the kobold's attack. x29agg}_ You kill the kobold! _You block the kobold's attack. x2  You hit the centaur. You freeze the centaur.  The centaur is moderately wounded.  The centaur hits you.  The centaur kicks you but does no damage.9agg#571.2 (0.99agg:_9agg~7 _You block the kobold's attack. x29aggbz mMThe centaur kicks you but does no damage.heavi  The centaur closely misses you. The centaur barely misses you.  ; The centaur barely misses you.9agg{ -2.2 (1.09agg :_9aggz ? _The centaur kicks you but does no damage.9agg ? _ You slash the centaur! You freeze the centaur.  The centaur is almost dead.You block the centaur's attack. x2; You block the kobold's attack.9aggV -3.1 (0.99agg( :_9agg. T _The kobold closely misses you.9aggl,centaur's attack. x2; You block the kobold's attack. _The kobold closely misses you.  You completely miss the centaur.  The centaur barely misses you.  The centaur kicks you but does no damage.84.0 _The kobold barely misses you. The kobold misses you.:aggM_  The centaur kicks you but does no damage. _The kobold barely misses you. The kobold misses you.You barely miss the centaur.completely misses you. The centaur closely misses you.hits you. You block the centaur's attack.5-9:aggE:agg4 _You block the kobold's attack.:agg4Q  You hit the centaur. You freeze the centaur.:agglN _$KK 2 kobolds (1 missile):aggUOU  You kill the centaur!:aggU535.7 (0.8:aggc:_:aggTi> _The kobold closely misses you.:aggi:agg Q  You slash the kobold! You freeze the kobold.:agg@9 ):agg%S   kobold:agg4You kill the kobold!:agg-6.6 (0.9:agg:_:agg4 _You block the kobold's attack.:agghG  You slash the kobold! You freeze the kobold.)6-7.6 (1.0:aggTS ` _You kill the kobold!:aggt _ _No target in view!:agg% :agg :aggiB_:aggH _No target in view!;agg z ......).......P.PPPPPP......P.#.P..........#.~........ßßßß..)......... #...P..ß...)##########......ß._..########..;agg.@ß.....(#.......)######.)# #..####.......... #....... .........;agg...................[..;agg9_;aggcc9=-8 _;aggͼ:_;agg _You now have 283 gold pieces (gained 17).;agg90==-9.6 (2;agg;aggT _Items here: ( ))))) †††.;agg ....PPPPPPP..P.....#.~P.....ßßßß..)...;agg #...P..ß...)##########......ß._..##.......)ß.....(........#........######.)# #....;agg...............;agg2;agg,80.6 (1;agg:_;agg _Items here: (( )) †.;aggN  .P.....#.~P.....ßßßß..)... #...P..ß...)##########......ß._..##.......)ß.....(........#)........######.@#...... ;agg #...###.......####;agg ;agg $1 ;agg _;agg ;agg O _You see here a +0 dagger. =aggS =aggv` =agg` $ _=agge =aggn =agg} ,=agg̀ =aggą =agg ,=agg =agg ( ))))) †††. _Items here: (( )) †. _You see here a +0 dagger. _Items here: (( )) †.  There is an ornate altar of the Wu Jian Council here.=agg =agg  _=aggq =agg= =aggu ,=agg =agg =aggC ,=agg3 =aggL =aggR ,=agg =aggq =agg ,=agg =aggf =agg ,=agg =agg =agg% ,=agg* =agg9<   #..###########......~≈≈~.. #. #......~~≈~... # #~~~~~..  #~~~≈... ##########.......≈~P~~. ...............~~≈≈~~...< ####........~≈≈≈~.... ............~~≈≈~~~.. .......P≈≈≈P... ...PPPPPPP.............~≈≈≈~~.. ...PPPPPPP.............~≈≈≈P~.. ....P...............#.~~≈≈≈~~~. ...P................#.~~≈~≈≈P.. .......ßßßß..)...........~≈≈~~P #...P..ß.[3=agg< 9;49m..)########...~.~≈≈~≈~ #......ß._..########.....~~≈≈~~ ......)ß.....(........#...~~≈≈≈C - a potion of curingThings that are here:=agg(K Y910.0)_=aggK ,3.6 (11=aggP 9_=aggR c _a +0 club; a +0 leather armour; an orc corpse=agg =aggl =agg =aggk =agg =agg =agg=agg_=agg,=agg.=agg=agg=agg7=aggB =agg$=agg/=agg/=aggQ2=agg6=agg@,=agg6A=aggD=aggJ=aggK=aggN=aggPP=agg\,=agg'`=agg`d=aggn,=aggo=aggar=agg|=aggM}=agg~=agg=agg,=aggW=agg=agg=agg1=agg̒=agg==aggB=agg=agg,=aggğ=agg=agg[,=agg3=aggm=aggڬ,=agg-=aggB=agg1 ................ .... ................ ... ...........######.. ########...# # ####..##########...# # .<...<.##### ....[........... ........... #@.###########....109.6 (16 #..# #.... #..# #.... #..# #.... ######..###########.... .......................  ..#########............  .................  .......)...[=aggz37m 10.6 (17=aggT=agg=# _Found a robe.>aggL>aggM>aggN>aggTR>agg^,>aggb,>aggm,>aggo>aggvt>agg},>agg>agg߁>agg~>agg>agg=>agg\>agg?>agg>agg>aggj>aggw,>aggF>agg>agg$,>agg>aggC>agg>agg>agg&>agg>agg<,>agg>agg>agg,>agg$>agg>agg>agg>aggx>agg_n>agg ...>.......  ..........  ...........  #...........  #....  # ######>aggT .......@........ 22.6 (12............### #............# #............##########......................................>agg;...................###########..################..##########>agg>agg6,3.6 (13>agg>aggi _Found a stone staircase leading down.  You pick up a book of Movement and begin reading...>agg,4.6 (14>aggw>agg  >agg$nYou add the spells Volatile Blastmotes, Vhi's Electric Charge and Gell's _Gavotte to your library.>agg [?25h[?0c >agg ^ Search for what [Enter for "long b", or ? for help]? ?agg [?25l[?1c?agg?agg$?agg1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=] ?agg? a - [D:9] a curare-tipped dart@aggLevel 9 of the Dungeon<<<>_(Press ? for help) #..##......~~~≈...   ######..###########.......≈~P~~.   ........................~~≈≈~~...<   ..#########..............~≈≈≈~....     ...................~~≈≈~~~..   ..............)......P≈≈≈P...   ....PPPPPPP.............~≈≈≈~~..   ....PPPPPPP.............~≈≈≈P~..  @agg .....P...............#.~~≈≈≈~~~.   ....P................#.~~≈~≈≈P..   ........ßßßß..)...........~≈≈~~P   #...P..ß...)########...~.~≈≈~≈~   ##......ß._..########.....~~≈≈~~   .......)ß.....(........#...~~≈≈≈   .......)...................P~~~≈   ######.)#..................~P~F≈  #.......................P~~  ####.....................~  @aggl #............   .............   ..............  @agg p ......[..   #### @agg @agg deadiverson the CarverHuman of the Shining One ***...Health: 90/90 ========================Magic: 11/11 ========================AC: 16Str: 17EV: 13@aggg Int: 11SH: 15Dex: 14XL: 11 Next:  3% Place: Dungeon:9Time: _Found a robe. _Found a stone staircase leading down.  You pick up a book of Movement and begin reading...  You add the spells Volatile Blastmotes, Vhi's Electric Charge and Gell's _Gavotte to your library.  Search for what [Enter for "long b", or ? for help]? curare@agg* @agg @agg! @agg - @agg6 ,@agg; @agg? stone staircase leading down.  You pick up a book of Movement and begin reading...add the spells Volatile Blastmotes, Vhi's Electric Charge and Gell's @aggf? _Gavotte to your library.  Search for what [Enter for "long b", or ? for help]? curare _Found a leather armour.@agg2E @agg6Q [.......................#...........#...........#........... .....########........... ....................... ..................####...#.........@..##...# Noise: --------- ............##########...# a) +4 falchion (freeze).......................... Throw: 27 darts (poison)....................................................###########..##########... y   killer bee (wandering)######..##########...........y......<...<.......[..............@aggOS 210125.6 (1.0)@agg` jy.6.6 (2@agg g @aggQl ] _A killer bee comes into view.Aagg4AaggAaggN _There are no items here.Bagg (((((((You throw a poisoned dart.Baggzt  The poisoned dart barely misses the killer bee.Baggm{BaggV...y.y.Bagg…f==7.7 (1.16BaggŊBagg4 _The killer bee buzzes angrily.Bagg(V ((((poisoned)  You throw a poisoned dart. The poisoned dart hits the killer bee.BaggBagg@  The killer bee is poisoned.BaggXBaggBagg.y.(y 2 killer bees (1 wandering, 1 poisoned)yBaggEa--8.85BaggBaggR] _A killer bee comes into view.Bagg ^ ((((Bagg٠ (You throw a poisoned dart.  The poisoned dart barely misses the killer bee.Bagg/( u  The poisoned dart closely misses the killer bee.Baggp+ d  The killer bee buzzes angrily. You hear an angry buzzing noise.Baggg, Bagg/ l  A killer bee comes into view.Bagg1 Bagg8 y...y.yy 3 killer bees (y.Baggm9 a==9.94Bagg? BaggQB C _The killer bee stings you but does no damage.Bagg f  You throw a poisoned dart. The poisoned dart hits the killer bee.Bagg Bagg Baggَ t  The killer bee is moderately wounded.Bagg BaggZ Bagg Bagg) eyy..Bagg a-31.03Bagg_ Bagg ; _You block the killer bee's attack. x3Baggk  You closely miss the killer bee.The killer bee is heavily wounded.BaggmwSy.BaggwE-9 (0.9Bagg~Bagg[s _You block the killer bee's attack. The killer bee misses you.Caggm  You hit the killer bee but do no damage.Cagg y.The killer bee is heavily wounded.The killer bee barely misses you. You block the killer bee's attack.Cagg#-2.7 (0.8CaggCagg _The killer bee completely misses you. You block the killer bee's attack. x2CaggI8Y  You slash the killer bee! You freeze the killer bee.CaggdG ( 2 killer bees  You kill the killer bee!The killer bee stings you but does no damage.  You block the killer bee's attack. The killer bee stings you.CagghKl89-4=3.6 (0.9Cagg2SCaggU8 _You block the killer bee's attack.Cagg  You barely miss the killer bee. You block the killer bee's attack. x2  The killer bee closely misses you.Cagg690=Cagg)-4.5CaggNCaggC _The killer bee stings you but does no damage.Cagg:{ (1 poisoned)  You throw a poisoned dart. The poisoned dart hits the killer bee.Cagg u  The killer bee is poisoned.  The killer bee stings you but does no damage.Caggw-5.7 (1.22Cagg;Cagg0; _You block the killer bee's attack. x3CaggQ Y  You slash the killer bee! You freeze the killer bee.CaggbX  The killer bee is severely wounded.A killer bee comes into view.CaggZe y 3 killer bees (1 wandering, 1 poison…)yCagge 689-Cagg7f &6.6 (0.9Caggo Caggis W _You block the killer bee's attack. x3; The killer bee stings you.Cagg"   The killer bee buzzes angrily.  You slash the killer bee! You freeze the killer bee.Cagg,  You kill the killer bee!  You hear an angry buzzing noise.Cagg- l  A killer bee comes into view.Cagg*/ Cagg)@ ...yyy.CaggD g90=5=7.5CaggN Cagg4Q ; _You block the killer bee's attack. x2Dagg!W  You hit the killer bee. You freeze the killer bee.DaggFt  The killer bee is moderately wounded.DaggDaggږDaggm" yyy(yyy 5 killer bees (2 wandering).  A killer bee comes into view. x2Dagg0-8.4DaggDagg{W _The killer bee barely misses you.Daggf  You throw a poisoned dart. The poisoned dart hits the killer bee.Dagg'Kt  The killer bee is moderately wounded.DaggLDaggeMDagg6NDaggSRU  The killer bee buzzes angrily. You hear a shout!Dagg2U  You block the killer bee's attack. The killer bee barely misses you.DaggVDaggWDaggyXDaggZl  A killer bee comes into view.Dagg[Dagg#]Dagg]Dagg^Dagg_DaggLrr yy.yyyy(y..yyyy 7 killer bees (2 wandering)  The killer bee barely misses you.Dagg%se=9.6 (1.21Dagg=DagǵDagg׍/  --more--DaggA ^ _A killer bee comes into view.Eaggyy#.. #.. #..yy....... .....#########........... .................. Eagg .....### #...# ..y.# #...# .y@.##########...#.y...........................(############..##########...#Eagg$| ######..##########...# 5 killer bees........(......<...<.#......[.........EaggQ.EaggEEaggEaggdEaggJ?You block the killer bee's attack.EaggQThe killer bee stings you but does no damage.  Eagg#GA killer bee comes into view.EaggIThe killer bee misses you.Eagg#`The killer bee stings you but does no damage.Eagg...yyy 6 killer bees (1 wandering)yEaggEaggJ,-40Eaggh 0EaggEaggJz - _You block the killer bee's attack. x2Eagg/  --more--FaggT _You see here a poisoned dart.Faggu##. #.... #..... .....#########.Faggv(.... ........ .........yy.....  ...### #...# .y.# #...# .Fagg_vy(.##########...###.y.@...................(#############..##########Faggv...# ######..#####Faggv........y......<...<.#......[..........Faggvf...........#########..###########Fagg}Fagg+~Fagg!FThe killer bee attacks as it pursues you!Fagg Fagg,Fagg FaggFaggFagg_Fagg..y(y.y@yy(FaggȍB=1FaggCFagg_v _You block the killer bee's attack. The killer bee closely misses you. x2Fagg #. #........... .....#########........... ........ ................  .### #...# .Fagg!yy# #...# .(y.##########...####.y.y..................@..(Fagg4!##############.y##########...#  ######..######FaggQ!........(......<...<.###Faggl!......[...........yyyy..........Fagg!#########..########### #..# #.Faggm%Fagg&Fagg(oYou block the killer bee's attack.  The killer bee attacks as it pursues you!FaggL)%  Faggt)RYou block the killer bee's attack.  The killer bee attacks as it pursues you!Fagg'*FaggE+Fagg-%  Fagg2-"You block the killer bee's attack.Fagg/%  Fagg0/f  The killer bee attacks as it pursues you!  You block the killer bee's attack.  FaggG/The killer bee attacks as it pursues you!  You block the killer bee's attack.  The killer bee stings you but does no damage.Fagg/Fagg<:h..(yyyFagg:ky.yyyFagg:&2FaggVCFaggFFaggO/  --more--GagglV _The killer bee closely misses you.GaggCvOYou hit the killer bee. You freeze the killer bee.Gagg[yThe killer bee is heavily wounded.The killer bee stings you but does no damage.GaggwzGagg\|You block the killer bee's attack. The killer bee closely misses you.Gaggjy..yyyyyyyyy 7 killer bees (1 wandering)  The killer bee barely misses you. You block the killer bee's attack. x2GaggW-3.5 (0.9GaggMGaggsC _The killer bee stings you but does no damage.Gagg  The killer bee buzzes angrily.  You hit the killer bee. You freeze the killer bee.  The killer bee is severely wounded.Gagg4 R  The killer bee stings you but does no damage.Gagg .y.yy  You block the killer bee's attack. x3Gagg5=4.3 (0.8GaggGagg!F _The killer bee stings you but does no damage. x2Gagg GaggDg You hit the killer bee but do no damage.Gaggڢ  You block the killer bee's attack. x2  A killer bee comes into view.Gaggߥ Gagg! You block the killer bee's attack.  The killer bee stings you but does no damage.  The killer bee barely misses you.Gagg/  --more--Gagg  #..# #..Gagg Gagg! }The killer bee misses you. The killer bee closely misses you.Gaggn! rThe killer bee stings you.  You are poisoned.GaggK: cy.yc   centaur (missile)Gagg: yyyyyyy 8 killer bees (1 wandering)  The killer bee poisons you! The killer bee misses you.Gagg; Gagg; {87==--5.2 (0.9Gagg; 7Pois Gagg L GaggW R _A centaur comes into view.GaggY #....c .....#########...y....... ........ ................  .y.### #...# .GaggeZ 1.# #...# .((.##########...#####..yy..................yy...###############..##########...# GaggZ m ######..##########...# ........(......<...<.####......[...GaggZ ...................yyyyyyyy 8 killer bees (1 wandering)GaggZ #########..###########... #..# #.#..# #.Gagg+[ Gagg/` ,GaggSa Gagg\b Gagggc GaggHd Gaggh &  GaggPh rYou feel sick.  The killer bee attacks as it pursues you!  The killer bee stings you but does no damage.Gaggk O  You block the killer bee's attack.  Gaggl -The killer bee stings you but does no damage.GaggZm GaggRn Gagg{ f .y...yGagg{ ...yyyThe killer bee closely misses you. You block the killer bee's attack.Gagg{ g6---6.2 (1.0Gaggc Gagg 8-Gagg' /  --more--Hagg' HaggB_The killer bee misses you.Iaggm#....c...... .....### .######........... . ........ ...... ..y....### #...# #....# #...# #.((y#...#.Iaggo}y..yy..yy.##.y#...# #######..#...# #........(......<...<.#......[...........#########..#.#..# #.#..# #.IaggxIaggyIagg}~You feel sick. You block the killer bee's attack.  The killer bee attacks as it pursues you!Iagg}Iagg~Iagg?You block the killer bee's attack.IaggJThe killer bee stings you but does no damage.IaggĄIaggi..y.y(yy 7 killer beesIagg.37IaggIagg( _The killer bee stings you.IaggFM#....c...... .....### .######..... . ......... ...... ....### #...# #.....# #...# #..((.#...######..y..yyy..(yy.#####.#.y#...# #.######..#...# #.........(......<...<.#####.......[......#########..#.#..# #.#..# #.Iagg>NIaggTIaggYZd  You feel sick.  The killer bee attacks as it pursues you!Iagg[Iagg ]Iagg `%  Iagg[`The killer bee completely misses you. The killer bee misses you.Iagg&aIaggebIaggj  The killer bee stings you but does no damage.Iagg|y..yyy.yy.y 8 killer bees (1 wandering)Iagg}&8IaggIagg] _A killer bee comes into view.Iagg D#....c...... .....### ..# ######. . ..# .y. ...... ..# .Iagg (..### #...# #.# ....# #...# #.P .((.#...######.P .y.~ .yyyy. .(.yy.#####.~ #..#...# #.~######..#...# #.~.(......<...<.#####.......[.~.Iagg  7 killer bees#..#.#..# #.#..# #.Iagg Iagg@ d  You feel sick.  The killer bee attacks as it pursues you!IaggO Iaggy IaggO Iagg Iagg Iaggi Iaggc IaggC Iagg IaggC Iagg. X y(c.yyy...y..yyc   centaur (missile)yyyyyyy 9 killer bees (2 wandering)  You block the killer bee's attack. x2; The killer bee completely misses you.Iagg: ?((((Iaggo Iagge Iagg ...yy.yyIagg q2=-9Iagge \ _The centaur throws a stone. You block the stone.Iagg,[ #....c...... .....### ..#≈. . ..#≈y. ...... ..#≈..### #...# #.#≈..# #...# #.P≈y(c#...######.P≈y.Iagg \ ~≈y...yyyy.≈(.y.y.#####.~..#...# #.~######..#...# #.~.(......<...<.#####..≈......[.~.#..#......~Iaggj\ y 7#..# #......~#..# #......~Iagge Iaggh Iagg(i Iaggi Iagg+o 3  You feel sick.Iagg[p Iaggs  The killer bee stings you but does no damage.  The killer bee attacks as it pursues you!Iaggt IaggNw Iaggpx Iaggz Iagg| Iagg} Iagg3 Iagg IaggX 3y.c....y..y....yyyyyy 9(2 wandering)IaggL U1-50Iaggb Iagg C _The killer bee stings you but does no damage.Jagg#....c...... .....### ..#≈. . ..#≈y. ...... ..#≈### #...# #.#≈.# #...# #.P≈yy.#...######.P≈Jaggc....y.~≈y....yy.≈(.yyyy.#####.~~≈..#...# #.~~≈######..#...# #.~~≈.(......<...<.#####..≈......[.~.~#..#......~≈81#..# #......~#..# #......~JaggJaggJagggJaggJaggvJagg)d  You feel sick.  The killer bee attacks as it pursues you!JaggJaggJaggJaggJagg  You block the killer bee's attack. x2; The killer bee misses you.JaggJagg1JaggJagg'JaggmX(y...y...c..yyy.yyyyyyy 92Jagg&1JaggHJagg~ _You block the killer bee's attack. The killer bee completely misses you.Jagg[#....c...... .....### ..#≈≈#. ........ ..#≈y. ....... ..#≈### #...# #.#≈# #...# #.P≈≈~y(.#...######.P≈≈~y...yy.~≈≈~c..yy.≈≈~(.y.yyy.#####.~~≈..#...# #.~~≈######..#...# #.~~≈.(......<...<.#####..≈......[.~~~≈.~≈#..#......~≈#..# #......~~≈#..# #......~Jaggg  You feel sick.  You are no longer poisoned.JagggiJaggjJagg+kJaggmw  The killer bee buzzes angrily. x2  The killer bee attacks as it pursues you!Jagg9oJaggepJagg1qJaggqJaggZsJagg]tJaggvJagg!wJaggZ|  You block the killer bee's attack. The killer bee misses you.Jagg.yc.yyy..yyyyyyyy 10 killer bees (1 wandering)Jaggn0==2JaggJaggW _The killer bee barely misses you.Jagg""#....c...... .....### ..#≈≈#. ........ ..#≈≈≈#y. ....... ..#≈≈≈#### #...# #.#≈≈≈P# #...# #.P≈≈~y(.#...######.P≈≈~y...y.~≈≈~!yc.yyy.≈≈~(...yyyy.#####.~~≈≈P..#...# #.~~≈≈P######..#Jagg#...# #.~~≈≈~.(......<...<.#####..≈≈≈~......[.~~~≈~.~≈~#..#......~≈≈~9 killer bees#..# #......~~≈~#..# #......~Jagg,Jagg.Jagg|0Jaggf1JaggR2Jagg_3Jagg;4Jagg4Jagg7N  The killer bee attacks as it pursues you!Jagg:JaggP=  The killer bee barely misses you. You block the killer bee's attack.Jaggc>Jagg>Jagg?JaggR y..yyyyy.c.yyThe killer bee barely misses you.JaggR.-3JaggdJagglC _The killer bee stings you but does no damage.Jagg#....c...... .....### ..#≈≈## . ........ ..#≈≈≈#.y. ....... ..#≈≈≈#~### #...# #.#≈≈≈P.# #...# #.P≈≈~~.y(.#...######.P≈≈~~.y...y.y.~≈≈~!.yyyyy.≈≈~(....c.yy.@....#####.~~≈≈P...#...# #.~~≈≈P. ######..#...# #.~~≈≈~P .Jagg(......<...<.#####..≈≈≈~. ......[.......~~~≈~ ........~≈~. #..#......~≈≈~.#..# #......~~≈~.#..# #......~Jagg8Jagg2JaggHJaggMJaggJagg:JaggJaggJaggJagg*JaggJaggJaggG  You block the killer bee's attack.JaggJaggJagg ..y..yy...yyyyy10 killer bees (1 wandering)JaggV1-4Jagg Jaggf C _The killer bee stings you but does no damage.Jagg  Ability - do what?CostFailure  Invocations -  X - Renounce ReligionNone0% a - Divine Shield3 MP, Piety-13%  b - Cleansing Flame5 MP, Piety-83% [?] toggle between ability selection and description.Kagg0 Kagg Kagg\ #....c...... .....### ..#≈≈## deadiverson the Carver #........... ........ ..#≈≈≈#. Human of the Shining One ***... ...y....... ....... ..#≈≈≈#~ Health: 81/90 =====================--- .......####...# #.#≈≈≈P. Magic: 11/11 ======================== .......##...# #.P≈≈~~. AC: 16Str: 17 ....y(.##########...######.P≈≈~~. EV: 13Kagg Int: 11 .......y.....y..y..........~≈≈~!. SH: 15Dex: 14 .........y...yyyy...........≈≈~~~ XL: 11 Next:  5% Place: Dungeon:9 ......(....c.yyy@....#####.~~≈≈P. Noise: =--------  Time: 10154.2 (0.0) ######..##########...# #.~~≈≈P. a) +4 falchion (freeze) ######..##########...# #.~~≈≈~P Throw: 21 darts (poison) ........(......<...<.#####..≈≈≈~. ......[....................~~~≈~~ .............................~≈~. c   centaur (missile) Kagg #########..###########......~≈≈~. yyyyyyy 10 killer bees (1 wandering)#..##......~~≈~.#..##......~~~~~The killer bee attacks as it pursues you!  The killer bee barely misses you. You block the killer bee's attack.  The killer bee barely misses you. _The killer bee stings you but does no damage.  You block the killer bee's attack. _The killer bee stings you but does no damage.Kagg P  Okay, then.Kagg Kagg Kagg . _Kaggǃ ....c...... .....### ..#≈≈## . ........ ..#≈≈≈#.y. ....... ..#≈≈≈#~.### #...# #.#≈≈≈P.# #...# #.P≈≈~~.y(.#...######.P≈≈~~.y.....y..y.~≈≈~!.y...yyyy.Kagg ≈≈~~~.(....c.yyy.@...#####.~~≈≈P...#...# #.~~≈≈P...#...# #.~~≈≈~P.(......<...<.#####..≈≈≈~.[..........~~~≈~~............~≈~...#####......~≈≈~.9 killer bees#..# #......~~≈~.#..# #......~~~~~.Kagg Kagg Kagg Kaggɐ Kagg( Kagg| Kagg N  The killer bee attacks as it pursues you!Kagg< Kagge Kagg\ Kaggә Kagg Kagg Kagg# Kagg G  You block the killer bee's attack.Kagg h .y..y.c.yyy..yyyy10 killer bees (1 wandering)  The killer bee stings you but does no damage.Kaggv +5.2 (1Kaggѿ Kagge ; _You block the killer bee's attack. x2LaggƘq...... ........ ..#≈≈≈#.. .y ....... ..#≈≈≈#~. ...### #...# #.#≈≈≈P.. # #...# #.P≈≈~~.. Laggpy(.##########...######.P≈≈~~.. ..y......y.y..........~≈≈~!.. ...y.c.yy....≈≈~~~. (......yyyy....#####.~~≈≈P.. ####..##########@..# #.~~≈≈P.. Lagg..##########...# #.~~≈≈~P. Lagg......(......<...<.#####..≈≈≈~.. [..............~~~≈~~.......~≈~.. LaggV#######..###########......~≈≈~..  #..# #......~~≈~.#..# #......~~~~#..# #......~~~≈..LaggLagg@LaggLaggLagg&LaggLaggSN  The killer bee attacks as it pursues you!Lagg+Lagg!LaggqLaggLaggLagg-LaggLaggҵLaggycy.....yyyy.yy.yyLagg&6LaggLagg~ _You block the killer bee's attack. x2; The killer bee barely misses you.Lagg~Lagg"LaggLagggLagg, y ~ .....### #...# #.#≈≈≈P. P≈≈~~y(.##########...#####...y.....ycy...........~≈≈~!Lagg........yyyy.........≈≈~~~(.......yy.yy..#####.~~≈≈P. ####..##########...# ~P ......(......<...<.#####..≈≈≈~.[....................~~~≈~~......###. 6 killer bees..  ######..###########.......≈~P~~.Lagg,Lagg$Lagg-N.yc.yy.yyc   centaur (missile)yyyyyyy 7 killer bees (1 wandering)Lagg /62-7Lagg$>LaggBLagg0 W.....### #...# #.#≈≈≈P...#  #...# #.P≈≈~~..y(.##########...######.P≈≈~~......y.....y.yc..........~≈≈~!............yy..≈≈~~~.(yy.yy..#####.~~≈≈P.. #####..##########y..# #.~~≈≈P..#..##########.y.# #.~~≈≈~P. .......(......<.@.<.#####..≈≈≈~..[..............~~~≈~~........~≈~.. ########..###########≈≈~.. #..# #......~~≈~..Lagg1  #..# #......~~~~~. yyy 3 killer bees #..# #......~~~≈..######..###########.......≈~P~~ ..................~~≈≈Lagg5 Lagg7 Lagg: N  The killer bee attacks as it pursues you!Laggd< Lagg<= Lagg<@ Lagg A LagguD  You block the killer bee's attack. The killer bee misses you.LaggE LaggU .y..yyyyyy 6 killer beesLaggV .=8Lagg=b Lagg^g C _The killer bee stings you but does no damage.Lagg .### #...# #.#≈≈≈P.# #...# #.P≈≈~~.y(.#...######.P≈≈~~.y.....y.yc..........~≈≈~!Lagg .y.y.........≈≈~~~.(.yy...y.#####.~~≈≈P#..#y..# #.~~≈≈P#..#yy.# #.~~≈≈~PLaggq .(......<@.y<.#####..≈≈≈~.[.~~~≈~~.~≈~#..#......~≈≈~ #..# #......~~≈~ #..# #......~~~~~ 3Lagg  #..# #......~~~≈ ######..Lagg d#.≈~P .~~≈≈~~Lagg­ ,LaggE Lagg N  The killer bee attacks as it pursues you!Lagg Lagg] R  The killer bee stings you but does no damage.Lagg Lagg~ Lagg/ Lagg1 ....yyyy 4 killer beesLagg &9LaggC Lagg 8 _You block the killer bee's attack.Laggo.### #...# #.#≈≈≈P.# #...# #.P≈≈~~.y(.#...######.P≈≈~~.y.....y.yc..........~≈≈~!.y.y.........≈≈.(.yy.....#####.~~≈≈P#..#...# #.~~≈≈P  ######..#...# #.~~≈≈~  .(......@.yy<.#####..≈≈≈~  ......[.yy.~~~≈ Lagg .~≈~  #..#......~≈≈~ #..# #......~~≈~ #..# #...... #..# #......~~~≈ ######..#.≈~P .~~≈≈LaggLaggLaggLaggLaggLaggLaggg  The killer bee closely misses you.LaggLaggbyyy.y 5 killer beesLaggU3=60LaggLaggk _The killer bee stings you but does no damage. _There is a stone staircase leading up here.Magg9+  You block the killer bee's attack. The killer bee barely misses you.Maggcyc   centaur (missile)yyyyyy 6 killer beesMagg-&1MaggMagg { ..........##  ####....########...##   ###### ##...##   #....#   #....#  Maggz  ##....##   ###### #......##   #....#######yy<....#  8  Magg  ##.........##@y.....#   ##..######...###....##  ##.### ##..# ######  ##.## #..# #.## #..#  ..# #..#Magg=    yyy 3 killer bees ### #..#Maggl    #..# Magg  ### ##..# _You block the killer bee's attack. x2; The killer bee barely misses you. x2Magg| :=Magg Maggg =4-2.7 (2.5Maggo Maggs  MaggHs w_You climb upwards. _There is a stone staircase leading down here.Maggy9  _There is a stone staircase leading down her  You hit the killer bee. You freeze the killer bee.  The killer bee is heavily wounded.  The killer bee completMagg9 y  You block the killer bee's attack. x2  The killer bee stings you but does no damage.Maggk: 5=3.6 (0.9Magg@ MaggC P _The killer bee misses you.Naggp4Y  You slash the killer bee! You freeze the killer bee.Nagg`? † 2  You kill the killer bee!NaggeB5=4.4 (0.8NaggFNaggJ NaggJm_You block the killer bee's attack. The killer bee closely misses you.Nagg  You hit the killer bee. You freeze the killer bee.  The killer bee is lightly wounded.  You block the killer bee's attack. The killer bee stings you.Nagg$=3-5.3 (0.9NaggNaggs _You block the killer bee's attack. The killer bee misses you.Naggi| _You block the killer bee's attack. The killer bee misses you.  You hit the killer bee but do no damage.  The killer bee is lightly wounded.  You block the killer bee's attack. The killer bee barely misses you.  You are poisoned.NaggC}1==--6.1 (0.8Pois Nagg]NaggB1 _The killer bee poisons you!NaggղY  You slash the killer bee! You freeze the killer bee.Nagg .   killer bee  You kill the killer bee!Naggl79-6=7.0 (0.9NaggNaggG _You feel sick. You block the killer bee's attack.Nagg  You slash the killer bee! You freeze the killer bee.  The killer bee is severely wounded.Nagg \7--9Nagg Nagg4 J _You feel sick. You block the killer bee's attack. x2NaggL W  You hit the killer bee. You freeze the killer bee.Naggϫ †You kill the killer bee!Naggm r-7-8.8Nagg Nagg $ _You feel sick.Nagg Naggd Nagg Nagg H _No target in view!OaggOaggOaggOaggWH _No target in view!Oagg% Oaggٹ OaggG Oagg Oagg =6-9.8 (1.0OaggW Oagg 3 ### #...# #.#≈≈≈P ........# #...# #.P≈≈~~ .....y(.##########...######.P≈≈~~ ........y.....y.yc..........~≈≈~! .................y.y.........≈≈~~ .......(.......yy.....#####.~~≈≈P #######..##########...# #.~~≈≈P######..##########.c.# #.~~≈≈~9  ........(......@y..<.#####..≈≈≈~Oagg ......[.......y..y.........~~~≈~.............................~≈~  #########..###########......~≈≈~ #..# #......~~≈~ #..# #......~~~~ c   centaur (missile)#..# Oaggm #......~~~≈ yyy 3 killer bees######..###########.......≈~P  ........................~~≈≈~ _You feel sick.Oagg 8-Oaggl Oagg Oagg^ Oagg n  You climb downwards. You feel sick. You block the killer bee's attack. x3Oagg Oagg Oagg Oagg Oagg  y.yycyy 5 killer bees  The killer bee barely misses you. x2; The killer bee misses you.Oaggg >5=71.3 (2.5Oagg.v Oagg&{ _The killer bee barely misses you. _There is a stone staircase leading up here.PaggB  You slash the killer bee! You freeze the killer bee.  You kill the killer bee! .ylauncher)You block the killer bee's attack. x2; The centaur wields a +0 shortbow.(PaggPagg(  The centaur shoots an arrow. You block the arrow.  The killer bee closely misses you.Paggh .yThe killer bee stings you but does no damage.Pagg6==2.1 (0.8Pagg'Pagg*PaggR7/  --more--Pagg 7 _You hear an angry buzzing noise.QaggQaggQaggeQaggQYou feel sick. You block the killer bee's attack. x2QaggQaggbThe killer bee closely misses you. You block the killer bee's attack.  The killer bee stings you. The killer bee barely misses you.QaggJThe killer bee stings you but does no damage.QaggOy.cy 6 killer beesQagg3x3=-3.1 (1.0Qagg-QaggR6..........##  ####....########...##   ###### ##...##   #....#   #....#   ##....##   ###### #..y...##   #....#######yy<....#  8  ##.........##@y.....#  Qagg ##..######...###....##  ##.### ##..# ######  ##.## #..# #.## #..#  ..# #..#   yyyy 4 killer bees ### #..#Qagg   #..# QaggG ### ##..# _The killer bee completely misses you.Qagg=8-QaggF  You climb upwards. You feel sick.QaggDP[=---4.6 (2.5QaggXUQagg\W5---Qagg/  --more--Qagg _You are no longer poisoned. _There is a stone staircase leading down here.QaggcYou hit the killer bee. You freeze the killer bee.  The killer bee is lightly wounded.  The killer bee stings you but does no damage.Qagg.yThe killer bee barely misses you. You block the killer bee's attack. x2Qaggp5=5.5 (0.9QaggZQaggxC _The killer bee stings you but does no damage.Qagg~  You slash the killer bee! You freeze the killer bee.  The killer bee is almost dead.Qagg <yYou block the killer bee's attack. The killer bee closely misses you.=6.4Qagg͒ Qagg } _The killer bee barely misses you. You block the killer bee's attack. x2Qagg - _ You miss the killer bee.bar  You block the killer bee's attack. The killer bee barely misses you.  You block the killer bee's attack.Qagg %4Qagg -7.2 (0.8Qagg= Qagg  C _The killer bee stings you but does no damage.Qagg  You closely miss the killer bee.The killer bee is almost dead.QaggB-8.0Qagg Qagg  _The killer bee completely misses you. You block the killer bee's attack. x3Ragg\  The killer bee is almost dead. _The killer bee completely misses you. You block the killer bee's attack. x3  You block the killer bee's attack. The killer bee completely misses you.  The killer bee stings you. You block the killer bee's attack. x2Ragg^]\69-9.0 (1.0Ragg7bRaggdX _The killer bee closely misses you.Ragg W  You hit the killer bee. You freeze the killer bee.Ragg]  You kill the killer bee!RaggI† 3Raggb70-89 (0.9RaggRagg; _You block the killer bee's attack. x2RaggtRagguuRagg|Ragg"F _Unknown command.Ragg{  You slash the killer bee! You freeze the killer bee.  The killer bee is severely wounded.Ragg΅ y.You block the killer bee's attack. The killer bee barely misses you. x2RaggI)80.8RaggRagg>{ _The killer bee closely misses you. You block the killer bee's attack.Ragg# W  You hit the killer bee. You freeze the killer bee.Ragg/  † 2  You kill the killer bee!The killer bee barely misses you. x2; The killer bee misses you.Ragg4 091.7Ragg*; Ragg= 8 _You block the killer bee's attack.RaggB  You closely miss the killer bee. The killer bee closely misses you.The killer bee stings you but does no damage.Ragg 012.6Ragg RaggP ; _You block the killer bee's attack. x2Raggu   You slash the killer bee! You freeze the killer bee.  The killer bee is severely wounded.You block the killer bee's attack. The killer bee closely misses you.Ragg0=3.5Ragg=Ragg0[ _The killer bee completely misses you.Sagg&j  You barely miss the killer bee.The killer bee is severely wounded.Saggj0-4.4SaggqSaggs; _You block the killer bee's attack. x3SaggW  You hit the killer bee. You freeze the killer bee.Sagg9 †   killer bee  You kill the killer bee!You block the killer bee's attack.SaggBm2=-5.4 (1.0SaggSagg Sagg5_The killer bee stings you but does no damage.Sagg/bSaggb-6.3 (0.9SaggiSagg;m Saggtm_You completely miss the killer bee. The killer bee barely misses you. x2Sagg   You slash the killer bee! You freeze the killer bee.  The killer bee is severely wounded.The killer bee stings you but does no damage.SaggV 5=7.1 (0.8Sagg{ Sagg+ W _The killer bee barely misses you.Saggh; W  You hit the killer bee. You freeze the killer bee.SaggA g†Sagg4F ?3=SaggF 710-8.1 (1.0SaggL SaggO N _You kill the killer bee!SaggeSaggf8-SagglSaggnH _No target in view!Tagg&Tagg&Tagge,Tagg.H _No target in view!TaggmTaggbTaggTaggTagg`5-9 _TaggTagg#### #...# #.#≈≈≈P ........# #...# #.P≈≈~~ .....y(.##########...######.P≈≈~~ ........y.....y.yc..........~≈≈~! .................y.y.........≈≈~~ .......(.......yy.....#####.~~≈≈P #######..##########...# #.~~≈≈P######..##########...# #.~~≈≈~9  ........(.....y@...<.#####..≈≈≈~......[........yc..........~~~≈~.............................~≈~  #########..###########......~≈≈~ #..# #......~~≈~ #..# #......~~~~ c   centaur (launcher) #..# #......~~~≈ yy 2 killer bees######..###Tagg########.......≈~P........................~~≈≈~-TaggTmissile)You climb downwards. You block the killer bee's attack. x2  The centaur unwields a +0 shortbow. You block the centaur's attack.  The centaur kicks you but does no damage.   closely misses you. The centaur barely misses you.The centaur kicks you but does no damage.Taggg`6=90.6 (2.5TagghTaggiTagg-/  --more--Uagg _The killer bee closely misses you. The killer bee completely misses you. _There is a stone staircase leading up here.Uagg You slash the centaur! You freeze the centaur.  The centaur is heavily wounded.You block the killer bee's attack. x2; You block the centaur's attack.Uagg=4=1.4 (0.8UaggUaggL _The centaur barely misses you.Uagg8zS  You slash the centaur! You freeze the centaur.UaggS  )yy 2 killer bees  You kill the centaur!The killer bee closely misses you. You block the killer bee's attack.Uaggc1-12.3 (0.9UaggUaggS _The killer bee stings you. You block the killer bee's attack.Uagg%  You barely miss the killer bee. You block the killer bee's attack. x3UaggA67--Uagg#)-3.2UaggUagg0 _The killer bee stings you.UaggPH  You closely miss the killer bee. The killer bee barely misses you.UaggI h8=-4.1UaggNS UaggTW ; _You block the killer bee's attack. x3Uaggb Uagg Uagg> Uagg! F _Unknown command.Uagg  You miss the killer bee. You block the killer bee's attack.Uaggd #5Uagg 3-5.0Uagg UaggD 0 _The killer bee stings you.VaggLYou slash the killer bee! You freeze the killer bee.  The killer bee is severely wounded.  The killer bee misses you.The killer bee stings you but does no damage.  You block the killer bee's attack.Vagg.=9VaggGVagg7C _The killer bee stings you but does no damage.Vagg!W  You hit the killer bee. You freeze the killer bee.Vagg0 †   killer bee  You kill the killer bee!Vagg4k6-2-6.9 (1.0Vagg;Vagg=Z _The killer bee barely misses you. x2VaggyVagg8-Vagg%Vaggr(F _Unknown command.VaggI`C7.7 (0.8VaggiVaggl{ _You barely miss the killer bee. You block the killer bee's attack. x2VaggY  You slash the killer bee! You freeze the killer bee.  The killer bee is almost dead.Vagg$5=8.6 (0.9VaggbVagg; _You block the killer bee's attack. x2Vagg Y  You slash the killer bee! You freeze the killer bee.Vagg h†Vagg =7-9.6 (1.0Vagg Vagg N _You kill the killer bee!VaggZ Vagg[ 1-Vagg` Vaggb H _No target in view!WaggA# #...# #.P≈≈~~.y(.##########...######.P≈≈~~...y.....y.yc..........~≈≈~!.........y.y.........≈≈~~~(Wagg,B1yy.....#####.~~≈≈P. ######..##########...# #.~~≈≈P...##########...# #.~~≈≈~ ........(.....†<...<.#####..≈≈≈~. ......[..........~~~≈~ .....~≈~. #########..###########WaggB~≈≈~. #..# #......~~≈~.#..# #......~~~~#..# #......~~~≈.######..###########.≈~P~........................~~≈≈~~..#########≈WaggqOWaggP7-200 _Wagg^Wagg d  Things that are here: _a +0 shortbow; 8 stones; a centaur corpseXagg  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6  aggN m 1.0   0       e - Long Blades  10.7  12.0   0               f - Armour   3.0   4.0   0       g - Dodging   0.0   1.0   0      h + Shields9.8  10.5   0       i - Stealth   0.0   0.8  +1           agg }40m                                   The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  Xagg [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  Xagg0 [!] training|cost|targetsYagg- iTargetTarget--  --  --  Yagg {--  --  --  --  14.0 8.0  12.0 10.0 7.0  a-z] set[-] clear selected targetYaggT ccost|targetsZaggu7W=] set aall targetsZagg ZaggZagg.......##...# #.P≈≈~~. deadiverson the Carver ....y(.##########...######.P≈≈~~. Human of the Shining One ***... .......y.....y.yc..........~≈≈~!. Health: 67/90 =================------- Zagg................y.y.........≈≈~~~ Magic: 11/11 ======================== ......(.......yy.....#####.~~≈≈P. AC: 16Str: 17 ######..##########...# #.~~≈≈P. EV: 13Int: 11 ######..##########...# #.~~≈≈~P SH: 15Dex: 14 ZaggV........(.....†<...<.#####..≈≈≈~. XL: 11 Next: 12% Place: Dungeon:9 Zagg'......[........†@..........~~~≈~~ Noise: ---------  Time: 10200.6 (0.0) .............................~≈~. a) +4 falchion (freeze) Zaggɘ?#########..###########......~≈≈~. Throw: 21 darts (poison)#..##......~~≈~.#..##......~~~~~#..##......~~~≈.Zagg ######..###########.......≈~P~ ........................~~≈≈~~ ..#########..............~≈≈≈~Zagg1  _You block the killer bee's attack. x2  You slash the killer bee! You freeze the killer bee. Zagg_You kill the killer bee! _No target in view!  Things that are here: _a +0 shortbow; 8 stones; a centaur corpseZaggßZagg3ZaggrZaggZaggH Zagg Zagg Zagg! Zagg : _Zagg w8=ZaggW ,Zaggw Zagg# 9=Zagg$ Zagg) Zagg) Zagg* Zagg/ ,Zagg/ Zagg4 Zaggi4 &70Zagg5 Zagg2: ,Zagg: Zagg> ,Zaggp? ZaggRB ZaggB %1ZaggC ZaggH ZaggJH Zagg=I ZaggkL ,ZaggM ZaggQ ZaggQ ZaggR D2=ZaggJS ZaggfV ZaggV ZaggW Zagg[ Zagg[ Zaggx] Zagg` Zagg a U3=Zaggpb ZaggMf Zaggf Zaggg Zagg%k ;4Zaggl Zaggop Zaggp Zaggq Zaggut Zaggu Zaggu Zaggx Zaggly K5=Zaggz Zagg!~ Zaggf~ Zagg Zaggǂ ,Zagg̃ Zagg Zagg\ #6Zagg 2=Zagg Zagg ,Zagg؍ Zaggِ Zagg$ Zagg0 Zagg Zaggd %7Zaggc Zagg ,Zagg Zagg۠ ,Zagg Zagg6 Zagg %8Zagg Zagg Zagg Zagg Zagg ,Zagg Zaggط Zaggz K9=Zagg Zagg Zagg3 Zaggh Zagg ,Zagg4 Zagg Zagg. $80ZaggS 2=Zagg Zagg ,Zagg` ZaggV Zaggq %1Zagg Zagg Zaggw Zagg Zaggv Zagg Zagg Zagg Zagg %2Zagg Zagg Zagg Zaggw Zagg Zagge ZaggU Zagg Zaggr #3Zagg (=Zagg Zagg Zagg Zagg2 Zagg ,ZaggM ZaggZagguN4=ZaggZaggZaggZaggZaggV ,Zagg_ ZaggDZagg%5ZaggZaggPZaggZaggZagg,ZaggZaggZaggI%6Zagg#Zagg'Zagg(Zagg )Zagg-,Zagg.ZaggY2a7=Zagg3ZaggB8,Zaggq9ZaggC=k8=Zagg>ZaggFCZaggCZaggDZaggGZaggGZaggHZaggCMZaggM%9ZaggNZaggPZagg7QZaggERZaggV,ZaggjWZagg,[:90Zagg,\(=Zaggy\Zagga1 _HP restored.Zaggd3Zagg%fZaggkf  There is a stone staircase leading up, spattered with blood here.ZagglZaggm _ZaggnZaggsf  You see here a killer bee corpse.ZaggwZaggx _Zagg!zZagg|Zagg=Zagg?Zagg _f - 23 poisoned darts (gained 2)Zagg(,ZaggZaggZagg,Zagg Zagg,ZaggZaggo _f - 24 poisoned darts (gained 1)ZaggZagg?ZaggZaggZaggZagg#ZaggZagg'ZaggZagg%ZaggRZagg,ZaggZagg*o _f - 25 poisoned darts (gained 1)ZaggZaggZaggZagg=o  f - 26 poisoned darts (gained 1)ZaggZaggfZaggf _You see here a killer bee corpse.Zagg&ZaggsZaggZaggsZaggv,ZaggZaggZagg# ,Zagg(!Zagg"$Zagg1'Zagg'Zaggk(Zagg**ZaggZ-,Zagg.Zaggq4Zaggf8,Zagg9Zagg;Zagg ?,Zagg?[agg[agg{,[agg[agg? [agg [agg[agg[agg[agg-[aggn[aggm[agg[aggM[agg[agg[agg [agg#,[agg$[agg&[agg),[agg*[agg,[agg0[agg<~  #############  ............#  ......#>...........# [..............######### ........................  #............#  #..............@...#  #.### ..#≈≈##...................... ..#≈≈≈#6 ........................ ..#≈≈≈# [agg=o........##########...### #.#≈≈≈P ........# #...# #.P≈≈~~ c   centaur (wandering) .....†..###...######.P≈≈~~ .......yc.c........~≈≈~! .................y.y.≈≈~~[aggH097.6 (97.0)[aggdIH*8.6 (98[aggWR[agg[ _A centaur comes into view. It is wielding a +2 heavy battleaxe.[aggU  #######  ......#  ......#>...........# [......######### ...............  ...........#  .......@...#  ...........### ............... ................ .##########...### ..# #...# †....#[aggO..c..!.[aggz  #######  ......#  ......#>...........# [......######### ...............  ...........#  .......@...#  ...........### [agg............... ................ .##########...### ..# #...# †....#..c..!.[agg4[agg[agg^ _A centaur is nearby![agg9  #######  ......#  ......#>...........# [agg;[......######### ...............  ...........#  .......@...#  ...........### ............... ................ .##########...### ..# #...# †....#..c..!.[aggm'  #######  ......#  ......#>...........# [......######### ...............  ...........#  .......@...#  [agg3...........### ............... ................ .##########...### ..# #...# †....#..c..!.[aggI[agg[agg)[agg^ _A centaur is nearby![agg   #######  ......#  ......#>...........# [......######### ...............  ...........#  .......@...#  ...........### ............... ................ .##########...### ..# #...# [aggJ f†....#..c..!.[aggL  #######  ......#  ......#>...........# [......######### ...............  ...........#  [agg.......@...#  ...........### ............... ................ .##########...### ..# #...# †....#..c..!.[agg[aggI[agg [agg^ _A centaur is nearby![aggI #############............# ..# ..># .######### ......... ## #.# #.......@..### ..#≈≈## #...... ..#≈≈≈#. .....#≈≈≈#~##########...#### #.#≈≈≈P.# #...# #.P≈≈~~.[agg s†..##########...######.P≈≈~~...........yc.c........~≈≈~!.....≈≈~~~.yy.....#####.~~≈≈P.[agg$ clauncher)cThe centaur unwields a +2 heavy battleaxe.[agg& P (([agg9' h(((The centaur wields a +0 orcbow. The centaur shoots an arrow.[agg߸ V.....[aggl 9=9.6 (1.0)[agg [agg * _You block the arrow.\agg](((((\agg; .....  You throw a poisoned dart. The poisoned dart hits the centaur.\agg"E^(((((\agguV.....\agg (((((The centaur shoots an arrow. The arrow hits you. The centaur shoots an arrow.\aggiV.....\agg9j86--300.8 (1.25\aggbs\aggyv* _You block the arrow.\aggm (((((, poisoned)You throw a poisoned dart. The poisoned dart hits the centaur.\aggV.....\agg ^(((((\agg .....  The centaur is poisoned. The centaur shoots an arrow. You block the arrow.\agg'^(((((\aggk-V.....\agg.]1.9 (1.14\agg7\agg;G _The centaur shoots an arrow. You block the arrow.\aggQ (((((((You throw a poisoned dart.\agg .....cThe poisoned dart barely misses the centaur.\agg^(((((\agg"V.....\agg#5--3.03\agg+\aggq/F _The centaur shoots an arrow. The arrow hits you.\aggs y............#  ..# .># .#########........ # .# .#####...#≈≈## ........#≈≈≈#.. ...#≈≈≈#~##########...######.#≈≈≈P..# #...# #.P≈≈~~.†..##########...######.P≈≈~~...........y..c........~≈≈~!....(≈≈~~~yy.....#####.~~≈≈P.. #####..##########...# #.~~≈≈P.\aggX \agg R((((\agg J....\agg& ((((The centaur shoots an arrow. You block the arrow. The centaur shoots an arrow.\agg O....\aggQ 4640\agg \agg * _You block the arrow.\agg~_ .>..#########.........# ####...#≈≈##.....\aggt≈#..~##########...######.#≈≈≈P. #...# #.P≈≈~~†..##########...#####\aggQ...........y..c........~≈≈~!....(........≈≈~~~yy.....#####.~~≈≈P. \aggI#####..##########...# ~P\agg \aggTrc( \agg .-5\agg \aggV+]aggA.>.#########.........# ####...#≈≈##.....≈#..~##########@..######.#≈≈≈P. #...# #.P≈≈~~†..##########c..#####...........y..(........~≈≈~!....(........≈≈~~~y......#####.~~≈≈P. #####..##########...# ###~P .............†<...<.#####..≈≈≈~.]agg+!]agg(<(]aggW]aggc.3===6]agg]aggvF _The centaur shoots an arrow. The arrow hits you.]agg_  _You block the arrow. _The centaur shoots an arrow. The arrow hits you.  You slash the centaur! You freeze the centaur.  The centaur is severely wounded.  The centaur looks more healthy. The centaur unwields a +0 orcbow.  wields a +2 heavy battleaxe.]agg/4--8 (0.8]agg]aggu _The centaur closely misses you. You block the centaur's attack.]aggQ  You hit the centaur. You freeze the centaur.]aggc#f)]agg'^4--7.7 (0.9]agg-]agg:1K _You kill the centaur!]agg.]agg]aggr^ _No target in view!]agg| 3]agg ]agg6 ]agg> B4 _]agg ]aggے ]agg ]aggN ,]agg ]agg ]agg %5]aggL ]aggޡ ]agg ]aggf ]agg- ,]aggd ]agg ]agg %6]agg ]agg ]agg ]aggV ]agg+ ]agg K7=]agg ]agg ,]agg ]agg' ]agg^ ]aggj ]agg ]agg U8=]agg3 ]agg ]agg/ ]aggk ]agg ]agg ]agg> ]aggC ]agg %9]agg ]agg ]agg ]agg' ]agg ,]aggh ]agg ]agg L90=]agg ]agg! $-]aggF ' .########...............# .......####...#≈≈##..............≈#..........~##########...######.#≈≈≈P. #@..# #.P≈≈~~†..##########...#####...........y..(........~≈≈~!....(........≈≈~~~.......#####.~~≈≈P.##.<.# .....[........†)..........~~~≈~~. ]aggA 025.7 (18.0)]agg. F-6.7 (19]agg4 ]aggr  Things that are here: _a +2 heavy battleaxe; a +0 orcbow; a centaur corpse]agg n3]agg p]aggDt]aggx: _]agg|]agg}]agg]]agg]agg$]agge=]agg o _f - 25 poisoned darts (gained 2)]agg  _f - 26 poisoned darts (gained 1)]agg~]aggW]agg]agg']agg]agg]agg]aggE]aggj]aggU]agg]agg']agg8]agg ]agg ]agg ]agg ]agg\]aggM,]agg]aggq]aggo]agg]agg]agg]agg ]agg!]agg"]agg%]agg+,]aggS-]agg40]agg3,]agg"5]agg6]agg9,]agg:]agg=]agg5A,]aggB^agg^aggn ,^agg ^aggI^agg^agg^agg^agg^aggW,^aggq^agg<^aggr",^agg#^aggo)B^agg*^agg-^agg0^agg0^agg}1^agg3^agg6,^agg7^agg=:^agg=^agg>^agg?^agg>A^agg7D^aggiD^agg,E^aggG^agguJ^aggJ^aggK^aggN^aggR^agg8R^aggS^aggU^agg Y^aggGY^agg[Z^agg]^agg%b^aggib^aggRd^aggf^aggj^agg^j^aggk^aggan^aggYr,^aggs^agg1v^aggy^agg]z^aggv{^agg~^aggE^aggx^agg^aggR  There is a stone staircase leading down here.^agg^agg5 _^agg^aggN^agg^agg@^aggu^agg^agg ^agg^aggW^agg^aggz,^agg^aggJ^aggO,^agg^agg!^agg*^agg\^agg^aggֵ^agg,^agg^agg$^agg,^agg^aggP^agg,^agg^agg^agg^aggI^agg\^agg^agg ^aggF^agg^agg^agg^agg^aggz^agg ^agg ,^agg^agg-^aggB^agg^agg^agg^agg\^agge^agg,^aggN^agg^agg^aggb^agg^agg^aggh ^agg ^agg4 ^agg ^agg^aggB^agg^agg~^aggc  #.................  #...........  #..............>..  #...........[.....  #.................  #.############..  #.# #...  #.# #.. # ######..  #...............  #...............6 ^aggU #........  #................†  #...............y   killer bee (wandering)  #.................  #..y.............. ##########^aggS"-88.7 (62^agg$^agg-I..y^agga.,9.7 (63^agg)6^agg:] _A killer bee comes into view.^agg #... #..............>.. #..[ #.. #.# #.#  #.#  #@# ^aggc~ #........ #........ #........ #........† #........ ^agg[#........ #....y...^agg~<  #... #..............>.. #..[ #.. #.# #.#  #.#  #@#  #........ #........^agg #........ #........† #........ #........ #....y...^agg*^agg^agg^agga _A killer bee is nearby!^aggs #... #..............>.. #..[ #.. #.# #.#  #.#  #@#  #........ #........ #........ #........† #........ #........ ^aggĊE#....y...^agg"\  #...^aggG" #..............>.. #..[ #..^aggp" #.# #.# ^agg" #.#  #@#  #........ #........ #........ #........†^agg7# #........ #........ #....y...^agg+^agg6,^agg2^agg6a _A killer bee is nearby!^aggg #... #..............>.. #..[ #.. #.# #.#  #.#  #@# ^aggh #........ #........ #........ #........† #........ #........ #....y...^agg  #... #..............>..^aggZ\ #..[ #.. #.# #.# ^agg~ #.#  #@# ^agg #........ #........^agg #........ #........†^agg #........ #........^aggd #....y...^aggn ^agg ^agg ^agg a _A killer bee is nearby!^agg (((((((You throw a poisoned dart.^aggh> ^aggY? ^aggH ....y.y.^aggI b90.8 (1.1)5^aggP ^agg%T f _The poisoned dart closely misses the killer bee.^aggR((((^agg^agg@^agg..y..(^agg[X1.94^agg%^agg( ^agg)Q_You throw a poisoned dart. The poisoned dart hits the killer bee._agg (((((((You throw a poisoned dart._aggH_aggI_aggRpy....._aggS(3.0_agg4S03_agg1Z_agg[e _The poisoned dart barely misses the killer bee._aggAy (poisoned)  You throw a poisoned dart. The poisoned dart hits the killer bee._aggc  The killer bee is poisoned. You block the killer bee's attack._aggs`=4.12_agg_aggz _The killer bee barely misses you. You block the killer bee's attack._agg<  You miss the killer bee.The killer bee is lightly wounded._agg +9 (0.8_aggr _aggF 8 _You block the killer bee's attack._agg  You closely miss the killer bee.The killer bee is lightly wounded._agg, -5.8 (0.9_aggr _aggv { _You block the killer bee's attack. The killer bee closely misses you._aggE  You miss the killer bee.The killer bee is moderately wounded._aggE-6.8 (1.0_aggL_aggwO; _You block the killer bee's attack. x2`agge&  `aggYou closely miss the killer bee.The killer bee is moderately wounded.`agg&7`agga`agg; _You block the killer bee's attack. x2`agge  You hit the killer bee. You freeze the killer bee.  The killer bee is severely wounded.`agg$`aggM&8.7 (0.9`agg`aggs _You block the killer bee's attack. The killer bee misses you.`agg  You closely miss the killer bee.The killer bee is almost dead.`agg-9.5 (0.8`agg`aggLX _The killer bee closely misses you.`aggJ   You barely miss the killer bee.The killer bee is almost dead.`agg `agg5 /400.4 (0.9`agg `agg ^ _The killer bee looks more healthy. You block the killer bee's attack. x2`agg0 W  You hit the killer bee. You freeze the killer bee.`agg`9 x(`aggw> (1.3`aggkE `aggH N _You kill the killer bee!aagg?%Iaagg'aagg)aagg-,aagg/aagg50aagg0aagg4o _f - 23 poisoned darts (gained 1)aagg 7aaggd7aagg98aagg:aagg-=,aagg=aagg?aaggB,aagggCaaggAEaaggG,aaggHaaggbM,aagg1Naagg]Qo _f - 24 poisoned darts (gained 1)aaggJTaagg}Taagg#UaaggVaaggeYaaggYaaggZaagg_,aagg_aaggao _f - 25 poisoned darts (gained 1)aaggbaagg2caaggcaaggeaagghaaggjhaagghaaggkaaggs #.# # #.############ #.................. #............. #......... #................† #.............. #.............. #(@............- #.################# #. ######5 #.  aagg-t#. ...... #y y   killer bee (wandering) #. ###### #.aaggw013.3 (12.0)aaggxaagg#N.yaaggF-4.3 (13aaggaaggW] _A killer bee comes into view.aagg #.#  #.######## #......... #......... #......... #.........† #......... #......... #(@....... #.######## #.  #.  #.  #.  #.  #yaagg= #.#  #.######## #......... #.........aagg ~ #......... #.........† #.........aaggB@ #......... #(@....... #.########aagg #.  #.  #.  #.  #.  #aagg*aagg‹aagg4aaggfaagg%a _A killer bee is nearby!aaggyM #.#  #.######## aaggʲv#......... #......... #......... #.........† #......... aaggS#......... #(@....... #.########aagg%N #.  #.  #. aaggM9 #.  #.  aaggvD#yaaggK  #.#  #.######## #......... #......... #......... #.........aaggKL o† #......... #......... #(@....... #.######## #.  #.  #.  #.  #.  #aaggL *aaggT aaggU aaggJ_ aaggj`  aagg` S_A killer bee is nearby!aagg  #.#  #.######## #......... #......... #......... #.........† #......... #......... #(@....... #.######## aagg| #.  #.  #.  #.  #.  #yaagg9  #.#  #.######## #.........aagg9 N #......... #......... #.........†aagg9  #......... #......... #(@....... #.########aagg1:  #.  #.  #.  #.  #.  #aaggo@ aagg@ aaggtE aaggG a _A killer bee is nearby!aaggt #.#  #.######## #......... #......... #......... #.........† #......... #......... #(@....... #.######## #.  #.  #.  #.  #. aagg I #ybaggj- #.#  #.######## #......... #......... #......... #.........† #......... #.........baggb #(@....... #.######## #.  #.  #.  #.  #.  #bagg<*baggbaggbaggbagg1 baggOS_A killer bee is nearby!baggЕ>((((bagg(ypoisoned)( _A killer bee is nearby! _baggFis nearby!  You throw a poisoned dart. The poisoned dart hits the killer bee.  The killer bee is poisoned.baggbaggjbagg&....y.(bagg'j==5.4 (1.1)4bagga.bagg{2U _The killer bee buzzes angrily. You hear an angry buzzing noise.baggU (((((You throw a poisoned dart.baggbaggbaggv..y.bagg1a--6.53bagg)baggf _The poisoned dart closely misses the killer bee.baggr ((very poisoned)  You throw a poisoned dart. The poisoned dart hits the killer bee.  The killer bee looks even sicker.bagg bagg+ G  The killer bee is lightly wounded.bagg baggu bagg! bagg y.y 2 killer bees (1 very poisoned)  A killer bee comes into view.baggR bagg =-7.62bagg# bagg' 8 _You block the killer bee's attack.baggl { (You throw a poisoned dart.bagg bagg u  The poisoned dart closely misses the killer bee.bagg bagg cyy(baggs X8.71baggj baggH 8 _You block the killer bee's attack.bagg W  You hit the killer bee. You freeze the killer bee.bagg4 bagg Sy.bagg ,90baggc bagg9 8 _The killer bee is lightly wounded.cagg  You miss the killer bee.The killer bee is severely wounded.cagg.20.5 (0.8caggcagg; _You block the killer bee's attack. x2cagg>  The killer bee is severely wounded. _You block the killer bee's attack. x2  You closely miss the killer bee.  The killer bee is severely wounded.The killer bee closely misses you. The killer bee stings you.  You are poisoned.cagg?85=--1.4 (0.9Pois caggIHcaggLW _The killer bee poisons you! You block the killer bee's attack. x2caggJY  You slash the killer bee! You freeze the killer bee.caggf* (   killer bee  You kill the killer bee!You feel sick. The killer bee closely misses you.cagg_3--52.3cagg˿caggY caggcagg5_The killer bee stings you but does no damage.caggF  You closely miss the killer bee.The killer bee is lightly wounded.caggF(3.2caggNcaggQJ _You feel sick. You block the killer bee's attack. x2cagg  You barely miss the killer bee.The killer bee is lightly wounded.cagg #2cagg P=-4.1cagg cagg _You feel sick. The killer bee misses you. You block the killer bee's attack.cagg?"  You hit the killer bee but do no damage.The killer bee is lightly wounded.cagg# Y1-9 (0.8cagg]* cagg2. G _You feel sick. You block the killer bee's attack.dagg1>f  You throw a poisoned dart. The poisoned dart hits the killer bee.dagg  The killer bee is lightly wounded.  You feel sick. You block the killer bee's attack.6.0 (1.10daggdaggX _The killer bee closely misses you.daggz (You throw a poisoned dart.dagg. yThe poisoned dart barely misses the killer bee.You feel sick. The killer bee completely misses you.daggd07.119daggdagg; _You block the killer bee's attack. x2daggnz (You throw a poisoned dart.dagg%: yThe poisoned dart closely misses the killer bee.You feel sick.  You are no longer poisoned.dagg:=8.28daggAdaggCEz _You block the killer bee's attack. The killer bee barely misses you.dagg0 z (You throw a poisoned dart.daggE yThe poisoned dart barely misses the killer bee.dagg+F (9.3dagg^F 07daggfM daggP ; _You block the killer bee's attack. x2dagg f  You throw a poisoned dart. The poisoned dart hits the killer bee.dagg G  The killer bee is lightly wounded.dagg Y30.46dagg3 daggx [ _The killer bee closely misses you. x2eaggQz (You throw a poisoned dart.eagg yThe poisoned dart barely misses the killer bee.The killer bee stings you but does no damage.eagge11.6 (1.25eaggSeagg{ _You block the killer bee's attack. The killer bee closely misses you.eagg z (You throw a poisoned dart.eagg} yThe poisoned dart closely misses the killer bee.You block the killer bee's attack.eaggϘ]2.7 (1.14eaggCeaggC _The killer bee stings you but does no damage.eagg (poisoned)  You throw a poisoned dart. The poisoned dart hits the killer bee.  The killer bee is poisoned.eagg@  The killer bee is lightly wounded.  The killer bee closely misses you.eaggAX3.83eaggHeaggJC _The killer bee stings you but does no damage.eaggsLz (You throw a poisoned dart.eagg yThe poisoned dart closely misses the killer bee.24.92eagg*eagg{ _You block the killer bee's attack. The killer bee closely misses you.eagg z (You throw a poisoned dart.eaggx  yThe poisoned dart barely misses the killer bee.The killer bee stings you but does no damage.6.1 (1.21eagg eagg { _You block the killer bee's attack. The killer bee closely misses you.eagg z (You throw a poisoned dart.eagg/ y The poisoned dart misses the killer bee.eagg03=7.2 (1.10eagg@8eaggK:; _You block the killer bee's attack. x2fagg9  You hit the killer bee but do no damage.The killer bee is moderately wounded.fagg -8.0 (0.8faggfaggŽ8 _You block the killer bee's attack.faggj  You barely miss the killer bee.The killer bee is heavily wounded.fagg+9 (0.9faggyQ _You block the killer bee's attack. x2fagg  You closely miss the killer bee.The killer bee is heavily wounded.The killer bee stings you but does no damage.fagg`4=9.8fagg fagg%8 _You block the killer bee's attack.faggm  You barely miss the killer bee.The killer bee is heavily wounded.faggn )40.7fagglu faggx { _The killer bee closely misses you. You block the killer bee's attack.fagg)  You hit the killer bee. You freeze the killer bee.  The killer bee is almost dead.1.5 (0.8fagg}1 fagg4 8 _You block the killer bee's attack.gagg  You closely miss the killer bee.The killer bee is almost dead.gagg+"M(gagg&562.4 (0.9gagg-gaggr0N _You kill the killer bee!gagg63gagg7gagg";gagg?}5gaggiAgaggA%6gagguBgaggD,gaggEgaggSGgaggGgagg/Hgagg+JgaggJK7=gaggRKgaggLgagg+MgaggMgaggOgaggOgaggPgaggRgaggSN8=gaggSgaggzU,gagg\VgaggWgagg XgaggXgaggZgaggZ%9gagg[gagg]gagg ^gagg^gaggr`,gagg)agagg:cgaggcL90=gaggWdgagg fgagg|hgagghgaggIigagglgaggmgaggmgaggo$ gaggoL_f - 21 poisoned darts (gained 11)gaggqgaggrgaggrgagg%vgaggv9=gaggwgaggyo _f - 22 poisoned darts (gained 1)gaggB  #............  #............  #..  #........gagg†  #........  #.........  #........  #.################  #@# #####-61.4 (19.gagg0)  #(....... .....  #........ .....22  #(....>..   #.####### #####  #(#  #.#  #.# ## gagg_gagg͉F-2.4 (20gaggfgagg4 _Found a staircase to the Lair.gaggb gagg gagg gagg gagggagg,gagg&,gagggagg$o _f - 23 poisoned darts (gained 1)gagggagggagggagggagggagggagggagggagggaggXgaggo _f - 24 poisoned darts (gained 1)gagggagggagg5gagggagg gagg gagg!gagg"gaggM#,gagg$o _f - 25 poisoned darts (gained 1)gagg%gagg%gagg%gagg&gagg'gagg'gagg'gagg(gagg)gagg)gagg*gagg*gagg+gagg,gaggQ,gagg-gagg-gagg.gaggX.gagg/gagg1gagg1gagg2gagg3gagg4gagg4gagg5gagg6gaggN7gaggy7gagg7gagg9gagg:gagg;gaggy;gagg<gaggS?,gagg@gaggQBgaggCgaggDgaggDgaggEgaggFgaggGgaggfGgaggIgaggEJgaggJgaggSKgaggLgaggMgaggMgaggNgaggPgaggR,gaggSgaggXgaggTZgaggZgaggJ[gagg]gagg`,gagg`gagg jgaggll,gaggmgagg pgaggr,gaggrgaggsgaggtgagg ugaggugaggxgaggzgagg){gagg|gaggU~gaggɀgagggaggʁgaggʃgagg$,gagggagggaggugagggagggagg~gagg,gagg%gaggEgagg,gagggaggpgaggG,gagggagggagggagggagggaggɘgagggagggagggaggњgagg,gagg]gagg(gagg,gaggygagggagg,gaggvgaggYgaggfgagggagg֣gagggagg(,gagggagg'gagg,gagg+gaggvgaggm,gaggBgagggaggŲ,gaggYgagg,gagg,gagggagggagg,gagg0gagggagg,gagg9gagggagg,gaggjgagggagg.gagggagggaggZgagggaggagagggagggagg5gagggagg1gagg&gaggW #..............  #.....................PPPPPPP  #.....................PPPPPPP  #................P.....  #...............P  #..............ßßß  #.##################...P..ß gagg& #.##################......ß._  #...........@............)ß..  #.................)  #...............########.)#5 gaggi #...............# #  #...............# ####..  #...............##..  #....................  #.................gagg\.... ...gaggJ_514.4 (52gaggu,5.4 (53gaggk:_gagg3. _D - a scroll of identifygaggj gagg gagg  gagg gagg@" gagg7& Bgagg+ Xgagg- gagg- gagg|. gagg0 gagg1 gagg1 gagg@2 gagg4 gaggE7 ,gaggO8 gagg: gagg< gaggG= gagg> gagg@@ gaggA gaggA gagg|B gagg"E gaggG gaggMG gaggG gaggJ gaggN ,gagg P gaggR ,gaggCS gagg)X N _You now have 295 gold pieces (gained 12).gaggZ gagg3[ gagg \ gagg_ gaggHa ,gagga gagg+c gaggd ,gagge gagguj gaggk ,gaggm gaggp gaggq ,gaggr gaggt gaggOv ,gagglw gaggx gagg\z gaggz gagg{ gagg gaggS gagg gagg gaggd gagg& ,gaggv gagg gagg gaggE gagg gagg gagg gagg_ gaggã gagg gagg gaggԨ gagg gagg gagg Xgagg gagg gagg gagg gagg׸ ,gagg gaggԻ gagg ,gagg gagg' gagg` ,gagg gagg gagg ,gagg{ gagg gagg ,gagg gagg- gagg ,gagg gagg gagg gagg gaggC gagg gaggU gagg gaggP gagg gagg% ,gagg gagg" gaggY ,gagg gagg gaggs ,gagg gagg gagge ,gagg gagg gagg gagg gagg7 gagg gagg ,gagg gagg gagg ,gagg gagg gaggp ,gagg gagg gagg< gagg ,gaggQ gagg[ gagg gagg gagg gagg gagg' gaggb gagg gagg gaggc gagg gagg gagg gagg gagg~ gagg> gagg ,gaggE gagg gagg0 gagg gaggI gagg gagg gagg gagg o.....~P~F≈ ................P~~F≈≈≈ ...........~~~≈≈ ........ .......~.# ........ ........### ........ .......... .[... ......! gaggx =##### #...#  #@..# 62.4 (47 #...# ################...# ...................# #################### F   marrowcuda (wandering) gagg gaggE gagg a _A marrowcuda is nearby!gagg :......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... .[... ......!  #...#  gagg #@..#  #...# #...# ...................# ##### gagg/......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... [... ......!  #...#  #@..#  #...# #...# gaggR...................###### gaggAgagggaggDgaggXa _A marrowcuda is nearby!hagg ......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... .[... ......!  #...#  #@..#  #...# #...# ...................# ##### hagg3hagg U......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... [... ......!  #...#  #@..#  #...# #...# ...................#haggUT##### hagg/]hagg]hagg2fhaggia _A marrowcuda is nearby!hagg......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... .[... ......!  #...#  #@..#  #...# #...# ...................# ##### hagg+......P~~F≈≈≈ ......~~~≈≈  .......~.#  ........###  .......... [... ......!  #...#  #@..#  #...# #...# ...................###### hagg,hagg5hagg6hagg>hagg9Ba _A marrowcuda is nearby!haggj. (((((((You throw a poisoned dart.hagg hagg ≈F~.....Fhagg a3.5 (1.1)4hagg hagg e _The poisoned dart barely misses the marrowcuda.hagg^ P ((hagg (((((You throw a poisoned dart.  The poisoned dart closely misses the marrowcuda.hagg hagg? hagg ≈~.F....hagg` X4.63haggǝ hagg ( _You hear a splash.hagg (((((((You throw a poisoned dart.  The poisoned dart barely misses the marrowcuda.iagg iaggu(~..F...iaggeX5.72iagg iagg $( _You hear a splash.iagg!B((iaggiagg iagg\(.FiaggiX6.81iaggdiaggW _You throw a poisoned dart. The poisoned dart hits the marrowcuda.iaggiagg=f  You throw a poisoned dart. The poisoned dart hits the marrowcuda.iagg>`=7.90iagg"HiaggI[ _The marrowcuda completely misses you.iagg  You barely miss the marrowcuda.8.8 (0.9iaggiagg5B _The marrowcuda bites you but does no damage.iagg  You hit the marrowcuda. You freeze the marrowcuda.  The marrowcuda is moderately damaged.iagg/ (9.7iagg iagg] 8 _You block the marrowcuda's attack.iaggv  You hit the marrowcuda but do no damage.The marrowcuda is moderately damaged.The marrowcuda closely misses you.iagg .70.5 (0.8iagg iagg{ B _The marrowcuda bites you but does no damage.iagg  You slash the marrowcuda!  The marrowcuda is heavily damaged.=1.4 (0.9iagggiaggW _The marrowcuda barely misses you.jaggiy  You barely miss the marrowcuda.The marrowcuda is heavily damaged.jaggy0-2.3jaggdjagg8 _You block the marrowcuda's attack.jagg!  You hit the marrowcuda. You freeze the marrowcuda.  The marrowcuda is almost destroyed.jagg!!-jagg "&3.1 (0.8jagg)jaggR-8 _You block the marrowcuda's attack.jagg  You hit the marrowcuda but do no damage.The marrowcuda is almost destroyed.jagg-4.0 (0.9jaggjaggX _The marrowcuda closely misses you.jagga  You barely miss the marrowcuda.The marrowcuda is almost destroyed.jagg> -5.0 (1.0jagg jagg ; _You block the marrowcuda's attack. x2jaggP  You slash the marrowcuda!  You destroy the marrowcuda!jagg@Z K( jagg] 76  You slash the marrowcuda!  You destroy the marrowcuda! _The Shining One accepts your kill.  Training target 10.0 for Shields reached!  Your Shields skill increases to level 10!You need to enable at least one skill for training.jaggPi /  --more--kagg{kaggC  Skill  Level Cost  Apt Skill  Level Cost  Apt kagg  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1      kaggS    kagg b - Unarmed Combat   0.0   1.0   0  kagg.S    kaggR c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1      kaggr l - Evocations   0.0   1.0   0  kagg d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0  kaggƫ            kagg. f - Armour   3.0   4.0   0      kagg. g - Dodging   0.0   1.0   0      kagg&. h - Shields  10.0  12.0   0      kaggì i - Stealth   0.0   0.8  +1                                  kagg"            You need to enable at least one skill.[?] Help[=] set a skill target  kaggX[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  kaggs[!] training|cost|targetsmagg'TargetTarget--  --  --  --  --  --  --  14.0 8.0  12.0 --  7.0  a-z] set[-] clear selected targetcost|targetsoaggB [?25h[?0coaggZB *8.0 pagg [?25l[?1cpaggo8.0 =] set aall targetspagg}> f + Armour 3.0qaggzqagg?..............~P~F≈deadiverson the Carver ................P~(≈≈≈≈Human of the Shining One ****.. .................~~~≈≈Health: 90/90 ======================== ........ .......~.#Magic: 11/11 ======================== ........ ........###AC: 16Str: 17 ..........(.......EV: 13Int: 11 .[.........!SH: 15Dex: 14 ######(..#XL: 11 Next: 17% Place: Dungeon:9#@..#Noise: =--------  Time: 10576.0 (1.0)#...#a) +4 falchion (freeze) ################...#Throw: 20 darts (poison) .................aggk1m..# ####################You slash the marrowcuda!  You destroy the marrowcuda! _The Shining One accepts your kill.Training target 10.0 for Shields reached!  Your Shields skill increases to level 10!You need to enable at least one skill for training.qaggU qagg)qagg. _qaggKqaggKqaggIMqaggPqaggSqaggX: _qagg|[qagg[qaggD]qaggao _f - 21 poisoned darts (gained 1)qaggeqaggeqagggqaggmqaggmqaggnqaggoqaggs,qaggxqaggzo _f - 22 poisoned darts (gained 1)qagg~qagg~qaggqagg[qaggqaggIqaggqaggcqagg ,qaggЋqagg#qagg,qaggqaggkqagg,qaggqagg#...~~≈≈≈~~. P~~~≈~≈## ~P~~≈≈≈≈### qagge...P~(≈≈≈≈≈ ....~~~≈≈≈≈  ..........~.# .. ............#### ... .........................-#######...##### qaggס#...# 2 #...#...# qaggZL..............# ###############qaggo/80.0)qaggM!-qagg~%7.0 (11qaggyqaggR _E - a white potionqaggcqaggqaggqagg!qaggqaggE,qaggDqaggqagg qaggFqagg qaggp qagg qagg qagg) qagg{ A  You enter the shallow water.qagg @Water qaggg qagg N _Moving in this stuff is going to be slow.qagg= qaggz qagg. qagg ,qagg qagg, o _f - 23 poisoned darts (gained 1)qagg0 qaggm0 qagg1 qaggO5 qaggh7 qagg7 !qaggp8 qagg; qagg= qagg\> qagg@ qaggvC qagghF qaggF qaggG qaggI qaggK qagg?K qaggK qaggM qagg\O ,qagg3P qagg` qaggc qaggd qaggf qaggok qagg#n qaggXn qaggo qagg)u qagg6w qaggmw qaggx qagg2} qagg qagg qaggo qagg qagg_ qagg qagg qagg qagg} ,qaggě qagg] qagg ,qagg[ qagg qagg~ qagg qagg qaggͯ qagg_ ,qagg qagg qagg qagg* qagg$ qagg qagg qagg[ qagg+ qaggE qaggH ,qagg qagg qagga ,qaggB qagg qagg ,qagg ,qagg A  You enter the shallow water.qagg @Water qagg qagg< N _Moving in this stuff is going to be slow.qaggV qagg &qagg qagg qagg A  You enter the shallow water.qagg) *Water qagg\ qagg qagg N _Moving in this stuff is going to be slow.qaggi 4qagg qagg qagg ,qagg qagg* qagg qagg< !qaggJ! qagg# qagg% qaggE& qagg( qagg, qagg0 qagg0 qagg'3 qagg7 qagg=: qagg: qagg< qaggX@ qaggB ,qaggCD qaggeG qaggJ qagg4K qaggN qaggR qaggU qaggV qaggX qagg] qagg` ,qaggc qaggg qaggk ,qaggn qaggq qaggu qaggTu qagg7w qagg-| Bqagg~ v _t - 2 potions of heal wounds (gained 1)qagg qagg: qagg qagg qagg ,qagg" qaggj qagg qaggϑ qagg qagg qagg qagg9 qagg1 qagg= qagg} ,qagg qagg qagg qagg qagg qaggƵ qagg qaggX qagg; qagg qagg qagg qagg qagg qaggn qagg qagg qaggW qagg ,qagg< qagg ,qagg qagg I _D - 2 scrolls of identify (gained 1)qaggJ 3qagg_ qaggd qagg Xqagg qagg qaggH qagg) qagg{ qagg qagg qagg qaggf #.~~≈≈.......... #.~~≈≈P..####### #.~~≈≈~P.############### qagg #..≈≈≈~................#~~~≈~~...............#.~≈~................#qagg ~≈≈~................#~~≈~................# qagg ...~~~~~........@......#648.2 (61.2 qagg1 -...~~~≈................# ....≈~P~~..............#3 qagg^ ..~~≈≈~~...<...........# qagg M...~≈≈≈~...............#.~~≈≈~~~.............# ....P≈≈≈~..............# qagg ....~≈≈≈~~...>.........# qaggJ N....~≈≈≈~~..qagg9 qagg ,9.2 (62qagg) qaggt ; _Found a stone staircase leading down.qagg qaggx qagg qagg qagg qaggQ qaggt qaggu qagg qagg* qaggG qagg qagg ,qaggn qaggM qagg ,qagg qagga qagg qagg qagg qaggX qagg# Bqagg2' qagg) qagg* qagg+ qagg. qagg1 qagg2 qagg3 qagg6 qagg9 qagg>: qagg; qagg? qaggB qaggGB qaggC qaggE qaggH ,qagg|J qaggUM qaggO qaggP qaggQ qagglU qaggW ,qaggX qagg[ qagg] qagg] qagg^ qaggJn qaggp qaggq qaggr qaggw qaggFz ,qagg{ qagg qagg ,qagg qagg qagg qagg* qaggԎ qagg͒ qagg qaggQ qagg{ qagg qagg ,qagg qagg qagg qagg? qagg- qagg; qagg\ ,qaggr qaggm qagg- qaggd qagg÷ qagg qagg qaggV qagg qagg* qagg qagg qagg qagg qagg qagg qaggj qagg qaggl qagg qagg qagg qagg ,qagg( qagg qagg qaggU qagg1 qagg qagg qaggk qagg qagg qagg qagg qaggG qagg qagg8 ,qagg qagg qagg@ qaggl qagg. qagg qagg qagg: qagg qagg qaggc qagg qagg  qaggC qagg  qagg= qagg qagg qagg! qagg! qagg" qagg% qagg( qagg( qagg) qaggp, qagg. qagg. qaggB/ qaggg1 qagg3 qagg4 qaggG5 qagge< *#...#≈≈##qagg< z... .....#≈≈≈#.........≈§§.§ qagg< .....#≈≈≈#~........≈§§..###.#≈≈≈.≈.≈§§ qagg<  #.P≈≈~~.≈§... qagg= ^####.~≈≈~~..≈≈≈≈≈qagg+= ..~≈≈~........≈≈~~~......qagg]= }. ####.~~≈≈........qagg= 89.2 (40.0  #.~~≈≈P..###########  #.~~≈≈~P.############### qagg= ####..≈≈≈~................#...~~~≈~~...............#.....~≈~................#....~≈≈~................#qagg= ....~~≈~................#....~~~~~...............#qagg? W _Found a burning altar of Makhleb.qaggqqaggqaggqaggoqagg>qaggP _qagg% qagg qaggM qagg qaggqaggqaggqaggqagg,qagg+qaggqaggGqaggxqagg*qaggqagg%Xqagg#'qagge'qagg(qagg+qagg/qagg;/qaggl0qaggM3qagg5,qagg6qagg>8qagg;qagg[;qagg<qaggY?qagg2Bragg)raggraggraggfraggragg?raggZragg7ragg]raggraggu ragg" raggK ragg ragg, raggraggraggraggragg,raggraggragg,raggraggraggraggragg*raggragg",ragg#ragg%ragg+?ragg+ ####  #..#  #..# ragg, #..############ #....ragg$,%708.2 (19 ragg@,.# #........≈≈≈≈≈≈≈≈ ragg[,### #........≈....... ragg, ..#≈≈ ##........≈.≈§§≈..ragg,#≈≈##.........≈.≈..§§§ragg -#≈≈≈#.........≈.§.§§≈§#≈≈≈#~........≈.≈...§ #.#≈≈≈..........≈.§≈§≈≈ #.P≈≈~~.........≈....§§ragg3.≈§.§§≈≈≈raggb4,9.2 (20ragg7ragg9( _Found a ring mail.raggraggraggmraggragg;Braggraggl,raggraggtragg"raggrraggraggɶraggeraggraggraggɾraggM,ragg@raggragg,raggraggragg,raggragg@nragg+,raggraggraggragg!raggraggraggSraggraggraggnragg,raggragg8ragg(ragguragg4raggragg,ragg*raggraggY,ragg2ragg'raggraggeraggwragg'raggraggragg$ragg;ragg,raggBraggragg!ragg*"ragg"ragg(ragg(,ragg;)ragg.ragg/,ragg0ragg=:Xraggt@raggAraggAraggSBraggGraggHragg$IraggIraggOraggP,raggTQraggVraggXraggXraggYraggp`raggNaraggaraggaraggkraggmraggmraggnraggxraggzraggzragg{raggraggraggʁraggCragg-ragg!ragguraggNraggώragg,raggraggȕraggt,raggJraggraggeraggragg'raggraggݤraggraggraggragguraggragg~raggraggj,raggraggragg=raggragg,raggBraggraggA  You enter the shallow water.ragga*Water raggragg<ragg:N _Moving in this stuff is going to be slow.raggKraggragg ,ragg,raggraggraggragg!ragg(raggragg= raggz ragg ragg1raggraggraggraggraggi!ragg!ragg#raggd'ragg(,raggz)ragg,raggA.ragg.ragg1ragg%5ragg6ragg37ragg7ragg>Bragg?raggCraggFragg?FraggFraggeHraggIraggIraggJraggNragg(PragggPraggmQraggTraggUragg!VraggWraggYragg_Bragg>`raggKbraggbraggcraggXfraggShragghraggniraggNlraggnragg=oraggpraggsraggu,raggEwragg~zragg|ragg[}ragg~raggraggraggKraggraggdraggraggCragg.ragg#raggraggraggragghragg,raggragg)raggragg5raggbraggXragg,ragg&raggraggC,raggraggHragg,ragguraggraggraggragg&raggbragg,raggraggragg5BraggraggBragg raggragg!raggraggvragg ,ragg ragg]raggraggraggraggraggraggUraggragg!ragg #ragg#ragg$ragg)ragg\+ragg+ragg@,ragg=1ragg3ragg@4ragg5raggB:ragg=,ragg>ragg|CraggEragg&FraggGraggpLraggRP,raggraggCXragg~HBraggJ,raggLraggLraggMragg-PraggQragg+Rragg#SraggTraggU,ragg]VraggJXraggP` #.ßßß  #.##################...P..ß  #.##################......ß._ ragg` #........................)ß  #........................(  #...............########.)# ragga" #...............# #.....  #...............# ####..  ############10.0 (6.0)  #ragg,au.  #........... raggga'.............. ...........############ >..........# #ragga~ ...........# # raggal...........# ####### ragga1 .....ragghraggi+1.0 (7raggnraggp; _Found a stone staircase leading down.raggO raggP ragg:Q ragg[ ragg@^ raggb ,raggb raggd raggHe raggDf ragg~i raggj raggk ragg@l raggn raggp ,raggBq ragg-y ragg({ ragg`{ ragg~ ragg raggn ragg ragg ragg raggW ragg ragg ragg ragg< raggj raggH raggC ragg7 raggl ragg; ragg% ragg raggK ragg ragg raggd Bragg% ragg ragg; ragg raggB ragg Bragg ragg ragg; ragg ragg ragg4 ragg^ ragg5 ragg ragg ragg ragg/ ragg raggv ,ragg. ragg raggl ragg ragg ragg ragg ,ragg ragg ragg ,ragg ragg ragg ragg raggP ragg ragg ,ragg ragg raggI ,ragg ragg$ raggA' ,ragg* ragg1 raggO5 ragg5 ragg7 ragg= ragg/A ragg{A raggzC raggJ ragg)R ,raggV ragg[ ragg_ ragg ` raggc raggii ragg6m raggwm ragg)q raggv raggE{ ragg{ ragg~ ragg raggx ragg raggٌ ragg ragg raggӘ ragga ragg& ragg ragg? ragg( ragg ragg raggd ragg} raggu ragg raggT ragge ragg ragg Bragg ragg ragg ragg ragg ragg ragg, ragg ragg ragg ragg raggE ragg{ ragg ragg ragg! ragg. ragg\ ragg ragg raggm ragg ragg ragg ragg ragg ragg ragg- ragg ragg ,ragg, ragg ragg ,ragg6 ragg' raggE ragg ragg ragg ragg ,ragg ragg" ragg ,ragg ragg raggM! ragg! ragg# ragg)% ragg) A  You enter the shallow water.ragg) @Water raggR+ raggRF N _Moving in this stuff is going to be slow.raggH ragg!I &ragguJ raggQ ragg[T raggT ragguY raggz] ragg_ ragg_ raggRa raggg raggj raggk raggJl raggr ragg2raggK4raggI6,ragg7ragg9ragg;raggw<raggZ=raggG?ragg$AraggAraggBraggDraggFragg#GraggcHragg%KraggMraggHMraggE{  You enter the shallow water.Water ragg{[P≈≈≈~..............# ~≈≈≈~~...>.........# ~≈≈≈~~.............# #.~~≈≈≈~~~..########### #.~~≈~≈≈~...########### .~≈≈~~P...........# raggi...~.~≈≈~≈~...#.####### #####.....~~≈≈~~.~...# .......#...~~≈≈≈@~..## 947.8 (52.6P~~~≈~≈### ~P~~≈≈≈≈### ...P~~≈≈≈≈≈## ..............~~~≈≈≈≈≈# ragg&................~.#≈#≈≈..............####≈#................###......#  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow waterragg=V. _Moving in this stuff is going to be slow.  You enter the shallow waterraggb<. _Moving in this stuff is going to be slow.ragg'raggDragg _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is goiraggdng to be slow. _Partly explored, can't reach some placessagg)<saggCInventory: 31/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon) saggQDnMissiles (go to first with ()  b - 3 throwing nets  f - 23 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=) saggD, d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)y - a wand of digging (6)  B - a wand of mindburst (22) saggDScrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation sagg#E! o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]uagg>fVc - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+}.The scales of a quicksilver dragon. Although it does not provide its wearer withas much protection as the scales of some heavier dragons, it is somewhat lighterand less encumbering. The armour repels both attacks on the wearer's willpower and magical modification of itself - it cannot be enchanted. Base armour rating: 9 Encumbrance rating: 7 rC+: It protects you from cold. Will+: It increases your willpower. Stlth+: It makes you more stealthy. If you take off this armour: Your AC would decrease by 10.2 (16.5 -> 6.3). Your EV would increase by 0.9 (13.3 -> 14.3). This ancient artefact cannot be changed by magic or mundane means. You took it off a spriggan in a bailey. Stash search prefixes: {inventory} {artefact} {artifact} {body armour} {body armor} (t)ake off, (d)rop, (=)adjust, or (i)nscribe.uaggInventory: 31/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 23 poisoned darts (quivered) Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +0 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand) Wands (go to first with /)  y - a wand of digging (6)  B - a wand of mindburst (22) Scrolls (go to first with ?)  g - 2 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog [Up|Down] select [PgDn|>] page down [PgUpuagg[39;49m|<] page up [Esc] exit[top]vaggRvagg@\vaggeB.[......P≈≈≈~..............#deadiverson the Carver ........~≈≈≈~~...>.........#Human of the Shining One ****.. ........~≈≈≈~~.............#Health: 90/90 ======================== .....#.~~≈≈≈~~~..###########Magic: 11/11 ======================== .....#.~~≈~≈≈~...###########AC: 16Str: 17 vaggg..........~≈≈~~P...........#EV: 13Int: 11 #####...~.~≈≈~≈~...#.#######SH: 15Dex: 14 #####.....~~≈≈~~.~...#XL: 11 Next: 17% Place: Dungeon:9 .......#...~~≈≈≈@~..##Noise: ---------  Time: 10947.8 (0.0) ...........P~~~≈~≈###a) +4 falchion (freeze) ...........~P~~≈≈≈≈###vaggugUThrow: 23 darts (poison) .............P~~≈≈≈≈≈##Water ..............~~~≈≈≈≈≈# ................~.#≈#≈≈# ..................####≈# vaggg.....................### .....................# _Moving in this stuff is going to be slow.  vagggYou enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Partly explored, can't reach some places.vaggpvagg/qvaggxxvaggyvagg&vaggX'vagg#)vagg[........vaggH`vagg!cvagge  You enter the shallow water. _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Partly explored, can't reach some placesvagg4vaggivaggvaggvaggvagg! _Moving in this stuff is going to be slow.  You enter the shallow water. _Moving in this stuff is going to be slow. _Partly explored, can't reach some placesvagg3 4vagg6 vagg:n vaggn vaggt vaggv _ _Partly explored, can't reach some places.xaggxaggmWhere to? (Tab - D:9 @ (x,y), ? - help) xaggR D - Dungeon  T - Temple L - LairxaggPxaggr.[......P≈≈≈~..............#deadiverson the Carver ........~≈≈≈~~...>.........#Human of the Shining One ****.. ........~≈≈≈~~.............#Health: 90/90 ======================== .....#.~~≈≈≈~~~..###########Magic: 11/11 ======================== .....#.~~≈~≈≈~...###########AC: 16Str: 17 xaggEs..........~≈≈~~P...........#EV: 13Int: 11 #####...~.~≈≈~≈~...#.#######SH: 15Dex: 14 #####.....~~≈≈~~.~...#XL: 11 Next: 17% Place: Dungeon:9 .......#...~~≈≈≈@~..##Noise: ---------  Time: 10947.8 (0.0) ...........P~~~≈~≈###a) +4 falchion (freeze) xaggsX...........~P~~≈≈≈≈###Throw: 23 darts (poison) .............P~~≈≈≈≈≈##Water ..............~~~≈≈≈≈≈# ................~.#≈#≈≈# ..................####≈# .....................### .....................#xaggtYou enter the shallow water. _Moving in this stuff is going to be slow. _Partly explored, can't reach some places. _Partly explored, can't reach some places. _Partly explored, can't reach some places. _Partly explored, can't reach some places.xagguxaggAwxaggxaggFxaggRA _xaggxagg0xagg3xaggٓxaggCxaggxaggxaggxaggŝ,xagg^xaggxaggܣxaggwxaggvxaggէxagg>xaggxaggxagg$XxaggAY  There is a stone staircase leading down here.xaggwxagg: _xaggyagg10yaggI yagg ,yagg yagg   #......#  #..../.# .  ###......# ..  .........# ...  yaggH m#.......# ....  .#.....(.#....#  ............... .......@.......57.2 (9.4 ############### yagg _You climb downwards.  Found 6 atropa-tipped darts and a wand of mindburst (7).yagg yagg yagg a _There is a stone staircase leading up here.zaggizaggzagg5zaggzagg: _zagg zaggzagg,zaggIzaggDH  You see here 6 atropa-tipped darts.zagg3 zagg  _zagg zagg zagg,zaggzaggzagg4.g.......#....  ..  #.  #zagg  #......#  #..../.# .#### ...........# ....#.......# ....zagg.#.....(.#....#......................<.......g   gnoll (polearm, asleep)###############zagg-.61.2 (4.0zagg+2.2 (5zagg=zaggs _A gnoll comes into view. It is wielding a +0 spear.{aggNEr#..!.g#+...   ###......# {aggE........# ...# .....#.....(.#....#...........<.......###############{aggMV{aggV+3.2 (1{agg_{aggdT _Found a grey potion. {aggeM_You see here a wand of mindburst (7).{agg T  B - a wand of mindburst (29) (gained 7 charges){agg8K  The gnoll shouts! You hear a shout! x2{aggۊ{agg  g..g.gg   gnoll sergeant (polearm){agggg 2 gnolls (polearms)A gnoll comes into view. It is wielding a +0 spear.A gnoll sergeant comes into view. It is wielding a +0 spear.{aggP&=={agg 4{agg{agg+' _You hear a shout!{agg R#..g..g...# .........# #.g......+ #.. # ## #......# #......# .###...@..# ......# ...#.# .... .#.....(.#....# ...............<.......g   gnoll (polearm)################ {agg {agg {aggK {aggk !...g...g.gg   gnoll sergeant (polearm)gg 2 gnolls (polearms)--5{agg {agg {aggl + ..g...g#........+g ...... #.###.....{aggwm '.#. .(.#....#.................<....################g   gnoll (polearm) {aggFr {agg{ .gg   gnoll sergeant (polearm)g   gnoll (polearm){aggv| A--6{aggX {agg {agg0 4 {agg H#..g.....+g...... ...... #.###........#. .{agg 8(.#....#................<......################{agg {agg {agg M..ggg   gnoll sergeant (polearm){agg &7{agg {agg |agg #..g..... #.g..... #......# #......# #......# .####......# .. ..........# ... ..## .... #.#....# ................ .<....... ################ |agg|agg$R.g.|agg$&8|agg+|agg&0Y _You see here 6 atropa-tipped darts.|agg |aggq |agg |aggp W.gg.gg   gnoll sergeant (polearm)gg 2 gnolls (polearms)|agg &9|agg |aggҲ / _F - 6 atropa-tipped darts|agg!] 4gg... ....#g..###.........#.... .....#.........<################ |aggs] g   gnoll (polearm) |agg< _You block the gnoll sergeant's attack.agg`  You hit the gnoll sergeant. You freeze the gnoll sergeant.  The gnoll sergeant is almost dead.aggRk .g The gnoll misses you. You block the gnoll's attack. x2aggkG-1.5 (0.8aggquagg}xE _The gnoll sergeant hits you but does no damage.agg8_  You hit the gnoll sergeant. You freeze the gnoll sergeant.aggy  You kill the gnoll sergeant!The gnoll hits you but does no damage. You block the gnoll's attack.aggl .gagg582.5 (1.0agg aggW< _The gnoll hits you but does no damage.aggsg  You hit the gnoll but do no damage. You block the gnoll's attack.  The gnoll closely misses you. The gnoll hits you but does no damage.aggg-3.3 (0.8aggmaggCpV _The gnoll completely misses you.agg+  You hit the gnoll but do no damage. The gnoll closely misses you.The gnoll hits you with a +0 whip. The gnoll hits you with a +0 spear.85--agg&4.2 (0.9agghagg$3 _You block the gnoll's attack.aggI M  You hit the gnoll. You freeze the gnoll.agg (5.1agg agg ] _The gnoll is heavily wounded.agg; O  You slash the gnoll! You freeze the gnoll.aggs ) 3You kill the gnoll!You block the gnoll's attack. The gnoll barely misses you.aggj 66--agg $9 (0.8aggű agg, < _The gnoll hits you but does no damage.aggP  You slice the gnoll!! You freeze the gnoll.agg ) 2 gnolls (1 polearm)You kill the gnoll!agg0=6.7aggagg6 _You block the gnoll's attack. x2agg7O  You slash the gnoll! You freeze the gnoll.aggYJ )   gnoll (You kill the gnoll!agg{K(7.5aggTaggX3 _You block the gnoll's attack.agg+..   ####......# .......g.# .)@.# .... .#)#....#agg)................<.......################agg aggc7=-8.5 (1.0aggaggh3 _You block the gnoll's attack.agg#  You hit the gnoll. You freeze the gnoll.  The gnoll is heavily wounded.agg$G-9.4 (0.9agg0,agg/S _The gnoll closely misses you.agg,d M  You hit the gnoll. You freeze the gnoll.aggSm A) aggq )90.3agg"v aggVx I _You kill the gnoll!aggD agg E agg{I aggTK H _No target in view!agg{#. #. #......# #......# #......# .####......# .. agg.........).# ... ..#....)..# .... #....).@#....# .......)..........aggp<........################# agg'agg)]9=-aggU)1.3 (1.0 _agg1agg+:k _Items here: )) [ †.agg agg\ agg agg( aggm : _aggٜ ,agg{ agg agg0 L90=agg aggw 1 _HP restored.agg 3agg agg agg agg agg agg agg ,agg agg agg agg 9=agg agg aggy ,agg agg agg agg agg agg aggs agg  .O...# ..........# #.........# #..!......# .........# agg& #........+ #........# #.@......#- #......#.#aggX  #......#  agg #......# .####......# ...........).# ...agg O   two-headed ogre (wandering)agg #..#....)..# ....#..#....).)#....#agg E.........).........agg .1000.3 (9agg ,1.3 (10.0)agg agg* _A two-headed ogre comes into view. It is wielding two +0 giant clubs.agg  .......O...#  ..........#  #.........#  #..!......#  .........#  #........+  #........#  #.@......#  #......#.#  #......#  aggy #......# .  ####......# ..  .........).# ...  #..#....)..# ....  #..#....).)#....#  ) agg .......O...#  ..........#  #.........#  #..!......#  .........#  #........+  #........# agg~b #.@......#  #......#.#  #......#  #......#  agg####......#  agg0.........).# ...  #..#....)..#  agg#..#....).)# agg*;)aggʝagg%aggΧaggf _A two-headed ogre is nearby!aggLr .......O...#  ..........#  #.........#  #..!......#  .........#  #........+  #........#  #.@......#  #......#.#  #......# aggr #......# .  ####......# ..  .........).# ...  #..#....)..# ....  #..#....).)#....#  ) aggb .......O...#  ..........#  #.........#  #..!......#  .........#  #........+  #........#  #.@......#  #......#.#  #......# agg= ( #......#  ####......#  .........).# ...  #..#....)..#  #..#....).)# )aggf4aggkaggf _A two-headed ogre is nearby!aggo[?25h[?0c  Search for what [Enter for "curare", or ? for help]? agg+ [?25l[?1cagg agg$agg42 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle) agg6 a - [carried] l - a +0 kite shield (worn) Results elsewhere ([,] to cycle)  b - [D:5] a +0 buckler (2 further duplicates)agg:agg<aggD*deadiverson the Carver.......O...#Human of the Shining One ****............#agg4EHealth: 90/90 ========================#.........#Magic: 11/11 ========================#..!......#AC: 16Str: 17aggE.........#EV: 13Int: 11#........+SH: 15Dex: 14#........#aggEXL: 11 Next: 18% Place: Dungeon:10#.@......#Noise: ---------  Time: 11001.3 (0.0)#......#.#agg8Fra) +4 falchion (freeze)#......#Throw: 23 darts (poison)#......# .aggZF####......# ...........).# ...aggFO   two-headed ogre (wandering)#..#....)..# ....#..#....).)#....#aggF.........)......... _Items here: )) [ †. _HP restored. aggF_A two-headed ogre comes into view. It is wielding two +0 giant clubs. _A two-headed ogre is nearby! aggG_A two-headed ogre is nearby!Search for what [Enter for "curare", or ? for help]? shieldaggVagg#Wagg`agg|d. _agg#4aggGagg~F _Unknown command.agg i ((((((aggh 8(You throw a poisoned dart.agg y  The poisoned dart barely misses the two-headed ogre.agg O......O==2.4 (1.12agg< agg ; _The two-headed ogre shouts in stereo!aggy ((((((poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.agg,agg`8(O.....agg9a--3.51aggCaggG6 _The two-headed ogre is poisoned.agg  ((((very poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.  The two-headed ogre looks even sicker.aggߘagg q(O....aggs--4.60agg.aggU= _The two-headed ogre is lightly wounded.aggM((( _The two-headed ogre is lightly wounded.  You throw a poisoned dartagg,c.  The poisoned dart hits the two-headed ogre.  The two-headed ogre looks even sicker.aggagg)h(O..agg+Y5.719agg6agg;= _The two-headed ogre is lightly wounded.aggG((You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.  The two-headed ogre looks even sicker. _The two-headed ogre is lightly wounded.  You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.agg4agg b(O.agg-X6.88aggaggM= _The two-headed ogre is lightly wounded.aggJ (extremely poisoned)You throw a poisoned dart.poisoned dart hits the two-headed ogre.  looks as sick as possible!agg4 agg Y(Oagg Q7.97agg agg = _The two-headed ogre is lightly wounded.aggP  You hit the two-headed ogre. You freeze the two-headed ogre.  The two-headed ogre is lightly wounded.aggQ5=8.8 (0.9agg baggf _The two-headed ogre closely misses you. You block the two-headed ogre's attack.aggt5  You hit the two-headed ogre but do no damage.9.6 (0.8agg=aggA= _The two-headed ogre is lightly wounded.aggB verThe two-headed ogre closely misses you. You block the two-headed ogre's attack.You hit the two-headed ogre but do no damage. _ You hit the two-headed ogre. You freeze the two-headed ogre.  The two-headed ogre is moderately wounded.  The two-headed ogre closely misses you.agg :73-----aggB 0==10.5 (0.9aggm* agg. H _The two-headed ogre hits you with a +0 giant club!aggY ]M_The two-headed ogre hits you with a +0 giant club!  You hit the two-headed ogre. You freeze the two-headed ogre.  The two-headed ogre is heavily wounded.The two-headed ogre closely misses you.agg agg l1--------1.5 (1.0agg agg H _The two-headed ogre hits you with a +0 giant club.aggS  You slash the two-headed ogre! You freeze the two-headed ogre.agg..#'###....# ##......@..#.#..# ####102.2 (13.0)###########.....  #..# #..# .. . ...... ####### agg 5agg~5,3.2 (14aggF<agg?9 _Found an escape hatch in the floor.aggaggxagg)aggvaggo,agg7aggaggagg2aggaggagg',aggaggaggF,aggaggaggagg!aggagg,aggaggQI _D - 3 scrolls of identify (gained 1)agg agg- agg aggBaggaggUagg5,aggagg!agg&,aggY(agg*agg/agg/aggp1agg3aggk7Bagg=aggA,aggsCagg9FaggJ,agg{Lagg_PP  There is an escape hatch in the floor here.aggSaggcT _aggUaggXagg ],agg^agg"eaggiagg7jagglaggnagg*r,aggsaggZw@  There is an open door here.agg{aggQ| _agg~aggcagg{aggąaggagg aggnBaggaggaggaggaggagg,aggagg:Xagg!agg,aggaggaggV,aggaggaggaggagg,aggVaggG,aggagg\aggBaggagg%,aggaggagg',aggagg#aggaggaggaggKaggaggaggxagg agg,aggaggtagg:,aggaggagg,aggaggagg agg agg agg aggv ,agg agg agg/ ,agg agg agg ,agg agg $ aggn( ,agg * agg, agg0 agg0 agg02 agg4 aggg: ,agg; aggEA ,agg]B aggG N _You now have 323 gold pieces (gained 22).agg K aggK aggL aggkO aggS agg#T aggU aggX agg[ agg\ aggc] agg5h   # ... #  #.. .. #  .# ####### aggh m###.# #.....#  #.....### #####'#  #.....#.#####...  #.#...#.#...#..[aggh   #.....#.##..#.#aggi   #@....#.##..#..[agg8i  aggYi  #.....#.....#.... aggi  #.....#..>..#'###. aggi  #.###.#.........#.aggi  aggj  #.....###########. agg"j  #................ aggj d  #......##......##.   #...#..##..##..##. aggj O  #.................aggj E aggt -50.2 (47aggu ,1.2 (48agg#} aggȀ a _H - a scroll labelled RAWNEV LACAagg2 agg aggV agg aggS agg agg ,agg agg1 agg agg aggr agg aggT aggD agg   #.. <.#  agg  #..##.###  ........ #. #....... ####. #...... #agg  #.. ..# #######...#agg5 c #.###.# #.....#.#.# #....@### #####'#...#4.2 (3aggX .0) #.....#.#####........#agg  #.#...#.#...#..[..##.#agg 8 #.....#.##..#.##.....# #.....#.##..#..[.....#agg k #.....#.....#........#agg  #.....#..>..#'###....#agg  #.###.#.........#.#..# #.....###########agg agg` +5.2 (4agg agg< 9 _Found a stone staircase leading up.agg\-3agg-agg/aggq1agg5Bagg76,agg6agg8agg$:,agg:agg;agg^=,agg=agg?aggcF T. ...#  #..#..#  #.....# . #.. <.# .. #..##.#####... #aggF7............ #......... ####........... #........############..###.# #.....#.#aggG.....### #####'##.....#.####T   troll (asleep)#.#...#.#...#..[..##.#aggWG#.....#.##..#.##.....#.##..#..[.....#aggLp 9  A troll comes into view.aggQs.TTaggMR5==60.2 (5aggXagg]' _The troll shouts!aggO ...# .T.# #..#..# #.....# .  #.. <.# ..  #..##.#####...  #.............  #....@........  #.............  #.....####### #.###.#  #.....###  #.....# #.#...#[aggP< #.....# [agg ...# .T.# #..#..# #.....# . agg$~ #.. <.# ..  #..##.#####...  #.............  #....@........ agg #.............  #.....####### #.###.#  #.....###  #.....# #.#...#[ #.....#aggT [aggqaggaggagg\ _A troll is nearby!agg=J ...# .T.# #..#..# #.....# .  #.. <.# ..  #..##.#####...  #............. aggJ #....@........  #.............  #.....####### #.###.#  #.....###  #.....# #.#...#[ #.....# [agg ...# .T.# #..#..# #.....# .  #.. <.# ..  #..##.#####...  #............. agg5 #....@........  #.............  #.....####### #.###.#  #.....###  #.....#agg_ #.#...#[ #.....#aggT [aggaggaggagg\ _A troll is nearby!agg/ (((((((You throw a poisoned dart.aggX agg` y..T....agg|a f--1.3 (1.12aggi aggNm ` _The poisoned dart barely misses the troll.agg} (((((poisoned)You throw a poisoned dart. The poisoned dart hits the troll.agg agg (T...agg s--2.41agg agg , _The troll is poisoned.agg (((very poisoned)You throw a poisoned dart. The poisoned dart hits the troll.aggaggRz(T..aggX3.50aggNagg2 _The troll looks even sicker.aggI ((You throw a poisoned dart. The poisoned dart hits the troll.aggagg%(T.4.7 (1.219aggagg2 _The troll looks even sicker.aggӨ(extremely poisoned)looks even sicker.  as sick as possible!aggL-agg6Z(Taggr7]5.8 (1.18agg>aggA3 _The troll is lightly wounded.aggO$  You slash the troll! You freeze the troll.  The troll is moderately wounded.aggl%5=6.7 (0.9agg-agg/6 _You block the troll's attack. x3agg a  You hit the troll. You freeze the troll.  The troll is heavily wounded.The troll closely misses you. The troll barely misses you.7.6aggB agg 3 _You block the troll's attack.agg# verYou hit the troll. You freeze the troll.  The troll is severely wounded.agg$ f82---=8.4 (0.8agg(* agg- K _The troll bites you! You block the troll's attack. x2aggBo  You slash the troll! You freeze the troll.  The troll is almost dead.agg&wo.agg|6319.4 (1.0aggÃaggI _You kill the troll!aggaggaggz agg/H _No target in view!agg(agg)agg *agg-agg2: _aggW2agg2#3agg24=--agg}3aggI7,agg8agg3;,agg5<agg>agg>#4agg?2=agg?agg#Bagg`BaggCaggJF,aggFagg^HaggH5aggHaggK,aggyLagg9N,aggNagg=PaggfP%6aggPaggDR,aggSaggUaggUaggVaggYagg[YaggYD7=agg9Zagg],aggb^agg`agg aagg8aN8=aggbaggd,agg@eagg h,agghagg3kaggxk%9agglaggTn,aggnagg pagg6paggpagg r:90agg?r(=aggraggtaggw,agg^xagg'zagg|,aggL}aggaggagg aggo _f - 19 poisoned darts (gained 1)aggagg9=aggagg,aggɉaggo _f - 20 poisoned darts (gained 1)aggaggKaggҏagg',agg aggo _f - 21 poisoned darts (gained 1)aggxaggҙagg9agg,aggaggIo _f - 22 poisoned darts (gained 1)agg3aggeaggKagg,aggaggi,aggaggo _f - 23 poisoned darts (gained 1)agg3agg?aggCagg,agg>aggܲaggX,aggagggagg,aggraggd   #. .#  #. ..#  #. ..#  #. ...# agg  #.##..#   #.....#    #.?...#    #.@.#.# aggʼR--  #.....#   #.....+ agge23  #.###.#  #.....#agg"  #.....#  #..#..#  #.....# agg  #...<.# ..agg*78 M  .. . .##agg....#..#...#  #.....+.....#.agg1207.4 (38.0)aggG--8.4 (39aggagg/x  x - 2 scrolls of teleportation (gained 1)agg,9.4 (40aggeaggR _You see here a staff of air.aggaggagg]aggZaggaggagg,agg,aggaggagg*,aggaggoaggwaggaggaggagg$ agg~ #>##..# #.....#  #.....#  #.....# aggB1 #.....#  #.....#  #.##..# aggn #...@.# 13.0)agg #.....#  #.##..#  #.....# #.|...# ..aggG #...#.# # #.....# #.....+ #.###.#agg(A4.4 (5aggaggi; _Found a stone staircase leading down.agg. agg agg agg agg agg Bagg agg agg agg0 aggb ,agga aggR agg| ,agg' agg0 agg ,agg agg agg ,agg agg agg ,aggV agg agg` ,aggR agg agg agg2 agg agg$ agg agg3 agg agg aggV ,agg aggk agg ,agg aggt agg7 ,agg agg agg agg agg agg_# ,agg# agg(&  aggN& H_You now have 338 gold pieces (gained 15).agg) 3agg+ agg- agg+1 aggx1 aggK2 agg4 aggu8 agg8 agg9 agg< aggs? agg@ agg@ agg C agg1F aggsF aggVG aggK ,agg_L aggpP n _g - 3 scrolls of vulnerability (gained 1)aggbT aggT aggyU agg/X agg#[ agg[ agg\ agg?_ aggb agg,c aggfd agg. ..##agg}agg6!+2.4 (1agg@$agg& agg&5_Found a stone staircase leading down.aggaggaggaggaggaggBBagg%agg|aggaggagg,aggaggaggaggaggagg,aggagg_f _v - 2 scrolls of noise (gained 1)agg 3agg+aggagg,aggagg7 _You open the door.agg3aggaggG @  There is an open door here.agg aggi  _agg agg aggR,agg!aggagg,aggaggEagg,aggagg[agg ,agg agg "agg#,agg.$agg%agg',agg['aggs(agg*,agg+agg|.agg/aggz0aggd1aggs2aggg4,agg4agg56agg8,agg~8agg:agg<,agg=agg>agg=A,aggIBagg}Dagg9G,agg>HaggJaggMaggNaggVPaggS@  There is an open door here.aggFXaggX _agg\Zagg\agg|`,aggeaaggcaggEg,agghaggjagglagglaggnaggpaggtaggtaggKvaggzagg}~aggXaggeaggaggagg-aggaggaggagg@aggaggwagg=,agg)aggagg,agg/aggaggaggǫaggaggLagg:,aggagg3agg˾,aggNaggpaggaggaggaggyaggagg#aggaggaggaggagg"aggagg[aggaggagg<agglaggaggagg<agg=,aggaggaggaggaggaggagg,aggsaggFaggy ,agg aggaggaggaggagg{aggaggaggagg2 agg#agg$agg%aggD(agg+,agg,aggV/agga2agg2agg3agg7agg:agg:agg;agg=aggA,aggBaggEaggwH,aggIagghLaggO,aggPaggS7 _You open the door.aggJV3aggUWaggh[@  There is an open door here.aggi^agg^ _aggu_aggbagge,aggfagghagg]k,agg)lagg%naggrpaggpagg^qagg'sagguagg(vaggvagg yagg"{,agg{aggYou open the door. _There is an open door here. _You open the door. _There is an open door here. _You open the door.aggdaggagg‚aggچThere is an open door here. _You open the door. _There is an open door here. _You open the door.  There is an open door here.aggaagg _aggaggagg,,agg@aggagg,aggΖaggyagg,aggaggagg.'.....#.#.# °.°°°#.#.....#.#.# ####.###.....#.#.+ .....###.....#.#.# ########.....'.#.# #####.##.....#.#.# # ..#......#...# ##+#########+#...# .............@# 318.4 (66.0)###...##..#..##....# .............. ...#.# .....#####+###.. ......# ... ..( ........# .ggl3m#.. .......# ..... #.....# ###........+aggagg~,9.4 (67aggagg _You open the door. _There is an open door here. _You open the door. _There is an open door here. _Found 4 darts of dispersalaggaggaggaggߥagg°.°°°#.# ####.###.....#.#.+ .....###.....#.#.# ########.....'.##.....#aggxM ..#...#+#########+#.. .................#######...##..#..##@...#.................######+###.....agg ......(#..........#K   kobold demonologist (asleep)###...++ ..K#aggZ8)#agg0.0)20.4 (1 _A kobold demonologist comes into view. It is wielding a +0 dagger.agg ..#.#.+.#.#.#'.#.##.#.# # #...####+#...#........#### #@...# .........#.# ####+###.....  ......(  .#.....  ......#  ###...+  ..K# .)agg agg..#.#.+.#.#.#'.#.##.#.# #...####+#...#........#### #@...# .........#.# agg0g####+###.....  ......( .#..... ......#  ###...+ ..K#)aggNaggAaggaggj _A kobold demonologist is nearby!agg# (((((Kpoisoned)agg$(You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.  The kobold demonologist is poisoned.aggط ......KThe kobold demonologist shouts!aggaggIaggJf==1.5 (1.12aggQaggUk _The kobold demonologist miscasts a cantrip.aggoN (((((((You throw a poisoned dart.agg^agg{......Kagga--2.61agg<agg\o _The poisoned dart closely misses the kobold demonologist.agg)  (((((very poisoned)You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.  The kobold demonologist looks even sicker.aggX aggh ....K(aggli s--3.70aggq aggs A _The kobold demonologist is lightly wounded.agg,H ((((You throw a poisoned dart.  The poisoned dart hits the kobold demonologist.agg? G...K(4.819 _The kobold demonologist is lightly wounded.agg4 ((((You throw a poisoned dart.agg"= .5.K5   quasit (summoned)  The poisoned dart closely misses the kobold demonologist.agg"X5.98agg,aggX1s _The kobold demonologist mumbles some strange words.agg (oned, poisoned)  You throw a poisoned dart. The poisoned dart hits the quasit.aggagg8agg5(K.aggX7.07aggagg\- _The quasit is poisoned.aggwb  You throw a poisoned dart. The poisoned dart hits the quasit.agg'1agg= K. The quasit is lightly wounded.  The quasit bites you but does no damage.agg>`=8.16aggHaggKs _You block the quasit's attack. The quasit closely misses you.aggz ((((You throw a poisoned dart.  The poisoned dart barely misses the quasit.agg   The poisoned dart barely misses the quasit.The poisoned dart barely misses the kobold demonologist.  x3  The kobold demonologist gestures wildly while chanting.quasit closely misses you. The quasit barely misses you.agg75K.55 , expiring, poisoned)5   white imp (summoned)5   ufetubus (summoned).9.25  --more--agg%< _The quasit claws you but does no damage.aggMK####.##+ ......#.#.# #####.'.# ..#..#+#########+# .................#######...##..#..##...................@5#.######+###K(.5... ...5..(#.5......(.####..(++ ..(#)# ..aggL'5   crimson imp (summoned, wandering).5   white imp (summoned)(…)aggZ4The crimson imp shouts!aggU[agg_XThe quasit disappears in a puff of smoke!aggr§55..5   crimson imp (summoned)5   white imp (summoned)5   ufetubus (summoned)The white imp disappears for a moment.agg{aggagg' A(.5   white imp (summoned)5   ufetubusaggO 6==300aggagg _The kobold demonologist begins to cast a cantrip, but forgets the words!agg5/ cYou slash the kobold demonologist! You freeze the kobold demonologist.agg: a5. agg; 5-1.0 (0.8aggF aggJ l _The kobold demonologist is severely wounded.aggti  You hit the kobold demonologist. You freeze the kobold demonologist.agg{  The kobold demonologist is severely wounded.agg  The white imp shouts, "Escape, thou peaked full-gorged haggard!"agg 555.5   crimson imp (summoned)5   white imp (summoned)5   ufetubus (summoned)The kobold demonologist barely misses you.The ufetubus slips past you! The ufetubus barely misses you.aggT--9 (0.9aggaggX6 _You block the ufetubus's attack.agg~!  You hit the kobold demonologist. You freeze the kobold demonologist.  The kobold demonologist is severely wounded.The kobold demonologist closely misses you.agg  55.The white imp shouts, "Crawl home, thou villainous motley-minded haggard!"aggU B-2.8aggagg9 _You block the ufetubus's attack. x2aggk  You closely miss the kobold demonologist.The kobold demonologist is severely wounded.You block the ufetubus's attack. x2; The white imp misses you.aggѵp(5 agg_(3.7aggaggA _You block the kobold demonologist's attack.agg} You block the ufetubus's attack. x2; The white imp misses you.kobold demonologist's attack.  You hit the kobold demonologist. You freeze the kobold demonologist.almost dead.The ufetubus  white impagg} agg U5.agg (4.6aggb aggG J _The kobold demonologist hits you but does no damage.aggY  You hit the kobold demonologist. You freeze the kobold demonologist.  You kill the kobold demonologist!The Shining One accepts your kill.aggUp  The ufetubus disappears in a puff of smoke!aggdq  The white imp disappears in a puff of smoke!aggҮaggn§@§)§agg 55.4 (0.8 _The crimson imp disappears in a puff of smoke!aggaggsagg/  --more--aggP h _Your Armour skill increases to level 5!agg.###.....#.#.+ .###.....#.#.# .....'.#.# .##.....#.#.#  ..#......#...# +###+#...# .......#### ###...##..#..##....# §.@#.# #####+###)§.# agg#......(.# #.#.# #....(.## ####..(++ ..(# )......# ...##aggh§(§§agg<-6.4 (1.0 _agg\aggP....aggu-7.4 (26aggaggX _f - 16 poisoned darts (gained 1)aggi aggk deadiverson the Carver (Human Fighter) Turns: 11168, Time: 00:21:05 Health: 90/90AC: 17 Str: 17 XL: 11 Next: 35% Magic: 11/11EV: 13 Int: 11 God: the Shining One [****..] Gold: 338SH: 15 Dex: 14 Spells: 10/10 levels left rFire . . .aggSl a - +4 falchion (freeze) rCold + . . l - +0 kite shield rNeg + + . c - quicksilver dragon scales of the Indigo Skies {rC+ WillrPois .(no helmet) rElec .w - +2 cloak {Stlth+} rCorr .(no gloves) SInv .aggl A - +0 pair of boots Will +....d - amulet of faith Stlth +p - +5 ring of evasion HPRegen 0.35/turn (no ring) MPRegen 0.12/turn %: faith @: glowing A: explore regen, iridescent scales 1, large bone plates 1, inability to drink after injury 1aggaggo###.###.....#.#.+deadiverson the Carver ....###.....#.#.#Human of the Shining One ****.. #######.....'.#.#Health: 90/90 ======================== ####.##.....#.#.#aggMagic: 11/11 ========================..#......#...#AC: 17Str: 17 #+#########+#...#EV: 13Int: 11 ................####SH: 15Dex: 14 ###...##..#..##....#XL: 11 Next: 35% Place: Dungeon:10 ................@#.#agg"Noise: ---------  Time: 11337.4 (0.0) .......#####+###)(......a) +4 falchion (freeze) .......##......(.Throw: 16 darts (poison) .......##.#...... .......##....(.## .......#####..(+ .......+..(# )......#...# .......# _Your Armour skill increases to level 5! _f - 16 poisoned darts (gained 1)aggagg%agg&agg...###.....#.#.# ######.....'.#.# .##.....#.#.#  ..#......#...# +#########+#...# ...............#### ##...##..#..##....# ................#.###########+###)@.......agg# #......(.## #.#......# #....(.#### ####..(++  ..(## ...aggb# #.#aggvagg+8.4 (1aggagg<agg+9.4 (2agg 07aggaggJX _f - 17 poisoned darts (gained 1)aggcL#####.....'.#.# .##.....#.#.#  ..#......#...# #########+#...# ..............#### #...##..#..##....# ...............#.######.#####+###).........agg}# #..@...(.# # #.#........# #....(.##### ####..(++  ..(## ...# # agg&agg9,40.4 (1aggraggaggP .##.....#.#.# ..#......#...# ########+#...# .............######..#..##....# # ..............#.######..#####+###).........# #......(.## #.#.@.......# #....(.##### ####..(+ aggP +  #..(## #...## #...##.# #...##.# ....## .agg>[ agg^ &1agga aggUc aggi .#......#...# #######+#...# ............######..#..##....# ##..........#.######...#####+###)..........# #......(.#..## #.#.........## #....@.####. # ####..(+ +  #..(# # #...# ##.# ....## .agg q# ..agg agg &2agg agg agg [3.4 (28aggi agg" X _f - 18 poisoned darts (gained 1)agg######+#...# ...........####.##..#..##....# .##..........#.######... #####+###)........... # #......(.#..# # #.#.........# # agg#......####. # ####..@+ +  #..(# # #...# ##.# ....# # ......# # .. .#..... # ...agg agg +4.4 (1aggagggagg+5.4 (2agg5121agg# agg"X _f - 21 poisoned darts (gained 3)agg| ...........####. .##..#..##.....## ............#.######...#####+###)......... #......(.#..##.#.......#......####. ####...+ + #..@##agg}.....#....#.. # ....aggaggB+6.4 (1agg`agg1agg[7.4 (23aggVaggEX _f - 23 poisoned darts (gained 2)agg8aggaggagg'agg ,agg%agg'agg+,agg*-agg27 _You open the door.agg;Iagg7B@  There is an open door here.aggZCaggC _aggEaggsGaggJ,aggpLagg1Nagg Q,aggQaggUaggX,aggYagg\agg],agg^aggvaaggd,aggeagggaggi,agg%jagglaggm,aggonaggqaggmtBaggJvaggx,aggyaggq{aggv},agg}agg7 _You open the door.agg3aggШ  There is an open door here. _agg #...#..####    #...#.....# ..   #...#.....# ..   #...#..##.# ..   ....#..##.######.#  ...#####......#.# #  #....... #......#.#.#  .#.....###'####...#  #........@...###  #.....##.........  #.............#.o  ..................<  ###################    oagg   orc (asleep)      aggǷ 60.0)  An orc comes into view. It is wielding a +0 dagger.aggm,8.4 (21aggվagg+; _Found an escape hatch in the ceiling.agg#((((((opoisoned)aggaggaggv_ .....o.oo 2 orcs (1 wandering, 1 poisoned)You throw a poisoned dart. The poisoned dart hits the orc. The orc is poisoned.aggRa9.5 (1.1)2aggagg[q _An orc comes into view. It is wielding a +0 whip.agg׭F(((((agg5_  You throw a poisoned dart. The poisoned dart hits the orc.agg7aggB....o(oaggCb==70.61aggKaggO8 _The orc shouts! You hear a bellow!aggI (((( very poisoned)You throw a poisoned dart. The poisoned dart hits the orc.agg aggg agg `...oo(agg a--1.70agg aggK 0 _The orc looks even sicker.aggp (((You throw a poisoned dart. The poisoned dart hits the orc.aggd agg9h ?  The orc looks even sicker.agg!j agg9k aggv 1 ..oo((ooo   orc warrior (missile, wandering)o   orc priest (wandering)oo 2 orcs (1 very poisoned)An orc warrior comes into view. It is wielding a +0 scimitar.aggv t--2.819agg agg$ y _An orc priest comes into view. It is wielding a +0 flail.aggrjO (((aggj8(You throw a poisoned dart.aggm  The poisoned dart barely misses the orc.aggragg+S  The orc warrior shouts! The orc priest shouts!agg`aggGagg :.oo..((o.o(o)ooo 3 orcs (1 very poisoned)agg a==3.98aggaggb| _An orc comes into view. It is wielding a +2 dagger of venom.aggE ((1 poisoned, 1 very poisoned)You throw a poisoned dart.  The poisoned dart barely misses the orc.agg!agg&aggaggҤagg\oo((ooo.o   orc priestooo 3 orcs (1 poisoned, 1 very poisoned)agga--5.07agg޼aggJ _The poisoned dart hits the orc. The orc is poisoned.agguI  You hit the orc. You freeze the orc.aggaggPaggagg" ..oo( 2 orcs (1You kill the orc!The orc priest calls down the wrath of Beogh upon you.agg479---=-9 (0.9aggagg\' _Beogh smites you!agg I  You hit the orc. You freeze the orc.aggf agg$ )o.   orcYou kill the orc!agg- ?(((agg agg׼ y)..o(oaggc Y80---6.8agg agg J _The orc warrior throws a stone. You block the stone.aggC#...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# # #####......#.#.#  . #......#.#.#  #.....###'####...#  aggC#.........@.(###  #.....##.....o(o.#  #............o#.(.  .......<.  ######   agg D,   agg VaggM]8((aggagg agg.ooo((agg517.8 (1.0aggagg _The orc warrior throws a stone. You block the stone.  Things that are here: _a +0 whip; a +0 dagger; a +0 leather armouraggr 9 #...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# # .#####......#.#.# #. #......#.#.# .#.....###'####...#  #).(### agg!  #.....##....ooo(.#  #......(#.(.  .......<.  ######     agg7 agg6 agg} agg roo(oagg 5-8 _agg agg agg(B  #...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.# .#. #......#.#.# .#.....###'####...#  #.).(###agg_D   #.....##....oo((.#  #............o#.(.  .........<.  ########     aggLH aggI agg"P o(o(aggQ V2-9aggY agg[ aggȶb #...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.#  .#. #......#.#.# #....#.....###'####...#  #.).o### aggz #.....##....o(((.#  #...........o(#.(.  ...........<.  ###########     aggoaggcaggaggho(o.o.agg:'80agg7aggBagg #...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.#  .#. #......#.#.#  #....#.....###'####...#  #.)o(### agg- #.....##...o.(((.#  #..........o.(#.(.  ..................<. ###################agg aggaggaggko.o.aggaggg<1aggRagg]b _The orc priest miscasts a cantrip.agg9aggA  The orc priest calls down the wrath of Beogh upon you.aggPjo)o.agg.Q870---aggSQ2aggp_aggsd' _Beogh smites you!aggo{agg|aggd`o.o.agg ?((((aggw$'@..=3agg.agg3s _The orc warrior throws a stone. The stone closely misses you.agg aggi aggz aggE oooo..agg .-4agg agg aggK  You slash the orc! You freeze the orc.agg{agg )o.o  You kill the orc!agg8(agg[48)agg89f1---==5.7 (0.9aggbFaggHK\ _The orc warrior throws a stone. The stone hits you but does no damage.agg>#...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.#  .#. #......#.#.#  #....#.....###'####...#  #.o.).(###  agg9??#.....##o....(((.#  #............(#.(.  ..................<.  ###################     aggx? aggPG  You block the orc priest's attack.agggQd66--6.7 (1.0agg[aggqa _The orc warrior hits you with a +0 scimitar. _You see here a +2 dagger of venom.aggn  You hit the orc warrior but do no damage.aggxG-7.6 (0.9agg6agg\ _You block the orc priest's attack. You block the orc warrior's attack.aggoa  You hit the orc warrior. You freeze the orc warrior.  aggUThe orc warrior is lightly wounded.  The orc priest hits you but does no damage.aggV57-aggm!8.5aggv$agg'9 _You block the orc warrior's attack.agg  You hit the orc warrior but do no damage.The orc warrior is lightly wounded.aggb  The orc priest invokes the aid of Beogh against you.agg! 7  You easily resist.agg! -9.3 (0.8aggd+ agg0/ B _The orc warrior hits you but does no damage.agg0 e  You barely miss the orc warrior.agg1 )90.1aggL; agg ? 9 _The orc warrior is lightly wounded.agg  You barely miss the orc warrior.The orc warrior is lightly wounded.agg MY  Y   yakYou barely miss the orc warrior.You block the orc priest's attack.  A yak comes into view.agg@58=agg{&1.1 (1.0agg4aggQ _The orc warrior misses you.aggB  You hit the orc warrior. You freeze the orc warrior.  The orc warrior is moderately wounded.agg}hY. agg-2.0 (0.9aggagg _The orc priest barely misses you. The orc warrior barely misses you.aggŸ  You hit the orc warrior. You freeze the orc warrior.  The orc warrior is moderately wounded.aggFVY(agg&9agg)agg{ _You block the orc priest's attack. The orc warrior barely misses you.agg  You slash the orc warrior! You freeze the orc warrior.  The orc warrior is severely wounded.agg( Y. The orc priest barely misses you.aggW)`62--3.8agg3agg7B _The orc warrior hits you with a +0 scimitar.agg  You barely miss the orc warrior.The orc warrior is severely wounded.aggi agg> aggN Y.The orc priest miscasts a cantrip.aggO >3--aggO &4.6 (0.8agg[ agga_ 9 _You block the orc warrior's attack.agg6 n  You hit the orc warrior but do no damage.agg 9 s  The orc warrior is severely wounded.agg;L  Y...(Y.Y 2 yaks (1 wandering)You block the orc priest's attack.  A yak comes into view.aggL -5.5 (0.9agg`X agga\ Q _The orc warrior misses you.aggR  The yak bellows!  You hit the orc warrior but do no damage.The orc warrior is severely wounded.agg5a YYou hear a bellow!aggaggagg:% Y.The orc priest looks encouraged for a moment.agg%5=6.3 (0.8agg-agg1O _You block the orc warrior's attack.agg$9/  --more--agg0( ^ _A yak comes into view.agg6  #...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.#  .#agg . #......#.#.#  #....#.....###'####...#  #)oY).(###  #.....##o....(Y(.#  #............(#Y(. agg  ..................<. ################### Y   yakagg  agg agg Lo.agg g64=--7.3 (1.0agg agg ( _The yak moves out of view.agg9*  You slash the orc priest! You freeze the orc priest.==8.1 (0.8agg4 agg8 V _The orc priest is almost dead.aggasYou slash the orc priest! You freeze the orc priest.  You kill the orc priest!aggvagg>wagg؂o..Y -9.0 (0.9aggqaggX _The Shining One accepts your kill.aggY  You hit the orc warrior. You freeze the orc warrior.aggaggR Y.....Y(Y 2 yaks (1 wandering)The orc warrior is severely wounded.A yak comes into view.agg/[5=-aggt9agg agg9 _You block the orc warrior's attack.aggIY  You hit the orc warrior. You freeze the orc warrior.aggY Y(Y The orc warrior is almost dead.aggY/400.7 (0.8agg(haggn9 _You block the orc warrior's attack.aggn  You hit the orc warrior but do no damage.agg6 Y.  The orc warrior is almost dead.agg(1.5aggaggIQ _The orc warrior misses you.agg}c n  You hit the orc warrior but do no damage.aggLd aggl Y..YY 3 yaks (1 wandering)The orc warrior is almost dead.aggl (2.3aggv agg~ B _The orc warrior hits you but does no damage.agg_ q  The yak bellows!  You hit the orc warrior. You freeze the orc warrior.agg2 agg aggA Y).YYYY 4 yaksagg =6=3.2 (0.9agg" agg' _ _The orc warrior is almost dead.aggp  You barely miss the orc warrior.The orc warrior is almost dead.agg,q0-4.1agg|agg:9 _You block the orc warrior's attack.aggn  You hit the orc warrior but do no damage.aggoaggFagg , .)Y(Y...Y(The orc warrior is almost dead.aggP E-9 (0.8aggagg!9 _You block the orc warrior's attack.agg[  You slash the orc warrior! You freeze the orc warrior.aggИaggaggaggaggYY.Y..... agg=775.8 (0.9aggBaggO _You kill the orc warrior!agg aggagg'5YY.agg'(6.7agg2agg5s _You hit the yak but do no damage. You block the yak's attack.agg4 K  You slash the yak! You freeze the yak.agg agg agg )YThe yak is moderately wounded.aggf 5=7.5 (0.8agg agg 1 _You block the yak's attack.agg8  You barely miss the yak.The yak is moderately wounded.agg9 aggF NY.aggG e59--8.4 (0.9aggS aggW ( _The yak gores you!agga  You slash the yak! You freeze the yak.aggaggx. 3 yaksaggz-9.4 (1.0agg/agg$[ _The yak is heavily wounded.agg$agg/P.Yagg06-10.2 (0.8aggs9agg=W _You hit the yak but do no damage.agg֜I  You hit the yak. You freeze the yak.aggϝQ60=--agg!1.0aggBagg]1 _The yak is lightly wounded.agg  You hit the yak. You freeze the yak.  The yak is moderately wounded.aggaggPY##.agg+9 (0.9agg%agg(; _The yak gores you but does no damage.aggLJ  You hit the yak. You freeze the yak.  The yak is moderately wounded.agg `53--2.8agg- agg D _The yak gores you! You block the yak's attack.agg  You hit the yak. You freeze the yak.  The yak is heavily wounded.agg tYY 4 yaksagg (3.7aggI agg W _You block the yak's attack. The yak gores you but does no damage.agg-  You hit the yak but do no damage.The yak is heavily wounded.aggG.agg 7Y.. 3 yaksagg7>4--agg8&4.5 (0.8aggAaggwC1 _You block the yak's attack.aggZ  You hit the yak but do no damage.The yak is heavily wounded.aggtYY 4 yaksaggI35.4 (0.9agghaggD _The yak gores you. You block the yak's attack.aggۙ####...'..#  #...#..####  #...#.....# #.. #...#.....# #.. #...#..##.# #..  ....#..##.######.# # .....#####......#.#.#agg̚$ .#....... #......#.#.##....#.....###@####...#  #....Y.YY.).(###  #....Y##.....(((.# #......(#Y(. ..................<.###################aggaggaggbagg' agg4YYYY..The yak attacks as it pursues you! You block the yak's attack.agg-6.4 (1.0aggaggMl _The yak misses you. _There is an open door here.agg  b #......####.####...'..# agg  #...#..####  #...#.....# #.. #...#.....# #.. #...#..##.# #..  ....#..##.######.# # .....#####......#.#.#agg \ .#....... #.@....#.#.##....#.....###'####...#  #...YYYY..).(###  #.....##.....(((.#agg ` #......(#Y(. ..................<. 3agg[ z yaks###################agg6% agg% agg& agg0 jY.Y.agg-2 H4-7 agg2 _agg; agg> aggu+ aggB, agg- aggT. aggL8 lY.Y)agg9 5=8.3 (0.9aggA aggE W _You hit the yak but do no damage.aggg  You slash the yak! You freeze the yak.  The yak is moderately wounded.aggiD39.2aggsaggv aggv6_You block the yak's attack. The yak gores you.aggBa  You slash the yak! You freeze the yak.aggagg YY.The yak is heavily wounded.aggA4=agg20.2 (1.0aggKagg1 _You block the yak's attack.agg<  You hit the yak. You freeze the yak.  The yak is severely wounded.agg5-1.1 (0.9agg agg; _The yak gores you but does no damage.aggiz  You slash the yak! You freeze the yak.  The yak is almost dead.agg,{B-2.0aggaggV4 _You block the yak's attack. x2agg K  You slash the yak! You freeze the yak.agg . 2 yaksYou kill the yak!agg s47--9=8 (0.8aggk& agg( ( _The yak gores you!agg  You slash the yak! You freeze the yak.  The yak is almost dead.agg -3.8 (1.0agg agg# ; _The yak gores you but does no damage.agg#K  You slash the yak! You freeze the yak.aggP%,agg<-..   yakagg2>41-4.6 (0.8aggq:agg>G _You kill the yak!aggdl  You hit the yak. You freeze the yak.  The yak is lightly wounded.agg-p{YY 2 yaksagg8q`8---5.4aggyagga|P _The yak barely misses you.agg@  You hit the yak but do no damage.The yak is lightly wounded.agg.   yakagg-6.3 (0.9aggoaggT _The yak completely misses you.agg4  You hit the yak. You freeze the yak.  The yak is moderately wounded.agg?tYY 2 yaksagg;@-7.3 (1.0aggLagg$Q1 _You block the yak's attack.agg7 I  You hit the yak. You freeze the yak.agg/ ?Y'agg c9=8.2 (0.9agg agg [ _The yak is heavily wounded.agg I  You hit the yak. You freeze the yak.aggV( TY.agg( (9.1agg*1 agg4 \ _The yak is severely wounded.agg8  You hit the yak. You freeze the yak.  The yak is almost dead.agg )30.0agg޼agg_4 _You block the yak's attack. x2aggK  You slash the yak! You freeze the yak.agg †   yakYou kill the yak!agg ]50=49aggagg; _The yak gores you but does no damage.aggh  You slash the yak! You freeze the yak.  The yak is severely wounded.aggo5=1.7 (0.8agg?agg)P _The yak barely misses you.agg[?  You hit the yak. You freeze the yak.  The yak is severely wounded.agg<@0-2.5aggHaggMI _The yak misses you.aggL K  You slash the yak! You freeze the yak.aggAX F†agg\ 86=3.3aggKe aggXh G _You kill the yak!aggP' ####...'..#  #...#..#####...#.....# #..#...#.....# #.. #...#..##.# #.. agg7( ....#..##.######.# #.....#####......#.#.# .#....... #..†...#.#.# #....#.....###@####...#  #......)..).(####.....##.....(((.##............(#Y............<.agg( d################### agg72 agg2 B1--agg#3 4.3 (1.0aggb: agg>  There is an open door, spattered with blood here. _You see here a yak corpse.aggN{ #...#..#####...#.....# #..#...#.....# #.. #...#..##.# #.. ....#..##.######.# #.....#####......#.#.# .#....... #..†...#.#.#  #....#.....###†####...#  #.....@)..).(####.....##.....(((.##............(#Y(. ..........aggH..<.################### aggaggH--5 _agg]aggݦagg"#...#..####  #...#.....# #..  #...#.....# #..  #...#..##.# #..  ....#..##.######.# #  .....#####......#.#.#  .#. #..†...#.#.#  #....#.....###†####...#  agg5$#...).(###  #.....##.....(((.#  #............(#Y(.  ..................<.  ###################          aggE/agg.0&6agg>8agg> _Items here: ( ))) [ ††.aggojaggmPick up what? 35/52 slots (_ for help) Hand Weapons (select all with ))  a - a +2 dagger of venomb - a +0 flail  c - a +0 scimitar Missiles (select all with ()d - 2 stones Armour (select all with [)e - a +0 plate armour Carrion an orc corpse aggman orc corpse [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]agg  c + a +0 scimitar[Enter] accept (1 chosen)aggw aggAf #...#..####  deadiverson the Carver#...#.....# #..  Human of the Shining One ****..#...#.....# #..  Health: 51/90 =============-----------#...#..##.# #..  Magic: 11/11 ========================....#..##.######.# #  AC: 17Str: 17.....#####......#.#.#  EV: 13Int: 11  .#....... #..†...#.#.#  SH: 15aggDex: 14 #....#.....###†####...#  XL: 11 Next: 46% Place: Dungeon:10#......@..).(###  Noise: ---------  Time: 11436.3 (0.0)#.....##.....(((.#   a) +4 falchion (freeze)#............(#Y(.   Throw: 17 darts (poison)..................<.  ###################          _The yak misses you.You slash the yak! You freeze the yak. _You kill the yak!There is an open daggDoor, spattered with blood here. _You see here a yak corpse. _Items here: ( ))) [ ††.aggaggG27.3 (1aggaggm' _J - a +0 scimitaraggaggB<Read which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportationD - 3 scrolls of identify agg" H - a scroll labelled RAWNEV LACA [!] read|quaff|evoke[?] describe selectedagg agg[ #...#..####  deadiverson the Carver#...#.....# #..  Human of the Shining One ****..#...#.....# #..  Health: 52/90 =============-----------#...#..##.# #..agg7  Magic: 11/11 ========================....#..##.######.# #  AC: 17Str: 17.....#####......#.#.#  EV: 13Int: 11  .#....... #..†...#.#.#  SH: 15Dex: 14 agg#....#.....###†####...#  XL: 11 Next: 46% Place: Dungeon:10#......@..).(###  Noise: ---------  Time: 11437.3 (0.0)#.....##.....(((.#   a) +4 falchion (freeze)agg6I#............(#Y(.   Throw: 17 darts (poison)..................<.  agggx###################    agg     aggYou slash the yak! You freeze the yak. _You kill the yak!There is an open door, spattered with blood here. _You see here a yak corpse. _Items here: ( ))) [ ††. _J - a +0 scimitaragg  As you read the scroll labelled RAWNEV LACA, it crumbles to dust.  It is a scroll of enchant armour.agg/  --more--agg8 agg: Enchant which item? Inventory Items Armour  l - a +0 kite shield (worn) aggU:  A - a +0 pair of boots (worn) Floor Items ([,] to select) Armouragg: va +0 plate armour[?] describe selectedagg2agg}aggN #...#..####  deadiverson the Carver#...#.....# #..  Human of the Shining One ****..#...#.....# #..  Health: 52/90 =============-----------#...#..##.# #..  Magic: 11/11 ========================....#..##.######.# #  AC: 17Str: 17.....#####......#.#.#  EV: 13aggl4Int: 11  .#....... #..†...#.#.#  SH: 15Dex: 14 #....#.....###†####...#  XL: 11 Next: 46% Place: Dungeon:10#......@..).(###agg  Noise: ---------  Time: 11437.3 (0.0)aggϾ#.....##.....(((.#   a) +4 falchion (freeze)#............(#Y(.   Throw: 17 darts (poison)agg9O..................<.  ###################    aggk     aggThere is an open door, spattered with blood here. _You see here a yak corpse. _Items here: ( ))) [ ††. agg_J - a +0 scimitar  As you read the scroll labelled RAWNEV LACA, it crumbles to dust.  It is a scroll of enchant armour.aggagg368.3 (1aggY _Your +0 kite shield glows green for a moment.agg agg- aggaggaggaggaggaggkS3=aggaggaggaggagg"agg6#K4=agg$agg',agg)agg-,agg0agg2O5agg3agg7,agg/9aggG;,agg;agg=agg,>96agg>aggdaggf;2agg-gagg)iaggQiaggjaggn,aggoaggraggrD3=aggsagg v,aggJwaggz,agg{aggaggU4=aggaggaggׇaggagg{,aggaggӐ;5aggagg,agg^agg,aggaggaggM%6aggjaggB,aggaggI,aggĢagga7=aggaggШ,agg)agg,aggUaggzk8=agg<aggr,agg.agg8aggs%9agg/aggaggкaggpaggǾ,aggݿaggagg'L90=aggaggDagge,aggaggPagga,agg.agg%agg,aggaggm  Things that are here:  a +0 whip; a +0 dagger; a +0 leather armouraggnagg@= _aggaggagg,aggagg,aggaggo _f - 18 poisoned darts (gained 1)agg3agg-agg,agg+agg/o _f - 19 poisoned darts (gained 1)agg3agg^agg,agg0agg!o _f - 20 poisoned darts (gained 1)agg3agg7agg ,agg3 agg o _f - 21 poisoned darts (gained 1)aggV3aggagg,agg3aggo _f - 22 poisoned darts (gained 1)aggE3aggagg*aggBaggkagg:aggaggoaggagg1agg0aggoagg agg:#o _f - 23 poisoned darts (gained 1)agg$3aggl%agg'aggU(,agg(agg)aggi,,agg'-agg.aggH/,agg/aggu0agg}1,agg1aggs2agg3,agg3agg4agg5,agg5agg8agg&:,agg:agg6<aggK=,agg=agg+>agg ?,agga?agg@agg@,agg AaggAaggB,aggCagg~Dagg:F,aggFaggGaggJ,aggJaggLaggM,agg-NaggNaggO,agg PaggPaggRaggLRaggRaggSaggIV,aggVagg#XaggY,aggKZagg[agg\,agg\agg]agg`^,agg^aggt_aggW`,agg`aggIaaggb,aggWbaggvcagg.e,aggeaggfaggh,aggLiaggpjaggTl,agglaggSmaggDn,aggnagg1oaggyp,aggpaggqaggr,aggtsagg!uagg}w,aggxaggtyagg\{,agg{agg|agg},agg-~agg(aggJ,aggaggsagg,aggDaggcagg̅aggagg@aggFaggt,aggƈaggEagg,agg&aggRagg ,aggagg[aggOaggaggagg)w ...   #. ...   #. #....#   agg># #. #....#   #.#. #.##.#   #.#. #.##.#   aggY#...###....#   #..........#  aggݠ< #...@#.....#   #....#.....#  agg #.......##.#  23agg! #...###.##.#  aggC #... #.##.#  aggk#.#. #.##.#  aggC#.#. #.##.#  .#.#. #.##.#  .##aggѡ`#.##.#  agg֧260264.0)aggި,35aggaggj/ _H - a scroll of summoningagg agg agg agg agg ,aggջ Xagg@ ,agg ,aggp aggx agg ,agg\ agg agg) ,aggq agg agg ,agg agg agg ,agg agg agg ,agg agg agg ,agg aggu aggX ,agg agg} agg agg agg@ agg& agg ,aggX agg aggO Baggr agg5 ,agg aggE aggr ,agg agg1 aggI agg ,agg agg ,agg agg agg agg8 agg6 ,agg agg@ agg agg agg4 ,agg aggt agg ,agg agg) aggk agg aggB agg aggN ,agg ,agg XaggD Bagg Bagg3 aggN agg ,agg; agg agg agg$ agg agg aggF agg agg agg[! agg" agg" agg,# agg$ agg% ,aggi% aggR& agg0( aggb( agg) agg* agg1 v#.#.# #.##.# ##. #.#.# #.##.# .# .## #...# #.##.# .######... #...# #.##.# .......... #...# #.# ....(.#..# #...# #.# .........# #...# #.# ....####. #...# #.# #...'..# #@..# #.# 35.3 (32.0) agg2 #...#..#####..∩....# #.# #...#.....##.#.#...# #.# #...#.....# ...#...# .##.# #...#..##.##.. #...# #.##.# ....#..##.######.#.# #.##.# ....#####......#.#.# #.##.# ....... #..†...#.#.# #.##.# ..#.....###†####...# #.##.# aggk7 agg7 ,6.3 (33agg< agg> 0 _Found Cumium's Distillery.agg( agg* 3aggq, agg5  ##.. ..##..#####.............# agg)6 (.#..# # #......# #> #.####. #. #. agg6 #...'..# ###.##..#####..∩.0.0)...##.#.# ...#.#.agg/7 r####.#. #...##......(..)..###.##.#   agg@ aggjA +7.3 (1aggG aggI ; _Found a stone staircase leading down.aggU`o# . #.#.# #.##.# .# .## #...#...# #.##.# #.######... #...#...# #.##.# . +...#...# #.# .(.#..# #...#...# #.# #.# #>..#...# #.# .####. #..#...# #.# #...'..# ###.#...# #.# agg` #...#..#####..∩@...# #.#  #...#.....##.#.#...# #.#  #...#.....# ...#...# .##.#  #...#..##.##...#...# #.##.#  ....#..##.######.#.# #.##.# .#####......#.#.# #.##.# agga#. #..†...#.#.# #.##.# .#.....###†####...# #.##.#  #......(..)..###.##.# agg^jaggj&8aggZoaggqaggߘ# . #.#.# #.##.# .# .## #...#...# #.##.# .#.######... #...#...# #.##.# ). +...#...# #.# agg-.(.#..# #...#...# #.# .#.# #>..#...# #.# aggU.####. #..#...# #.# #...'..# ###.#...# #.#  agg #...#..#####..@....# #.#  agg #...#.....##.#.#...# #.#  aggߙ #...#.....##...#...# .##.#  #...#..##.##...#...# #.##.#  aggja ....#..##.######.#.# #.##.#  .....#####......#.#.# #.##.# .#. #..†...#.#.# #.##.# .#.....###†####...# #.##.#  #......(..)..###.##.# aggsagg&9agg¦aggѨg _There is an entrance to Cumium's Distillery here.aggp agg Welcome to Cumium's Distillery! What would you like to do?  a -  39 gold a potion of attraction  b -  78 gold 2 potions of curing  c -  13 gold a potion of degeneration  d -  130 gold a potion of haste (unknown)  e -  130 gold a potion of haste (unknown) agg#  f -  208 gold 2 potions of magic You have 338 gold pieces. [Esc] exit[!] buy|examine items[a-f] mark item for purchase [/] sort (type)[A-F] put item on shopping listagg 3aggx;aggC####.#.#.# #.##.#   deadiverson the Carver ...# .## #...#...# #.##.#   Human of the Shining One ****.. .#.######... #...#...# #.##.#   Health: 90/90 ======================== )........... +...#...# #.#   Magic: 11/11 ======================== ......(.#..# #...#...# #.#   AC: 17Str: 17 agg(D.#.........# #>..#...# #.#   EV: 13Int: 11 ......####. #..#...# #.#   SH: 16Dex: 14 aggD###...'..# ###.#...# #.#   XL: 11 Next: 46% Place: Dungeon:10#...#..#####..@....# #.#   Noise: ---------  Time: 11639.3 (0.0)#...#.....##.#.#...# #.#   a) +4 falchion (freeze)#...#.....##...#...# .##.#   Throw: 23 darts (poison)#...#..##.##...#...# #.##.#  ....#..##.######.#.# #.##.#  .....#####......#.#.# #.##.#  aggE$  .#....... #..†...#.#.# #.##.#    ....#.....###†####...# #.##.#   #......(..)..###.##.#    aggkEw_f - 22 poisoned darts (gained 1) _f - 23 poisoned darts (gained 1) _H - a scroll of summoning _Found Cumium's Distillery. _Found a stone staircase leading down. _There is an entrance to Cumium's Distillery here.aggKagglLaggQaggSagg+paggpaggwaggUzF _Unknown command.aggm:agg:agg;aggABaggYEagg.IP _agg\L,aggMaggNaggAQaggQagg:Ragg5Xagg[,agg[agge^agg`,aggaaggd7 _You open the door.aggmg3agghaggjaggn,aggfpaggt@  There is an open door here.agg3xaggx _aggyagg|aggaggFaggaggBagg,aggagg݋agg,aggraggߖ,aggtagg<q _C - 2 potions of curing (gained 1)aggaggaggˤagg aggo,aggxagg.aggagg6aggOaggagg>,aggWaggsagg,agg|aggaggpaggagg aggagg,aggaggtaggC,agg.aggPagg agg;agg$aggJagg,aggYagg*agg_,aggagg{aggaggG,aggxagg,aggWaggaggaggCaggaggaggN,aggaggagg,aggaggagg,agg0agg5aggS,aggaggagg,aggagg>aggaggaggaggm7 _You open the door.agg3aggLagg<@  There is an open door here.aggagg _agg+aggLagg agg agg aggH aggS,aggaggaggaggaggagg?agg,agg@aggagg agg2aggagg agg)"aggV"agg"agg$aggk'agg'agg7(agg)agg+,agg,aggU.agg0agg70agg0aggE2agg3agg4agg4agg7agg8agg 9agg9agg;agg@=,agg=agg?aggE  #.....#  #.....# ..#aggF#.#...# #### ##########.....# agg(F# #..............#...## aggIF# #.##..#...#....#...#. # #.........#....#...#. agglF##.............#...#. aggF#..@######....#...#.85.3 (46.0) aggF#### #.#.# #..#.#...#. aggGh...# .....# #..#.#...#. .#.# )...#### #..#.'...#. ...## #.... #....#...#. ....#######...# #....#...#. aggG?###.'.....#.#.# #.##.#...#. °°#.#.# #....#...#. #.###.....#.#.+ #....#####.aggNaggN,6.3 (47aggNRaggS$ _Found a flail.agg% 3aggq& agg) agg, agg, agg1 ,aggi2 agg2 agg2 aggF4 aggZ6 ,aggf7 agg09 agg; ,agg= aggXB aggwE naggH BaggUJ agg~J aggOK aggM aggP ,aggP aggQ aggS agg9S aggS aggU aggV ,aggW aggZ 7 _You open the door.agg~] 3aggb^ agg_ aggja agga aggb agge @  There is an open door here.aggg aggh  _aggHi agg&k aggm ,aggmn aggo aggSq ,agg/s aggu aggw ,aggx aggp| agg~ ,agg agg_ agg  #..............#...### #.##..#...#....#...#.. #.........#....#...#.# ##.............#...#.# #...######....#...#. ### #####.#.#.<..#..#.#...#.# ..# #.......#....#..#.#...#.# #.# #)...####....#..#.'...#.# ..## #....#..@....#....#...#.#703.3 (1 ...#######...#.#######....#...#. aggԇ ##.'.....#.#.#.# #.##.#...#. °#.#.....#.#.#.## #....#...#. .###.....#.#.'..# #....#####. .###.....#.#.#..# #.#..# #.#.....'.#.#..# #....# #. #.##.....#.#.#### #....# #. ..#......#...# #.##.###+#.#agg aggD ,4.3 (18aggO agg_ 9 _Found a stone staircase leading up.agg agg@ agg agg agg agg Bagg ,aggI agg agg ,agg aggF agg ,agg agg agg ,agg agg @  There is an open door here.agg agg  _aggn agg aggC ,agg aggG agg] agg agg agg aggf ,aggi agg! agg$ ,agg% agg' aggn* agg* agg+ agg- aggs0 ,agg1 agg3 agg7 ,agg8 agg: agg= ,agg? aggB 7 _You open the door.aggD 3agg%F aggtN @  There is an open door here.aggQ aggR  _aggS aggU aggNX agg}X aggnY aggx[ agg] agg*^ aggf_ agga agg3d aggbd aggPe aggi aggRl ,aggCm aggo aggr ,aggs aggv aggx ,aggy agg agg agg agg agg agg ,agg aggw agg ,agg: agg aggʛ agg2 aggޝ agg aggȢ agg aggs aggE agg ,agg aggϮ 7 _You open the door.agg agg aggq agga @  There is an open door here.agg aggi  _agg agg1 agg| agg agg agg There is an open door here. _You open the door. _There is an open door here. _You open the door. _There is an open door here. _You open the door.agg# 3agg5 agg agg ,agg agg agg ,aggR agg aggB ,agg aggW agg ,agg aggZ agg agg agg aggX agg ,agg> aggagg5aggfaggagg agg ,agg~ aggVaggCaggvaggaggaggGaggagg|aggaggaggaggagg*agg-,agg1.agg1agg3agg+4agg4agg7agg9agg :agg:agg>agg[B,aggCaggFaggvI,aggJaggMaggP,aggRaggUagg1Y,agghZagg+]agg_agg_aggaaggdaggg,agg iaggkaggoaggoaggqaggsaggwaggKwaggxagg{agg&~aggX~aggagg߅aggagg'agggaggzagg,aggaggagg,agg aggaggagg:aggagg aggu,aggaggժaggí,aggaggagg.,aggaggKaggҸ,aggaggaggagg aggaggjagg,aggaggMagg,agglagg+aggvaggaggxagg!aggaggaggtaggDagg,agg"aggagg],aggaggagg{,aggagg'agg[aggaggagg]agg,aggaggagg4,aggaggragg,agg,agg3agg,agg9agg~agg,agg3agg+ aggb ,agg agg'agg,aggaggagg,aggagg[agg,aggbaggTagg2agg\aggagg agg#,agg#agg%agg',agg:(agg)agg),,agg,agg^.agg0,agg1agg2agg3,aggR4aggp5aggC7agg7agg8agg9aggm<,agg =agg>agg@aggcA,agg agg7,aggagg:agg4,aggaggagg,aggaggagg ,aggR agg% agg,aggaggaggaggaggaggagg,aggAaggraggaggaggSaggsagg,aggagg!agg",agg0#agg$You open the door. _There is an open door here. _You open the door. _There is an open door here. _You open the dooragg+% .agg:&agg^&agg&agg'agg6)aggf)agg)agg;,There is an open door here. _You open the door. _There is an open door here. _You open the door.  There is an open door here.agge.agg. _agg/aggs0aggD1,agg1agg3agg5,agg5aggO7agg^9,agg9aggK<aggM>,agg'?agg@aggB,aggtCaggEagg Gagg=GaggGaggIaggJ,agg?KaggMagg'O,aggOagg5QaggR,aggSaggTUaggXBaggXaggZ,aggZaggW]You open the door. _There is an open door here. _You open the door. _There is an open door here.  agg_K _aggDd   ...   ... .#   ###.. .#   #.#.##.#   #.#....#   .#. ####.#....#  ##...# #.#..#....#  ...# #.##.#@...#  819.3 (115.0)..# #.##.'....#  aggd.#...# #....#.##.#  .....# #....#....#  .....#...#####.#....#  #....#...#...#.#....#  #....#...#.#.#.#....#  .....#.#....#  aggds#....#...#.#.#.#....#  aggdagggaggj _There is an open door here. _You open the door. _There is an open door here. _Key pressed, stopping explore.agg_agg[agg$ _agg,agg',aggaggaggϔ,agg+aggagg,agg_aggzaggaggagg%aggHaggr,agg۠aggagg%,aggaggaggaggaggOaggagg7,aggaggagg+aggIagg®agg=agg,agg.aggagg-,aggaggagg*aggdaggaggagg,aggagg2aggn,aggaggagg,agg'aggaggaggaggaggagg,agg agg~agg,aggagg/aggaggaggkagg`aggM,aggaggaggf,aggaggagg,agg!agg aggaggaggaggaggaggaggaggiagg,agg#agg^agg,aggaggagguaggaggMaggaggaggaggaggagg,aggaggbagg,agg?agg agg,aggEaggagghaggagg(aggaagg%aggaggagg agg ,aggS agg agg- ,agg aggagg,agg.aggagg,aggaggJaggUagg~aggagg agg,agg+aggagg,aggagg!agg"agg:#agg#agg%aggH',agg'agg(agg)agg)aggB*agg +agg,agg?,aggn,agg|-agg.,agg)/agg0agg2,aggS3agg5agg7,agg8aggG9agg:,agg:agg;aggc=,agg>agg@aggI....#..########...... ...... #...... ..### ..#...... ..#...##############...### ..#....................# ..##### .........############ aggI......# .#...###..# ......###W....###..# .#.#.......@..# .'.########.....# .....#........#.###.# .####.....#.# .#agg5J )##....#.#####.. # ######### ..>....#.#.## .## #........ W   wraith (dormant) .........#..# . #.##..#..##....#### .. #........ .........###.......aggP369.3 (50.0)aggZi.WWaggv[-70.3 (51aggbaggfY _A wraith comes into view.aggf ......#. ..#. ####. .............#  ..#  .#...###..# .....###..# .W.....@..# #######.....# #.###.# #.# .# #.. # > .##  .  .. aggw8 ......#. ..#. ####. .............#  ..#  .#...###..# .....###..# .W.....@..# #######.....# aggc,#.###.# #.# .##.. # > .##  .  .. aggΧaggagg֮aggβ] _A wraith is nearby!aggq ......#. ..#. ####. .............#  ..#  .#...###..# .....###..# .W.....@..# #######.....# #.###.# #.# .# aggt#.. # > .##  .  .. aggd ......#. ..#. ####. .............#  ..#  .#...###..# .....###..# .W.....@..# #######.....# #.###.# #.# .##.. # > .##  .  .. agg>aggaggNaggE] _A wraith is nearby!agg <(((((agg{$ agg, g(W....agg- a1.4 (1.1)2agg2 agg5 S _You throw a poisoned dart. The poisoned dart hits the wraith.aggvB.#.. #...... #.### . .. #.# #....########....# #.....................#.##### ..........##.# #.#...###..#.###.....###..#aggo.#.#.(W...@...#.'.#.....#.#.#.###.#.####.....#.# .#.)##....#.#####.. # .>....#.#.## .## #.#..# . #.##..#.##....#### .. #.# ##agg[agg(a.W20aggaggcagg[".#.. #. #..... #.### ...... #.# #....##....# #......#.##### ..........# #agg _.# #.#...###..# +.###.....###..# #.#.#.(.W.@....# #.'.#.....# #.#.#.###.# #.####.....#.# .# #...)##....#.#####.. # #...>....#.#.## .## # #.#..# . #.##..# #....##....#### ..agg0{ # #.# ##aggagg..Wagg@&3agg(aggUagg=agg9?5=4.3 (0.9aggFaggNJy _You hit the wraith but do no damage. You block the wraith's attack.agg  You slash the wraith! You freeze the wraith.  The wraith is moderately damaged.agg0=5.2aggagg4 _You block the wraith's attack.aggo9 8  You hit the wraith.agge: 5-6.0 (0.8aggNA aggC ^ _The wraith is heavily damaged.agg̳  You hit the wraith but do no damage.The wraith is heavily damaged.agg E-9 (0.9aggX aggF 4 _You block the wraith's attack.agg/  You slash the wraith! You freeze the wraith.  The wraith is severely damaged.agg&0=7.8agg agg4 _You block the wraith's attack.aggA  You barely miss the wraith.The wraith is severely damaged.agg[B0-8.7aggHaggK aggK&_You block the wraith's attack.aggN  You slash the wraith!  The wraith is almost destroyed.agg]B-9.6aggaggc4 _You block the wraith's attack.aggd  You hit the wraith but do no damage.The wraith is almost destroyed.The wraith hits you! The wraith drains your vigour!agge8---=80.4 (0.8Slow aggnaggjp2 _You feel yourself slow down.agg4  You slash the wraith! You freeze the wraith.  You destroy the wraith!The Shining One accepts your kill.agg4=o.aggqD 8==-88-1.8 (1.4 _You feel better.aggIaggLg _Your Armour skill increases to level 6!agg agg 8-aggL aggu H _No target in view!agg aggi agg aggl agg 9== _agg agg+ agg M90=agg? agg' agg7 ,agg agg agg ,agg aggg agg ,aggv agg agg aggX :=agg agga ,agg agg o _f - 23 poisoned darts (gained 1)agg <agg agg j _You feel yourself speed up.agg agg: aggI agg agg ,agg agg agg ,agg agg7 agg! ,aggJ" agg[$ agg& ,agg' agg) agg(, aggj, agg- agg0 agg&3 ,agg3 agg5 agg 8 agg48 agg8 agg; agg'= ,agg&> aggB agg@E aggkE aggE agg+H aggI aggI aggJ aggL aggN ,aggO aggQ aggS ,aggT aggV aggX aggY aggY aggc[ agg] ,aggt^ aggY` aggQb ,aggc aggd aggf ,aggyg aggh aggj aggj agg^k aggm aggn agg o aggo aggq aggr ,aggxs aggt aggv ,aggiw agg}x agg>{ ,agg{ agg! Xagg agg agg ,agg aggч Bagg@ agg. ,agg7 aggˍ aggt agg agg agg XaggN agg agg) agg agg aggy agg agg agg aggy ,aggO agg aggy ,agg agg aggʲ ,agg aggM agg ,agg agg! agg ,aggW aggf agg agg aggN agg} agg ,agg aggZ agg agg agg agg{ agg ,agg agg; aggd agg aggQ agg agg Bagg agg ,aggj agg agg ,agg agg agg aggaggU,aggaggaggi ,agg aggO agg,aggagg:aggI,aggaggYagg.Xagg agg|aggagg aggg#,agg$agg&agg+,agg,agg3Bagg94agg8agg;agg;aggw<aggd>agg-@,aggAaggCagguE,aggXFaggH7 _You open the door.aggJ3aggrKaggQO@  There is an open door here.aggPaggwQ _aggQaggRaggTagg-UagglVagg@XaggY,aggYaggZagg\,agg!]agg]agg%_agg_,agg`agga,aggSbagg cagg|d,aggdaggMgaggh,agghaggujaggvk,aggElaggmaggpBagg?ragg&v,aggcwaggxaggz,agg{agg|agg}agg}aggV~aggaggqagg҂aggԃagg>aggЊ,aggNaggagg,aggagg7agg),aggaggqaggaggagg~aggaggj,aggRagg&agg,aggpaggagg,aggagg aggf,aggaggagg*,aggaggagg,aggaggaggaggXaggagg2aggoaggaggaggaggaggaagg aggaggaggaggGagg@  There is an open door here.aggaggR _aggFagg7agg,agg8agg!agg.,aggaggaggs,aggaggJagg=aggagg3aggagg?,aggaggagg,agg[agg agg ,aggaggagg,aggagg?agg,aggaggaggu ,agg!agg1$agg|(Bagg)aggs+,agg,agg.agg0agg1agg1agg3agg5,agg66agg7agg:agg:aggA;agg9>agg4@aggt@aggEAaggaggagg,aggagg ,agg agg3 agg,agg7aggOaggaggaggaggmaggagg<aggOagg;!aggH#,aggS$aggp&aggl),agg*aggt-aggU0,aggl1agg57 _You open the door.agg=o  #.....# #....#.#.....   #.....#...#....#.#....##   #.....#..)#....#.#.....   #.##..#...#....#.#.#.......   #.....#...#....#.# agg>  #.....#...#..#.#.#.........   #.##..#...#..#.#.#.#..##...   #.....#...#....#.#.#..##..#   #.|...#...@....#.#.........-2006.3 (124.5)   #...#.#####..##############   #.....# #..#$$$$$§§☼☼○○°☼3   #.....+ #..##############   #.###.# #..#.....○.....°. aggK@  #.....# #..##+###########   #.....# #......####...#   #..#..# #.##.#.# ##..#   #.....#. +aggJaggdJF-75aggRaggaV _You open the door. _There is an open door here. _There is an open door here. _You open the door. _Found a falchion. _There is an open door here.agg0pIaggNqaggsaggPt$ _aggvwaggwaggy,agg.{agg}aggY,aggaggaggagg҃agghaggagg,aggaggagg,aggagg1agg,aggagg֕aggaggLaggaggaggh,aggaggagg|,aggLaggԩ] #...#.#####..################## agg  #.....# #..#$$$$$.§☼☼○○°☼○°.°  #.....+ #..################## aggse #.###.# #..#...°○○.....°.....  #.....# #..##+##############  #.....# #......####...#.#.### agg #..#..# #.##.#.# ##..#...#  #.....# #....#.# +...##+  #...<.# #...@# # #  #..##.#####....# #####.#..  #..............# #.......... agg> #..............# ####...|......  #..............# #.............  #.....############...##'#.#....  #.###.# #.....#.#.#..#.#....  #.....### #####'#...#..#....  #.....#.#####........#..####.aggį210.0)aggE,8.3 (11aggaggFd _K - a scroll labelled VOCICO ZYTOZXUagg8agg^9agg:agg8?aggBaggCaggFaggHaggL,aggOaggSagg?W,agg)Yagg3^aggs`,aggcaagg caggd,aggweaggfaggh,agghaggjaggGmaggmagg@  There is an open door here.aggAaggQB _agg\CaggLaggnO,agglPaggZYagg[[,agg\aggNbaggre,aggtfagg&naggp,aggqaggCyaggQ{,agg{agg?aggS,aggaggagg$,aggݑaggJagg,aggϜagg aggaggaggaggaggaggaggagg(agg,aggagghagg۾agg2aggڿaggaggJ,aggaggagg&,aggaggaggaggaggAaggagg,aggaggagg,aggaggUagg!agg]agg$aggagg,aggaggaggJ ,agg aggagg,aggwaggwagg,aggvaggagg9#,agg$agg*agg-,agg-agg=3agg5,agg7agg;agg>,agg[@aggEaggH,aggcJaggNagg9R,aggSagg|Wagg\[,agg\agg`aggd,agg'gaggpagg ragg;vaggnzaggzaggJ|agg agg@BaggWagg8agguagg8agg@aggȒaggaggaggaggAaggaggagg;aggBaggPaggaggVaggaggȴagg۸,agguaggSagg,agg}Xaggaggagg,agg^aggaggxaggaggXaggagg,agguagg{#...#..##+#####... #####......####...#.#.#####.##... # #.##.#.# ##..#...# ..#.... # #....#.# +...##+######## # #....#.# #.............. aggX#####....#.# #####.#..###...##.. .........#.# #.................. .........#.####...|...........### .........###....@.............#101.3 (83 ############...##'#.#.........#.. # #.....#.#.#..#.#..# agg### #####'#...#..#...........# #.#####........#..####+ agg#.#...#..[..##.#... #.)......# #.##..#.##.....#... #........# #.##..#..[.....#..# #......#.# aggKs#.....#........#..# #......#.###aggagg8aggT _Key pressed, stopping explore.agg3agg agg$agg&agg*: _agg-@  There is an open door here.agg0agg21 _aggo2agg_5agg29,aggN:agg;agg=,agg>aggBaggD,aggFaggJagg\O,aggQaggUaggY,aggyZagg^aggc,aggfaggiagg^l,aggmaggF| .....###..................#...###...##'#.#.........#...  #.....#.#.#..#.#.........#..  #####'#...#..#...........#...##. ###........#..####........+...## ..#..[..##.#.....#.)......#...## ..#.##.....#.....#........#...###..[.....#..##.#......#.#...##.agg|##..#..##@#......#.###'## ..#'###....#...#.#......#......# ......#.#..#######......#......'####...............).#......# .......#..#....)..#......## .....##......#..#....).)#....#. .##..##..#...........). ......................<........ #agg};#############################aggɆ210.3 (9.0)agg,1.3 (10.0)aggKagg' _L - a ring of iceaggQaggֳaggǷaggagg aggaggaggagg,aggaggaggagg6aggaggagg:,aggaggCaggaggaggagg[aggxaggagg4aggaggaggagg aggE @  There is an open door here.agg aggz  _agg agg\ aggJ agg agg* agg agg ,agg agg" agg ' ,agg* agg, agg0 agge0 agg4 agg7 aggt9 ,agg: agg= 7 _You open the door.agg@ 3aggqC agg^K aggGN ,aggO aggR aggT ,aggV aggW agg]Z ,aggL[ agg\ agg}^ ,agga_ agg` aggb ,aggb aggd aggGf ,aggf aggn| 7 _You open the door.agg$~ 3aggY agg agg agg agg agg agg: ,agg agg aggJ ,agg aggv agg2 aggY agg agg aggT ,agg̪ aggެ agg$ ,agg agg agg7 ,agg agg agg ,agg agg% agg ,agg agg agg۾ ,agg] aggO aggv agg agg: agg agg; ,agg agg aggG agg agg2 agg aggA agg agg agg  agg R Things that are here:  a +0 dagger; a +0 robeagg agg 5 _agg& agg agg= agg agg agg6 aggl agg) agg agg6 aggu aggB agg* agg agg agg agg agg ,agg agg agg agg aggY agg agg agg agg agg agg ,agg agg' agg! ,agg" agg# agg& ,agg& aggP J  There is an open door here. _#.#######....#...#...###....#  #.# #.##.#...#..#  #.## #....#...#....#.....#  '..# #....#####....#.....#  #..# #.#..#...##.#  #..# #....#.W.#...###.##.#  agg{R #### #....# ..#...# #.##.#  # #.##.###'#.#.# #.##.#  # #....#..@#.#.# #.##.#  #### #....#...#.#.# #.##.#  # #.##.#...#...# #.##.#  .#.######....#...#...# #.##.#  )............'...#...# #.##.#  .(.#..#.#...#...# #.##.#   W   shadowghast (dormant).........#.#>..#...# #.##.#  ####...gg$S *40m##..#...# #.##.#  ...'..#...###.#...# #.##.#  agg_  W63.3 (52WYou open the door.  A shadowghast comes into view.aggq 8*agg@ W(invisible)The shadowghast slips into darkness.agg 8WaggW ,4.3 (53agg agg I _The shadowghast flickers and vanishes for a moment.aggf       #....#####  #.#..#...# agg .W.#   ..#...#  # #.##.###'#.#.#  # #....#..@#.#.# agg !  #....#...#.#.# agg +  #.##.#...#...#  agg #...#...#  aggG %)............'...#...#  agg` 1(.#..#.#...#...#  #.#>..#...# aggu % ..##..#...#  agg %  agg ~      #....#####  #.#..#...#  .W.# aggց |  ..#...#   #.##.###'#.#.#   #....#..@#.#.#   #....#...#.#.#   #.##.#...#...#  #...#...#  )............'...#...# agg (.#..#.#...#...#  agg3 #.#>..#...#  aggT o..##..#...#  aggt   aggf agg, agg= agg b _A shadowghast is nearby!agg @    aggxu  #....#####  #.#..#...#  .W.#   ..#...# agg+ # #.##.###'#.#.#  #agg8 #....#..@#.#.#  agg9 #....#...#.#.#   #.##.#...#...# agg! #...#...#  agg;)............'...#...#  (.#..#.#...#...# agg8% #.#>..#...#  aggX!..##..#...#   aggw agg4:      #....#####  #.#..#...#  .W.#   ..#...# agg:$  #.##.###'#.#.#   #....#..@#.#.#   #....#...#.#.#   #.##.#...#...# agg; #...#...#  )............'...#...#  aggL;O(.#..#.#...#...#  #.#>..#...#  agg;~..##..#...#    aggCaggZDaggSJaggLb _A shadowghast is nearby!agg      #....#####  #.#..#...# aggh .W.#   ..#...#  # #.##.###'#.#.#  # #....#..@#.#.#   #....#...#.#.# agg+  #.##.#...#...#  agg3#...#...#  )............'...#...# aggы) (.#..#.#...#...#  agg,#.#>..#...#  ..##..#...# agg/   agg%      #....#####  #.#..#...#  .W.#   ..#...#  agg@& #.##.###'#.#.#   #....#..@#.#.#   #....#...#.#.#   #.##.#...#...#  #...#...#  aggw&7)............'...#...#  (.#..#.#...#...#  agg&#.#>..#...#  ..##..#...#  agg&  agg/agg-0agg-8agg:b _A shadowghast is nearby!aggP......#.#.#.########...### ##. #.##...# '...#####....#....#..#...#...... #..#.W# ####...#...#..##.### . ###...#...#.# ...# #.##.#. .#.######....# )............'.....(.#..#.#.#.........#.#> ......###.aggaggL.Wagg85.3 (1.0) _aggZagg Q _There is an open door here.aggZ agg 5=6.1 (0.8aggq agg _ _You hit the shadowghast but do no damage.agg`  You slash the shadowghast!  The shadowghast is moderately damaged.agga5=7.0 (0.9agggaggj9 _You block the shadowghast's attack.aggg WWYou hit the shadowghast but do no damage.The shadowghast is moderately damaged.aggW82---9agg>agg 0 _The shadowghast claws you!agg  You barely miss the shadowghast.The shadowghast is moderately damaged.agg_3=---agg 8.8aggaggW0 _The shadowghast claws you.agg  You hit the shadowghast.  The shadowghast is heavily damaged.aggB-9.7aggJaggX _The shadowghast barely misses you.aggV  You hit the shadowghast but do no damage.The shadowghast is heavily damaged.agglW .70.5 (0.8agg_ agg` \ _The shadowghast completely misses you.aggF  You hit the shadowghast but do no damage.The shadowghast is heavily damaged.aggFe4=1.4 (0.9aggMaggPQ _The shadowghast misses you.agg>  You hit the shadowghast but do no damage.The shadowghast is heavily damaged.agg (2.3aggragg0 _The shadowghast claws you.agg  You barely miss the shadowghast.The shadowghast is moderately damaged.aggaggS!3.2aggkaggi9 _You block the shadowghast's attack.aggRZm  You hit the shadowghast.54.1aggaaggscc _The shadowghast is heavily damaged.agg>  You barely miss the shadowghast.The shadowghast is heavily damaged.agggC 8*agg W(invisible)The shadowghast slips into darkness.agg 8Wagg (5.0agg~ agg I _The shadowghast flickers and vanishes for a moment.agg$  You hit the shadowghast.  The shadowghast is heavily damaged.8 (0.8aggD agg 9 _You block the shadowghast's attack.aggĒ  You hit the shadowghast.  The shadowghast is heavily damaged.aggW066.6aggܙaggzG  You hit the shadowghast.  The shadowghast is heavily damaged. _You block the shadowghast's attack.  You hit the shadowghast.  The shadowghast is heavily damaged. _You block the shadowghast's attack.aggLM~ _You block the shadowghast's attack.  You hit the shadowghast.  The shadowghast is heavily damaged. _You block the shadowghast's attack.  You barely miss the shadowghast.  The shadowghast is heavily damaged.aggM(7.4agg_VaggY9 _You block the shadowghast's attack.aggB" WWYou hit the shadowghast but do no damage.The shadowghast is heavily damaged.aggD#-8.3 (0.9agg)agg00 _The shadowghast claws you.agg  You hit the shadowghast.  The shadowghast is severely damaged.aggA(9.2agg agg 9 _You block the shadowghast's attack.agg#  You slash the shadowghast!  You destroy the shadowghast!The Shining One accepts your kill.agg( o.agg b90==5180.1agg agg & _You feel better.aggX\M####.'......agg#.#.#.########...### ##. #.##...# '...#####....#....#... #..# ####agg)...#..@#..##.###' #. agg[#### #....#...#.#.# #.##.#  ... aggR#.#>..#agg>aggF5-1.1 (1.0aggaggUagg[?25h[?0c  agg8USearch for what [Enter for "shield", or ? for help]? agg2 [?25l[?1caggagg?1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position  a - [carried] J - a +0 scimitaragg'aggagg: aggB aggH ####....#..#.'...#.#.#.#.##.#   deadiverson the Carver #.......#....#...#.#.#.#.##.#   Human of the Shining One ****.. #.#######....#...#...###....#   Health: 90/90 ======================== #.# #.##.#...#..........#   Magic: 11/11 ======================== #.## #....#...#....#.....#   AC: 18Str: 17 '..# #....#####....#.....#   EV: 13Int: 11 #..# #.#..#...#.......##.#   SH: 16Dex: 14 aggI #..# #....#...#...###.##.#   XL: 11 Next: 51% Place: Dungeon:10 #### #....#..@#...# #.##.#   Noise: ---------  Time: 12181.1 (0.0) ##.##.###'#.#.# #.##.#   a) +4 falchion (freeze) ##....#...#.#.# #.##.#   Throw: 23 darts (poison) aggI "#### #....#...#.#.# #.##.#  ...# #.##.#...#...# #.##.#  .#.######....#...#...# #.##.#    )............'...#...# #.##.#    ......(.#..#.#...#...# #.##.#    .#.........#.#>..#...# #.##.#    _You block the shadowghast's attack.  You slash the shadowghast!  You destroy the shadowghast!The Shining One accepts your kill. _You feel better.  Search for what [Enter for "shield", or ? for help]? scimagg P aggsQ agg$V aggjX . _aggF agg agg! agg F _Unknown command.aggaggInventory: 38/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon)J - a +0 scimitar Missiles (go to first with ()  b - 3 throwing nets agg f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=) agg d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)L - a ring of ice Wands (go to first with /)y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]aggzJ - a +0 scimitar. A long sword with a wide, curved blade. Base accuracy: +0 Base damage: 12 Base attack delay: 1.4 This weapon's minimum attack delay (0.7) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.8 XLs.  Current attack delay: 0.9. agg˛Damage rating: 18 (Base 12 x 110% (Dex) x 141% (Skill)). This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. You took it off an orc warrior on level 10 of the Dungeon. Stash search prefixes: {inventory} {Long Blades} {one-handed} {melee weapon} Menu/colouring prefixes: identified melee weapon “The museum-cabinet and huge library arrogated to themselves the entire lower  floor — there were the controversial and incompatible books that are somehow  the history of the nineteenth century; there were scimitars from Nishapur, in (w)ield, (d)rop, (=)adjust, or (i)nscribe.aggL` Inventory: 38/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon)  J - a +0 scimitar Missiles (go to first with () agga a b - 3 throwing nets  f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  L - a ring of ice aggra Wands (go to first with /)  y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability agga % j - a scroll of blinking [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]agg:}a - a +4 falchion of freezing (weapon). A long single-edged sword with a slightly curved blade. Base accuracy: +2 Base damage: 8 Base attack delay: 1.3 This weapon's minimum attack delay (0.6) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.8 XLs.  Current attack delay: 0.8. Damage rating: 16 (Base 8 x 110% (Dex) x 141% (Skill) + 4 (Ench)). Freeze: It freezes victims, dealing an additional one-quarter of any damage that pierces defenders' armour. It may also slow down cold-blooded creatures. This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. You took it off a wight on level 7 of the Dungeon. Stash search prefixes: {inventory} {ego} {branded} {Long Blades} {one-handed} {freeze} {melee weapon} Menu/colouring prefixes: identified enchanted ego melee equipped weapon (u)nwield, (d)rop, (=)adjust, or (i)nscribe.aggl #Inventory: 38/52 slots Hand Weapons (go to first with ))  a - a +4 falchion of freezing (weapon)  J - a +0 scimitar aggIm sMissiles (go to first with ()  b - 3 throwing nets  f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)L - a ring of ice Wands (go to first with /)  y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking aggm [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]agg0agg6agg>####....#..#.'...#.#.#.#.##.#   deadiverson the Carver #.......#....#...#.#.#.#.##.#   Human of the Shining One ****.. #.#######....#...#...###....#   Health: 90/90 ======================== #.# #.##.#...#..........#   Magic: 11/11 ======================== #.## #....#...#....#.....#   AC: 18Str: 17 '..# #....#####....#.....#   EV: 13agg?Int: 11 #..# #.#..#...#.......##.#   SH: 16Dex: 14 #..# #....#...#...###.##.#   XL: 11 Next: 51% Place: Dungeon:10 #### #....#..@#...# #.##.#   Noise: ---------  Time: 12181.1 (0.0) ##.##.###'#.#.# #.##.#   a) +4 falchion (freeze) ##....#...#.#.# #.##.#   Throw: 23 darts (poison) #### #....#...#.#.# #.##.#  ...# #.##.#...#...# #.##.#  .#.######....#...#...# #.##.# gg?m   )............'...#...# #.##.#    ......(.#..#.#...#...# #.##.#    .#.........#.#>..#...# #.##.#   You slash the shadowghast!  You destroy the shadowghast!The Shining One accepts your kill. _You feel better. _Search for what [Enter for "shield", or ? for help]? scim _Unknown command.agghGagg..#...# #.##.#   You slash the shadowghast!  aggq You destroy the shadowghast!The Shining One accepts your kill. _You feel better. _Search for what [Enter for "shield", or ? for help]? scim _Unknown command.agg,r aggz nYou destroy the shadowghast!The Shining One accepts your kill. _You feel better. _Search for what [Enter for "shield", or ? for help]? scimUnknown command.  Your +4 falchion of freezing stops glowing.agg{ h6 (0.5J) +0 scimitar agg| agg̀ aggS 0 _J - a +0 scimitar (weapon)aggPIaggYTDrop what?38/52 slots (_ for help) Hand Weapons (select all with ))  J - a +0 scimitar (weapon)  a - a +4 falchion of freezing Missiles (select all with ()  b - 3 throwing nets agg UW f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)L - a ring of ice Wands (select all with /)y - a wand of digging (6)  B - a wand of mindburst (29) aggVScrolls (select all with ?)  g - 3 scrolls of vulnerability [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]agg(1 turn)  J - a +0 scimitar (weapon)  a + a +4 falchion of freezing[Enter] accept (1 chosen)agg|aggb####....#..#.'...#.#.#.#.##.#   deadiverson the Carver #.......#....#...#.#.#.#.##.#   Human of the Shining One ****.. agg#.#######....#...#...###....#   Health: 90/90 ======================== #.# #.##.#...#..........#   Magic: 11/11 ======================== #.## #....#...#....#.....#   AC: 18Str: 17 '..# #....#####....#.....#   EV: 13Int: 11 aggY#..# #.#..#...#.......##.#   SH: 16Dex: 14 aggG#..# #....#...#...###.##.#   XL: 11 Next: 51% Place: Dungeon:10 agg#### #....#..@#...# #.##.#   Noise: ---------  Time: 12181.6 (0.0) ##.##.###'#.#.# #.##.#   J) +0 scimitar ##....#...#.#.# #.##.#   Throw: 23 darts (poison) #### #....#...#.#.# #.##.#  agg#...# #.##.#...#...# #.##.#  .#.######....#...#...# #.##.#    aggF)............'...#...# #.##.#    ......(.#..#.#...#...# #.##.#  agg  .#.........#.#>..#...# #.##.#   The Shining One accepts your kill. _You feel better. _Search for what [Enter for "shield", or ? for help]? scim aggӄ_Unknown command.Your +4 falchion of freezing stops glowing. _J - a +0 scimitar (weapon)agg+2.6 (1aggDagg9 _You drop a +4 falchion of freezing.aggY  Adjust (i)tems, (s)pells, or (a)bilities? aggxAdjust which item? Hand Weapons (go to first with ))  J - a +0 scimitar (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)L - a ring of ice Wands (go to first with /)y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]agg agg ####....#..#.'...#.#.#.#.##.#   deadiverson the Carver #.......#....#...#.#.#.#.##.#   Human of the Shining One ****.. #.#######....#...#...###....#   Health: 90/90 ======================== #.# #.##.#...#..........#   Magic: 11/11 ======================== #.## #....#...#....#.....#   AC: 18Str: 17 '..# #....#####....#.....#   EV: 13Int: 11 #..# #.#..#...#.......##.#   SH: 16Dex: 14 #..# #....#...#...###.##.#   XL: 11 Next: 51% Place: Dungeon:10 #### #....#..@#...# #.##.#ggo ;49m   Noise: ---------  Time: 12182.6 (0.0) ##.##.###'#.#.# #.##.#   J) +0 scimitar ##....#...#.#.# #.##.#   Throw: 23 darts (poison) #### #....#...#.#.# #.##.#  ...# #.##.#...#...# #.##.#  .#.######....#...#...# #.##.#    )............'...#...# #.##.#    ......(.#..#.#...#...# #.##.#    .#.........#.#>..#...# #.##.#   Your +4 falchion of freezing stops glowing. _J - a +0 scimitar (weapon) _You drop a +4 falchion of freezagg' +ing.  Adjust (i)tems, (s)pells, or (a)bilities? J - a +0 scimitar (weapon)  Adjust to which letter? (? for menu, Esc to quit)aggK agg8 9aagga agg  _J - a +0 scimitar (weapon) _You drop a +4 falchion of freezing.(i)tems, (s)pells, or (a)bilities?   J - a +0 scimitar (weapon)  Adjust to which letter? (? for menu, Esc to quit) _a - a +0 scimitar (weapon)aggAIaggYagg aggM: _agg˱V  There is an open door, spattered with blood here.aggagg! _aggagg%agg,aggaggÿaggj,aggaggagghaggaggaggagg,aggagg@  There is an open door here.aggagg _aggaggeagg,aggaggagg,aggaggAagg,aggaggagg6,aggaggbaggNBagg[aggj,aggaggagg,agg" aggX agg ,agg'aggRagg,agggaggpagg,aggaggagg,aggagg agg3#,agg7$agg+&agg(,agg)agg-@  There is an open door here.aggx/agg/ _agg0agg2agg5,aggk6agg8agg:,agg@naggAaggC,aggDagg Fagg)HaggkHaggHaggTaggW,aggRXaggh]Xagg7daggf,aggfagg^jaggm,aggymaggpaggs,aggtaggwaggM{,agg{agg+~aggaggaggaggagg?,aggƆagg aggaggaggagg2agg$,aggːaggSaggЕ,agg<aggagg,aggagg՜@  There is an open door here.aggbagg _agg(agg7agg,aggaggagg#.#.#...#####.#.. ### ###...#...##.#..#.. ..# #.....#...##.##.#.. #.....#...##.##.'.. #.#...#...##....#.# ..# ##########.....#...##....#.. ### #..............#...#####.#.. agg`#.##..#...#....#...#...#.#.. #.........#@...#...#.#.#.#..227.6 (45.0) ##.............#...#.#.#.#.. #...######....#...#.#.#.#.. aggR #####.#.#.<..#..#.#...#.#.#.#..  #.......#....#..#.#...#.#.#.#.. agg #)...####....#..#.'...#.#.#.#.#  #....#.......#....#...#.#.#.#.# ####...#.#######....#...#...###.. .aggr..#.#.#.# #.##.#...#........aggaggagg^ _Partly explored, can't reach some items.agg3aggWaggeg......0.0)...#...#..#..#.'...aggimaggtpagg"t^ _Partly explored, can't reach some items.agg; Iaggnt 4aggz agg| c _Partly explored, can't reach some items.agg0 Iagg_d agg e aggM l _Partly explored, can't reach some items.agg&oaggpfWhere to? (Tab - D:10, ? - help) agg+qR D - Dungeon  T - Temple L - Lairagg agg ##.#.#...#####.#.. deadiverson the Carver ######...#...##.#..#.. Human of the Shining One ****.. ..##.....#...##.##.#.. Health: 90/90 ======================== #.##.....#...##.##.'.. Magic: 11/11 ======================== #.##.#...#...##....#.# AC: 18Str: 17 ..# ##########.....#...##....#.. EV: 13Int: 11 ### #..............#...#####.#.. SH: 16Dex: 14#.##..#...#....#...#...#.#.. XL: 11 Next: 51% Place: Dungeon:10#.........#@...#...#.#.#.#.. Noise: --------- agg [37m Time: 12227.6 (0.0)##.............#...#.#.#.#.. a) +0 scimitar#...######....#...#.#.#.#.. Throw: 23 darts (poison)#####.#.#.<..#..#.#...#.#.#.#..#.......#....#..#.#...#.#.#.#..#)...####....#..#.'...#.#.#.#.# #....#.......#....#...#.#.#.#.#  ####...#.#######....#...#...###..  ...#.#.#.# #.##.#...#........  _There is an open door here. _There is an open door here. _Partly explored, can't reach some items. _Partly explored, can't reach some items. _Partly explored, can't reach some items. _Partly explored, can't reach some items.agg agg agg5 aggo agg  $ _agg! aggo" agg% agg^% agg& aggZ) agg, ,agg, aggi2 Bagg2 agg76 agg8 ,aggD9 agg; aggf> ,agg> aggA aggVD ,aggD agg G aggH ,aggI agg&J aggK agg L agg]L aggZM aggN ,aggN aggTP agg_Q ,aggQ aggR aggT ,aggU aggW aggY ,agg4Z agg5[ agg\ agg/] agg6^ agg` aggc ,agg+d agg|f aggi ,agg&j aggl aggn ,agg1p agg/r aggu ,agg&v aggw aggy ,aggz aggR} _Partly explored, can't reach some items. _ There is an open door here.agg agg`  _agg agg[ agg ,agg agg _Partly explored, can't reach some items. _There is an open door here.   stone staircase leading down here.aggL agg : _agg҈ aggL }1agg/   #####  ##.....  .......  ########.......  .......?.......  .......@....... 50.4 (22.8) ####....  #...........  #.#######... #. .. # . _You climb downwards.  Found a scroll of identify. _There is a stone staircase leading up here.agga{agg{agg|aggaggaggC: _aggagg$aggފaggOI _D - 4 scrolls of identify (gained 1)aggE3agg-aggdaggƗ,aggaggagg_,aggWaggaggʤ,aggaggaggn,aggagg/aggUaggaggagguaggi,aggagg޻agg!,aggxaggaggaggaggagg aggqaggaggaggagg,aggagg0aggaggagg$aggUagg,aggaggaggaggaggagg0aggs,aggwagg.agg)Baggagg,aggaggBaggagg?aggaggagg,aggaggaggFaggaggAagg\aggu##..........#..........###........#........###........#.......... #####.......... #.............. #............V.........#####.........#### ##.......## #......##V   vampire (dormant)####..##aggA.##agg7-720agg],3.4 (23agg^aggZ _A vampire comes into view.aggȢ # #...  #..........  ###........  #........  ###........  #..........  #####..........  #..............  #..@...........  ...................  V..................  ..#####.........###  aggw# ##.......##  #......##  ####..##  .## agg2; # #...  #..........  ###........  #........  ###........  #..........  #####..........  #..............  #..@...........  ...................  V..................  ..#####........agg<} # ##....... #......##  ####..## .## aggD4aggKaggO^ _A vampire is nearby!agg S aggW Read which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  agg&X s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportationD - 4 scrolls of identify  H - a scroll of summoning  K - a scroll labelled VOCICO ZYTOZXU [!] read|quaff|evoke[?] describe selectedagg agg agg w##..........deadiverson the Carver#..........Human of the Shining One ****..###........agg ?Health: 90/90 ========================#........Magic: 11/11 ========================###........AC: 18Str: 17#..........EV: 13Int: 11#####..........SH: 16Dex: 14agg b#..............XL: 11 Next: 51% Place: Dungeon:11#..@...........Noise: ---------  Time: 12273.4 (0.0)...................a) +0 scimitarV..................Throw: 23 darts (poison)..#####.........#### ##.......###......##aggj V   vampire (dormant)####..##.## _You climb downwards.  Found a scroll of identify. _There is a stone staircase leading up here. _D - 4 scrolls of identify (gained 1) _A vampire comes into view. agg Q_A vampire is nearby!agg agg UIdentify which item? (\ to view known items) Scrolls (select first with ?)  K - a scroll labelled VOCICO ZYTOZXU Potions (select first with !)  h - 2 bubbling ruby potions  z - a metallic yellow potion  E - a white potion  G - a grey potion[?] describe selectedaggw agg agg ##..........deadiverson the Carver#..........Human of the Shining One ****..###........Health: 90/90 ========================#........Magic: 11/11 ========================agg ###........AC: 18Str: 17#..........EV: 13Int: 11#####..........SH: 16Dex: 14#..............XL: 11 Next: 51% Place: Dungeon:11#..@...........Noise: ---------  Time: 12273.4 (0.0)...................a) +0 scimitarV..................Throw: 23 darts (poison)..#####.........#### ##.......###......##V   vampire (dormant)####..##.## _You climb downwards.  Found a scroll of identify. _There is a stone staircase leading up here. _D - 4 agg2 uscrolls of identify (gained 1) _A vampire comes into view. _A vampire is nearby!  As you read the scroll of identify, it crumbles to dust.4.4 (1 _K - a scroll of amnesiaagg"agg_#agg;)agg,K _You can't go up here!aggT #.#.... ##.......... #.... ###..  #.. ###..  #.. #####..aggT ~ #.  # .. V...........#####..#### ##.#....####..##agg0[ agg{\ -5 _agg` aggb aggcX#.#######. #.#.......... ##.......... #.... ###.  #. ###  #. ##### aggd#.  # ....V...........#####..### ##.#....####.agglaggDmaggm6agg saggtagg#......... #.#######.......... #.#.......... ##.... #.... ###. aggF #. ###  #. ##### #..  #....V...........#####..## ##.#....aggagg&7aggagg# agg####. #........... #.#######... #.#... ##... #... ###.  #. ###  #. ##### agg~x#.. #...V...........#####..#### ##.aggagga&8aggagg>aggN M.......<###........#######.#.#...## ### #.#####........................###.........###agg agg &9aggF agg aggQ=FM.agg=.......<..###........######.###.#..## ###..........agg5>k...........................agge>aggFagg*G'80agg,LaggnNaggW]M########.........<..###........######.##..aggX## ###..........................aggV`<1aggFdaggeaggeM  ########.........<..###.........######.#agg..###........................aggaggb&2agg&aggagg[ p ### # ########. .. .......<.####...... #........ #.#######. #. #agg] .# #. #..###. #. ###. #... #####...  #.aggGd agge &3aggj aggpl agg$j  ########### ### # ########. .. .......<.####...... #........ #.#######. #. #.# #. #...###..aggj  #.. ###.. #.... #####.aggYr aggs &4aggx aggz agg? ########### ### # ########. .. .......<.####. #........agg!* #.#######. #. #.# #... #....###... #... ###... #.agg)agg&5aggaggagg  ########### ### # ########. .. .......<agg.####. #........ #.#######. #. #....# #..... #.....###....aggB| #.... ###.aggagg&6aggaggagg0: ########### ### # ########. agg;.. .......<.####. #........ #.#######..... #. #.....# #...... #.......###..... #.aggbB<7aggGagg\Lagg: ## ###. #. #. . .<. ####. #. #.#...... #. #....... # #........ #......... ###........  #.aggeagg&8aggDaggaggJ{  ## ###. #. #. . .. ####. #. #.#. #. #.. # #... #....  ###.  #.agg agg &9agg agg a _There is a stone staircase leading up here.aggnT aggW Read which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation agg[X A o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportationD - 3 scrolls of identify  H - a scroll of summoning  K - a scroll of amnesia [!] read|quaff|evoke[?] describe selectedaggϞ aggdeadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11aggs########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12289.4 (0.0)####..................a) +0 scimitar#..................aggǥ Throw: 23 darts (poison)#.#######..........#.#..........agg&c##..........#..........###........#........ _A vampire comes into view. _A vampire is nearby!As you read the scroll of identify, it crumbles to dust. aggT_K - a scroll of amnesia _You can't go up here! _There is a stone staircase leading up here.aggaggSIdentify which item? (\ to view known items) Potions (select first with !)  h - 2 bubbling ruby potions  z - a metallic yellow potion  E - a white potion aggw G - a grey potion[?] describe selectedagg.Wagg\aggb,deadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########agg7c]Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11aggc.......@..............Noise: ---------  Time: 12289.4 (0.0)####..................a) +0 scimitar#..................Throw: 23 darts (poison)#.#######..........aggc#.#..........##..........#..........###........aggd#........ _A vampire comes into view. _A vampire is nearby!agg0dAs you read the scroll of identify, it crumbles to dust. _K - a scroll of amnesia _You can't go up here! _There is a stone staircase leading up here.aggyv]  As you read the scroll of identify, it crumbles to dust.agg/w,90.4 (1aggNi _h - 2 potions of invisibilityaggagg"aRead which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportationD - 2 scrolls of identify  H - a scroll of summoning  K - a scroll of amnesia [!] read|quaff|evoke[?] describe selectedaggi agg; agg deadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11agg s########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12290.4 (0.0)####..................a) +0 scimitar#..................Throw: 23 darts (poison)#.#######..........#.#..........##..........#..........###........#........As you read the scroll of identify, it crumbles to dust. _K - a scroll of amnesia _You can't go up here! _There is a stone staircase leading up here.  As you read the scroll of identify, it crumbles to dust. _h - 2 potions of invisibilityagg  aggM Identify which item? (\ to view known items) Potions (select first with !) agg  z - a metallic yellow potion  E - a white potion  G - a grey potion[?] describe selectedaggaggagg\deadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12290.4 (0.0)####..................a) +0 scimitaraggW^#..................Throw: 23 darts (poison)#.#######..........#.#..........##..........#..........###........#........As you read the scroll of identify, it crumbles to dust. _K - a scroll of amnesia _You can't go up here! _There is a stone staircase leading up here.  As you read the scroll of identify, it crumbles to dust. _h - 2 potions of invisibilityagg]  As you read the scroll of identify, it crumbles to dust.aggG+1.4 (1agg?agg]U _z - a potion of hasteagg agg ORead which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogagg r - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportationD - a scroll of identify  H - a scroll of summoning  K - a scroll of amnesia [!] read|quaff|evoke[?] describe selectedaggaggaggldeadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11aggKN########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12291.4 (0.0)####..................a) +0 scimitar#..................Throw: 23 darts (poison)#.#######..........#.aggؤ7#..........##..........#..........###........#........ _You can't go up here! _There is a stone staircase leading up here.  As you read the scroll of identify, it crumbles to dust. _h - 2 potions of invisibilityAs you read the scroll of identify, it crumbles to dust. _z - a potion of hasteaggaggaggIdentify which item? (\ to view known items) Potions (select first with !)  E - a white potion agg G - a grey potion[?] describe selectedaggwg agg%i aggm deadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11agg;n ########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12291.4 (0.0)####..................a) +0 scimitar#..................Throw: 23 darts (poison)#.#######..........#.#..........agg o ##..........#..........###........#........ _You can't go up here! _There is a stone staircase leading up here.  As you read the scroll of identify, it crumbles to dust. _h - 2 potions of invisibilityAs you read the scroll of identify, it crumbles to dust. _z - a potion of hasteagg3~ ]  As you read the scroll of identify, it crumbles to dust.agg +2.4 (1agg F _E - a potion of brillianceaggaggJDrop what?36/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 23 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn) agg>Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)L - a ring of ice Wands (select all with /)y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (select all with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit agg4Letters toggle [.|Space] toggle selected[top]aggo " Wands /  y - a wand of digging (6)  B - a wand of mindburst (29) Scrolls (select all with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 2 scrolls of teleportation  H - a scroll of summoning  K - a scroll of amnesia Potions!e - 2 potions of enlightenment  h - 2 potions of invisibility  i - a potion of cancellationk - 4 potions of mutation  q - a potion of attraction65%aggN H - a scroll of summoning  t - 2 potions of heal wounds  u - a potion of magic  z - a potion of haste  C - 2 potions of curingE - a potion of brilliance  G - a grey potion agg6Miscellaneous (select all with })  I - a Gell's gravitambourine (2/2)botaggd(1 turn)  H - a scroll of summoning  h + 2 potions of invisibility[Enter] accept (1 chosen)aggMP aggc deadiverson the CarverHuman of the Shining One ****..Health: 90/90 ========================###########Magic: 11/11 ========================###..........AC: 18Str: 17#.............EV: 13Int: 11########..............SH: 16Dex: 14......................XL: 11 Next: 51% Place: Dungeon:11.......@..............Noise: ---------  Time: 12292.4 (0.0)####..................a) +0 scimitar#..................Throw: 23 darts (poison)#.#######..........#.#..........##..........#..........###........ggd 3H#........As you read the scroll of identify, it crumbles to dust. _h - 2 potions of invisibilityAs you read the scroll of identify, it crumbles to dust. _z - a potion of hasteAs you read the scroll of identify, it crumbles to dust. _E - a potion of brilliance3.4 (1aggg aggj 9 _You drop 2 potions of invisibility.agg)4agg-agg0F _Unknown command.aggagg3aggaggaggP _aggaggagg`aggaggagg=aggaggTagg^,agg aggagg(aggyaggaggaggF#.............#########...........................................<.............####.................#........... agg4#.#######.. #.# #.. #@# #..8.4 (5!.......# #..........# ###.............### #............. ###.......##.... #.. #... #####..agg #... #..... #..... aggaggY+9.4 (6agg agg _ _Found a potion of degeneration.aggT agg agg agg agg agg Baggw ,aggI aggz agg agg^ agg< aggB agg ........< ####.. #.. #.#######. #.# #..####+##.# #..!.......# #..........# ###.......@### #. ###agg. ####  #....# #### #....# #.... #....# #..V   vampire (dormant) #........... #....V....#####agg -302.4 (3agg/ +3.4 (4agg agg agga < ####.. #.. #.# aggX. #.#  ..####+##.#  ..!.......#  ..........#  .......@###  ........#  ####....#  #....#  #....#  #....#  #..... #....agg=3 < ####.. #.. #.# . #.#  ..####+##.#  ..!.......#  ..........#  .......@###  ........#  ####....#  #....#  #....#  agg)4#....#  #..... #....agg;agg<aggEaggI^ _A vampire is nearby!aggm < ####.. #.. #.# . #.#  ..####+##.#  ..!.......#  ..........#  .......@###  ........#  ####....#  #....#  #....#  #....#  #..... #....aggXxB < ####.. #.. #.# . #.#  ..####+##.#  ..!.......#  ..........#  .......@###  ........#  ####....#  #....#  aggAy#....#  #....#  #..... #....aggagg\agg"aggÍ^ _A vampire is nearby!agg ####.... .#######. .####+##!.......#........###.###  ######aggij.. ####.........V.......###### ###aggaggVV.4.4 (1 _aggaggsaggG [ .#######.# .####+##.#!.......#..####  ######.. ####....V.....aggG .#####....#### ### #agg1K agg/R NV.aggR &5aggV aggxY agg #######...# .####+##.!........####  ######.. ####....V.............#####....#### ###..... ####..##agg aggr z  The vampire gestures at you while chanting.agg؊ agg /==6agg: aggk 7 _You resist with almost no effort.aggf.. ####+##!.......#### .. ######.. ####....V...............#####.....##### ###...... #.###..## .##aggqaggu2*agg L V(invisible)The vampire casts a spell.agg9Vagg~E====7aggaggzE _The vampire flickers and vanishes for a moment.agg9  You completely miss the vampire.The vampire hits you but does no damage.agg ;[=---8aggCaggPFU _The vampire closely misses you.agg agg aggeYou barely miss the vampire. The vampire barely misses you.aggaggagg---agg(9aggaggv5 _You block the vampire's attack.agg_ agg` .10.3 (0.9aggg aggj V _You completely miss the vampire.agg1  You hit the vampire.  The vampire is lightly damaged.  You block the vampire's attack. x2; The vampire closely misses you.agg2 -1.4 (1.1agg9 agg=< 5 _You block the vampire's attack.agg  You hit the vampire but do no damage.The vampire is lightly damaged.agg,20agg agg| aggg_The vampire closely misses you. You block the vampire's attack.aggM  You hit the vampire.  The vampire is moderately damaged.aggM&3agg#UaggWt _You block the vampire's attack. The vampire barely misses you.agg-  You barely miss the vampire.The vampire is moderately damaged.aggh/&4agg5agg88 _You block the vampire's attack. x2aggm  You slash the vampire!  aggtyThe vampire is severely damaged.The vampire hits you but does no damage.agg.=5aggKagg5 _You block the vampire's attack.agg_ 9  You hit the vampire.aggn 8*agg  The vampire is severely damaged.The vampire draws life force from you.aggO 8@aggqP ]87--6aggW aggZ > _The vampire is healed by the life force!aggw j  You hit the vampire but do no damage.agg c8--7.3 (0.9agg agg _ _The vampire is heavily damaged.aggj  You hit the vampire but do no damage.aggC8*aggm  The vampire is heavily damaged.The vampire draws life force from you.agg8@aggV6-8.2aggaggc> _The vampire is healed by the life force!aggp2e  You slash the vampire!agg68*agg   The vampire is almost destroyed.The vampire draws life force from you.aggk8@aggZ^2--=agg9.2 (1.0aggT _The vampire is healed by the life force!aggFj  You hit the vampire but do no damage.agg8*agg  The vampire is severely damaged.The vampire draws life force from you.aggS8@aggSS1--agg2T 20aggZagg]> _The vampire is healed by the life force!agg {  You slash the vampire!  You destroy the vampire!agg F.agg7 =3=1.1 (0.9agg agg` X _The Shining One accepts your kill.agg> t ####+#!.......##.## .. ######.. ####....agg .............####............agg aggO #3aggr A=--2.1 (1.0agg agg agg>Iagg@aggE4=agg_Jg5agg}KaggKaggBLaggoMaggMagg+NaggOagg aggKA aggyC aggC aggE agg;F aggG ,agg)H agg!I aggI ,agg4J aggJ aggK aggK agg?L aggM aggO aggO aggqP aggU nagg9V ,aggV agg[ '#......+ #..(...# #......### .........# # agg3[ ##.......# #..  #.......# ....  #.......##### .....  #...........#####......  aggf[ #..............@.......  #.......#######+###.... .........# .........# .........# agg[ w#####<...##....# agg[ agg` 60'..............#agg a .......#........#.........#aggf aggZg M======8.1 (11agg1j aggl = _As you open the door, it creaks loudly!aggWaggaggaggaggagg,aggaggagg agg aggq aggf,agg^agg]aggaggaggagg:agg aggM agg $agg$agg<(agg(agg),agg/aggk7.### ## ...# #.## ...# ####..### #......## ...##### ##.......## aggy88.......#####.........### .......................> ...#######'###.... ...# .... #..@....## ------74.1 (6.0) ...# .......#..../..# #.........#.......# #.........#.......##.........#.......#  .........#.$....# #.......# agg8R #.......#agg=AaggA&------aggA$5.1 (7aggagg ; _Found a stone staircase leading down.aggJ agg.K agg7M aggQ agg2U aggU agg$Y agg|Y aggU] agg] agg _ aggd  #.## # ####..## # aggAe #......## ##### ##.......## ...#####...aggie ###........>..agge #######'###.... # .... #.......## # .......#....@..# agge ~#.........#.......# #..aggf s#.......#  ..agg4f #..$....# #...aggVf 7....# agg|f agg$m +7.1 (2aggm +8.1 (3aggr aggp - _h - a wand of roots (2)agg*y aggy agg~ ,aggB agge Bagg ,aggW agg agg ,agg aggӎ agg agg agg aggp ,agg agg N _You now have 374 gold pieces (gained 14).agg_ Iaggޝ aggq ,agg agg aggU ,agg aggg agg( ,agg ,aggI ,agg agg agg ,agg agg agg) ,agg agg agg ,agg@ agg agg agg agga agg agg ,agg aggP aggA ,agg/ agg agg ,agg agg@ aggA agge agg aggd agg ,agg- agg% aggX Bagg$ ,agg agg q _C - 3 potions of curing (gained 1)agg 3agg agg aggc ,agg agg agg# ,agg agg` aggR ,agg\ agg aggb ,aggE agg4agg ,aggaggagg agg agg aggvagg,agg{aggagg,aggagg2BaggF#O _h - a wand of roots (6) (gained 4 charges)agg%agg9&agg'agg*agg(-,agg.agg31aggk3,aggd4agg6aggs9agg9agg:agg`=agg)@aggu@aggAaggEaggeGaggGaggHagg9KaggQMaggMaggNaggPaggS,agg=TaggVaggYagg`YaggZagg\agg_,aggXaaggvbaggCe,aggyfagghaggj,agg%kaggnaggp,aggpaggragg5t,aggtaggwaggx,aggyagg/{agg|,aggP}agg~aggR,aggaggaggƄ,aggaggKagg։,aggaggagg׏,aggaggagg,aggזaggjagg{agg՛aggaggڞagg,aggaggagg%agg\aggfagguagg,aggaggagg;,aggaggϸaggaggaggaggݾaggU,aggHagg,aggKaggBx _x - 3 scrolls of teleportation (gained 1)aggnaggagg#aggagg,aggoagg2    ...#  ...agg  ...#   agg.. ##+## #..#   #. #.....#..#  agg agg#..#.....#..#   agg#n#..#....>'..#   #..#######@.#  aggK.440.1 (62.0) aggp#...........#   ####.....agg]#   agg....######   ..###+##..#  agg#..#   #..#  agg #..#   #..# agg1^  _You open the door.agg[ _Found a stone staircase leading down.aggaggaggagg agg agge: _agg%  aggThere is an open door here.aggaggn _aggaggaggagg aggagg?aggkaggaggaggaggaggaggIaggagg agg !aggZ!aggB"agg#,agg#agg$agg%agg%agg%agg'agg(,agg%)agg#*aggR+,agg+agg,agg-agg-aggS.agg/agg0,agg0agg2agg3agg4agg4aggh6agg8,agg9agg>Bagg?aggTAaggB,agg2CaggDagg.E,aggEaggFaggGaggHaggHaggJaggyL,agg6MaggNaggQaggQagg,RaggSaggTaggTaggUagg}VaggcWaggWaggXagg~Y7 _You open the door.aggZaggZagg3[agg]@  There is an open door here.agg^agg_ _agg*`aggFbaggcaggcagg>dagg%eaggiN#........#.....# aggi###........ #.....# #.......... #.....# ####.......... #.....###### .............. #........... agg:j .............. #..........# .............. #..........# ...............#######..........# ##.........###..@......##+####..#65.1 (25  ##.......## #..###'#..#.....#..##......## #..#...#..#.....#..#aggaj####..## #..#...#..#....>'..# .## #..#...#..#######..# #..#...#...........# #>.#####...........#aggj #.. ..........###### ..###+##..#aggdnaggn,6.1 (26aggqaggNs9 _Found an escape hatch in the floor.agg4/ agg/ agg0 agg3 agg6 aggy9 Bagg: ,agg; agg= agg> agg? agg? aggMC aggpE aggE aggIF agg?H aggJ ,agg{K agg{M aggO agg P aggP aggR aggU ,agg.V aggX agguZ ,aggL[ aggM] aggA_ ,aggB` agga aggc aggc aggd aggh aggk aggk agg`m aggqp aggfs ,agg2u aggw aggDz aggsz agg{ agg~ agg/ agg_ agg agg agg agg3 agg aggB aggЎ agg agg aggԖ ###########  #..........  ............ agg .............  ...  .# . agg* ..# #######...# aggC r........# #aggt .......@.......  agg .................# .................# agg {...........#######...aggڗ ..####.........# #.....#agg #.........# #.....#agg l###.........# #agg/ #...........# #.....# aggF U###...........# #.....#######agg_ E agg ,82.1 (1agg{ ,3.1 (17agg agg 5 _D - a ring of poison resistanceagg agg\ agg agg agg agg Bagg& ,agg aggO aggʮ agg aggE aggt agg agg agg agg agg ,agg agg agg agg agg agg agg agg+ agg agg aggx ,aggL aggZ aggo agg agga agg agg agg{ agg i _k - 5 potions of mutation (gained 1)agg agg agg ,agg agg5 agg agg agg agg agg agg= agg",aggaggaggaggaggaggcaggL ,agg agg aggaggagg,aggaggagg,aggHaggaggCagg`aggagg4aggb,aggagg agg!,aggn"agg'$agg%,agg&aggP)aggb*,agg+aggo,agg-agg-aggf.agg0aggm1,agg1aggK3aggu4,agg5agg7agg8agg 9agg9agg:agg;agg;agga<agg=agg/?,agg?agg@aggA,aggiBaggtCaggDaggDaggMEaggMFaggG,aggbHagg@LaggM,aggNaggBOagg.Q,aggdQaggSaggU,aggVaggWagg!YaggGYaggAZaggZagg[,aggw\agg]agg^agg^agg#_agg`agg#a,aggaagg}bagg=c,aggcaggsdagg_eaggeaggeagggagggagggagghagghaggiaggiaggjaggjaggkaggkagg!lagglaggmaggnaggEnaggoaggAq,aggqagg*uP  There is an escape hatch in the floor here.aggxK _agg{agg},agg3~aggaggaggaggaggagg,aggjaggljagg,aggWaggaggo,aggۍaggΎagg,aggבaggagg0agg\aggagg̗agg,aggxaggqaggĢagg.........#######..........# .....###.........##+####..### #..###'#..#.....#..### #..#...#..#.....#..### #..#...#..#....>'..# .## #..#...#..#######..# aggF6## #..#...#...........# #>.#####...# aggs#........@....###### #.....###+##..# ## #.....# #..# .## #.....# #aggң..# ..## #.....# #..# ...## #.....# #..# ....## #.....# #..# .....###.....# #..# .......>.....# #..#aggGU543.1 (60'...aggV....##....##....##....##....#aggaggmM======4.1 (61aggagg= _As you open the door, it creaks loudly!aggaggaggagg*agga,aggagg@  There is an open door here.aggagg_ _agg,aggeaggaggaggcaggaggaggaggagg=aggSagg|agg+aggagg*aggbaggaggXaggaggѭaggaggaggagg ,aggaggagg,agg@aggaggպaggaggaggaggaggÿagggaggR  There is a stone staircase leading down here.aggtagg _aggaggaggaggaggagg9aggN,aggaggagg,aggaggqaggaggaggaggaggaggaggaggaggBaggagg9aggaggaggaggaggaggaggagg[aggagg5aggaggb agg agg5 agg agg_ agg agg0agg+agg,aggagg@  There is an open door here.aggagg@ _aggaggaggaggaggaggagg"",agg"agg5%aggV&aggz&agg&agg)agg+agg,agg,agg/agg1,agg82agg3agg4agg4agg5agg6agg8agg9agg9agg3=@  There is an open door here.agg5?agg? _agg`@aggAaggBaggBagg0CaggGDaggoEaggEaggEaggFaggGaggGaggHaggHaggIaggIaggJaggWMagg(PaggPaggpQaggTaggVaggVagg XaggZagg]agg^aggc_aggvaaggScaggcaggdaggfaggQi,aggXjagglaggo,agg8paggqaggs,agg_taggeuaggw,aggyaggW{agg}agg&~agg aggDagg,aggOaggIi #..................... ##.......#######'###... .........#.........#... ..........#.........#... ..........#.........#... ######<...#.........#... #....#.........#... #....#.........#... #.@..#.........#...------ #....###.......#...agg #......#.......#... #......#########... #.................. #.................. #......aggq.....####### ........... agg).agg-92.1 (48aggPK------3.1 (49aggsD _J - a scroll of identifyaggaggaggaggYaggagg<Baggagg,aggaggagg,agg aggaggaggaggaggUagg],aggLaggyaggl,aggraggaggaggaggHagg&agg-,aggaggagg1aggtagg6aggfagg,agg`aggagg,agg#aggM agg< aggv agg= aggagg,aggaggaggBaggaggaggaggYagg)Jagg+agg,agg0Xagg2BaggJ4agg5agg6agg6agg8agg9,agg$:agg;agg=,agg>agg?aggAaggAaggkBaggXCaggDaggEagg}EaggGagg5NaggtOagg*QaggQaggRaggnYaggZ,agg[agg^aggqXaggqraggragg%sagg'uaggvaggwaggbwaggyaggzagg"{agg{agg}agg,aggagg݁aggaggaggraggoaggnaggaggaggagg,aggaggtagg7aggbagg:agg\agg1aggaggaggaggkaggaggHagg;aggaggaggaggJaggXaggaggaggPaggaggaggaggagg8aggagg^agggaggaggaggagggaggjaggaggaggaggķaggaggagg!aggaggaggʼaggڽaggY,aggagg|aggaggZaggaggaggaggaggaggjaggaggagg{aggagg #......#......:... #......#######.... #............... #...............######...........##......................# ......................# ......................# agg=a.......@....####......# 646.1 (53......#####.# #......##..... #.# #...........> #.# #..######### #.# #..# ### #### aggmagg8agg,7.1 (54aggpagg; _Found a stone staircase leading down.agg3aggaggdaggzagg,agg1agg!aggK"agg#agg&agg- #....#....... #....#........ #....###..## #......#aggR.:....# #......### #...# #.agg.8..<######..........................9.1 (2.0)#.......................#.$.....................#..............####.............#####.# #.....agg/#........# #.# #.....#.....>..# #.# #..############# #.# #..#aggM/G### ####agg7agg8,50.1 (3agg?agg[B9 _Found a stone staircase leading up.agg) agg agg agg5 agg6 aggA Baggi% ,agg&( agg7+ aggV. ,agg/ agg2 aggj5 ,agg6 agg> / ..........# #...............# #....#######<...######....# #....#........# #....#....# #....#...# #....##....## ## #.# #...# #....<######............####..............  #.$.................  #..............####. #........#####.# #. You pick up a book of Flames and begin reading...aggC +4.1 (4aggD +5.1 (5aggG aggbJ T _You add the spells Inner Flame and Flame Wave to your library.agg1aggaggagg;agg,agg ,agg#agg8$agg%agg(agg*agg8+agg ,aggy-agg/agg/agg0agg3aggP6agg6agg7agg:agg@<,agg<agg?,agg?aggBN _You now have 385 gold pieces (gained 11).aggCaggJCaggCagg)EaggTFaggFaggGaggIaggJaggJagggKaggLaggM,aggQNagg`OaggaP,aggPaggQaggRaggSagg|SaggTaggUaggUaggVaggWaggXaggTYaggYaggZagg[agg[agg,\agg]agg_agg_agg`aggbaggjfBagg-gagg hagg1hagguhaggaiagg6jagg[jaggjaggmkagg\nXaggIpBaggpaggq,aggTraggraggsagg tagg^tagg-uaggvagg!waggwagg=zagg~W  #....  agg~........# #....   #.......# #..(.   #.......## ###....   #......... ....... agg~  #......... ####...   #......... #.... agg  #......... #   #.@......< #aggB80.1 (25.0)   #.#####... #   #.# ## aggts  ##.# agg  #..#   #..# #... agg .# #....#######<  .#####....#  .agg/...# aggwagg,1.1 (26aggagg{ agg3_Found a stone staircase leading up.agg_aggUaggagganagg aggaggbaggagg(aggCaggaggaggaggG,aggaggagg,agg?aggagggaggaggaggagg,aggtaggagg,aggzaggxagg`aggaggaggagg ,agg aggX agg0 ,agg agg7 _You open the door.agg3aggaggagg%aggcaggaggagg],aggaggagg aggkaggaggiagg agg agg!aggx$P  There is a stone staircase leading up here.agg&agg}& _agg7'agg(agg +agg+agg,agg.agg1agg&2agg3aggL5aggk7agg7agg}8agg:agg;aggS<aggd=agg@7 _You open the door.aggBaggCaggCagg8F@  There is an open door here.agglGaggG _aggdHaggJaggQBaggVaggsV,aggWaggqZagg\,agg]aggj_aggb,aggcaggeaggBhagghaggoiagglagglaggmaggrN _You now have 408 gold pieces (gained 23).aggStaggtagguaggazaggz,agg}aggagg,aggfagg^agg,aggqagg _You open the door.agg@  There is an open door here.aggaggc _agg agg)aggaggaggaggjagge,aggaggsagg,aggagg1agg#,aggaggsagg" .. ... .. ..# ####. agg#..# # #..# # #..# # .#######..# #agg O.........# #####aggū #@..###+###... aggs#................# aggA+..######........# #..#....#........# agg##+###..#....#..# ........#....#### O   two-headed ogre (asleep)aggn ........'....#......#aggì ........#....#......+agg߬ agg#.......#....#..(...#agg+.721.1 (40agg,2.1 (41aggagg _A two-headed ogre comes into view. It is wielding two +0 giant clubs.agg ...  ..#  #..#  #..#  #..#  .#######..#  agg0O.........#  #@..# #........ +..###### #..#. ##+###..#. agg........#. ........'.  ........#.  .(...# aggp ...  ..#  #..#  #..#  #..# agg  .#######..#  O.........#  #@..# #........ +..###### agg2#..#. ##+###..#.aggh ........#. ........'.agg ........#. .(agg agg64aggaggf _A two-headed ogre is nearby!agg)B ...  ..#  #..#  #..#  #..#  .#######..#  O.........#  #@..# #........ +..###### #..#. ##+###..#. ........#. ........'.  ........#.aggBA  .(...# agg  ...  ..#  #..#  #..#  #..#  .#######..#  O.........#  #@..#aggM  #........ +..###### #..#. ##+###..#. ........#. ........'. ........#.agg _ .(agg aggz agg agg f _A two-headed ogre is nearby!aggL ((((((OYou throw a poisoned dart.  The poisoned dart hits the two-headed ogre.agge aggKg |(O.....agg h :==3.2 (1.1)aggRh 02aggqo aggir ; _The two-headed ogre shouts in stereo!agg ~ (((((You throw a poisoned dart.agg- agg6 [(O....agg6 a--4.31agg= agg6A A _The poisoned dart hits the two-headed ogre.agg (((((poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.aggaggaggƊh..O..aggts--5.40aggǑaggu6 _The two-headed ogre is poisoned.aggfI ((very poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.aggagg?P.O.agg{Y6.519agg1agg< _The two-headed ogre looks even sicker.agg (You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.  The two-headed ogre looks even sicker.aggG'agg.M(Oagg/X7.68agg5agg8= _The two-headed ogre is lightly wounded.aggN  You slash the two-headed ogre!  The two-headed ogre is lightly wounded.aggP 4=80agg'T aggV @ _You block the two-headed ogre's attack. x2agg| C  You slash the two-headed ogre!agg< 5=9.5 (0.9agg agg g _The two-headed ogre is heavily wounded.agg2  You slash the two-headed ogre!  The two-headed ogre is almost dead.The two-headed ogre hits you with a +0 giant club.agg?Y86--30.4aggaggz\ _The two-headed ogre barely misses you.aggݑ  You slash the two-headed ogre!  The two-headed ogre is almost dead.aggf7=-1.4 (1.0aggaggI _The two-headed ogre hits you but does no damage. x2aggA  You hit the two-headed ogre.aggC)agg  62-2 _You kill the two-headed ogre!aggV'agg)g _Your Armour skill increases to level 7!agg  ... ... ..##### #..# # #..# # #..# #..#######..# #.((...(@...# #####..######...###+###...... #........ +..######. #..#....#agg@. ##+###..#....#........ ........#....#.## ........'....#......# .#....#......+agg'agg28=--3 aggr _aggagg  Things that are here: _a +0 giant club; a +0 giant clubagg# agg 8-agg agg agg%    ...  ..# #### #..# # #..# # #..# #.#..# #.((...@)...# #####.######...###+### #. +..###### #..#....#agg  ##+###..#....#  ........#....#......#  ........'....#......#  .#....#......+ agg aggagg594 _aggagg!aggS"[5.4 (29agg&agg *` _f - 19 poisoned darts (gained 1)agg      ...   ..# ####   #..# #   #..# #  . #..# #  .#..# #  aggW.((..@.)...# #####  .######...###+###  . #..   +..######   #..#....#   ##+###..#....#   agg.#....#......   .'....#......   .#....#......aggaggaggaggS90=6.4 (1aggagg agg      ...   ..#   #..#  # #..#  #.. #..#  #....#..#  #...((.@..)...#  #....######...###+###  #.. #...  # +..######   #..#....#   ##+###..#....#  agg .#....#   .'....#   .#....#agg8agg&7aggaggagg      ...  # ..#  #. #..#  #.. #..#  #... #..#agg  #....#..#  #...((@...)...# agg  #....######...###+### agg7 #... #... aggU~ #/. +..###### aggqB#. #..#....#aggS # ##+###..#....# aggįY .#....#  aggk.'....#  .#....#aggaggָ&8agg'aggT _Found a wooden wand.agg?    #.  agg? #. ...   ####. ..#  agg^@  #.... #..#  #.... #..#  #.... #..#  #....#..# agg@  #...(@....)...# agg@   #....######...###+### agg@  #.... #  #/... +..######agg@ {  #.... #..#....# aggYA  ##...##+###..#....# #....#....# #....'....#  aggA ..#....#aggI aggJ &9aggnO aggW aggX y=40.4 (220agg?^ agg` ` _f - 20 poisoned darts (gained 1)aggv     #..   #.# ...   ####.# ..#   #....# #..#  #....# #..#agg   #....# #..#  #....#..#  #...@.....)...#  agg  #....######...###+###  #....# # agg4  #/...# +..######  #....# #..#....#aggN g  ##...##+###..#....# aggy  #.....#....#  #....agg k.'....#  .#....#agg aggv +1.4 (1agg agg agg [2.4 (21agg" agg ` _f - 21 poisoned darts (gained 1)agg3aggaggaggbaggƩBagg,agg agg%aggagg*aggagg ####.#..# ..# #..# ...# #..#  #....# #..#  #....#######..#  #.........)...#  #....######...###+  #....# #.......  #@...# +..####  #....# #..#....  ##...##+###..#  #...........#..  #...........'..  ............#..  #####.......#..  #.......##'##  #..........agg+5.4 (3agg+6.4 (4aggagg. _M - a wand of flame (12)aggD\agg\agg;]aggaagg?caggDdagghXagg[iaggOkaggxm,agg?naggpaggsaggsaggtaggwaggyaggyaggzagg}agg,aggaggagg,aggagg^T  #.........)...#  #....######...###  #....#....  #....# +..####agg  #....# #..#...  ##...##+###..#...  #...........#...  ####...........'agg  #.@............#...  ########.......#agg E  #.......##'# agg.q #.  #.........##aggNC  #.........# aggk@ #.........# aggQ #........<#. aggJ #.#####...#agg;,53.4 (7aggݚ+4.4 (8aggagg0 _N - a wand of charming (3)agg5 agg5 agg86 agg/; agg= aggrB BaggB agg C aggC aggF aggH aggH aggJ aggL aggO aggP aggGQ aggS agg|V aggV aggW aggY aggs\ agg\ agg^ agg` agg c ,aggUd aggrg agg$j agghj aggk aggjo  aggo 1_You open the door.aggr aggr aggs agg{ @  There is an open door here.aggR} agg~  _agg agg^ agg ,aggƄ agg҇ agglj ,agg agg 7 _You open the door.aggO agg aggw agg @  There is an open door here.agg/ agg՗  _agg{ agg˙ agg aggH aggܛ agg aggr agg agg agg agg agg9 aggF aggn agg aggɪ aggY agg aggb  ..  ...[.. ..####+ ..... ..! ##.... ........ #.. ..... .....agg  #.# #... .....  ####.# #..# ####.  #....# #..# #.  #....# #@.# #.72.4 (18.0) agg  #....# #..# #.  #....#######..# #....  #.........)...# #####  #....######...###+###agg ,..  #....#....#.......#  #....#....'..###### agg; #....#....#..#....#.#  ##...##'###..#....#........#agg8 aggz agg %3.4 (19agg agg $ _Found a cloak.agg[3agg@\agg_aggafl ##....).. .. #...[.. ..####+##...! aggf###.#.. ...# #.# #... ........#agg!g####.# #..# ####....##....# #.@# #....#0.0)#....# #..# #....#aggDg#....# #..# #....#aggfgq#....#######..# #.aggg#.........)...# ######....######...###+###..aggg#....#....#.........####....#....'..#####aggg6#....#....agggsagguw+4.4 (1aggyagg% _Found a dagger.agg{baggMfaggi,aggkagg3oaggtaggKtaggvagg|agg ,agg3aggagg݉agg"agg/aggaggaggaggaggϦaggSaggagg agg,E#########. aggv...........######## . ........<........# .# ####agg......#####.# #agg  #..........# #.### #....).....# #.#  #...[......####+##.#  agg/#.....@....!.......#  #######..................#  agg#.........................###  #.# ####.................# ##.# #..###########....# ...# #..# #....# ##agg  ...# #..# #....# #.  ...# #..# #....#####.  ...#######..# #...agg"E agg,81.4 (7agg+2.4 (8aggaggE1 _O - an amulet of reflectionaggaggwaggaggaggBaggaggJX # ##########.. D........######## . ........<agg.......# .# ####.............#####.# #.......#..........# #.#######....)..@..# #.# agg #...[......####+##.#  agg#..........!.......#  #######.... agg4~.........................## .aggX# ####.................# D   acid dragon (asleep)# #..###########....#aggq# #..# #....# ##### #..# #....# #...agg+3.4 (1agg+4.4 (2aggagg_ _An acid dragon comes into view.aggt  ## D. ######## . < .......# .# aggt & ......#####.#  #..........#  #....)..@..# #.#  #...[......#  #..........!..  ..................# ................###  ####.................# aggu  #..###########....#  #..# #....#  #..#  aggh 5 agg ,## D. ######## . < .......# .#  ......#####.# agg  #..........#  #....)..@..# #.#  #...[......# agg}  #..........!..  ...............agg ............... ####.................#  #..###########...agg  #..# #....#  #..#  agg aggu agg agg+ agg0  agg1 aggg1 ?_An acid dragon is nearby!agg1 aggr  ## D. ######## . < .......# .#  ......#####.#  #..........#  aggR g#....)..@..# #.#  #...[......#  #..........!..  ..................# ................###  ####.................#  #..###########....#  #..# #....#  #..#  agg#J ## D. ######## . < .......# .#  ......#####.#  #..........#  #....)..@..# #.#  aggJ#...[......#  #..........!..  ..............................aggJp ####.................# aggJe #..###########...aggJ #..# #....#  #..#  aggUTaggTagg*]agg_c _An acid dragon is nearby!aggLW ###### agg#.############ .D...######## .. ........<.......# .# ####.agg*......#####.# #........#........@.# #.#######aggx#....).....# #.# ##...[......####+##.# # #.!.......#agg?c #  #######......#aggf # ...........### # ####.................#agg[ # # #..###########....# # #..# #....# #####aggagg)5.4 (1 aggP _aggYaggoaggL  ####### #.############# #.D...######## #.. ........<.......# #.# ####.......#####@# #.........#..........# #.#######.#....).....# #.# #.#...[####+##.# #. #.!.......# #. #######.......# ## ............###  ####.................# # #..###########....# #.agg agg&6agg@aggagg" " ################## #.D..........aggV# y#######..........<. #@# ###......#####.............#####..).....# .[......####+## #..........!. #######....agg# !..## ..........agg# i.######.............#agge. agg. &7agg6 agg8 agg ################## #.D.#######..........<. #.#######......#####agg...........#####.).....# [......####+## #..........!. #######........## ......##agg DDThe acid dragon roars!aggE====8aggagg#| _You block the acid dragon's attack. The acid dragon barely misses you.agg # You slice the acid dragon!!  The acid dragon is severely wounded.The acid dragon bites you but does no damage.===-9 _You block the acid dragon's attack.agg  You hit the acid dragon.  The acid dragon is almost dead.agg86-----90aggaggDs _The acid dragon barely misses you. The acid dragon claws you.aggu e  You barely miss the acid dragon.agg  agg: B7=---aggh &1.3 (0.9agg)# agg% _ _The acid dragon is almost dead.agg (catching breath)You hit the acid dragon but do no damage.The acid dragon is almost dead.agg- q  The acid dragon spits acid at you.aggQc aggc Z73----======aggd &2.3 (1.0aggsi aggj 2 _The splash of acid hits you!agg=?  You slash the acid dragon!aggIE.agg_e4=-----3aggiaggkO _You kill the acid dragon!agg ######## #.############# aggx#..######## #...........<.......# #.#######.......#####.# #.........#..........# #.#######.#....).....# #.# #..agg #...[......####+##.# #..  #..........!.# #..  ######.# ### aggagg4----------4agg_aggaggi7 agg7 agg9 aggQ= agg= aggB agg C aggGC aggD agg H agg]H K5=aggJ aggL ,aggvN aggQ ,agg&S agg\ 6=agg#_ agg_ %7agg#a aggc aggc agge aggg ,aggh aggk aggl %8aggm agg+s ,aggdu agg#z ,agg| agg agg1 K9=agg agg ,aggC aggk ,agg agg agg O80=agg aggÑ aggr agg agg agg, agg agg agg %1agg agg agg agg_ agg ,aggm agg% aggw %2aggJ agg} agg aggI aggf ,agg agg a3=agg0 aggm agg agg aggj agg agg 84=agg agg aggq agg agg agg ,agg agg aggo %5agg agg ,agg agg agg> agg agg agg %6agg agg ,agg agg; ,aggD agg: agg agg D7=agg" agg ,aggX agg ,agg aggP agg U8=aggk agg ,agg& agg ,agg agg; agg} %9agge aggh ,agg aggN agg agg agg# agg~# $90agg# (=aggq% agg>, aggV/ ,agg|1 agg4 agg7 aggE8 aggx9 agg> aggOA ,aggC agg8F aggI aggJ 9=agg]L aggP agg8T agg~T aggLV agg<` aggb aggb agg&d agg4h aggq aggOr aggu aggz u  You see here a potion of degeneration.agg;~ agg~  _agg agg aggH agg agg agg agg' aggz agg agg$ agg agg agg aggޔ aggƗ agg agg aggN 7 _You open the door.aggH agg agg aggk @  There is an open door here.agg agg%  _aggb agg aggү agg agg aggP agg agg۳ aggx agg aggJ aggy agg agg, u  You see here a potion of degeneration.aggT agg  _aggJ aggE aggN ,agg agg@ agg agg/ agg$ aggG agg aggP agg agg agg agg0 agg, agg agg agg5 agg agg aggK agg agg agg aggH agg agg aggf agg agg ,agg aggd ,agg( aggS agg agg agg agg6 agg ,agg agg# agge agg agg? aggG aggE ,agg agg agg agg ,agg agga ,agg agg` agg agg. aggn aggZ agg agg= aggt aggO agg aggO agg agg agg+ aggh agg agg! agg# aggW# agg# aggl% agg& agg' agg2( agg( agg* ,agg+ agg, agg^. agg. agg6/ agg7 agg8 agg8 agg9 agg= aggF@ ,agg|A agg"E agg:G ,aggG aggI aggFK aggK agg~L aggGP aggR agg6S aggT aggV aggY aggY aggo^ agga aggqf aggf agg*i aggXm aggp aggp aggr aggu agg@y aggy agg{ agg~ agg agǵ agg aggg agg aggŌ agg agg aggǒ ,agg0 agg agg4 aggq agg agg˘ agg aggp agg aggn agg agg& agg aggԣ agg^ agg agg agg\ agg ,agg aggI agg ,aggh aggص aggƸ agg agg\ agg6 aggQ i#.#######.................# ###.# #..###########....# ....# #..#........ #....# # ....# #..#....... #....# # ....# #..#...... #.... agg [....#######..#.V... #..... .........)...# ... #####... ....######...###'###..........### ....#....#......##### agg - ....#....'..####### ....#....#..#....#........# aggn ~#...##'###..#....#........# #.....#....#...... #...........'....#...... V   vampire (dormant) ............#....#......+ #####.#....#..(  #.##'#####aggf L 90006.0)  You open the door.aggK y.VVagg ,17agg agg  aggE L_A vampire comes into view.agg  .  #..##########  #..#........   #..#.......   #..#...... .#..... )...# .V. ######...###'###....#......@....... '..######........# .......# ......# ...### ..# .+ (...#   agg 0 .  #..##########  #..#........   #..#.......   #..#...... .#..... )...# .V. ######...###'###....#......@....... '..######........# agg y.......# .........# .+(...#  agg- 4aggf t _A vampire is nearby!aggB. .  #..##########  #..#........   #..#.......   #..#...... .#..... )...# .V. ######...###'###....#......@....... agg'..######........# .......# ......# ...### ..# .+ (...#   aggQ .  #..##########  #..#........   #..#.......  agg #..#...... .#..... )...# .V. ######...###'###....#......@....... '..######........# .......# .........# agg .+(...#  agg*aggo*agg2agg5^ _A vampire is nearby!aggP$ .  #..##########  #..#........   #..#.......   #..#...... .#..... )...# .V. ######...###'###....#......@.......aggHQ '..######........# .......# ......# ...### ..# .+ (...#   agg7 .  #..##########  #..#........   #..#.......   #..#...... .#..... )...# .V. ######...###'###....#......@....... agg'..######........# .......# .........# .+(...#  agg4aggYagg^ _A vampire is nearby!aggEYi........##  #.#######............. ###.########### ...#....#....#  #..#.........#....############..#........ #.....)...#..V..#####...#####...###@###..........####........####aggMZ'..######. ....#......##'###.......#.....### #'....# .........+ ####....#..(#aggeO=2.0)aggoaggs _You block the vampire's attack. The vampire closely misses you. _There is an open door here.aggm(( agg( You slash the vampire!  The vampire is moderately damaged.agg)5=3.2 (0.9aggy6 _The vampire barely misses you. You block the vampire's attack.aggz  You hit the vampire but do no damage.The vampire is moderately damaged.agg0 `83---4.1agg. aggJ j _The vampire hits you! The vampire barely misses you.aggc  You hit the vampire but do no damage.The vampire is moderately damaged.The vampire hits you but does no damage.agg  d4---5.1 (1.0agg agg U _The vampire closely misses you.agg  You hit the vampire but do no damage.The vampire is moderately damaged.agg&:*agg V(invisible)The vampire mumbles some strange words.agg}V====6.2 (1.1aggWaggE _The vampire flickers and vanishes for a moment.agg  You hit the vampire.  The vampire is moderately damaged.=---agg$&7.1 (0.9agg7aggu _The vampire closely misses you. You block the vampire's attack.aggWP  You hit the vampire but do no damage.The vampire is moderately damaged.aggIQZ5---8.0aggYXagg[8 _You block the vampire's attack. x2agg  You hit the vampire.  The vampire is moderately damaged.9.0 (1.0 _You block the vampire's attack. x2agg You hit the vampire.  You hit the vampire but do no damage.  The vampire hits you but does no damage.aggζ '10agg agg U _The vampire closely misses you.agg@  You slash the vampire!  The vampire is severely damaged.You block the vampire's attack.aggNA ;6=9 (0.9aggI aggK ? _The vampire bites you but does no damage.agg]  You slash the vampire!  The vampire is almost destroyed.The vampire hits you but does no damage.31.9 (1.0 _The vampire bites you.agg,  You hit the vampire.  You destroy the vampire!The Shining One accepts your kill.agga5E.agg;E66-2.8 (0.9aggBaggyE& _You feel better.aggnagg8-agg)%agg(H _No target in view!aggB3aggNDagg[GaggDL7= _agg'MaggP,agg3RaggTaggKUU8=aggTVaggX,aggYagge\,agg_agg_aggs`%9aggaaggVdaggdaggeagghagg\haggiagglb90=aggmaggsagg3uagg{uagg vaggh~aggagg>aggagg҆@  There is an open door here.aggaggΊ _agg6aggaggϐagg9=aggRnaggaggagg͞aggagg(aggaggaggaggaggBaggagg-aggaggϹaggaggM..)...#.....#####..... ###...###'###..........#####..... ..#................##### ##....'..######........# #....#..#....#........# ####. aggJ###..#....#........# #..#....#......####+# ##'....#......#ßßß.## .#....#.....@'...hß# -agg.#....#..(...#ßßß.## .##'###......####+# ##...............# #. aggiy.......#####.......# ####. .#...#.......# #.... h   howler monkey (asleep) .#...#.......##### ##....<#...#...........#####........#...#.....................aggJ 31.8 (19.0)  You open the door.aggF-2.8 (20aggeagg` _A howler monkey comes into view.agg ).'###.................##### #........# #........# #........# #......####+# #......#ßßß.## #.....@'...hß# #..(...#ßßß.## #......####+# ..........# ###.......# #.......# #.......##### <#...#........agg9 4).'###.................##### #........# #........# #........# #......####+# #......#ßßß.## #.....@'...hß# #..(...#ßßß.## #......####+# ..........# ###.......# #.......# agg #.......##### <#...#........agg agg agg agg d _A howler monkey is nearby!agg[ 7).'###.......agg v..........##### #........# #........# #........# #......####+# #......#ßßß.## #.....@'...hß# #..(...#ßßß.## #......####+# ..........# ###.......# agg3 [#.......# #.......##### <#...#........agg)>).'###.................##### #........# #........# #........# #......####+# #......#ßßß.## #.....@'...hß# #..(...#ßßß.## #......####+# ..........# ###.......# #.......# #.......##### <#...#........agg CaggCaggLagg'Pd _A howler monkey is nearby!aggL)...#.....#####....###'###..........#####. .#.........##### ##. .'..######........# #. .agg:#..#....#........# ####...#....#........# #.##....#......####+# #'....#......#ßßß.## #....#....hß# #....#..(...#ßßß.## ##'###......####+# #..# #.######.......# ####.agg P#...#.......# #.#...#.......##### ##.<#...#...........#####....#...#.aggagg*aggrah..hagg;===3.8 (1.0)aggAaggZ  You open the door. _A howler monkey comes into view. aggB_A howler monkey is nearby! _is nearby! _The howler monkey howls!There is an open door here.agg)...#.....#####. #...###'###..........#####. #........##### ##. '..######........# #. #..#....#........# ####..# #..#....#........# #.#agg#....#......####+# ### '....#......#ßßß.## #....#......'@h..ß# #....#..(...#ßßß.## ##'###......####+# ### ....# aggg#.######.......# agg ####..##...#.......# #.#...#.......##### ##.agg1X<#...#...........#####....#...#.agggagg/--4aggiaggZ _The howler monkey barely misses you.agg  You slash the howler monkey!  The howler monkey is heavily wounded.agg@V=-5.7 (0.9aggRaggD _The howler monkey hits you but does no damage.aggNx  You hit the howler monkey but do no damage.The howler monkey is heavily wounded.-6.6agg܋ i _The howler monkey misses you.agg   You hit the howler monkey.  The howler monkey is almost dead.-7.6 (1.0aggC ^ _The howler monkey completely misses you.agg.A  You slash the howler monkey!agg7q†agg=.78aggGg _You kill the howler monkey!aggaggaggAagg+H _No target in view!aggaggWagg6aggTagg@agg: _aggi  You see here a howler monkey corpse.aggf"agg # _agg$agg%agg:',agg'agg+agg}5S.#.........#... .#.....#####..... .###'###...#####.........# ..............##### ##.......## ######........#o#.+ #......## agg56..#........##..# ####..## #....#........#... #.## #....#......####'# ### '....#......#ßßß@## - #....#......'.†..ß# #....#..(...#ßßß.##  ##'###......####+##agg|6H##.........# .#######.......# ####..## o   orc wizard (asleep)agg6/#...#.......# #......###...#.......##### ##.......## .<#...#...######aggYCF 41.6 (3  You open the door.aggSDE-2.6 (4aggGKaggUYz _An orc wizard comes into view. It is wielding a +0 dagger.agg* #####.........#####...... .###'###....#####.. ......#### #.## ######o#.+ #......####..# ####..##..#...#.## #####@# ### '...#ßßß.##....'.†..ß# #....#..(...#ßßß.## agg  ##'###......####+###..... #.## ######..## .##### ###agg  aggq( b.ooagg) +3.6 (1aggE3 aggs8 Q _There is an open door here.aggH% #####.........#####...... .###'###....#####.. ......##### #.## ######.#.+ #......###o####..##..#.@.#agg%.## #####'##### '...#ßßß.#....'.†..ß# #....#..(...#ßßß.# ##'#######+### .....agg;& .########..## agg1agg 2.=4agg7agg;A _The orc wizard hits you but does no damage.agg  You hit the orc wizard.  The orc wizard is heavily wounded.agg!-5.7 (1.1aggaggX _The orc wizard closely misses you.agg'  You completely miss the orc wizard.The orc wizard is heavily wounded.agg)[88-60agg/agg3? _The orc wizard hits you with a +0 dagger.aggw  You barely miss the orc wizard.The orc wizard is heavily wounded.agg_6--7aggAaggm? _The orc wizard hits you with a +0 dagger.agg[ >  You slash the orc wizard!agg C)agg" \7==8agg' aggI) N _You kill the orc wizard!aggz agg` agg agg H _No target in view!agg3aggaggagg$ _agg@aggaggaggaggagg-U8=agguagg,aggRaggagg %9aggagg[agg+aggwagg,aggagg?aggL90=agg aggaggaggRaggaggaggagg#aggaggM###########....# # #.#....# ##### #.#....# # #.........#....##### #.........#.....agg. #.....#####...............'###...#####...## ......##### ##.......## #####.#.#@+ #......##-- ....#..##).# ####..## ....#.agg`!.#...# #.## ....#......####'## ### ....#......#ßßß.## ....#......'.†..ß##..(...#ßßß.agg!## #'###......####+# ##.....#  #.##agg###...##'...T#50.0)###+#T   troll (asleep)aggl  As you open the door, it creaks loudly!  A troll comes into view.agg T.Taggu M======9.7 (11aggUagg' _The troll shouts!aggo ....# #. .#....# #####. .#....# #. .#....#####. .#. .....#####.'###.#####.######...##.## #.#.#.@..T.#......## ##.##).####+####..## ##.#...# #.## ##......####'## ### ##......#ßßß.## ##......'.†..ß# ##..(...#ßßß.## # '###......####+# ### ## #.## #T.=------60.7 (1.0) _There is an open door here.aggh....# #.#....# #####.#....# #.#....#####.#.#####. #'###.#####.###.#####...##.## #..#.#.'@T..#......## #.#.##).####+####..## #.#.#...# #.## #.#......####'## ### #.#......#ßßß.## #>#......'.†..ß# #.#..(...#ßßß.## #. ###......####+# ### #.# #.## #.aggrJ=-----aggr1aggxagge{s _The troll barely misses you. You block the troll's attack. x2agg?  You slash the troll!  The troll is moderately wounded.agg.=2agg#aggL6 _You block the troll's attack. x3aggT  You hit the troll.  The troll is moderately wounded.aggU.-3agg`L _You block the troll's attack. x3agg (poisoned)You throw a poisoned dart. The poisoned dart hits the troll.  The troll is poisoned.aggH  The troll is moderately wounded.You block the troll's attack. The troll barely misses you.-4.8 (1.10aggagg!3 _You block the troll's attack.aggP  aggӄ agg V(((You throw a poisoned dart.agg T.The poisoned dart completely misses the troll.The troll barely misses you. You block the troll's attack.agg Y5.919agg agg$ R _The troll barely misses you.agg  ( agg very poisoned)You throw a poisoned dart. The poisoned dart hits the troll.  The troll looks even sicker.agg  The troll is moderately wounded.The troll bites you but does no damage. The troll completely misses you.aggϖ B7.08agg aggy aggm 3 _You block the troll's attack.agg   You slash the troll!  The troll is severely wounded.aggV79---=agg=80aggsagg)] _The troll bites you. You block the troll's attack. The troll claws you.agg F  You hit the troll but do no damage.The troll is severely wounded.aggF3-9 (0.9aggMagglQs _The troll barely misses you. You block the troll's attack. x2agg  You slash the troll!  The troll is almost dead.You kill the troll!agge[aggn?70=70.0 (1.1aggagg#H _The troll leather armour is intact enough to wear.agg aggagg~agg+H _No target in view!agg8 agg agg ,agg= U80--- _agg agg} agg agg= agg` agg agg* agg agg %1agg^ agg ,agg agg agg_ agg agg agg %2agg agg ,agg agg, aggm aggd agg agg) 53=aggU agg agg agg agg< agg ,agg* agg agg@ ?4=aggv agg agg! aggd agg agg ,agg/ agg` agg %5aggJ agg agg ! agg9" agg% aggM% %6agg& aggJ* ,agg+ aggz. ,agg/ agg2 agg3 K7=agg&4 agg6 ,aggB8 agg3; ,agg[< agg=> agg> #8agg> 2=agg? aggB aggB aggmD agg>F ,agghG aggoJ aggJ %9aggjL agg{O ,aggP agg.##....'.†..ß#.B.⌠.Y.+#.... B   boulder beetle (asleep)(...#ßßß.##..⌠....##.... Y   aggo yak (asleep) ......####+##.⌠...⌠.### #.... x   unseen horror (wandering, invisible)# #.## #.... 3005.0 (35.0)  You open the door.  A boulder beetle, a yak and an unseen horror come into view.xY.B⌠..Bwandering)Yx===6.0 (36agg agg & _The yak bellows!aggG  You slash the unseen horror!  The unseen horror is moderately wounded.The unseen horror hits you but does no damage.aggIaggUJagg\'xY⌠○BB agg\9-7.0 (1.0)aggf;○aggjU _You block the unseen horror's attack. The boulder beetle leaps!agg.....####....###..... .###### ##....########.... ..#####...#### #..##.#.'.[..## #..#.aggW#).####@####..## ...#...x...#.## ####'##.⌠.Y.⌠.### ßßß.##....⌠..# >.##'.†..ß#..○⌠...+....agg(...#ßßß.##..⌠....#....####+##B⌠...⌠.###..# #.......#.## #####..##aggJagg{aggM{Y.°B.aggO--8agg:°agg _You block the unseen horror's attack. x2 _There is an open door here.agg{  You hit the unseen horror.  The unseen horror is moderately wounded.agg{ agg . ..x.BB(rolling)You block the unseen horror's attack.  The boulder beetle curls into a ball and begins rolling!agg @-9aggɚ 0BBagg/ 1 _You block the yak's attack.aggχ##### #### ##### .aggC.... .#####.........### ##....#####..###....####...#.## #..##agg|W.#.'.[.@#......###).####'####..##..#...#..Y..x.#.##aggJ###'##.⌠...⌠.###..#.agg5#ßßß.##....⌠..#>.##....'.†..ß#...⌠...+B(...#ßßß.##B.⌠....# aggÉ####+##.⌠...⌠.###  .#.......#.## aggЏ,agg(agg"aggagg#Zx.Y..B°°x   unseen horror (invisible)agg'10aggagg; _You block the unseen horror's attack.agg0y cThe boulder beetle curls into a ball and begins rolling! _You block the yak's attack. _You block the unseen horror's attack.  You hit the unseen horror.  The unseen horror is moderately wounded.  aggTz agg B°°°B°agg +9 (0.9aggj ^B°agg D _The unseen horror hits you but does no damage.agg  You slash the unseen horror!  The unseen horror is almost dead.aggaggraggL xY°B.. You block the unseen horror's attack.agg)6==1.9 (1.0aggaggC _The boulder beetle stops rolling and uncurls.aggs  You hit the unseen horror.  The unseen horror is almost dead.aggu aggP x..⌠.The unseen horror hits you but does no damage.agg /--2aggُ agg P _The yak barely misses you.aggC(poisoned)agg'  .xYou throw a poisoned dart. The poisoned dart hits the yak. The yak is poisoned.The unseen horror hits you but does no damage. x2agg(x--4.0 (1.10agg2agg61 _You block the yak's attack.agg  You hit the unseen horror but do no damage.The unseen horror is almost dead.agg x.The unseen horror hits you but does no damage.agg+ ,50agg agg] 1 _You block the yak's attack.agg3 5  You hit the yak.agg @  The yak is lightly wounded.aggJ S  The unseen horror hits you but does no damage.agg +9 (0.9agg+ agg2 1 _You block the yak's attack.aggf  You hit the yak but do no damage.agg@  The yak is lightly wounded.aggagg(6.8aggagg(W _You block the unseen horror's attack. You block the yak's attack.aggp\  ((poisoned)You throw a poisoned dart.  The poisoned dart barely misses the yak.The poisoned dart hits the boulder beetle.agg agg  The boulder beetle is poisoned. The unseen horror barely misses you.agg* agg .xY( Bagg 82---=7.9 (1.119agg: agg& B _The yak gores you! The boulder beetle leaps!agg=7  You slash the yak!agg  The yak is heavily wounded.You block the unseen horror's attack. The unseen horror closely misses you.agg(T[xB⌠agg,80aggagg1 _You block the yak's attack.aggNs A  You slash the unseen horror!agg n .Brolling, poisoned)B   You kill the unseen horror!The yak looks more healthy. You block the yak's attack.agg p3=--4-9aggG agg N _The boulder beetle curls into a ball and begins rolling!agg  You hit the yak.  The yak is severely wounded.-20.8 (0.9agg1 _You block the yak's attack.agg 5  You hit the yak.agg f  The yak is almost dead.agg kB°° agg: -1.8 (1.0agg gB°Bagg" ; _The yak gores you but does no damage.agg( 5  You hit the yak.agg agg  B°°.B⌠The yak is almost dead.aggc ^4=2agg :°agg| 1 _You block the yak's attack.agg.5  You hit the yak.agg0aggg= B°..B  You kill the yak!The boulder beetle hits you!agg? 77--73 _The boulder beetle stops rolling and uncurls.  Training target 8.0 for Armour reached!  Your Armour skill increases to level 8!aggG/  --more--agg \ need to enable at least one skill for training.aggl /  --more--aggXagg^  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6  gg_0m 1.0   0       e - Long Blades  10.7  12.0   0               f - Armour   8.0   9.0   0       g - Dodging   0.0   1.0   0       h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1           ggqa0m                                   You need to enable at least one skill.[?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsagg:: > g + Dodging 0.0aggaggagg######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 77/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13023.8 (1.0) agg........##).####B####..## #..#. a) +0 scimitar ........#...#...°...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle (poisoned) ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....You need to enable at least one skill for training.aggaggagg. _bggbggnFire/throw/use which item? ([*] to toss any item) Missiles (go to first with () bgg- b - 3 throwing nets  f - 19 poisoned darts (quivered)F - 6 atropa-tipped darts Wands (go to first with /)h - a wand of roots (6)  y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  N - a wand of charming (3) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silence  H - a scroll of summoningbgg)YbggC######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 77/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 bgg{........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13023.8 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...°...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+bggքA#.... B   boulder beetle (poisoned) ..(...#ßßß.##..⌠....##.... bgg......####+##.⌠...⌠.### #.... ........# #.......#.## #.... _You need to enable at least one skill for training.  Throw: 6 darts (atropa)bggPress: ? - help, Shift-Dir - straight line, f - boulder beetleAim: a boulder beetle (lightly wounded, poisoned, haloed, 98% to hit, chance toblind on hit: 3%)bgg ######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 77/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18bggi Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 bgg q........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13023.8 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...°...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle (poisoned) ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....Throw: 6 darts (atropa)bggҚ &Press: ? - help, Shift-Dir - straight line, f - boulder beetleAim: a boulder beetle (lightly wounded, poisoned, haloed, 98% to hit, chance toblind on hit: 3%)  You throw an atropa-tipped dart.  The atropa-tipped dart hits the boulder beetle.bgg' /  --more--bggp  The boulder beetle resists.  The boulder beetle is lightly wounded.bggP}(The boulder beetle looks more healthy.bgg]-4.9 (1.1bgg&bggG*> _The boulder beetle bites you but does no damage.bggbggFire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  b - 3 throwing nets  f - 19 poisoned darts (quivered)F - 5 atropa-tipped darts Wands (go to first with /)h - a wand of roots (6)  y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  N - a wand of charming (3) bgg`Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silence  H - a scroll of summoningbggO3bgg]j######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 77/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 bggI_........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13024.9 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....The boulder beetle looks more healthy. _The boulder beetle bites you but does no damage.  Throw: 5 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - bouldbggber beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)bgg#L######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 77/90 ====================---- .....#....#####...............#bggLMagic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13024.9 (0.0) bggMQ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... bggN........# #.......#.## #....Throw: 5 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)  You throw an atropa-tipped dart.  The atropa-tipped dart hits the boulder beetle.bgg+U/  --more--bgg@ p  The boulder beetle resists.  The boulder beetle is lightly wounded.bggo bgg{ 586.1 (1.2bgg~ bgg > _The boulder beetle bites you but does no damage.bgg7^bgg bFire/throw/use which item? ([*] to toss any item) Missiles (go to first with () bggb b - 3 throwing nets  f - 19 poisoned darts (quivered)F - 4 atropa-tipped darts Wands (go to first with /)h - a wand of roots (6)  y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  N - a wand of charming (3) bggbScrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking bggc m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silence  H - a scroll of summoningbggMbgge######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 78/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13bggInt: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13026.1 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....bgg##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....The boulder beetle is lightly wounded. _The boulder beetle bites you but does no damage.  Throw: 4 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)bgg? ######....##...........#deadiverson the Carver bgg .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 78/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 bgg ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13026.1 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. bgg, 0......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....#bgg b#.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....Throw: 4 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)  You throw an atropa-tipped dart.  The atropa-tipped dart hits the boulder beetle.bgg /  --more--bggqp  The boulder beetle resists.  The boulder beetle is lightly wounded.bggGbgg -7.2 (1.1bggդbgg> _The boulder beetle bites you but does no damage.bgg bgg~ Fire/throw/use which item? ([*] to toss any item) bgg Missiles (go to first with ()  b - 3 throwing nets  f - 19 poisoned darts (quivered)F - 3 atropa-tipped darts Wands (go to first with /)h - a wand of roots (6)  y - a wand of digging (6)  bgg} B - a wand of mindburst (29)  M - a wand of flame (12)  N - a wand of charming (3) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silence  bgg H - a scroll of summoningbggd bggt C######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 78/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 bgg, ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13027.2 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........#bgg  #.......#.## #....The boulder beetle is lightly wounded. _The boulder beetle bites you but does no damage.  Throw: 3 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)bgg]h######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#bgg^Health: 78/90 ====================---- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 bgg _........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13027.2 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. bgg[_......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle bgg_..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....bgg_Throw: 3 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  bgg_lhit: 3%)  You throw an atropa-tipped dart.  The atropa-tipped dart hits the boulder beetle.bggg/  --more--bggp  The boulder beetle resists.  The boulder beetle is lightly wounded.bgg\9=8.3 (1.1 _The boulder beetle closely misses you.bggr bggv Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  b - 3 throwing nets  f - 19 poisoned darts (quivered)F - 2 atropa-tipped darts Wands (go to first with /)bggw h - a wand of roots (6)  y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  N - a wand of charming (3) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silence  bggw H - a scroll of summoningbggbgg######....##...........#deadiverson the Carver .....#....# #####...........#Human of the Shining One ****.. .....#....# #...............#Health: 79/90 =====================--- bggf.....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16Dex: 14 bgg........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13028.3 (0.0) bgg........##).####B####..## #..#. a) +0 scimitar bgg........#...#...(...#.## #..#. Throw: 19 darts (poison) ......####'##.⌠...⌠.### #..#. ......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+#.... B   boulder beetle ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....The boulder beetle is lightly wounded. bggl"_The boulder beetle closely misses you.Throw: 2 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetleAim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)bgg"######....##...........#deadiverson the Carver .....#....# #####...........#bgg<#=Human of the Shining One ****.. .....#....# #...............#Health: 79/90 =====================--- .....#....#####...............#Magic: 11/11 ======================== .....#........................#AC: 18Str: 17 .#####........................### EV: 13Int: 11 ##..........#####.........###.... SH: 16bgg#Dex: 14 ........#####...##.......## #..## XL: 11 Next: 77% Place: Dungeon:11 ........#.#.'.[.@#......## #..#. Noise: =--------  Time: 13028.3 (0.0) ........##).####B####..## #..#. a) +0 scimitar ........#...#...(...#.## #..#. Throw: 19 darts (poison) bgg $......####'##.⌠...⌠.### #..#. bgg=$......#ßßß.##....⌠..##>.## ......'.†..ß#...⌠...+bgg$#.... B   boulder beetle ..(...#ßßß.##..⌠....##.... ......####+##.⌠...⌠.### #.... ........# #.......#.## #....Throw: 2 darts (atropa)Press: ? - help, Shift-Dir - straight line, f/p - boulder beetlebgg~%Aim: a boulder beetle (lightly wounded, haloed, 98% to hit, chance to blind on  hit: 3%)  You throw an atropa-tipped dart.  The atropa-tipped dart hits the boulder beetle.bgg1/  --more--bgg p  The boulder beetle resists.  The boulder beetle is lightly wounded.bggQ ,bggJ C°Bbgg -9.5 (1.2bgg* bgg ' _The boulder beetle leaps! bgg((((poisoned)You throw a poisoned dart.  The poisoned dart hits the boulder beetle.  The boulder beetle is poisoned. bggA bgg.(.B(-30.6 (1.18 bgg' bgg*< _The boulder beetle is lightly wounded. bggKYM((very poisoned) _The boulder beetle is lightly wounded.  You throw a poisoned dart.  The poisoned dart hits the boulder beetle.  The boulder beetle looks even sicker. bgg (.BB  rolling, very poisoned)The boulder beetle is lightly wounded. bgg80-1.77 bgg bggsN _The boulder beetle curls into a ball and begins rolling! bgg+ ((B  The boulder beetle is lightly wounded. _The boulder beetle curls into a ball and begins rolling!  You throw a poisoned dart.  The poisoned dart hits the boulder beetle.  The boulder beetle looks even sicker. bggl-  bgg7.  bgg; rB.°° bgg#< ]2.9 (1.26 bgg3F LB° bggI i _The boulder beetle is moderately wounded. bgg dM° bgg extremely po… _The boulder beetle is moderately wounded.  You throw a poisoned dart.  The poisoned dart hits the boulder beetle.  The boulder beetle looks as sick as possible! bgga  ((Bextremely poisoned)The boulder beetle is moderately wounded.You block the boulder beetle's attack. bgg m1=4.0 (1.15 bgg  bgg C _The boulder beetle stops rolling and uncurls. bggK  You slash the boulder beetle!  The boulder beetle is heavily wounded. bggL3=9 (0.9 bgg&W bggZT _The boulder beetle misses you. bgg  You hit the boulder beetle but do no damage.The boulder beetle is heavily wounded. bgg5-6.0 (1.1 bggύ bggr\ _The boulder beetle closely misses you. bgg  verYou hit the boulder beetle but do no damage.The boulder beetle is heavily wounded. bgg\2-70 bggl bggoF _The boulder beetle bites you but does no damage. bgg.  You hit the boulder beetle but do no damage.The boulder beetle is severely wounded. bgg|/&8 bgg7 bgg<< _You block the boulder beetle's attack. bggB  You hit the boulder beetle.  The boulder beetle is severely wounded. bgg) -9.1 (1.1 bgg  bgg T _The boulder beetle misses you. bggh  You hit the boulder beetle.  The boulder beetle is severely wounded. bgg~ \3=40.0 (0.9 bgg  bgg   bgg ._You block the boulder beetle's attack. bgg  You slash the boulder beetle!  The boulder beetle is almost dead. bgg5=1.0 (1.0 bgg bggq< _You block the boulder beetle's attack. bggkFC  You slice the boulder beetle!! bggcPf( bggW 486-9 (0.9 _You kill the boulder beetle! bgg` bgg#cy _Your Dodging skill gained 2 levels and is now at level 2! bgg bgg8- bgg bggH _No target in view! bgg  bggۗ bgg bgg bgg͟r4= _ bgg, bgg8 bggR, bgg bgg  bggj%5 bggϮ bgg, bggӳ bggQ6 bgg bgg9 bgg bgg, bgg bgg bggwD7= bgg bgg, bgg bgg, bggo bgg bgg&U8= bgg bggw, bgg+ bgg, bgg`g9 bggg, bggW bggw bgg bggJ bgg bggL90= bgg bggO bgg bgg bgg bgg%  F - 6 atropa-tipped darts (gained 5); f - 16 poisoned darts (gained 1)  There is an open door, spattered with blood here.  Things that are here: bgg bgg  bgg _a boulder beetle corpse; a yak corpse bgg;  bgg  bgg  bggV bgg9= bgg[ bggo _f - 17 poisoned darts (gained 1) bgg bggi bggL bgg# bgg.$ bgg:% bggG)o _f - 19 poisoned darts (gained 2) bgg* bgg+ bgg, bggv4B bgg7o _f - 20 poisoned darts (gained 1) bgg9 bgg: bgg: bgg> bgg A, bggB bgghE bggLG bggG bgg(I bggL bggN, bggO bggFS bgg_5........#.#.'.[..#......## #..#....##).####†####..## #..#....#...#.......#.## #..#..####'##.⌠...⌠.### #..#..#ßßß.##....⌠..# #>.## . bgg`.....'.†..ß#...⌠...+ #.... ..(...#ßßß.##..⌠....# ####+##.⌠...⌠.### #.... #...@...#.## #...- # ####'#### bgg`. # .V#......## #...20 #.......##### ..##.......## #... #...........#####.........###.... #...........................> bgg^aV   vampire (dormant) #.......#######'###................#.........#.......####### bggac.........#.......# # bggfJ 71.9 (30.0)  You open the door. bgg pV.V bggpF-2.9 (31 bggx bgge|Z _A vampire comes into view. bggn [.. ).####†####..## #.......#.## #.⌠...⌠.### #....⌠..# #>†..ß#...⌠...+ (#..⌠....# #.⌠...⌠.###  #...@...#.##  ####V####..##  ..#  ..## ###>  bgge [.. ).####†####..## #.......#.## #.⌠...⌠.### #....⌠..# #>†..ß#...⌠...+ (#..⌠....# #.⌠...⌠.###  #...@...#.##  ####V####..##  ..#  ..## ###>  bgg 4 bgg{  bgg ^ _A vampire is nearby! bgg0 [.. ).####†####..## #.......#.## #.⌠...⌠.### #....⌠..# #> bgg1 †..ß#...⌠...+ (#..⌠....# #.⌠...⌠.###  #...@...#.##  ####V####..##  ..#  ..## ###>  bgg[.. ).####†####..## #.......#.## #.⌠...⌠.### #....⌠..# #>†..ß#...⌠...+ (#..⌠....# #.⌠...⌠.###  #...@...#.##  ####V####..##  ..#  ..## ### bggF>  bgg bgg bgg bgg ^ _A vampire is nearby! bggϾ  You slash the vampire!  The vampire is lightly damaged.=3.9 (1.0) bggn bgg"x _You block the vampire's attack. The vampire completely misses you. bgg/  You barely miss the vampire.The vampire is lightly damaged. bgg0-4.8 (0.9 bggY9 bgg<8 _You block the vampire's attack. x2 bggy  You hit the vampire.  The vampire is moderately damaged. bggOz-5.8 (1.0 bggd bgg8 _You block the vampire's attack. x2 bggv  You hit the vampire.  The vampire is heavily damaged.The vampire hits you but does no damage. bgg~ &6 bgg  bgg8 ? _The vampire bites you but does no damage. bggyW e  You slash the vampire! bgg+a 8* bgg5  The vampire is severely damaged.The vampire draws life force from you. bgg 8@ bgg e86--=7.7 (0.9 bgg!  bgg > _The vampire is healed by the life force! bgg  You hit the vampire.  The vampire is severely damaged.-8.6 bgg bggq8 _You block the vampire's attack. x2 bgg#j  You hit the vampire but do no damage. bgg|*8* bggi  The vampire is severely damaged.The vampire draws life force from you. bgg-8@ bgg_5---9.5 bgg bgg> _The vampire is healed by the life force! bgg  You hit the vampire but do no damage.The vampire is severely damaged. bgg;* bgg) V(invisible)The vampire casts a spell. bgg:9V bggH====80.4 bgg# bgg9&E _The vampire flickers and vanishes for a moment. bggce  You slash the vampire! bggij8* bggpD  The vampire is almost destroyed.The vampire draws life force from you. bggL8@ bggj3==--1.4 (1.0 bgg bgg> _The vampire is healed by the life force! bgg {  You slash the vampire!  You destroy the vampire! bgg .⌠...⌠.' bggt `48---2 bgg  bgg X _The Shining One accepts your kill. bggs  bggt 8- bgg{  bgg_~ H _No target in view! bggt64bggbggmH _No target in view!bggFMbggNbggNbggQbggU: _bggWbgg4Xbgg!Ybgg)[bgg{[%5bggl\bggM_,bgg`bggb,bggcbggi}6bggjbggl,bggnbgg`pbggpK7=bggrbggu,bggubggwbgg xbggybgg|98bgg}2=bgg~bgg6,bggbgg,bggbgg׆bggK%9bgg@bggˊbggbggbggbgg}L90=bggϏbggɓbgg,bggbggV  There is an open door, spattered with blood here.bggV5 _bggbggbggobggѣbggbgg R  There is a fountain of clear blue water here.bggbgg@= _bggجbggbggbggbggҴbggbggk###..................######.#####.........###......#####...##.......## #..###'##.#.'.[..#......## #..#...###).####†####..## #..#...#...#.......#.## . #..#...#.####'##.⌠...⌠.### ..C #..#...##ßßß.##....⌠..##....! #>.#####'.†..ß#...⌠..@'....O[ #...- bgg)\...#ßßß.##..⌠....##....$ #.....## ...####+##.⌠...⌠.### ..C #.....# .....# #.......#.## . #.....# .....# ####'####..## #.....# .....# +....### #.....#. O   two-headed ogre (asleep) .....#####...##.......## #.....#. CC 2 cyclopes (missiles, asleep).#####.........###.....#...>.....#.bggl 104.4 (22.0)  You open the door.  A two-headed ogre and 2 cyclopes come into view.bgg&bggbggC& bggCO.CHOH   manticore (wandering)CC 2 cyclopes (missiles)The cyclops shouts! The two-headed ogre shouts in stereo! The cyclops shouts!bggK5==5.4 (23bgg bggS _A manticore comes into view. _Found a leather armour, 33 gold pieces and a potion of cancellation.bggSbgg bggibggF _Unknown command.bggΡbggˣEvoke which item? Wands  h - a wand of roots (6)y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  bgg2UN - a wand of charming (3) Miscellaneous  I - a Gell's gravitambourine (2/2) [!] read|quaff|evoke[?] describe selectedbgg bgg bgg- ###........................###### deadiverson the Carver .........#####.........###....... Human of the Shining One ****.. .....#####...##.......## #..###'# Health: 90/90 ======================== .....#.#.'.[..#......## #..#...# Magic: 11/11 ======================== .....##).####†####..## #..#...# AC: 18Str: 17 .....#...#.......#.## . #..#...# EV: 14Int: 11 ...####'##.⌠...⌠.### ..C #..#...# SH: 16bgg! Dex: 14 ...#ßßß.##....⌠..##....! #>.##### XL: 11 Next: 88% Place: Dungeon:11 ...'.†..ß#...⌠..@'...O.[ #....... Noise: ==-------  Time: 13105.4 (0.0) ...#ßßß.##..⌠....##...C$ #.....## a) +0 scimitar ...####+##.⌠...⌠.### ..H #.....#. Throw: 20 darts (poison) .....# #.......#.## . #.....#. .....# ####'####..## #.....#. .....# +....bgg_ #......## #.....#. O   two-headed ogre .....#####...##.......## #.....#. H   manticore (wandering) .........#####.........###.....#. CC 2 cyclopes (missiles) .........................>.....#.You open the door.  A two-headed ogre and 2 cyclopes come into view.The cyclops shouts! The two-headed ogre shouts in stereo! The cyclops shouts! _A manticore comes into view. bgg _Found a leather armour, 33 gold pieces and a potion of cancellation. _Unknown command.bgg< ~###........................###### deadiverson the Carver .........#####.........###....... Human of the Shining One ****.. .....#####...##.......## #..###'# Health: 90/90 ======================== .....#.#.'.[..#......## #..#...# Magic: 11/11 ======================== .....##).####†####..## #..#...# AC: 18Str: 17 .....#...#.......#.## . #..#...# EV: 14Int: 11 bgg ...####'##.⌠...⌠.### **C #..#...# SH: 16Dex: 14 ...#ßßß.##....⌠..##***** #>.##### XL: 11 Next: 88% Place: Dungeon:11 ...'.†..ß#...⌠..@'.**O** #....... Noise: ==-------  Time: 13105.4 (0.0) ...#ßßß.##..⌠....##***C* #.....## a) +0 scimitar ...####+##.⌠...⌠.### **H #.....#. Throw: 20 darts (poison) .....# #.......#.## . #.....#. .....# ####'####..## #.....#. bggs .....# +....#......## #.....#. O   two-headed ogre .....#####...##.......## #.....#. H   manticore (wandering) .........#####.........###.....#. CC 2 cyclopes (missiles) .........................>.....#. bgg _A manticore comes into view. _Found a leather armour, 33 gold pieces and a potion of cancellation. _Unknown command.Aiming: Gell's GravitasPress: ? - help, Dir - move target, f - two-headed ogreAim: a two-headed ogre, wielding two +0 giant clubs (haloed)bgg8###........................###### deadiverson the Carver .........#####.........###....... Human of the Shining One ****.. .....#####...##.......## #..###'# Health: 90/90 ======================== .....#.#.'.[..#......## #..#...# Magic: 11/11 ======================== .....##).####†####..## #..#...# AC: 18Str: 17 .....#...#.......#.## . #..#...# EV: 14Int: 11 bgg...####'##.⌠...⌠.### *** #..#...# SH: 16Dex: 14 ...#ßßß.##....⌠..##*...* #>.##### XL: 11 Next: 88% Place: Dungeon:11 ...'.†..ß#...⌠..@'.*.O.* #....... Noise: ==-------  Time: 13105.4 (0.0) ...#ßßß.##..⌠....##*..C* #.....## a) +0 scimitar ...####+##.⌠...⌠.### *** #.....#. Throw: 20 darts (poison) .....# #[39;4bgg9m.......#.## . #.....#. .....# ####'####..## #.....#. .....# +....#......## #.....#. O   two-headed ogre .....#####...##.......## #.....#. H   manticore (wandering) .........#####.........###.....#. CC 2 cyclopes (missiles) .........................>.....#. _Found a leather armour, 33 gold pieces and a potion of cancellation. _Unknown command.Aiming: Gell's GravitasPress: ? - help, Dir - move target, f - two-headed ogreAim: a two-headed ogre, wielding two +0 giant clubs (haloed)  You rattle the tambourine.bggR>..C.***!.*O*[.***$..Hbgg....*...CbggD  Aiming: Gell's Gravitas  Press: ? - help, Dir - move target, f - two-headed ogre: a two-headed ogre, wielding two +0 giant clubs (haloed)  You rattle the tambourine.  Waves of gravity draw inward around the two-headed ogre.  The two-headed ogre is pinned by gravity.bggibgg/  --more--bgg# K W.HOC.(bound)Hbound), bound)W   shadowghast (wandering)The manticore is pinned by gravity. The cyclops is pinned by gravity. x2  A shadowghast comes into view.bgg v```  The manticore flicks its tail.bggvC bggSF QThe volley of spikes skewers you but does no damage.bggZ W.H..H'.WH 2 manticores (1 bound)W   wraith(…)bgg[ 3=6.4 (1bggj bggo _A wraith comes into view. A manticore comes into view.bgg4bgg8bgg > _Unknown command.bggl)...#.# ####...............#####.....####..###.......#####...##.......## #..###'.#.#.'.[..#......## #..#....##).####†####..## #..#......#...#.......#.## W #..#....####'##.⌠...⌠.### ... #..#...bgg*.#ßßß.##....⌠@.##.H..H #>.####.'.†..ß#...⌠...'...OC[ #...... (...#ßßß.##..⌠....##...C$ #.....#####+##.⌠...⌠.###.... #.....#.# #.......#.## .W #.....#.# ####'#### #.....#.# +....# #.....# CC 2 cyclopes (missiles, bound)#####...## #.....#########.....#bgg.bgg@W.W   wraithbggA7---7 _bggNNbgg8Sbgg.#....#####.# ....#.# #####...............#### #..........###..###......#####...##.......## #..###.#.#.'.[..#......## #..#.##).####†####..## #..#...#...#.......#.## W #..#bgg.####'##.⌠..@⌠.### ... #..#...#ßßß.##....⌠..##.H..H #>.### .....'.†..ß#...⌠...'...OC[ #..... .(...#ßßß.##..⌠....##...C$ #.....####+##.⌠...⌠.###..W. #......# #.......#.##... #......# ####'#### #......# +....# #.....#####...## #..... bggbggbgg m.HC.H   manticoreC   cyclops (missile)bgg B---8bgg bgg bgg .#....# #.#.#....#####.# .....#.# .#####...............### ##..........###..###.....#####...##.......## #..##.#.#.'.[..#......## #..#.##).####†####..## #..#...#...#...@...#.## W #..#.####'##.⌠...⌠.### ... #..#.bgg .#ßßß.##....⌠..##....H #>.## ......'.†..ß#...⌠...'.H.OC[ #(...#ßßß.##..⌠....##..C.$ #####+##.⌠...⌠.###..W. #.# #.......#.##... # #.# ####'#### #....  #.# +....# #.... bgg ,bgg, H.C.H   manticorebgg C   cyclops (missile)bgg &9bggs bgg bgg#### ##### ..... .#####.........### ##....#####..###....bgg####...#.## #..##.#.'.[..#......###).####@####..## ..#...#.......#.## Wbgg ###'##.⌠...⌠.### ... #..#.#ßßß.##....⌠..##....H #>.##....'.†..ß#...⌠...'H..OC[(...#ßßß.##..⌠....##.C..$####+##.⌠...⌠.###..W ........#.##...####'####..## bggbggMWW   wraithbgg ````  The manticore flicks its tail.The volley of spikes skewers you!bgg8bgg9.bgg:⌠bgg1;.bgg;'bggn=bgg >81bgg>---bggv? ===bgg@ 10bggiABarbs bggAbggObgg`V ! _Barbed spikes become lodged in your body.  There is an open door, spattered with blood here.  Things that are here: _a boulder beetle corpse; a yak corpsebgg@bggThe barbs in your skin will harm you if you move. Continue? Y - Yes  N - Nobgg bgg1 f.....#....# #####...........#deadiverson the Carver .....#....# #...............#Human of the Shining One ****.. .....#....#####...............#Health: 81/90 =====================--- .....#........................#Magic: 11/11 ======================== bgg1 .#####........................### AC: 18Str: 17 ##..........#####.........###.... EV: 14Int: 11 ........#####...##.......## #..## SH: 16Dex: 14 ........#.#.'.[..#......## #..#. XL: 11 Next: 88% Place: Dungeon:11 ........##).####@####..## #..#. Noise: ===------  Time: 13110.4 (0.0) bgg:2 N........#...#.......#.## W #..#. a) +0 scimitar ......####'##.⌠...⌠.### ... #..#. Throw: 20 darts (poison) bggz2 ......#ßßß.##....⌠..##....H #>.## Barbs ......'.†..ß#...⌠...'H..OC[ #.... bgg3 '..(...#ßßß.##..⌠....##.C..$ #.... H   manticore ......####+##.⌠...⌠.###W.W. #.... W   wraith ........# #.......#.##... #.... #.......# ####'####..## #....The volley of spikes skewers you! _Barbed spikes become lodged in your body.  bggS3 There is an open door, spattered with blood here.  Things that are here: _a boulder beetle corpse; a yak corpseOkay, then.bgg3 bgg4 bgg_? bggB . _bgg% (((((((You throw a poisoned dart.  The poisoned dart barely misses the manticore.bgg}bgg  .⌠.'HW.  The poisoned dart barely misses the wraith.bgg ````  The manticore flicks its tail.The volley of spikes skewers you!!bggYX u.⌠.'bggY 61-----1.5 (1.119bgg` bggd D _More barbed spikes become lodged in your body.bggZ ((((You throw a poisoned dart. The poisoned dart hits the manticore.bgg~ ,bgg= g .⌠.'H.WCC   cyclops (missile)The manticore is lightly wounded.bgg' ````  The manticore flicks its tail.The volley of spikes skewers you!bgg' u.⌠.'bgg( $48bgg( ---------2.68bgg23 bgg7 D _More barbed spikes become lodged in your body.bgg\ ((((You throw a poisoned dart. The poisoned dart hits the manticore.bgg bgg bgg] .⌠.HOO   two-headed ogreH   manticoreC   cyclops (missile)bgg~ 9=------3.8 (1.27bgg bgg7 _The manticore is lightly wounded.bggÍ ((((poisoned)You throw a poisoned dart. The poisoned dart hits the manticore.  The manticore is poisoned.bggq-Z .⌠.The manticore is lightly wounded. ```  The manticore flicks its tail.The volley of spikes skewers you.bggeo.⌠.bgg3--===4.9 (1.16bggGbggD _More barbed spikes become lodged in your body.bgg;64bggCbggG^ _You are too injured to fight recklessly!bggbggSbgg^bgg5^ _You are too injured to fight recklessly!bggibggbgg bgg ^ _You are too injured to fight recklessly!bgg bgg^ =Read which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 3 scrolls of teleportationH - a scroll of summoning  bgg #J - a scroll of identify  K - a scroll of amnesia [!] read|quaff|evoke[?] describe selectedbggbggbggg.....#....# #####...........#deadiverson the Carver .....#....# #...............#Human of the Shining One ****.. .....#....#####...............#Health: 43/90 ===========------------- .....#........................#Magic: 11/11 ======================== .#####........................### AC: 18Str: 17 ##..........#####.........###.... EV: 14Int: 11 ........#####...##.......## #..## SH: 16Dex: 14 bgg:........#.#.'.[..#......## #..#. XL: 11 Next: 88% Place: Dungeon:11 ........##).####@####..## #..#. Noise: ===------  Time: 13114.9 (0.0) ........#...#.......#.## W #..#. a) +0 scimitar ......####'##.⌠...⌠.### ... #..#. Throw: 16 darts (poison) ......#ßßß.##....⌠..##....H #>.## Barbs ......'.†..ß#...⌠...HO.WOC[ #.... ..(...#ßßß.##..⌠....##CC..$ #....bgg* O   two-headed ogre ......####+##.⌠...⌠.###..W. #.... H   manticore (poisoned) ........# #.......#.##... #.... C   cyclops (missile) #.......# ####'####..## #....The manticore flicks its tail.The volley of spikes skewers you. _More barbed spikes become lodged in your body. _You are too injured to fight recklessly! _You are too injured to fight recklessly! _You are too injured to fight recklessly!bgg6  okOooo, ally target)O   two-headed ogre (summoned) (…)As you read the scroll of summoning, it crumbles to dust.  Wisps of shadow whirl around you...bggB ```  The manticore flicks its tail.bggu o.⌠.bgg +5.9 (1bgg bggr J _The volley of spikes skewers you but does no damage.bggk4bgg,bggF _Unknown command.bggk bgg, ```  The manticore flicks its tail.bgg8A bggB BbggC bggD bgg{V .oko⌠⌠O.obggW B46bggg bggk J _The volley of spikes skewers you but does no damage.bggbggbgg(bgg,  The manticore flicks its tail. _The volley of spikes skewers you but does no damage. _Unknown command.  The manticore flicks its tail. _The volley of spikes skewers you but does no damage. _Unknown command.bggbggR.kbgg ` _The volley of spikes skewers you but does no damage. _Unknown command.  The manticore flicks its tail. _The volley of spikes skewers you but does no damage. _Unknown command.  The manticore flicks its tail.bggCbgggD,bggDbggTEbggW.o⌠oOk.oobggX&7bggibggq _Unknown command.  The manticore flicks its tail. _The volley of spikes skewers you but does no damage. _Unknown command.  The manticore flicks its tail. _The volley of spikes skewers your wyvern!bgg'N  _Unknown command.bgg7 bggjD m  The manticore flicks its tail.bgg. N  The volley of spikes skewers your wyvern!bgg ,bgg ,bgg .ooooObgg{ .-8bggF bgg ^ _Your wyvern barely misses the manticore.bgg/bgg/8-bgg=bggBF _Unknown command.bgg'I  Your wyvern closely misses the manticore.The manticore bites your wyvern. The manticore claws your wyvern.  Your wyvern dies!bggqJbgg7KbggKbgg_⌠o⌠oobgg`e5=--9bgg4tbgg{ bggA|T_Your wyvern's corpse dissolves into shadows!bggO--bggbgg4F _Unknown command.bgg9b  The manticore looks more healthy.bgg\h  The manticore flicks its tail.The volley of spikes skewers your orc!  Your orc dies!bgg1t9.bggbggbgg  Your orc's corpse dissolves into shadows!Your two-headed ogre hits the manticore with a +0 giant spiked club.bgg..ooo bgg;0==20bggS)3bgg3/  --more--bgg= Y _Your two-headed ogre hits the manticore with a +0 giant spiked club!! bgg! The manticore bites your orc warrior. The manticore claws your orc warrior.  The manticore barely misses your orc warrior. bgg"&;* bgg-`Your orc wizard gestures wildly while chanting. bggjYour orc wizard flickers and vanishes for a moment.  Your orc warrior hits the manticore with a +0 scimitar! bgg(o(ally target)C   cyclops (missile)O   two-headed ogre (summoned)o   orc warrior (summoned)  bggz 5931 _The manticore dies! bggMb  --more-- bgg4i _Your Dodging skill increases to level 3! bggJ  bgg>  bgg OW W   shadowghastO   two-headed ogre (summoned)Your two-headed ogre closely misses the two-headed ogre.Your two-headed ogre hits the two-headed ogre with a +0 giant spiked club!  Your orc warrior hits the two-headed ogre with a +0 scimitar!! bggb  Your orc wizard casts a spell at the two-headed ogre. bgg  bgg T6=2 bgg%  bgg 6 _The magic dart hits the two-headed ogre!!bggK  Your orc wizard casts a spell at the two-headed ogre. _The magic dart hits the two-headed ogre!  The two-headed ogre hits your orc warrior with a +0 giant club!!  The two-headed ogre closely misses your orc warrior.  Your orc wizard closely misses the two-headed ogre.  Your orc warrior hits the two-headed ogre with a +0 scimitar!!bggF!bgg !bgg2,.oOC   cyclops (missile)W   shadowghast (ally target)O   two-headed ogre (summoned)o   orc warrior (summoned) !bggZ!bggij.....#....# #####...........#deadiverson the Carver .....#....# #...............#Human of the Shining One ****.. .....#....#####...............#!bggHealth: 46/90 ============------------ .....#........................#Magic: 11/11 ======================== .#####........................### AC: 18Str: 17 ##..........#####.........###.... EV: 15Int: 11 ........#####...##.......## #..## SH: 16Dex: 14 ........#.#.'.[..#......## #..#. XL: 11 Next: 102% Place: Dungeon:11 ........##).####@####..## #..#. Noise: ==-------  Time: 13123.9 (1.0) ........#...#.......#.## W #..#. a) +0 scimitar ......####'##.⌠...⌠.### ... #..#.!bgg Throw: 16 darts (poison) ......#ßßß.##....⌠.o##....H #>.## Barbs ......'.†..ß#...⌠..oOW.WOC[ #.... ..(...#ßßß.##..⌠...o##CC..$ #.... C   cyclops (missile) !bggJ......####+##.⌠...⌠.###..W. #.... W   shadowghast (ally target) ........# #.......#.##... #.... O   two-headed ogre (summoned) #.......# ####'####..## #.... o   orc warrior (summoned)!bgg{(…)_The magic dart hits the two-headed ogre!  The two-headed ogre hits your orc warrior with a +0 giant club!!  The two-headed ogre closely misses your orc warrior.Your orc wizard closely misses the two-headed ogre.Your orc warrior hits the two-headed ogre with a +0 scimitar! !bgg:_The two-headed ogre dies!!bggh  The two-headed ogre hits your orc warrior with a +0 giant club!!  !bgg>UThe two-headed ogre closely misses your orc warrior.Your orc wizard closely misses the two-headed ogre.  Your orc warrior hits the two-headed ogre with a +0 scimitar! _The two-headed ogre dies!Your Dodging skill increases to level 4!!bgg/  --more--!bggg  You have reached level 12!!bgg/  --more--"bggb50/972/1252 1% "bgg.Ncyclops (missile)"bgg4O _You feel agile."bgg5u"bgg:*"bggZWinvisible, ally target)The shadowghast slips into darkness."bgg9,"bggoThe shadowghast flickers and vanishes for a moment.  Your two-headed ogre hits the shadowghast with a +0 giant spiked club!!  The shadowghast is destroyed!"bgg oO(o, ally target)O   two-headed ogre (summoned)o   orc warrioro  izard (summoned, invisible)"bgg 63-4"bgg "bgg X _The Shining One accepts your kill."bgg "bgg{ "bgg, W.W   wraith ("bgg. O--5"bggY "bggP"bggx8-"bgg"bggٸF _Unknown command.#bgg\  You carefully extract the barbed spikes from your body.Your two-headed ogre barely misses the wraith.#bggf  Your two-headed ogre hits the wraith with a +0 giant spiked club.#bgg#bgg NooOW..CC   cyclops (missile)W   wraith (ally target)O   two-headed ogre (summoned)o  arrior (summoned) #bggJ16#bgg#bggq"; _The wraith hits your two-headed ogre!#bggV0 WW  distracted, ally target)The wraith hits your two-headed ogre but does no damage.  Your two-headed ogre hits the wraith with a +0 giant spiked club!!#bgg&7#bggr#bggh _Your two-headed ogre completely misses the wraith.#bggUfWW#bggGVB28#bggc#bgggN _The wraith hits your two-headed ogre but does no damage.#bgg #bggu #bgg #bgg F _Unknown command.#bgg0  Your two-headed ogre hits the wraith with a +0 giant spiked club!  The wraith is destroyed!#bggY1 #bgg? HH   manticore (ally target)C   cyclops (missile)#bggF = 649 #bggG K_The Shining One accepts your kill.#bgg3X #bgg_ h _Your Dodging skill increases to level 5!#bgg#bggz  ed, skewered)The manticore flicks its tail.$bgg. # The volley of spikes skewers your two-headed ogre!!  Your two-headed ogre hits the manticore with a +0 giant spiked club!!$bggM/0==30$bgg!<$bgg@Z _Your two-headed ogre hits the manticore with a +0 giant spiked club!$bgg:   The manticore flicks its tail.$bgg$bgg\3=1$bgg&$bggH _The volley of spikes skewers your two-headed ogre!$bgg ^ _!  The manticore barely misses your two-headed ogre. x2  The manticore claws your two-headed ogre.  Your two-headed ogre barely misses the manticore.  Your two-headed ogre hits the manticore with a +0 giant spiked club!!$bgg $bggI $bgg $bgg% oOCoCC 2 cyclopes (missiles, ally target)O   two-headed ogre (summoned, skewered)o   orc warrior (summoned)o  izard (summoned, invisible)$bgg * 78--2$bgg5 $bgg#: I _The manticore dies!$bgg $bggm .   cyclops (missile Your two-headed ogre barely misses the cyclops.$bggb A--3$bgg $bgg X _Your two-headed ogre hits the cyclops with a +0 giant spiked club!%bgg  The cyclops hits your two-headed ogre!!  Your two-headed ogre dies!%bggv%bgg%bggR%bgg*ooo.o   orc warrior (summoned)o  %bggX,izard (summoned, invisible)o(summoned)%bgg-54=%bgg-4%bgg(9%bggv?k _Your two-headed ogre's corpse dissolves into shadows!%bgg%bgg.&  Your orc wizard dissolves into shadows!The cyclops hits your orc warrior!  Your orc warrior dies!%bgg&%bggw1..oo  %bgg{2&5%bggg<%bgg?g _Your orc warrior's corpse dissolves into shadows!%bggtCCdistracted, ally ta…)%bgg&6%bgg%bgg;C _Your orc hits the cyclops but does no damage.%bgg CCally target)The cyclops completely misses your orc.57%bggP%bggC _Your orc hits the cyclops but does no damage.%bgg4 %bggi %bggD nC()%bgg &8%bggk %bgg V _Your orc dissolves into shadows!%bgg/%bggCC 2 cyclopes (missiles)%bgg&9%bgg4%bgg&bgg: O ((&bgg; \(You throw a poisoned dart. The poisoned dart hits the cyclops.&bgg .⌠.The cyclops is moderately wounded.&bgg 3(((&bggXf o.⌠.&bgggg 3=41.0 (1.15&bggq &bggu O _The cyclops throws a large rock. The large rock hits you.&bgg;( (((You throw a poisoned dart. The poisoned dart hits the cyclops.&bgg &bgg &bggH .⌠CC(&bgg 0-2.1&bggE 04&bgg &bgg b _The cyclops is moderately wounded.&bgg ((, 1 poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops is poisoned.&bgg/ .⌠The cyclops is moderately wounded.&bgg9-(('bgg {'bggȆ.⌠C)'bggׇ|4=3.23'bgg'bggP _The cyclops throws a large rock. You block the large rock.'bgg5 (( very poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker.'bgg'bggY.C('bgg`-4.32'bgg'bggb _The cyclops is moderately wounded.'bggb& (You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker.'bgg'bgg..C.-5.41'bgg'bgg  You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker. _The cyclops is moderately wounded. 'bggx You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker. _The cyclops is moderately wounded.(bgg?(extremely poi…)_The cyclops is moderately wounded.  You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker. _The cyclops is moderately wounded.  You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks as sick as possible!(bgg,{ .The cyclops is moderately wounded.(bgg5'((bgg5(bggtT.C((bgg}0-=6.50(bgg(bggO _The cyclops throws a large rock. The large rock hits you.(bggh (You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks as sick as possible!(bgg(bggSC((bggp-7.69 darts (poison) (bgg(bggb _The cyclops is moderately wounded.)bgg!X;  You slash the cyclops!)bggyi C.The cyclops is severely wounded.)bggjh1-===8.7)bgg z)bggH~X _The cyclops completely misses you.)bggS  You slash the cyclops!  The cyclops is almost dead.)bgg'()bgg .The cyclops throws a large rock. You block the large rock.)bgg4-90)bgg^)bggT _The cyclops barely misses you.)bgg# very poisoned)You hit the cyclops but do no damage.The cyclops is almost dead.)bgg* '()bgg% .--50.6 (0.9)bgg )bgg P _The cyclops throws a large rock. You block the large rock.*bgg  You hit the cyclops.  The cyclops is almost dead.*bggc2-1.6 (1.0*bgg )*bgg+U _The cyclops closely misses you.*bgg+C *bggC3 You hit the cyclops.*bggF*bggHQC(.   cyclops (missile)*bggU6122.5 (0.9*bggd*bgggK _You kill the cyclops!*bggh ;  You slash the cyclops!*bggV 0=3.4*bggi *bggU 5 _The cyclops is lightly wounded.+bgg2  You hit the cyclops.  The cyclops is moderately wounded.+bgg3f3=-4.3+bgg|;+bgg:@5 _You block the cyclops's attack.+bgg'  You hit the cyclops.  The cyclops is moderately wounded.+bggB-5.2+bggt+bggFT _The cyclops barely misses you.+bggEc9  You hit the cyclops.+bggJd-6.2 (1.0+bggoo+bggq_ _The cyclops is heavily wounded.+bgg  You slash the cyclops!  The cyclops is severely wounded.+bgg\4==7+bgg;'+bggj+T _The cyclops barely misses you.+bgg &  +bgg iYou slash the cyclops!  The cyclops is almost dead.+bgg 8+bggr +bgg 5 _You block the cyclops's attack.+bggё j  You hit the cyclops but do no damage.+bgg .-9+bgg] +bgg ` _The cyclops is severely wounded.,bgg;  You slash the cyclops!,bgg4f(,bgg# 56=60 _You kill the cyclops!,bgg,bgg h _Your Dodging skill increases to level 6!,bggi ....###..... .###### ##....########.... ..#####...#### #..##.#.'.[..## #..#.#).####†####..## ...#...@(..#.## W####'##.⌠...(.### ...ßßß.##....⌠.(##....H #>.##'.†..ß#...⌠...)(..OC[ #....(...#ßßß.##..⌠....##....$.⌠...⌠.####'#### #.......# +....#......## #.... ,bgg,bgg}6--1 _,bggl,bgg  Things that are here: _3 large rocks; a cyclops corpse,bgg#....#####.# #..........# #####.#### #..........########..... .......#####...## #..####.#.'.[..#......## #..#..##).####†####..## #..#.#...#...((..#.## W #..#.####'##.⌠..@(.### ... #..#.#ßßß.##....⌠.(##....H #>.###'.†..ß#...⌠...)(..OC[ #..... .(...#ßßß.##..⌠....##....$ #.,bgg7...####+##.⌠...⌠.###..W. #..# #.......#.##... #.# ####'####..## #. .# +....#....#. .#####...##.#.,bgg,bggd6--2 _,bgg,bggf,bggW #....#####.# #.# .# .#####.###.#####...##.## #..###'#.#.'.[..#......## #..#.##).####†####..## #..#.#...#...((..#.## W #..#.####'##.⌠...@.### ... #..#.#ßßß.##....⌠.(##....H #>.#'.†..ß#...⌠...)(..OC[ #. (...#ßßß.##..⌠....##....$ #.....#####+##.⌠...⌠.###.... #.....## #.,bggW [40m#.##... #.....## ####'####..##. #.....## +....#......## #.....######...##.## #.....#,bgg\f ,bggf &3,bggOp ,bgg~  f - 12 poisoned darts (gained 3)4.2 (212 darts (poison),bgg ,bgg4 C _There is a fountain of clear blue water here.-bgg0#..........# ###.###### .........########.......#####...### #..###'##.#.'.[..#......## #..#...###).####†####..## #..#...##...#...((..#.## W #..#...#####'##.⌠...⌠.### ... #..#...##ßßß.##....⌠.@##....H #>.#####'.†..ß#...⌠...)(....[ #.......#ßßß.##..⌠....##....$ #.....## ...####+##.⌠...⌠.###.... #.....#..# #.-bggN[33m......#.##... #.....#.# ####'####..##.. #.....#.# +....#....#.....#.#####...##.#.....#....#####..#.....#.-bgg-bgga8=5.2 (1-bggo-bgg'/-bgg/[6.2 (23-bgg:-bgg=` _f - 13 poisoned darts (gained 1)-bgg7##.####### ........########........#####...##.#..###'##.#.'.[..#......##..#..#...#.-bgg5##).####†####..##...#..#...#.#...#...((..#.##....#..#...#.####'##.⌠...⌠.###....[#..#...#.#ßßß.##....⌠..##....!=#>.#####.-bggv{'.†..ß#...⌠...@(....[##........#ßßß.##..⌠....##....$$#.....#######+##.⌠...⌠.###....$#.....#...# #.......#.#.....#.# ####'####.#.....#.-bggW# +....#....#.....#.#####...##.#.....#....#####..#.....#.......>.....#.-bgg+-bggO,m62==7.2 (1-bgg 9-bggNThere is a fountain of clear blue water here. _f - 13 poisoned darts (gained 1) _Found 26 gold pieces, a tubular garnet ring and a pair of gloves.6  n open door, spattered with blood here.  Things that are here:-bggN3=8.2 (26-bggf _a +0 giant club; a +0 giant club; a two-headed ogre corpse-bgg݅c.#.#####.###.#####...##.##.#..###'#.#.#.'.[..#......##..#..#...#.-bgg##).####†####..##...#..#...#.#...#...((..#.##....#..#...#. .####'##.⌠...⌠.###....[#..#...#. .#ßßß.##....⌠..##....!=#>.#####. .'.†..ß#...⌠...)@....[##. .#ßßß.##..⌠....##....$$#.....###' .####+##.⌠...⌠.###....$#.....#.# #.......#.##....#.....#.# ####'####..##...#.....#.# +....#......##..#.....#.#####...##.##.#.....#.#####.###.....#.>.....#.[9;1-bggۇ7H-bgg-bgg\+9.2 (1-bgg/-bgge-bgg\70.2 (28-bgg-bggB` _f - 18 poisoned darts (gained 2)-bggX .#.#####.###.######...##.##.#..###'#..##.#.'.[..#......##..#..#...#..###).####†####..##...#..#...#..#-bggX #...#...((..#.##....#..#...#..# ####'##.⌠...⌠.###....[#..#...#. #ßßß.##....⌠..##....!=#>.#####. -bgg#Y '.†..ß#...⌠...).@...[##. #ßßß.##..⌠....##....$$#.....###'# -bggEY ####+##.⌠...⌠.###....$#.....#.# #.......#.##....#.....#.# ####'####..##...#.....#.-bggY Z# +....#......##..#.....#.#####...##.##.#.....#.#####.###.....#.>.....#.-bggjd -bggEe G41.2 (1-bggr -bggu -bggI 9#.#####.###.# .#####...##.##.#..###'#..#. .#.#.'.[..#......##..#..#...#..#. .##).####†####..##...#..#...#..#. .#...#...((..#.##....#..#...#..#-bggJ '##.⌠...⌠.###....[#..#...#. ßßß.##....⌠..##....!=#>.#####. .†..ß#...⌠...)..@..[##. ßßß.##..⌠....##....$$#.....###'#-bggIJ +##.⌠...⌠.###....$#.....#....# .# #.......#.##....#.....#....# .-bgguJ # ####'####..##...#.....#....# .# +....#......##..#.....#....# .-bggJ #####...##.##.#.....#....######.###.....#....#-bggJ W>.....#....#-bggW -bggPX &2-bggd -bgge .bggB8#.#####.###.##+ #####...##.##.#..###'#..#. #.#.'.[..#......##..#..#...#..#. ##).####†####..##...#..#...#..#. #...#...((..#.##....#..#...#..#'##.⌠...⌠.###....[#..#...#..##....⌠..##....!=#>.#####. †..ß#...⌠...)...@.[##..bggy.##..⌠....##....$$#.....###'##.+##.⌠...⌠.###....$#.....#....#. # #.#.##....#.....#....#. # ####'####..##...#.....#....#. # +....#......##..#.....#....#. #####...##.##.#.....#....#.#####.###.....#....#.>.....#....#..bgg.bgg\5=3.bggϻ.bgg.bgg82#.#####.###.##+#...##.##.#..###'#..#. .#.'.[..#......##..#..#...#..#. #).####†####..##...#..#...#..#. ...#...((..#.##....#..#...#..# #'##.⌠...⌠.###....[#..#...#..##....⌠..##....!=#>.#####. .bgg9..ß#...⌠...)....@[##..##..⌠....##....$$#.....###'##. #+##.⌠...⌠.###....$#.....#....#.  #.#.##....#.....#....#.  ####'####..##...#.....#....#.  +....#......##..#.....#....#....##.##.#.....#....#.#####.###.....#....#.>.....#....#..bggI<4.bggW.bgg7Y.bggO*# #.........#######...... ..#####..#.........##+## ###...##.#..###'#..#. #.'.[..#....#..#...#..#. ).####†####.#..#...#..#.... ..#...((..#.#..#...#..##### '##.⌠...⌠.#[#..#...#. .##....⌠..##....@=#>.##### .ß#.).....[##.............# .##..⌠....##....$$#.....###'##..# +##.⌠...⌠.###....$#.....#....#..##.......#.##....#.....#....#..#####'####..##...#.....#....#..#  +....#......##..#.....#....#..# ###...##.#.....#....#..#########.....#....#..#.bgg9.bggw:&5.bggC.bggUQ  i - 2 potions of cancellation (gained 1)6=6.2 (2.bggW.bggZf _You see here a potion of degeneration..bggt> # #.#. .#####.###.##+#...##.##.#..###'#..#. .'.[..#......##..#..#...#..#. .####†####..##...#..#...#..#....>.bgg> I#...((..#.##....#..#...#..# ##.⌠...⌠.###....[#..#...#. ##....⌠..##....!@#>.#####. ß#...⌠...).....[##.# ##..⌠....##....$$#.....###'##..# ##.⌠...⌠.###....$#  #.#.##....#  .bgg,? ####'####..##...#.....#....#..#  +....#......##..#.....#....#..#...##.##.#.....#....#..######.###.....#....#..#.bggz[ .bgg"\ +7.2 (1.bggg .bggz .bggZ{ +8.2 (2.bgg .bgg - _H - a ring of willpower.bgg M#### .........#######....... .#####..###.........##+### ##...#.##.#..###' .'.[..#......##.###†####..##....> .bgg/ .#...((..#.##....######⌠...⌠.###....@#..#... ##....⌠..##....!.#>.#####.. ß#...⌠...).....[##.............## ##..⌠....##....$$#.....###'##..#..##.bggM .bgg G79.2 (1.bgg .bgg W _You see here a +0 pair of gloves./bgg/bgg^'80/bggҎ/bggJ- _P - a +0 pair of gloves/bggW /bggZ Wear which item? Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)P - a +0 pair of gloves[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip /bggi/bgg_/bgg####...............# #....... deadiverson the Carver ...................# #....... Human of the Shining One ****.. ...................#######....... Health: 67/97 ================-------- .#####.........###.........##+### Magic: 12/12 ======================== ##...##.......##.#..###'#..#..... AC: 18Str: 17 .'.[..#......##..#..#...#..#..... EV: 16Int: 11 .####†####..##...#..#...#..#....> SH: 16Dex: 15 .#...((..#.##....#..#...#..###### XL: 12 Next: 16% Place: Dungeon:11 ##.⌠...⌠.###....@#..#...#........ Noise: ---------  Time: 13180.2 (0.0) [3/bggY#4m##....⌠..##....!.#>.#####........ a) +0 scimitar ß#...⌠...).....[##.............## Throw: 18 darts (poison) ##..⌠....##....$$#.....###'##..# ##.⌠...⌠.###....$#.....#....#..##.......#.##....#.....#....#..#####'####..##...#.....#....#..#+....#......##..#.....#....#..# ##...##.......##.#.....#....#..# _f - 18 poisoned darts (gained 2)  i - 2 potions of cancellation (gained 1) _You see here a potion of degeneration. _H - a ring of willpower _You see here a +0 pair of gloves. _P - a +0 pair of gloves/bgg,/bgg+1.2 (1/bggU/bggf  You start putting on your armour./bggoG82.2 (2/bggz /bgg|/bgg+3.2 (3/bgg/bgg/bgg+4.2 (4/bggI"/bgg'/bgg'&69/bgg'6=5.2 (5/bgg+/bgg .& /bggT.c20 _You continue putting on your +0 pair of gloves. x4/bgg./bggp6/bgg9c _You finish putting on your +0 pair of gloves.0bgg0bggmrDrop what?42/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 18 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (select all with [) 0bgg c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (select all with /)h - a wand of roots (6) 0bggEw[Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]1bggx.1bgg2####...............# #....... deadiverson the Carver ...................# #....... Human of the Shining One ****.. ...................#######....... Health: 69/97 =================------- .#####.........###.........##+### Magic: 12/12 ======================== ##...##.......##.#..###'#..#..... AC: 20Str: 17 .'.[..#......##..#..#...#..#..... EV: 16Int: 11 .####†####..##...#..#...#..#....> SH: 16Dex: 15 .#...((..#.##....#..#...#..###### XL: 12 Next: 16% Place: Dungeon:11 ##.⌠...⌠.###....@#..#...#........ Noise: ---------  Time: 13185.2 (0.0) 1bgg38##....⌠..##....!.#>.#####........ a) +0 scimitar ß#...⌠...).....[##.............## Throw: 18 darts (poison) ##..⌠....##....$$#.....###'##..# ##.⌠...⌠.###....$#.....#....#..##.......#.##....#.....#....#..#####'####..##...#.....#....#..#+....#......##..#.....#....#..# ##...##.......##.#.....#....#..# _You see here a +0 pair of gloves. _P - a +0 pair of gloves  You start putting on your armour. _You continue putting on your +0 pair of gloves. x4 _You finish putting on your +0 pair of gloves.  Okay, then.1bgg31bggA:1bgg<. _1bggZ .....# #.###############.........##+## ###...##.#..###'#..#.... #.'.[..#.#..#...#..# ).####†####.#..#...#..# ..#...((..#1bgg\ .#..#...#..##### '##.⌠...⌠.#.#..#...#....... .##....⌠...#>.##### .ß#.).....[##......# .##.##....$$#.....###'##.. +##.⌠...⌠.###....$#.....#....#..#  #.......#.##....#.....#....#..# ####'####..##...#.....#....#..#  +....#......##..#.....#....#..#  ###...##.......##.#.....#....#..#  ..###..###.....#....#..# 1bggm 1bggin 26.2 (1 _1bgg[w 1bggz _P - a +0 pair of gloves  You start putting on your armour. _You continue putting on your +0 pair of gloves. x4 _You finish putting on your +0 pair of gloves. _You see here a potion of degeneration.2bgg; #############.........##+## ###...####.#..###'#..#.... #2bgg.'.[..##..#..#... ).####†####..##. ..#...((..#.##.#### '##.⌠...⌠.###...... .##....⌠..##....!.#>.#### .ß#...⌠...).....@##.......# .2bgg ~##..⌠....##....$$###'## 2bgg0+##.⌠...⌠.###....$#....2bggc6..## 2bgg..................>.....#....#..# 2bgg2bgg6707 _2bgg2bggW _You see here a +0 leather armour.2bggV ########.........##+## ###...####.#..###'#..#.... #.'.[..##..#..#... ).####†####..##. ..#...((..#.##.2bggW#### '##.⌠...⌠.###...... .##....⌠..##....!.#>.#### .ß#...⌠...).....[##.......2bggW# .##..⌠....##....@$#.....###'## +##.⌠...⌠.###....$....  #.......#.##..... #####'###...............######..# 2bggd2bggwd$8 2bggd _2bgg9n2bggHx2bggx+9.2 (22bggU _You now have 441 gold pieces (gained 33).2bgg@J#####.###.##+#...##.##.#..###'#..#. .'.[..#......##..#..#...#..#. .####†####..##...#..#...#..#....>#...((..#.##....#..#...#..# ##.⌠...⌠.###.....#..#...#. ##....⌠..##....!.#>.#####. ß#...⌠...).....[##.# ##..⌠....##.....@#.....###'##..# ##.⌠...⌠.###....$#.....#....#..#  #.#.##....#.....#....#..# ...##.##.#.....#....#..######.2bgg###.....#....#..#>.....#....#..#'###.######..#2bgg2bgg4190.2 (12bgg2bggy  You now have 456 gold pieces (gained 15).1.2 (22bgg2bgg\ _q - 2 potions of attraction (gained 1)2bgg$T [ ##...####.#..###'#..#..... .'.[..##..#..#... .####†####..##.>...((..#.##.##### ##.⌠...⌠.###..........⌠..##....!.#>.#### ß#...⌠...).....[##.......## ##..⌠....##......###'##..# ⌠...⌠.###....  #.......#.##....###'####..## .......#.......#######.........#2bgg.[ A2.2 (12bggic 2bggk 2bgg-l %22bggQl 3.2 (22bgg;v 2bggTx ? _You now have 467 gold pieces (gained 11).3bgg&33bggc3bgg,3bgg"3bgg-,3bgg 3bgg3bgg/K3=3bggv3bgg3bgg73bgg+3bgg3bggU4=3bggm3bgg,3bgg3bggB,3bgg3bgg3bgg%53bggq3bgg3bgg<3bgg3bggw3bgg3bgg3bgg3bgg/%63bggv3bgg,3bggm3bgg3bgg3bggP3bgg3bgg[ K7=3bgg 3bgg 3bgg 3bggt3bgg,3bgg3bgg3bgg#83bgg/2=3bgg3bgg>3bggd3bggJ3bgg"3bgg+#%93bgg$3bgg&,3bgg>(3bgg+,3bggE-3bgge/3bgg/&803bgg'13bgg33bgg33bggW53bgg<,3bgg=3bgg@3bgg@K1=3bgg7B3bggD3bgg0D3bggE3bggH,3bgg!J3bggcLk2=3bggM3bggrP,3bggQ3bggS3bggS%33bggPU3bggW3bggW3bggFY3bgg\,3bgg%^3bgg]a;43bgg$c3bgge,3bggdg3bggj,3bggyl3bggoa5=3bggq3bgg9v,3bggx3bgg|,3bggk3bgg3bggU6=3bgg3bgg,3bggЉ3bgg,3bgg3bgg\;73bgg@3bgg,3bggۜ3bgg3bggT%83bgg3bgg8,3bgg3bgg,3bgg3bggحa9=3bggq3bggӱ3bgg3bgg|3bgg,3bgg)3bggƸ3bggV90=3bggݹ3bgg,3bgg3bgg,,3bgg3bgg 3bggb%13bgg3bgg},3bggk3bggN;23bgg3bgg3bgg3bgg3bgg4,3bgg3bgg3bggD3=3bgg3bgg,3bgg3bgg,3bgg3bggk4=3bgg3bgg,3bgg]3bgg,3bggo3bgg3bgg%53bgg3bgg,3bgg+3bgg,3bggA3bgg03bggW%63bgg3bgg,3bgg3bgga7=3bgg33bggX3bgg^3bggx,3bggU3bgg$ ,3bgg 3bgg{3bgg3bgg3bgg9=3bgg3bgg3bgg!,3bgg#3bgg^'3bgg,,3bgg-3bgg63bgg8,3bggp:3bgg?  There is an open door, spattered with blood here.  Things that are here:  a +0 giant club; a +0 giant club; a two-headed ogre corpse3bgg C3bggjC _3bggE3bggG3bggI,3bggJ3bggMR  There is a fountain of clear blue water here.3bggO3bggO _3bggP3bggR3bggV,3bggW3bggZV  There is an open door, spattered with blood here.3bgg`\3bgg\ _3bgg]3bggPd3bggf3bgg!g3bgg1l,3bgg{m3bggm3bgg`n3bggq3bggr3bggs3bggst3bgg9u7 _You open the door.3bggv33bgg]v3bgg|@  There is an open door here.3bgghm....#..##).####÷####..## .3bgg...#..#...#...((..#.## ....#......####'##.⌠...⌠.###..... ....#......#ßßß.##....⌠..##....!. 3bgg....#......'.†..ß#...⌠...).....[# ....#..(...#ßßß.##..⌠....##..... 3bggR#'###......####+##.⌠...⌠.###..... .............#...#.##.... .#####.......##.@####'####..##... 3bgg.#...#.......#c#.'....#......##.. .#...#.......#####...##.......##. <#...#.....#####.........## .#...#....................'#######'###......... c   centaur (asleep)#.......## .............#...........#.........#3bggX]278.2 (85.0)9.2 (863bgg3bggIZ _A centaur comes into view.3bgg).####÷((†).....[(..##+##.⌠...⌠.#...#.....#.@####'3bgg?p#c#.'....######...## <####  3bgg$).####÷((†3bgg&%).....[(..##+##.⌠...⌠.#...#.....#.@####'3bgg_%#c#.'....######...## <####  3bggC _A centaur is nearby!3bggI).####÷((†).....[(..##+##.⌠...⌠.#...#.....#.@####'#c#.'....######...## <####  3bgg 1).####÷((†).....[(..##+##.⌠...⌠.#...#.....#.@####'#c#.'....######...## <####  3bgg 3bggO 3bgg 3bgg| ^ _A centaur is nearby!3bgg ).####÷((†).....[(..##+##.⌠...⌠.#...#.....#.@####'#c#.'....######...## <####  3bgg 1).####÷((†).....[(..##+##.⌠...⌠.#...#.....#.@####'#c#.'....######...## <####  3bgg 3bgg3 3bgg 3bgg/ ^ _A centaur is nearby!3bggQ?#....#.##).####÷####..## #....#.#...#...((..#.## #....#......####'##.⌠...⌠.### '....#......#ßßß.##....⌠..##....! #....#......'.†..ß#...⌠...).....[ #....#..(...#ßßß.##..⌠....##.... ##'###......####+##.⌠...⌠.###.....#...#.......#.## ..#####.##@.####'####..## ..#...#3bggB@.#c#.'....#......## ..#...#.#####...##.## .<#...#.#####. ..#...# ..##'##.#'###.#.#. .#.#.# .#.#.#4bgg< 4bgg 980.2 (1.0) _4bgg4bgg4bgga(cc   _A centaur is nearby!You slash the centaur!  The centaur shouts!  The centaur is severely wounded. 4bgg,b You block the centaur's attack. The centaur completely misses you.  The centaur hits you but does no damage.4bggbL====1.1 (0.94bggh4bggkX _The centaur completely misses you.4bgg!;  You slash the centaur!4bgg\)4bgge7==--2.04bgg64bggwK _You kill the centaur!4bgg4bgg:9--4bgg 4bggH _No target in view!4bggw 4bggpw 4bggy 4bggs $04bggޮ 4bgg 4bgg8 E _Done exploring.4bgg 4bgg" 34bgg@ 4bggD 4bgg#H 4bggI  4bggJ 7_Done exploring.5bggl5bggWm5bggo5bggЦ45bgg5bgg E _Done exploring.5bggI5bgg5bgg!5bggG)[ _Done exploring.6bgg6bggfWhere to? (Tab - D:11, ? - help) 6bggR D - Dungeon  T - Temple L - Lair6bgg^6bgg^6bgg#....#........##).####÷####..##.. deadiverson the Carver #....#........#...#...((..#.##... Human of the Shining One ****.. #....#......####'##.⌠...⌠.###.... Health: 97/97 ======================== '....#......#ßßß.##....⌠..##....! Magic: 12/12 ======================== #....#......'.†..ß#...⌠...).....[ AC: 20Str: 17 #....#..(...#ßßß.##..⌠....##..... EV: 16Int: 11 ##'###......####+##.⌠...⌠.###.... SH: 16Dex: 15 6bgg..............#...#.......#.##... XL: 12 Next: 17% Place: Dungeon:11 ..#####.......##@.####'####..##.. Noise: ==-------  Time: 13282.0 (0.0) ..#...#.......#)#.'....#......##. a) +0 scimitar ..#...#.......#####...##.......## Throw: 18 darts (poison) .<#...#...........#####.........# ..#...#.......................... 6bggN..##'##.......#######'###........  ..............#.........#.......#  ..............#.........#.......#6bgg  ..............#.........#.......#  _You kill the centaur! _No target in view! _Done exploring. _Done exploring. _Done exploring. _Done exploring.6bggʍ6bgg6bggY6bggb6bgg: _6bgg6bgg,6bggI6bgg7 _You open the door.6bgg^6bgg6bggq6bgg@  There is an open door here.6bgg6bgg _6bggI6bggk6bgg,6bgg6bgg6bggh,6bgg6bggFk  You see here a howler monkey skeleton.6bggX6bgg _6bgg[6bgg6bgg,6bggF6bggW@  There is an open door here.6bggC _6bggOX6bggS6bggQV,6bggOX6bggk]6bgg `6bgg=`6bggtb6bggk6bggLm6bggm6bggon6bggOr6bggQt6bggt6bggu6bggHy6bggz6bgg{6bgg{6bggm6bgg6bgg6bgg6bgg6bgg6bgg06bgg,6bgg6bgg,6bggJ6bgg6bggW6bgg6bgg֕6bggĘ6bggx,6bgg^6bgg 6bgg6bggҟ6bgg6bggߤ6bgg6bgg66bggڨ6bggw6bggu6bgg6bgg6bgg16bgg6bgg:6bgg6bgg'  There is a stone staircase leading down here. _6bggT ## * #.#  ...##  ....  . #... 6bgg ...#####..#  .V#.......# 2 .......@..# -- ........###  .......## ....... ......#6bggD .....#V   vampire (dormant) ...#. ...#. 6bgg@ 6bggc  You climb downwards.  You can now summon a divine warrior.--6bgg6bggH.318.7 (36.7)6bgggO6bggR _Found a stone staircase leading up. _There is a stone staircase leading up here.7bgg ## #.# ...##. ....#.. #...7bgg.#####..#.V#.#<..#.###.##.##7bggG.##.#....#.....#.7bgg7bgg89.7 (1.0) _7bgg7bgg7bgg_  ### #.#.. ...##.. ....#. #........#####..#.V#.#7bgg9` .<..#.####.##.#.#......##.##.....#.7bggl` K#....#.7bggf 7bggn x.VV7bggn '207bggu 7bggy 7bgg #.. ###.. #.#... ...##..7bgg  ....#....# #.........#####..#.#.#.V.@..<..#.####.##7bggA .#..#......##W.##.#.#W   wraith (dormant)#....#..7bgg[ 7bgg 7bgg .V.WW7bgg &17bgg< 7bgg Y _A wraith comes into view.7bggj7bgg( .W  You hit the vampire but do no damage. The vampire barely misses you.7bgg(.=27bgg/7bgg35 _You block the vampire's attack.8bgg9  You hit the vampire.8bgg  W.The vampire is lightly damaged.8bgg &38bgg~8bggu _The vampire closely misses you. You block the vampire's attack.8bgglj  You hit the vampire but do no damage.8bgg W.The vampire is lightly damaged.8bgg߲&48bgg28bgg8 _You block the vampire's attack. x28bgg`j  You hit the vampire but do no damage.8bggqa-5.6 (0.98bggMh8bgg8m5 _The vampire is lightly damaged.8bgg  You slice the vampire!!  The vampire is heavily damaged.You block the vampire's attack.8bgg tW. 8bggv 6==6.6 (1.08bgg 8bgg ? _The vampire bites you but does no damage.8bgg  You slash the vampire!  The vampire is almost destroyed.8bggtW. 8bggr .-78bgg'8bgg,8 _You block the vampire's attack. x29bggTj  You hit the vampire but do no damage.9bgg8*9bgg  The vampire is almost destroyed.The vampire draws life force from you.9bgg]Wv @The vampire is healed by the life force!9bggW^4---9bggX89bgg`9bggdL _The wraith misses you.9bgg5  You barely miss the vampire.The vampire is severely damaged.9bgg::*9bggN V(invisible)The vampire mumbles some strange words.9bggN} VThe vampire flickers and vanishes for a moment.9bgg's5-====99bgg;9bgg4 _You block the wraith's attack.9bggG  You hit the vampire.*9bgg  The vampire is almost destroyed.The vampire draws life force from you.9bggs v @The vampire is healed by the life force!9bggt 2-=---309bgg ~ 9bgg T _The wraith closely misses you.:bgg=  You barely miss the vampire.The vampire is severely damaged.The vampire completely misses you. You block the vampire's attack.:bgg=h3=---1:bggJG:bggNL _The wraith misses you.:bggy{  You slash the vampire!  You destroy the vampire!:bggم .W   wraith  The Shining One accepts your kill.:bgg܋=9=2.5 (0.9:bgg:bggɗ4 _You block the wraith's attack.:bggHv :bggv 5-3.5 (1.0:bggX} :bgg _You barely miss the wraith. The wraith barely misses you.;bgg8]-4=-4.4 (0.9 _You hit the wraith but do no damage. The wraith hits you but does no damage.;bggc  You slash the wraith!  The wraith is moderately damaged.;bggF0=5.3;bgg;bgg4 _You block the wraith's attack.;bgg^  You hit the wraith but do no damage.The wraith is moderately damaged.;bgg@5-6.3 (1.0;bgg;bgg$4 _You block the wraith's attack.;bgg  You hit the wraith.  The wraith is heavily damaged.;bgg]5-7.2 (0.9;bggP;bgg4 _You block the wraith's attack.;bgg|  You slash the wraith!  The wraith is severely damaged.;bgg5~ 5=8.2 (1.0;bggo ;bgg݈ = _The wraith hits you but does no damage.;bggw  You barely miss the wraith.The wraith is severely damaged.;bggx.-9;bgg;bggB4 _You block the wraith's attack.20=5.1 (0.9=bgg@=bggYDX _The Shining One accepts your kill.=bggl5#..##.##...+.#......+...##.# ....#.# #....#......#####..# #.....#.......##..........<..#..##### ...####..#.##....#.. ..... ..=bggTt=bgg-u6--6.1 (1.0=bggy=bgg{>bggM>bgg >bgg>bgg~>bgg(>bgg9=>bgg,>bgg,>bgg>bgg>bgg #..##Tß!##  ##..#$..$c  #...+$$$. ###...+$_I #.#.+.$ ...##.......#$ ....#.## #.... ######..#--8.1 (2 #.....#.......# #..........<..#..........###..##........##...........#I   obsidian statue (unaware) ...#......##c  [39;49>bgg<Sm centaur warrior (asleep)#........##T   troll (asleep).......#.#>bggcE  Found an opulent altar of Gozag.>bgg>bgg  The centaur warrior shouts! You hear a shout!  Marking area around an obsidian statue as unsafe for travelling.>bgg/  --more--?bgg1Y.T..$.c_I.IcT?bgg76 9.1 (3 _?bgg=:_?bggN?bggY. 7_?bgg,/ ?bggj5 ?bggV8 F _Unknown command.?bggT ?bggU ?bggoY ?bggf ?bggt  Ravn's ghost turns its malevolent gaze towards you.?bggv ?bggw ?bggy ?bggz ?bggz ?bgg | ?bggW ?bggw ?bggV ?bgg = _The tengu reaver shouts!?bgg# ?bggS ?bggD ?bggU ?bgg@ ?bgg= ?bgg ?bgg ?bgg ?bgg ?bgg ?bggc ?bgg ,?bgg?bgg?bggw ?bgg?bggS,?bgg?bgg ?bgg),?bgg+?bgg5?bgg ......... ##. .##. .# ....#####..y #..##.ß!........###..#$..$.# ..y....!.#...+$$$.ß# ##........##...+W_I$∩# #.# .u.....+QT$$ß#...#...@..#co$$.#....# .##Vß. #.... .######..# ......)#.....#.......#)......bgg+? 20m#..........<..#.........### ........#### ...##......# ... ### BbggMF Bbgg6G BbggtH Bbgg _You block the white ugly thing's attack.CbggA.# ....#####..y #..##.ß!........###..#$..$.# ......y!.#...+$$$.ß# ##..##...+W_I$∩# #.# .....+cT$$ß#...#.#Qo$$.#....# .u..##Vß. #.... .......#....@.#####..# ......)#.....#.......# )#..........<..# .........###.....bggB40m...####...##......# ... ##....###  #........## .......#.# CbggICbggK,CbggMCbggvOT  The white ugly thing attacks as it pursues you!Cbggj.c_y....+WCbggk..uCbggl&4Cbgg|Cbgg> _You block the white ugly thing's attack.Cbggy.# ....##### ..y...... #..##.ß!## ........###..#$..$.# .!.#...+$$$.ß# ## .##...+c_I$∩# #.# .y....+WT$$ß#...## .#Qo$$.#....# .Cbgg##Vß. #.... .#...u.@#####..# ......)#.....#.# )......#..........<..# .......###.##.....##...##.............# ... ##....#......## #........## u   white ugly thingCbgg.#.# c   centaur warriorCbgg[Cbgg;CbggkCbggsx_.$y.uCbgg.-5Cbgg8_CbggnCbgg ..y #..##.ß!........###..#$..$.# .!.#...+$$$.ß# ##.##...+c_I$∩# #.# .....+W$$$ß#...#.#Qo$$.#....# .Cbgg 3y..##Vß. #.... .#....u.#####..# ......)#.....#@......# )#..........<..# ...................### .##........##...##.............#Cbgg ... ##....#......## u   white ugly thing #........## Cbgg. y   vampire mosquito.......#.#.##....#..Cbgg[Cbgg}CbggCbggkK...uCbggo@-6Cbgg<+8_Cbgg.Cbgg B  You hit the white ugly thing.Cbgg2 M  The white ugly thing is lightly wounded.Cbgg :_Cbgg _88---=7Cbgg>) Cbgg 3 d _The white ugly thing stings you. The white ugly thing freezes you! You resist.Cbgg s  You hit the white ugly thing but do no damage.Cbgg Cbgg yyyy 2 vampire mosquitoes (1 wandering)The white ugly thing is lightly wounded.Cbgg= `9=--8Cbgg_ Cbggʳ I _The white ugly thing stings you but does no damage.Cbggrp  The vampire mosquito buzzes angrily.  You slash the white ugly thing!CbggCbggnCbggnz  The white ugly thing is moderately wounded.Cbgg._y# yCbgg6==9.0 (0.9Cbggw!Cbgg%I _The white ugly thing stings you but does no damage.Dbgg/  You hit the white ugly thing but do no damage.Dbgg2z  The white ugly thing is moderately wounded.Dbgg3DbggsCy_..y.yDbggD7--70.0 (1.0DbggO8_DbggMSV _The white ugly thing misses you.Dbgg5  You slash the white ugly thing!  The white ugly thing is heavily wounded.Dbgg{  You block the vampire mosquito's attack.  The white ugly thing barely misses you.Dbgg?.yDbggi90==-Dbgg1Dbgg Dbgg> _You block the vampire mosquito's attack.Dbgg/  You slash the white ugly thing!  The white ugly thing is severely wounded.Dbgg  You block the vampire mosquito's attack.  The white ugly thing stings you but does no damage.Dbggbj.y Dbggr3=9 (0.9Dbgg DbggH _The vampire mosquito bites you but does no damage.Dbgg9D  You slash the white ugly thing!DbggӉDbgg! _.yy  The white ugly thing is severely wounded.The white ugly thing stings you but does no damage.-2.8DbggDbgg!^ _The vampire mosquito closely misses you.EbggB/_The vampire mosquito closely misses you.  You hit the white ugly thing but do no damage.You block the vampire mosquito's attack. x2  The vampire mosquito bites you but does no damage.EbggC^1--3.8 (1.0EbggVT:_Ebgg WI _The white ugly thing stings you but does no damage.Ebggz_  The vampire mosquito bites you but does no damage. _The white ugly thing stings you but does no damage.  You slash the white ugly thing!  The white ugly thing is almost dead.  You block the vampire mosquito's attack. x3  The vampire mosquito biteEbgg@-4Ebgg:_Ebgg[I _The white ugly thing stings you but does no damage.Ebgg D  You slash the white ugly thing!Ebgg m _†yy 2 vampire mosquitoes  You kill the white ugly thing!You block the vampire mosquito's attack.  The vampire mosquito closely misses you. x2Ebgg# >74=5Ebgg. :_Ebgg5 H _The vampire mosquito bites you but does no damage.Fbggě   You closely miss the vampire mosquito. The vampire mosquito barely misses you.You block the vampire mosquito's attack.  The vampire mosquito bites you.Fbgg.-6Fbgg5Fbgg> _You block the vampire mosquito's attack.Fbgg>_a_The vampire mosquito bites you. _You block the vampire mosquito's attack.  You hit the vampire mosquito.  The vampire mosquito is lightly damaged  You block the vampire mosquito's attack.  The vampire mosquito completely misses you.Fbgg`@-7Fbggl:_FbggpA _You block the vampire mosquito's attack. x2Fbgg4   The vampire mosquito completely misses you. _You block the vampire mosquito's attack. x2  You slash the vampire mosquito!  The vampire mosquito is heavily damaged.You block the vampire mosquito's attack. x2  The vampire mosquito misses you.Fbggp5 5=8.7 (0.9Fbgg"? FbggC > _You block the vampire mosquito's attack.Fbggr  You barely miss the vampire mosquito.The vampire mosquito is heavily damaged.Fbgg t =2-9.7 (1.0FbggX 8_Fbggֆ A _You block the vampire mosquito's attack. x3FbggRThe vampire mosquito is heavily damaged. _You block the vampire mosquito's attack. x3  You slash!  The vampire mosquito is almost destroyed.The vampire mosquito misses you.  Fbgg6=80.6 (0.9Fbgg:_FbggV _The vampire mosquito misses you.Gbgg8_The vampire mosquito misses you.hit the vampire mosquito.  The vampire mosquito bites you but does no damage.  The vampire mosquito bites you.Gbgg9>89-1.6 (1.0GbggEGbgg)I> _You block the vampire mosquito's attack.Gbgg#  You hit the vampire mosquito.  You destroy the vampire mosquito!Gbgg: _.   vampire mosquitoThe Shining One accepts your kill.The vampire mosquito completely misses you.Gbgg/ 7-6-2 _The vampire mosquito bites you.Gbgg8_Gbggh _Your Dodging skill increases to level 7!Gbgg K _You hit the vampire mosquito.  The vampire mosquito is lightly damaged.Gbgg#L-3.7 (1.1GbggY8_Gbgg9]A _You block the vampire mosquito's attack. x2Gbggl  You barely miss the vampire mosquito.The vampire mosquito is lightly damaged.GbggT 58-Gbgg &4.6 (0.9GbggB Gbgg" A _You block the vampire mosquito's attack. x2Gbgge  You slice the vampire mosquito!!  The vampire mosquito is severely damaged.You block the vampire mosquito's attack.Gbggߓ 1==5.5Gbgg :_Gbgg{ H _The vampire mosquito bites you but does no damage.Gbggm  You hit the vampire mosquito but do no damage.The vampire mosquito is severely damaged.Gbgg6--6.5 (1.0GbggGbgg&^ _The vampire mosquito closely misses you.Hbgg   You slash the vampire mosquito!  You destroy the vampire mosquito!Hbggl F.Hbggf9=7--Hbgg@&7.4 (0.9Hbgg8_HbggX _The Shining One accepts your kill.Hbgg4HbggHbggH _No target in view!Hbgg|3HbgghHbgg: _HbggŋHbggHbgg.HbggHbggHbgg,V90=HbggaHbgg֣HbggHbggHbgg,HbggHbgg;1HbggHbggn,HbggxHbggt,HbggHbggHbgg%2HbggAHbgga,HbggHbgg)HbggD3=HbggSHbgg2HbggxHbggWHbggHbggUHbggHbggY k4=Hbgg Hbgg Hbgg HbggY Hbgg Hbgg Hbgg Hbgg Hbgg %5Hbgg% Hbgg+ ,Hbggu. Hbgg4 ,Hbggh7 Hbgg< ;6Hbgg> HbggBE HbggE HbggH HbggO HbggP D7=HbggS HbggZ 1 _HP restored.Hbgg|b Hbggg Hbgg(h Hbgg7m Hbgg~ g  You see here an ugly thing corpse.Hbggv 5 _Hbgg Hbgg Hbggֱ ,Hbgg` Hbgg Hbgg5 Hbgg HbggA Hbgg 9=Hbgg Hbgg _Ravn's ghost whispers, "They're coming for you..."Hbgg Hbgg Hbgg  Hbgg_ Hbggx HbggV" Hbggd* Hbgg- Hbgg3 Hbgg3 Hbgg9 HbggG HbggO HbggU Hbgg[Y HbggY Hbgg] Hbggc Hbggh Hbggh Hbgg;k Hbggq Hbgg8r HbggXt Hbgg{ $ Hbgg.{ M_C - 4 potions of curing (gained 1)Hbgg  ....#(..  ......##  ...#  ... .# ##  Hbggy ... ..##.  ..##....##### .........##..##.ß!## .......@###..#$..$.#-418.4 (31.0) ...#...+$$$.ß# ## .##...+W_I$∩# #.# Hbgg I.............+Qc$$ß#...# .....#VQ$$.#.... Hbgg .......##Tß.##.....Hbgg #.....†#####..#)#.....#.......#)..........<..#Hbgg9 Hbgg HbggŚ F-9.4 (32Hbgg Hbggҧ % _Found 3 stones.Hbgg Hbgg, Hbgg Hbgge Hbggر BHbggܲ Hbgg ,Hbgg Hbgg Hbgg@ Hbgg Hbgg HbggE Hbgg HbggY Hbggg Hbgg> Hbgg Hbgg% HbggD Hbgg Hbgg~ Hbgg Hbgg Hbgg HbggM" Hbgg' HbggJ- Hbgg2 Hbgg7 Hbgg< Hbgg-= HbggA HbggN Hbgg` ,Hbggc Hbggi Hbggm Hbgg n Hbggp Hbggu HbggDz ,Hbgg Hbgg Hbgge Hbgg Hbgg Hbgg Hbgg ,HbggA Hbgg Hbgg$ Hbgg[ HbggU Hbgg֚ Hbgg Hbgg_ Hbgg Hbggʣ Hbgg Hbgg Hbgg Hbggh HbggT ,Hbgg Hbgg Hbgg Hbggȳ Hbgg Hbgg Hbgge Hbgg Hbggź Hbgg Hbgg% Hbgg Hbgg Hbgg Hbgg ,HbggP Hbgg Hbggi Hbgg HbggR Hbgg& Hbgg Hbgg& Hbgg; Hbgg* Hbgg . !.  #.. . #### ###..### .....# 39.4 (20.....## >.....# ....#...###..###...#....#..#(.....# .......##..#Hbgg( "#Hbggm HbggD -40.4 (21Hbgg Hbgg' ; _Found a stone staircase leading down.HbggdHbggdHbgghHbggnHbggrsHbggw,Hbgg{HbggfHbggHbggHbggHbgg,HbggHbgg?Hbgg?HbggHbggHbggؚHbgg HbggUHbggHbgg4HbggHbgg0HbggHbggHbggHbggHbggHbgg ### #.###  ##...##  ##.@...## HbggWV #.......## ##..#....### #..........#### #.##......Hbgg###..### #................#Hbgg ................## .../.>...........#.......Hbggؽ"...#Hbggc17.4 (7.0)Hbgg+8.4 (8HbggHbggZ _Q - 2 bubbling red potionsIbggIbgg_IbggIbggiIbggSIbggBIbggE,IbggJIbggIbgg[IbggIbgg`IbggIbggZIbggIbggIbggPIbgg,IbggIbgg6Ibgg ,Ibgg Ibgg) Ibgg,IbggLIbgge,IbgggIbggP _h - a wand of roots (14) (gained 8 charges)IbggR$ ##.....##  #.......## ##..#....#####..........#####.##......###..###Ibgg$###................##.................##..###.....>...........#.......@..............#56......................##....................#..#Ibgg`%'....................#........#............#(...................##. ..............##......#. ...>.......#.  ..... Ibggm-Ibggv.+7.4 (9Ibgg4Ibgg79 _Found an escape hatch in the floor.IbggCIbggIbggIbggOIbggIbggpIbgg,Ibgg,IbggIbggIbgg,IbggIbggIbggIbggIbggIbggIbgg"E ##.....## #.......## ##..#....###### ##..........####.. #.##....Ibgg###.... ###...#...... #.........###.....>..[.......61.4 (4.......Ibgg.....#.....###..#.........##..#.......>.Ibgg"IbggIbggR+2.4 (5Ibgg}Ibgga) _Found a chain mail.IbggIbggIbggjIbggIbggIbgg'Ibgg,Ibgg,IbggkIbggIbggMIbggIbgg$Ibgg#IbggIbggHIbggIbggQIbggIbgg7IbggIbgg Ibgg,Ibgg1IbggIbggIbgg9IbggIbggIbggp ,Ibgg!Ibgg#Ibgg',Ibgg(Ibgg,Ibgg0,Ibgg1Ibgg5Ibgg9,IbggB:Ibgg>IbggH ## #. ##### ##. #### ###...# #. #..####.....#### #...#.## ##..........### #.@..[....... # IbggI+ # #.###.#... #. ###y   vampire mosquito (dormant) .. #...... .y #.......> IbggZW073.4 (11.0)IbggW,4.4 (12IbggH`Ibggec _A vampire mosquito comes into view.Ibgg  #####  #### ###...#  #..####.. #...#.... ##.......... #.@..[....... #......... +......... #......... #.###..... #. ###... .. #.... .y #.......>Ibgg=  #####  #### ###...#  #..####.. #...#.... ##.......... #.@..[....... #......... +......... #......... #.###..... #. ###... .. #.... .y #.......> Ibgg/ IbggЋ Ibgg Ibgg g _A vampire mosquito is nearby!Ibgg #####  #### ###...#  #..####.. #...#.... ##.......... #.@..[....... #......... +......... #......... #.###..... #. ###... .. #.... .y #.......>Jbgg]Y #####  #### ###...#  #..####.. #...#.... ##.......... #.@..[....... #......... +......... #......... #.###..... Jbgg]H#. ###... .. #.... .y #.......> Jbgge4Jbgg nJbggpg _A vampire mosquito is nearby!Jbgg.###### ##.#### ###...# #.#..####.....####...#....##....#....[.................+##### ###... #..y #.......>...Jbgg>Jbggj  The vampire mosquito buzzes angrily. You hear an angry buzzing noise.JbggJbggJbggJbgg yy 2 vampire mosquitoesy.y  A vampire mosquito comes into view. x2Jbgg{:==5.0)JbggSJbggP _The vampire mosquito buzzes angrily. x2; You hear a shout!JbggA; ########## ###...#  #..####.....####. #...#.......##.#...# #....[........ #.... + # #.####Jbgg܈ #.y ###. ... #.. y... #.......>y 3 vampire mosquitoes..y.. ......Jbgg,JbggUJbggl,Jbgg$Jbggyy.y..=6JbggJbggJbggy Jbgg JbggQ  Jbgg~ m You hit the vampire mosquito but do no damage.Jbgg Jbgg Jbggx Xy.Jbgg 6--7.3 (0.9Jbgg Jbgg > _You block the vampire mosquito's attack.Jbggz D  You slash the vampire mosquito!JbggV w  The vampire mosquito is heavily damaged.Jbgg JbggH r  A vampire mosquito comes into view.Jbgg Jbgg9 JbggP  y.ee   deep elf pyromanceryyyyy 4 vampire mosquitoes (1 wandering)A deep elf pyromancer comes into view. It is wielding a +4 long sword.Jbgg V=-8.3 (1.0Jbgg Jbgg > _You block the vampire mosquito's attack.Kbgg8p  The vampire mosquito buzzes angrily.  You slash the vampire mosquito!KbggU9KbggQ<x  The vampire mosquito is almost destroyed.Kbgg>KbggNc y.ey..yThe vampire mosquito closely misses you. x2  You block the vampire mosquito's attack. x2KbggWO&9Kbgg[Kbgg,^] _The vampire mosquito barely misses you.Kbgg  You completely miss the vampire mosquito.The vampire mosquito is almost destroyed.KbggP  You block the vampire mosquito's attack. x2Kbgg9eyKbgg4..Kbgg6-80.2 (0.9Kbgg;Kbgg?] _The vampire mosquito barely misses you.Kbgg"You completely miss the vampire mosquito.  The vampire mosquito is almost destroyed.You block the vampire mosquito's attack. x2 _The vampire mosquito barely misses you.  You completely miss the vampire mosquito.  The vampire mosquito is almost destroyed.Kbgg y.You block the vampire mosquito's attack.  The vampire mosquito completely misses you.The vampire mosquito bites you but does no damage. x2KbggG-1.2 (1.0KbggKbggXA _You block the vampire mosquito's attack. x2Kbgg-  You hit the vampire mosquito.  You destroy the vampire mosquito!Kbggg  The Shining One accepts your kill.Kbgg֢  The vampire mosquito closely misses you.You block the vampire mosquito's attack.  The vampire mosquito closely misses you. x2Kbgg*......e###..... ###..... 3Kbggv.82KbggKbggKbgg/  --more--LbggH< _You block the vampire mosquito's attack.Lbgg>You hit the vampire mosquito.  The vampire mosquito is moderately damaged.You block the vampire mosquito's attack.  The vampire mosquito closely misses you.The vampire mosquito misses you. x2LbggԈ&3Lbgg[LbggA _You block the vampire mosquito's attack. x2Lbgg 0--You closely miss the vampire mosquito.The vampire mosquito is lightly damaged.block the vampire mosquito's attack. x2  The vampire mosquito closely misses you.  The vampire mosquito bites you but does no damage.LbggE /  --more--Mbggk  The vampire mosquito bites you!4MbggpMbggٶE _The vampire mosquito draws vitality from your injuries!Mbgg:1--You hit the vampire mosquito.  The vampire mosquito is moderately damaged.  You block the vampire mosquito's attack.  The vampire mosquito closely misses you.Mbggs~You block the vampire mosquito's attack.  The vampire mosquito bites you but does no damage.Mbgg;/  --more--Mbgg1 n  The vampire mosquito completely misses you.Mbgg2 -5.3 (1.1MbggO: Mbgg@ 6 _You block the vampire mosquito's attack.Mbgg You hit the vampire mosquito.  The vampire mosquito is heavily damaged.The vampire mosquito bites you!  You block the vampire mosquito's attack.Mbgg;MbggC ey  The vampire mosquito bites you.  You block the vampire mosquito's attack.Mbggs$83Mbgg9--6.2 (0.9MbggMbggSMbgg&/  --more--Nbgg F _The vampire mosquito bites you but does no damage.Nbggf You hit the deep elf pyromancer but do no damage.You block the vampire mosquito's attack.  The vampire mosquito closely misses you.You block the vampire mosquito's attack.Nbggg64--Nbggg&7.2 (1.0NbggrNbggw@ _The vampire mosquito bites you but does no damage.Obgg& E E   fire elemental (summoned)yyy 3 vampire mosquitoesYou slash the deep elf pyromancer!  The deep elf pyromancer is moderately wounded.You block the vampire mosquito's attack. x2Obgg6==8.1 (0.9Obgg&;EObggf _The deep elf pyromancer casts a spell.Obgg< _The deep elf pyromancer casts a spell.  You slice the deep elf pyromancer!!  The deep elf pyromancer is almost dead. Obgg The vampire mosquito closely misses you.The vampire mosquito bites you.Obgg OE○ Obgg679-Obgg&9.1 (1.0Obgg.EEObgg%ObggL _The deep elf pyromancer hits you with a +4 long sword.Obgg E°E _The deep elf pyromancer hits you with a +4 long sword.  You hit the deep elf pyromancer.  The deep elf pyromancer is almost dead.bar  You block the vampire mosquito's attack. x2  You block the deep elf pyromancer's attack.Obgg U80---Obggک 90.0 (0.9Obgg7 DEEObgg= H _The vampire mosquito bites you but does no damage.Obgg dMEE Obgg _The vampire mosquito bites you but does no damage.  You barely miss the deep elf pyromancer.The vampire mosquito bites you!  The vampire mosquito closely misses you.Obgg $71Obgg b--=-1.0 (1.0Obgg_ NEEObgg[ V _The vampire mosquito misses you.PbggABE.EYou hit the deep elf pyromancer.  The vampire mosquito bites you but does no damage.  The deep elf pyromancer misses you.  The vampire mosquito bites you but does no damage.PbggTB%-PbggB 2PbggKVEEPbggM2-Pbgg\  --more--Pbgg]Pbgg < _You block the vampire mosquito's attack.Pbggv EEYou hit the deep elf pyromancer.  The deep elf pyromancer is almost dead.The vampire mosquito closely misses you.Pbgg hThe vampire mosquito misses you.You block the deep elf pyromancer's attack.Pbgg Z2--9 (0.9Pbgg NEEPbgg > _You block the vampire mosquito's attack.Qbgg  You slash the deep elf pyromancer!  You kill the deep elf pyromancer!Qbgg#Qbgg}v  The fire elemental disappears in a puff of smoke!Qbggy.§yyy 3 vampire mosquitoesQbggP6333.9 (1.0QbggQbgg A _You block the vampire mosquito's attack. x3Qbgg"68-slash the vampire mosquito!  The vampire mosquito is almost destroyed.The vampire mosquito barely misses you.You block the vampire mosquito's attack.vampire mosquito closely misses you.  The vampire mosquito bites you.Qbgg?/  --more--Rbggʳ  ..... ...... Rbggj5=4.8 (0.9RbggtRbgg6 _You block the vampire mosquito's attack.Rbgg69=You barely miss the vampire mosquito.  The vampire mosquito is almost destroyed.You block the vampire mosquito's attack.  The vampire mosquito barely misses you.You block the vampire mosquito's attack.  The vampire mosquito closely misses you.Rbgg/  --more--Rbgg)[ K  You block the vampire mosquito's attack.Rbgg"^ 5-5.8 (1.0Rbggzd Rbggh Y _The vampire mosquito completely misses you.Rbgg)5 You hit the vampire mosquito.  You destroy the vampire mosquito!The Shining One accepts your kill.Rbgg0@ & ). 2You feel better. The vampire mosquito misses you.The vampire mosquito completely misses you.RbggD 78===4-6.7 (0.9RbggQ RbggHW A _You block the vampire mosquito's attack. x2SbggwThe vampire mosquito completely misses you. _You block the vampire mosquito's attack. x2  You slash the vampire mosquito!  The vampire mosquito is heavily damaged.  You block the vampire mosquito's attack.  The vampire mosquito completely misses you.SbggHx5=7.7 (1.0SbggSbggŅ> _You block the vampire mosquito's attack.SbggGSbggߨSbgg8SbggF _Unknown command.Sbgg͡The vampire mosquito completely misses you. _You block the vampire mosquito's attack. _Unknown command.You slash the vampire mosquito!  The vampire mosquito is almost destroyed.  You block the vampire mosquito's attack. x2Sbggf9==8.6 (0.9SbggêSbggخa _The vampire mosquito completely misses you.Sbgg/G?M_The vampire mosquito completely misses you.  You slash the vampire mosquito!  You destroy the vampire mosquito!The Shining One accepts your kill.SbggW †   vampire mosquitoYou feel better.  The vampire mosquito closely misses you.Sbggs]m85==5-9.6 (1.0SbggeSbggk> _You block the vampire mosquito's attack.Sbggt  You barely miss the vampire mosquito.You block the vampire mosquito's attack.Sbgg# B-500Sbgg Sbgg H _The vampire mosquito bites you but does no damage.Sbgg(  You barely miss the vampire mosquito. The vampire mosquito barely misses you.Sbgg f6==1.5 (0.9SbggU Sbgg H _The vampire mosquito bites you but does no damage.Tbgg~ &  Tbgg }You hit the vampire mosquito but do no damage.You block the vampire mosquito's attack.Tbgg -2.5 (1.0TbggRTbggH _The vampire mosquito bites you but does no damage.Tbgg  You closely miss the vampire mosquito.You block the vampire mosquito's attack.3TbggвTbgg] _The vampire mosquito barely misses you.Tbggk  You closely miss the vampire mosquito.Tbgg.74TbggTbggIA _You block the vampire mosquito's attack. x2TbggoI  You slash the vampire mosquito!  The vampire mosquito is moderately damaged.TbggpJ.=5TbggSTbggWA _You block the vampire mosquito's attack. x2Tbgg2 You block the vampire mosquito's attack. x2  You slash the vampire mosquito!  The vampire mosquito is moderately damaged. _You block's attack. x2  You closely miss the vampire mosquito.  The vampire mosquito is moderately damaged.Tbggq 68-6Tbgg Tbgg > _You block the vampire mosquito's attack.Tbgg`  You barely miss the vampire mosquito.The vampire mosquito is moderately damaged.TbggFa @-7Tbggi Tbgg|m A _You block the vampire mosquito's attack. x2Tbggh   You hit the vampire mosquito but do no damage.The vampire mosquito is moderately damaged.Tbgg &8TbggfTbggA _You block the vampire mosquito's attack. x2Ubgg  You slash the vampire mosquito!  The vampire mosquito is almost destroyed.Ubgg\9==9Ubgg_UbggA _You block the vampire mosquito's attack. x2Ubgg^F  You hit the vampire mosquito.  The vampire mosquito is almost destroyed.The vampire mosquito completely misses you.Ubgg(G/-10UbggrOUbggT] _The vampire mosquito barely misses you.Ubgg   You hit the vampire mosquito.  You destroy the vampire mosquito!The Shining One accepts your kill.Ubgg%F.Ubggz+97===7-Ubgg+1Ubgg4Ubgg6& _You feel better.Ubgg ##### ##.#### ###...# #.#..####.....####.#...#.......##...##..........###.#....[...#......+.†Ubggj ^#)@.#.#####.. ###.... #........ #.......>.............. Ubgg- UbggZ. .-2Ubgg5 Ubgg8 Ubgg ##### ## #### ###...# #. #..####.....#### #...#.## ##.### #....[ # +.† # #.###.# #.. ###. .... #... .....##.> .......Ubgg ......... ...........UbggUbggI@-3Ubgg Ubggp _Items here: ) [ †††.VbggU Vbgg Pick up what? 43/52 slots (_ for help) Hand Weapons (select all with ))  a - a +4 long sword Armour (select all with [)b - a +0 ring mail Carrion Vbggr <an elf corpse a vampire mosquito corpse Vbgg a vampire mosquito corpse [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]Wbggf  a + a +4 long sword[Enter] accept (1 chosen)WbggK Wbgg͟ Wbgg' ##### ## deadiverson the Carver#### ###...# #. Human of the Shining One *****.#..####.....####. Health: 97/97 ========================#...#.......##... Magic: 12/12 ========================##..........###... AC: 20Str: 17#....[............ EV: 17Int: 11Wbggե #................. SH: 16Dex: 15+.†............... XL: 12 Next: 37% Place: Dungeon:12#@................ Noise: ---------  Time: 13513.5 (0.0)#.###..........#.. a) +0 scimitar#.. ###........... Throw: 18 darts (poison).... #.................##.......>............................... _The vampire mosquito barely misses you.Wbgg &You hit the vampire mosquito.  You destroy the vampire mosquito!The Shining One accepts your kill. _You feel better. _Items here: ) [ †††.Wbgg WbggT +4.5 (1Wbgg WbggO I _R - a +4 long swordXbgg Xbgg; [Inventory: 44/52 slots Xbgg; Hand Weapons (go to first with ))  a - a +0 scimitar (weapon)  R - a +4 long sword Missiles (go to first with ()  b - 3 throwing nets  f - 18 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (go to first with "=) Xbgg p d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /)h - a wand of roots (14) [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]Ybgg R - a +4 long sword. A sword with a long, slashing blade. Base accuracy: +1 Base damage: 10 Base attack delay: 1.4 This weapon's minimum attack delay (0.7) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.8 XLs.  Current attack delay: 0.9. Damage rating: 19 (Base 10 x 112% (Dex) x 141% (Skill) + 4 (Ench)). This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. You took it off a deep elf pyromancer on level 12 of the Dungeon. Ybggu Stash search prefixes: {inventory} {Long Blades} {one-handed} {melee weapon} Menu/colouring prefixes: identified enchanted melee weapon “While we were at grips with this great army and their dreadful broadswords  (maquahuitl [made of obsidian]), many of the most powerful among the enemy  seem to have decided to capture a horse. They began with a furious attack, and (w)ield, (d)rop, (=)adjust, or (i)nscribe.ZbggInventory: 44/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar (weapon)  R - a +4 long sword Missiles (go to first with ()  b - 3 throwing nets  f - 18 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [) ZbggY c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /)  h - a wand of roots (14) [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]Zbgg a - a +0 scimitar (weapon). A long sword with a wide, curved blade. Base accuracy: +0 Base damage: 12 Base attack delay: 1.4 This weapon's minimum attack delay (0.7) is reached at skill level 14.  Your skill: 10.7  At 100% training you would reach 14.0 in about 0.8 XLs.  Current attack delay: 0.9. Zbggr Damage rating: 19 (Base 12 x 112% (Dex) x 141% (Skill)). This weapon falls into the 'Long Blades' category. It is a one-handed weapon. It can be maximally enchanted to +9. You took it off an orc warrior on level 10 of the Dungeon. Stash search prefixes: {inventory} {Long Blades} {one-handed} {melee weapon} Menu/colouring prefixes: identified melee equipped weapon “The museum-cabinet and huge library arrogated to themselves the entire lower  floor — there were the controversial and incompatible books that are somehow  the history of the nineteenth century; there were scimitars from Nishapur, in (u)nwield, (d)rop, (=)adjust, or (i)nscribe.[bgg@y Inventory: 44/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar (weapon)  R - a +4 long sword Missiles (go to first with ()  b - 3 throwing nets  f - 18 poisoned darts (quivered)F - 6 atropa-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) [bggFzJewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /)  h - a wand of roots (14) [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top][bgg[bggŎ[bggޗ##### ## deadiverson the Carver#### ###...# #. Human of the Shining One *****.#..####.....####. Health: 97/97 ========================#...#.......##... Magic: 12/12 ========================##..........###... AC: 20Str: 17#....[............ EV: 17Int: 11[bgg#................. SH: 16Dex: 15+.†............... XL: 12 Next: 37% Place: Dungeon:12#@................ Noise: ---------  Time: 13514.5 (0.0)#.###..........#.. a) +0 scimitar#.. ###........... Throw: 18 darts (poison).... #.................##.......>...............................  [bggJYou hit the vampire mosquito.  You destroy the vampire mosquito!The Shining One accepts your kill. _You feel better. _Items here: ) [ †††. _R - a +4 long sword[bgg\[bggZ[bgg_[bgg]bgg8w]bggw]bggy]bgg!]bggA7#### ###...# #...####.....###.#....##....#....[....+.†#[.###....#.####.......##........#>]bgg.................<...]bggs]bgg+5.5 (1]bggB]bggd  You destroy the vampire mosquito!The Shining One accepts your kill. _You feel better. _Items here: ) [ †††. _R - a +4 long sword _Found a stone staircase leading up.]bgg"(]bgg(]bggX4]bgg]bgg]bggQ]bggh]bgg]]bgg]bgg]bgg]bgge,]bgg#]bggy]bgg,]bgg]bggD]bgg,]bgg=]bgg"]bgg$]bgg]bgg]bgg(]bgg,]bgg4]bgg]bgg,]bgg,]bgg(  +.†..........   #[...........  #.##########.###......  ]bgg'u#..........#..####....  ########.......##  .##>  #..]bgg  ##.  #.@........... 26.5 (11.0)  #.........<....  ##.............  ###...........  ]bgg .......   .......   ..#....   .[##]bggYH#..  ]bgg,B7.5 (12]bgg]bggX- _Found a leather armour.]bgg ]bgg5 ]bgg0 ]bgg ]bgg ]bgg ,]bgg ]bgg ,]bgg ]bgg]bgg < #.##########.### #..........#..#### ########....... ]bgg r#.......##.......> #...........  ##......  ##... #.........<l... ]bggO  ##..  ###.... ]bgg  #  .. ]bgg ...#....# #..[###]bgg l   komodo dragon (wandering) ##.##  ]bgg 8### ]bgg19.5 (2.0)]bgg?l.]bgg,30.5 (3]bgg4"]bgg+'` _A komodo dragon comes into view.^bggrW ....#..## #.......# #.......##> #...........  ##............  ##........l....  #.........<....  ##..@..........  ###...........  #........ ^bgg3X .........  ...#....#  #..[###...  ##.## ...  ### .. ^bgg + ....#..## #.......# #.......##> #...........  ##............  ^bgg##........l....  #.........<....  ##..@..........  ###...........  #........  ......... ...#....# ^bgg#..[###...  ##.## ... ^bgg<### .. ^bgg^bgg^bgg^bggi d _A komodo dragon is nearby!^bgg, #[....#.##########.###...##..........#..###########.##..#.##.......>...^bgg ..... ##..l.... #....@....<.... ##... ###...#.....#...#....##^bgg]#..[###...###.## ..### ..^bgg^bgg=h.ll^bgg+1.5 (1^bggE^bgg7 _The komodo dragon hisses angrily.^bgg( ((((poisoned)You throw a poisoned dart.  The poisoned dart hits the komodo dragon.^bgg^bgg..l(2.6 (1.17^bggK^bgg4 _The komodo dragon is poisoned._bggq' _bggr((You throw a poisoned dart.  The poisoned dart hits the komodo dragon._bgg_bggX.l(_bggX3.76_bgg_bgg; _The komodo dragon is lightly wounded._bgg (You throw a poisoned dart.  The poisoned dart hits the komodo dragon._bggm_bggxMl(_bggyX4.85_bgg_bgg?   You throw a poisoned dart.  The poisoned dart hits the komodo dragon. _The komodo dragon is lightly wounded.  You throw a poisoned dart.  The poisoned dart hits the komodo dragon. _The komodo dragon is lightly wounded._bgg\ _The komodo dragon is lightly wounded.  You throw a poisoned dart.  The poisoned dart hits the komodo dragon. _The komodo dragon is lightly wounded.  You slash the komodo dragon!  The komodo dragon is moderately wounded._bgg 5=5.7 (0.9_bgg_bggo; _You block the komodo dragon's attack._bggk  You slash the komodo dragon!  The komodo dragon is heavily wounded._bgg 5=6.7 (1.0_bgg _bgg ^ _The komodo dragon completely misses you._bgg?  You hit the komodo dragon.  The komodo dragon is severely wounded.-7.6 (0.9_bggE _bggH ; _You block the komodo dragon's attack._bggV You hit the komodo dragon but do no damage.The komodo dragon is severely wounded._bgggn0---8.6 (1.0_bggt_bggdX _The komodo dragon looks more healthy. The komodo dragon bites you!`bggA  You slash the komodo dragon!`bggE.`bgg69=9`bgg`bggnQ _You kill the komodo dragon!`bgga`bgg`bgg`bgg"H _No target in view!`bgg`bggB`bgg `bgg`bggs!1-- _`bgg@$`bggm&`bggd'`bggB(`bggL,`bgg,2`bgg.`bgg3,`bgg5`bgg9`bgg^9K3=`bggo;`bggC?`bgg?`bggA`bggD,`bggE`bggG`bggGU4=`bgg I`bggJ,`bgg{L`bggzM`bggM`bgg........... . `bggA`bggG--8.6 (29`bgg`bggn; _Found a stone staircase leading down.`bgg `bggT `bgg `bgg `bgg `bgg- B`bgg\ `bgg `bgg `bgg `bgg `bggK `bggf `bgg `bgg ,`bgg `bgg `bggF ,`bgg `bgg\ `bgg2 `bggi `bgg `bggG `bgg B`bgg! `bgg `bgg `bgg `bggV `bgg6 B`bgg `bgg ..... .^........... ....##.........# ............. ##...#.........# ...........#.. #.............## ...........)#.. ..........##...##.....)......#.. `bggc ..........##.................... ............#.................## .............#.#####. ...##..... .>..............@# ... ##....#79.6 (11 ................#..`bggB 3...............##.................# .....##............#### .###............. #..... .>.... ...`bgg C80.6 (12`bgg `bgg ; _Found a stone staircase leading down.`bgg[ 3`bgg$ `bggR `bggO `bgg `bgg ,`bggd ##.# ... #...#..# ..# .............## ..)#. `bgg ..##...##.....)#.##...............#.##`bgg S...#.#####. ...##...... >...###.#... `bggK y# ......... #....##`bgg X...# ..##.#### #.### ..... .. .`bgg ` #..... ..>u   green ugly thing (asleep).... ...`bgg q u#.#`bgg" 11.0)`bgg wuu.`bgg +2.6 (2`bgg `bgg c _A green ugly thing comes into view.`bgg?   )#)#...#....#.#####. >.......###.#... .......@....... ......##....... `bggf@  ......# .......  ...#### #.###..  .... .. .  #..... ..>  .... u..  .#.# abgg   )#)#...#....#.#####. >abgg.......###.#... .......@....... ......##.......  ......# .......  ...#### #.###..  abgg٘.... .. . #..... ..>  .... u..abgg\ .#.# abggabggabggb} _A green ugly thing is nearby!abggݿ   )#)#...#....#.#####. >.......###.#... .......@....... ......##.......  ......# .......  ...#### #.###..  .... .. .  #..... ..>  .... u..  .#.# abggV   )#)#...#....#.#####. >.......###.#... .......@....... ......##.......  ......# .......  abggX...#### #.###..  .... .. . #..... ..>  .... u.. .#.# abgg`abggLaabgghabggCmg _A green ugly thing is nearby!abgg  (((((You throw a poisoned dart.abgghabgg:t....u(abgg-u]3.7 (1.17abgg~abggԂB _The poisoned dart hits the green ugly thing.abggt P ((abggu ?((You throw a poisoned dart.abgg abggd ...u(abggy X4.86abgg abgg  _is nearby!  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.abggn (((  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.  You throw a poisoned dart.abggz abgg }..u(abgg_ (5.9abgg 05abggZ abgg   You throw a poisoned dart. _The poisoned dart hits the green ugly thing.  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.  You throw a poisoned dart. _The poisoned dart hits the green ugly thing.abggKmm(((poisoned)  abggabgg~abgglu.(abggX7.04abggu abgg}7 _The green ugly thing is poisoned.bbgg?  You throw a poisoned dart.bbgg6Q  The poisoned dart hits the green ugly thing.bbggt7`=8.13bbgg@bbggD> _You block the green ugly thing's attack.bbggr  You hit the green ugly thing.  The green ugly thing is lightly wounded.bbgg7,90bbggbbgg> _You block the green ugly thing's attack.bbggܗ  You hit the green ugly thing but do no damage.The green ugly thing is lightly wounded.bbgg.90.0 (0.9bbgg(bbggI _The green ugly thing stings you but does no damage.bbgg0  You hit the green ugly thing but do no damage.The green ugly thing is lightly wounded.bbgg -1.0 (1.0bbgg bbgg} r  You hit the green ugly thing but do no damage.The green ugly thing is lightly wounded. _stings you but does no damage.  You hit the green ugly thing but do no damage.  The green ugly thing is lightly wounded. _stings you but does no damage.bbgg _The green ugly thing stings you but does no damage.  You hit the green ugly thing but do no damage.  is lightly woundedbbgg . _The green ugly thing stings you but does no damage.  You barely miss the green ugly thing.  is lightly wounded.bbgg +9 (0.9bbgg! bbgg& > _You block the green ugly thing's attack.bbggc  You barely miss the green ugly thing.The green ugly thing is lightly wounded.bbggc-2.9 (1.0bbgglbbggp^ _The green ugly thing closely misses you.cbggm  You hit the green ugly thing but do no damage.The green ugly thing is lightly wounded.cbggm&3cbggvxcbggC}I _The green ugly thing stings you but does no damage.cbgg You barely miss the green ugly thing.The green ugly thing is lightly wounded.  The green ugly thing looks more healthy.cbgg&4cbgg cbgg,@ _The green ugly thing misses you.cbggkcbgg  You slash the green ugly thing!=cbggu5.8 (0.9cbggҬcbggkk _The green ugly thing is moderately wounded.cbgg  You slash the green ugly thing!  The green ugly thing is heavily wounded.cbgg ]8---6.8 (1.0cbgg cbgg 6 _The green ugly thing stings you!cbgg  You hit the green ugly thing but do no damage.The green ugly thing is heavily wounded.cbgg 5-7.7 (0.9cbggp cbgg ^ _The green ugly thing closely misses you.cbgg:  You hit the green ugly thing but do no damage.The green ugly thing is heavily wounded.cbgg;e8----8.7 (1.0cbgg/QcbggU> _You block the green ugly thing's attack.dbgg  You barely miss the green ugly thing.The green ugly thing is heavily wounded.dbgg[&9dbggdbgg] _The green ugly thing barely misses you.dbgg  You hit the green ugly thing.  The green ugly thing is heavily wounded.dbgg}(600dbggdbgg> _You block the green ugly thing's attack.dbgg  You hit the green ugly thing.  The green ugly thing is heavily wounded.dbggT9=1dbgg5dbgg5  You hit the green ugly thing.  The green ugly thing is heavily wounded. _You block the green ugly thing's attack.  You hit the green ugly thing.  dbggThe green ugly thing is heavily wounded. _You block the green ugly thing's attack.dbggב  _You block the green ugly thing's attack.  You hit the green ugly thing.  The green ugly thing is heavily wounded. dbgg^ _You block the green ugly thing's attack.  You slash the green ugly thing!  The green ugly thing is severely wounded.dbgg .=2dbgg# dbggx > _You block the green ugly thing's attack.dbgg;  You hit the green ugly thing but do no damage.The green ugly thing is severely wounded.dbgg= .-3dbggI dbgg I _The green ugly thing stings you but does no damage.ebgg/ The green ugly thing is severely wounded. _The green ugly thing stings you but does no damage.almost dead.  The green ugly thing stings you.  You are poisoned.ebgg8=======-=4Pois ebgg ebgg7 _The green ugly thing poisons you!ebgga  You barely miss the green ugly thing.The green ugly thing is almost dead.You feel extremely sick.ebggg1---5ebggdebgga _The green ugly thing completely misses you.ebggYM_The green ugly thing completely misses you.  You barely miss the green ugly thing.  The green ugly thing is almost dead.You feel very sick.ebggp76----6.8 (1.1ebggebggZ> _You block the green ugly thing's attack.ebggЋ  You hit the green ugly thing.  The green ugly thing is almost dead.You feel very sick.ebggA2---ebgg%70ebgg.ebgg3> _You block the green ugly thing's attack.ebgg MThe green ugly thing is almost dead.ebgg# U69-8ebgg ebgg V _The green ugly thing misses you.ebggF?B  You hit the green ugly thing.fbggc (  You kill the green ugly thing!fbggm 67-439 _You feel very sick.fbggfbgg+h _Your Dodging skill increases to level 8!fbggfbgg8-fbgg3fbggH _No target in view!fbgg|fbgg5fbggBfbggfbggP5fbgg3 _You feel sick.fbggm>3-fbggfbggfbggG3 _You feel sick.fbggɝ8-fbggfbgg3 _You feel sick.fbgg9:2fbggjfbgg֧3 _You feel sick.fbgg`:1fbggpfbgg3 _You feel sick.fbggfbggfbgg 3 _You feel sick.fbggU0=-fbggfbgg%  fbggMU=-fbggfbggj _You are no longer poisoned.fbggSfbggsfbggfbgg?fbgg9fbggfbgg`=1=fbggfbggfbggfbgg=fbgg:fbgg3fbgg|fbggvfbggfbggI52=fbggfbggqfbggfbggfbggmfbgg fbggcfbggfbgge3fbggfbggOfbggfbgg?O4fbggfbggC,fbggVfbggfbgg fbgg"fbggfbgg>S5=fbgg1fbggfbgg'fbggfbggBfbgg1fbgg#6fbgg(=fbggfbgg=fbggqfbggfbggfbgg4fbggfbgg9 fbgg 97fbgg fbggfbgghfbggfbgg,fbggfbgg)c869=fbggk+,fbgg ,fbgg.fbgg//B70=fbgg`/fbgga5XfbggY123=4=fbgge5fbggdjBfbggkfbggkfbgglfbgg]tfbggt%6fbggbvfbgg"y,fbggyfbggn|,fbggV}fbgg`a7=fbgg3fbggfbggƒfbggfbggfbgg`U8=fbggfbggӊfbggfbgg#fbggmfbggfbggfbggDfbgg%9fbggfbggL,fbggSfbggfbggәfbggfbggfbggM&80fbggFfbgg,fbggfbggУ,fbggfbgg\fbggK1=fbggfbggfbggfbgg fbggJfbggU2=fbggïfbgg fbggOfbggGfbggfbggwfbgg,fbggfbgg%3fbggfbggfbggfbgg fbggfbggfbggfbggfbgg>%4fbgg^fbgg,fbggfbgg,fbggfbgg}fbggK5=fbggffbgg,fbggfbgg4fbgg{fbggxfbggfbggU6=fbggfbggfbggfbggufbgg(fbggs%7fbggfbggfbggfbggfbgg?fbggfbggifbggfbgg8%8fbggfbgg&fbggwfbggNfbgg fbggTfbggUfbggGfbggfbggD9=fbggfbggfbggfbggfbggfbggfbgg fbgg fbgg| V90=fbggfbggfbggdfbggfbggfbgge%1fbggfbgg^fbggfbggfbgg!fbgg"fbgg#fbgg~&fbgg&%2fbgg7(fbgg*fbgg +fbgg+fbgg.fbggE/fbgg0fbggb3fbgg3K3=fbgg4fbggT7fbgg7fbgg8fbgg;,fbgg:=fbgg@fbggh@#4fbgg@2=fbggAfbggHEfbggEfbggFfbggUJ,fbggKfbgg(NfbggrN%5fbggOfbggtRfbggRfbggSfbggvVfbggV%6fbgg3XfbggM[fbgg[fbgg\fbggj_fbgg_fbgg`fbgg;dfbggdfbggdD7=fbggefbgg[hfbggj,fbggkfbggmfbggpfbgg~pfbggqfbggz,fbgg{fbgg~o _f - 14 poisoned darts (gained 1)fbggfbggՂ2=fbggfbggMfbggҗ=....##...##.....)# .......##....................#.................#.#.#####.#...##..........###.#....##....#fbggR............... #........##......... .....##........# .##....######@###..#. .-.. #.(.# ..  fbgg #..... ....(>. # 4 .... ..##.#(...fbgg fbggȘ... #. .#.##fbgg .. #. .#..fbggah   howler monkey (asleep)fbgg . .. .. .. .. ..hfbgg0fbggx72415.0)-56fbggffbgg˵ _A howler monkey comes into view. _You see here a poisoned dart.fbggWP)..............#####.#...##fbggXP.###.#....#.......... #......... #........# #@#  #.(.# ..   ....(>. #  .... ..##.#(...#  ... #. .#.##  .. #. .#..  . .. .. ..  fbggX`.. .. ..h fbggj )..............#####.#...##.###.#....#.......... #......... #........# #@#  #.(.# ..   ....(>. #  .... ..##.#(...# ... #. .#.## fbggT .. #. .#..  . .. .. .. .. .. .. fbggb fbgg fbgg/ fbggS d _A howler monkey is nearby!fbgg )..............#####.#...##.###.#....#.......... #......... #........# #@#  #.(.# ..   ....(>. # fbgg  .... ..##.#(...#  ... #. .#.##  .. #. .#..  . .. .. ..  .. .. ..h fbggi )..............#####.#...##.###.#....#.......... #......... #........# #@# fbggWk q #.(.# ..   ....(>. #  .... ..##.#(...# ... #. .#.## .. #. .#..  . .. .. .. .. .. .. fbggs 4fbggz fbgg d _A howler monkey is nearby!fbgg )..............#####.#...##.###.#....#.......... #......... #........# #@#  #.(.# ..   ....(>. #  .... ..##.#(...#  ... #. .#.##  .. #. .#..  . .. .. ..  .. .. ..h gbgg)..............#####.#...##.###.#....#.......... #......... #........# gbgg#@#  #.(.# ..   ....(>. #  .... ..##.#(...# ... #. .#.## .. #. .#..  . .. .. .. .. .. .. gbggX"gbgg"gbggS*gbgg3.d _A howler monkey is nearby!gbggogbggp16.0)gbggRq05gbggxgbgg~` _f - 15 poisoned darts (gained 1)gbgg!F &##.......................#######.#...##.........###.#....##....#......... #....##......... .......###........# .##....#######.###..#. .....  #.(@# .. gbggF  #............(>...# .... ...##.#(...##  ... #.#.#.##.. #...#... ...... ..... ..h.. ....gbggL gbggGS  The howler monkey howls!  A howler monkey comes into view.gbggmb hh 2 howler monkeyshhThe howler monkey hoots and howls with incredible vigour!gbggNc G========7gbggi gbggl * _You hear a shout! x2gbggN s.#######.#...##.........###.#....##....#..........##....##.......... .......###........# #.##....#.######.###..#... ..... ..###.(.##[.....  #......(@...# .... ...##.#(...## gbgg  ... #.#.#.## .. #...#... ...... .......hh................. ..gbggM gbgg  Found a scale mail.  A howler monkey comes into view.gbgg gbggI gbgg^  h..h(1 wandering)hThe howler monkey hoots and howls with incredible vigour!gbgg &8gbgg gbggp  _You hear a shout! x2 _There is a stone staircase leading down here.gbggI^#####.#...##.........###.#....##....#..........##........###.......... .......#.###........###.##....#.######.###..#.... ..... ..###.(.##[.....  #gbgg&_V....(>...# .... ...##.#(.@.##  ... #.#.#.## .. #...#.. . ........h .....................h............ ..#.gbggAw hhcatching breath)  The howler monkey hoots and howls with incredible vigour! x2gbggx&9gbgggbgg׆* _You hear a shout! x4hbgg3.....##....#............##........###.. .##..###.##.######.###..#.... ..... ..###.(.##[.....  #.....(>...#  .... ...##.#(...## ... #.#.#@##  #...#..h..# ........h..... .........................h...................h 3 howler monkeys (1 catching breath) ....#.....###.hbgghbggVh.hbggjA=30hbgghbggy| _The howler monkey hoots and howls with incredible vigour! x2hbggE2 ..........##........####.......... .......#.# ##........###.##....#.. hbgg2######.###..#.... ..... .. .###.(.##[..... #....(>...#  .... ...##.#(...##  ... #.#.#.#####.. #...#.@h..#hbgg43. ........h...... .........h.................<.....#hbgg3...###.... ####....##hbgg,7hbggIh.<1 catching breath)=--------1hbggKhbggPb _Found a stone staircase leading up. You block the howler monkey's attack. x2hbgg   You slash the howler monkey!  The howler monkey is severely wounded.You block the howler monkey's attack. x2; The howler monkey misses you.hbggU=-------2hbgghbggu; _You block the howler monkey's attack.hbggA  You slash the howler monkey!hbgg\ . 2 howler monkeys (1 catching breath)  You kill the howler monkey!You block the howler monkey's attack. x2  The howler monkey hoots and howls with incredible vigour!hbgg4H=========3hbgghbggx' _You hear a shout!hbgg'A  You hit the howler monkey.  The howler monkey is moderately wounded.hbggA ]=--------4.9 (1.1hbggJ hbggN > _You block the howler monkey's attack. x2hbgg~   You slash the howler monkey!  The howler monkey is almost dead.You block the howler monkey's attack.hbgg [=-------50hbggf hbggF D _The howler monkey hits you but does no damage.ibggtA  You slash the howler monkey!ibggO`  You kill the howler monkey!ibgg? †CC   cyclops (missile)h   howler monkey  You block the howler monkey's attack.ibgg[64-6ibggibggZ _A cyclops comes into view.ibgg  You barely miss the howler monkey. The howler monkey misses you.ibgg%@-7ibggfibggB; _You block the howler monkey's attack.ibgg>A  You slash the howler monkey!ibgg1Tv C. ibggT(catching breath)  The howler monkey is severely wounded.The howler monkey hoots and howls with incredible vigour!ibggxUH=========8ibggfibggj* _You hear a shout! x2ibggö  You hit the howler monkey.  The howler monkey is severely wounded.ibgg<.CibggV=--------9ibggibggZ _The howler monkey barely misses you.ibgg  You hit the howler monkey.  The howler monkey is almost dead.The howler monkey hits you but does no damage.ibgg :((((ibgg N....ibggt H--------40ibgga ibgg P _The cyclops throws a large rock. You block the large rock.ibgg ?  You hit the howler monkey.ibgg ibgg ! †K   kobold (missile, wandering)KYou kill the howler monkey!ibgg &1ibgg ibgg ~ _A kobold comes into view. It is quivering curare-tipped darts.jbgg<-z##. #..##........###.##....#..######.###..#.... ..... .....###.(.##[.....  #......(>...#  .... ...##.#(...## ... #.#.#.##### .. #.#...#..†..##.jbggp. . .......@.†...... .. . ...C< ......#..###.. ####K...## ....jbggo:jbggCA((((((jbggGjbgg†@....K.jbgg&2jbggjbgg| _The cyclops throws a large rock. The large rock completely misses you.jbgg (((, poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.jbgg  ...KK)The cyclops is poisoned.  The kobold shouts!jbgg4 ((((((The kobold throws a curare-tipped dart.jbgg .@....The curare-tipped dart barely misses you.jbgg1(((jbggZ=E...jbggf>f==4.0 (1.14jbggHjbggPMP _The cyclops throws a large rock. You block the large rock.jbggMK(((jbggy jbgg{ jbgg c  You throw a poisoned dart. The poisoned dart hits the cyclops.jbggm ..C(K.K 2 kobolds (missiles)Kjbgg b---5.13jbgg jbggG ~ _A kobold comes into view. It is quivering curare-tipped darts.jbgg (((((((You throw a poisoned dart.jbgg= jbgg(? jbggk@ jbgg[ ...C..K.KK 3 kobolds (missiles)jbgg\ XThe poisoned dart completely misses the cyclops.jbgg4] t---6.22jbggo jbgg~ ~ _A kobold comes into view. It is quivering curare-tipped darts.jbgg? (( very poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker.jbgg?y ..The cyclops is lightly wounded.jbggJ((kbgg kbggl!kbgg"kbgg&n  The kobold throws a curare-tipped dart. You block the curare-tipped dart.kbgg4lC...(....WKW   wraith.KKK 3 kobolds (missiles)kbgg6e=7.4 (1.21kbggDkbggJY _A wraith comes into view.kbgg (You throw a poisoned dart. The poisoned dart hits the cyclops.kbgg5]x .The cyclops is lightly wounded.kbgggJ((kbggkbgg ...K.The kobold throws a curare-tipped dart. You block the curare-tipped dart.kbggZ ](((((kbggAkbgg'kbggIC(....W.#....###...kbgg]8.5 (1.10kbgg(kbgg_ _The kobold throws a curare-tipped dart. You block the curare-tipped dart.kbgg<9  You hit the cyclops.kbgg:  KK 4 kobolds (missiles)The cyclops is lightly wounded.  A kobold comes into view. It is quivering curare-tipped darts.kbgg J((kbggkbgg ..K.The kobold throws a curare-tipped dart. You block the curare-tipped dart.kbgg7](((((kbgg4kbggH ..W.....#....The kobold throws a curare-tipped dart. You block the curare-tipped dart.kbgg I,90kbgg0Ykbggf5 _You block the cyclops's attack.kbggM F..##.#... ...#...##........###.##....#######.###..#.... ..... .. ..###.(.##[.....#............(>....... ...##.#(...## . #.#.#.##### . #.#...#@.†..##. ..C..†.(.(..............(.W...KK....<(.....###.......... ####K...## 3kbggY <...K...#kbgg kbgg kbgg kbgg kbgg kbgg -W...KK......K.KK 4 kobolds (missiles).kbgg /-50kbgg kbggq kbgg|y###.#....##....#.........##.#.... ...#...##........###.##....#######.###..#.... ..... .. ..###.(.##[.....#............(>...#.... ...##.#(...## . #.#.#@##### kbgg}. #.#...#..†..##. . ......C..†.....(.........(W...KK........(...<(.....#.......###..K...... 3. ####.K..##kbggkbggz,kbggkbgg5kbggkbggC.W..K.K......K.KK 4 kobolds (missiles).kbgg@-1kbggkbgg8lbggX<  You slice the cyclops!!lbgg ^o  The cyclops is severely wounded.lbgg^lbgg_lbgg,albggblbggs7 WK.K(.....K ..K.KK lbggs5 kobolds (missiles)A kobold comes into view. It is quivering curare-tipped darts.lbgg!u0===2lbggBlbggT _The cyclops barely misses you.lbggr;  You slash the cyclops!lbgg}  K.  The cyclops is almost dead.lbggC(lbgglbgglbgglbgglbgg3!&K..K..K.KKKKK 5 kobolds (missiles)lbgg!.-3lbgg]0lbgg4_ _The kobold throws a curare-tipped dart. You block the curare-tipped dart.lbggA 9  You hit the cyclops.lbggB lbggC lbgg=E j  The cyclops is almost dead.lbggW K†K..K.K.lbgghX i86----4lbggk lbggwq J _You block the kobold's attack. The cyclops hits you!lbgg j  You hit the cyclops but do no damage.lbgg" lbgg lbgg j  The cyclops is almost dead.lbgg lbgg W†KK..K..K.W   wraithKKKKK 5 kobolds (missiles)lbggk .-5lbgg lbgg! T _You block the kobold's attack. You block the cyclops's attack.mbggw9  You hit the cyclops.mbgg{mbggx|mbggZ  You kill the cyclops!mbggPOK.K.W   wraithKKKKK 5 kobolds (missiles)mbgg7---8-6mbggάmbggS _You block the wraith's attack. You block the kobold's attack.mbgg8  You hit the wraith.mbgg  The wraith is lightly damaged.  The kobold closely misses you. The wraith closely misses you.mbggK.K.mbgg{&7mbgg&mbgg4-4 _You block the kobold's attack.mbggt8  You hit the wraith.mbggԆ K†The wraith is lightly damaged.  You block the kobold's attack. You block the wraith's attack.mbggD&8mbggmbgg4 _You block the kobold's attack.mbgg   You hit the wraith but do no damage.The wraith is lightly damaged.  The kobold completely misses you. The wraith closely misses you.mbggQ.89mbggmbgg4 _You block the kobold's attack.mbgg  The wraith is lightly damaged.  The kobold completely misses you. The wraith closely misses you. _You block the kobold's attack.  You slash the wraith!  The wraith is heavily damaged.  You block the wraith's attack.mbggD /=60mbggr mbgg 4 _You block the kobold's attack.mbgg[b xThe wraith is heavily damaged.  You block the wraith's attack. _You block the kobold's attack.  You barely miss the wraith.  The wraith is heavily damaged.  You block the wraith's attack.mbggBc 5-1.4 (0.9mbgger mbggx 4 _You block the kobold's attack.nbggK)hThe wraith is heavily damaged.  You block the wraith's attack. _You block the kobold's attack.  You hit the wraith but do no damage.The wraith is heavily damaged.  You block the wraith's attack.nbgge*m9=-2.4 (1.0nbgg*4nbgg;4 _You block the kobold's attack.nbgg,.  You slash the wraith!  The wraith is almost destroyed.You block the kobold's attack. You block the wraith's attack.=3.3 (0.9nbgg%nbggzT _The kobold closely misses you.nbgg&  nbggNYou hit the wraith.  The wraith is almost destroyed.The kobold hits you but does no damage. The wraith closely misses you.nbggԧ5-4.3 (1.0nbggϸnbgg4 _You block the kobold's attack.nbgg3y  You slash the wraith!  You destroy the wraith!nbggs& nbgg.KKKKK 5 kobolds (missiles)  The Shining One accepts your kill.nbggq90=50-nbgg65nbgg]nbggJ7 _You block the kobold's attack. x2nbgg$ :  You slash the kobold!nbgg1nbggnbgg † 4You kill the kobold!nbggn-6.2 (0.9nbgg)nbgg-= _The kobold hits you but does no damage.obggK:  You slash the kobold!obgg[ ( 3You kill the kobold!obggd( obgge(The kobold throws a curare-tipped dart. The curare-tipped dart hits you.You are poisoned.obgg (You have difficulty breathing. You feel yourself slow down.obggD (You block the kobold's attack. The kobold throws a curare-tipped dart.obgg9(obgg85====-7.2 (1.0Slow Pois obggobgg8-obggȤ/  --more--obgg 5 _You block the curare-tipped dart.obgg JYou barely miss the kobold.obggtoK.You feel very sick.obgg7\0--8.5 (1.3obgg#obgg.), _You block the kobold's attack.pbggxYou barely miss the kobold.You feel very sick.pbggh76---9.9 (1.4pbggzpbggw _You block the kobold's attack. x3; The kobold closely misses you.pbgg  You barely miss the kobold.You feel very sick.pbggd\4-71.4 (1.5pbgg:pbgg7 _You block the kobold's attack. x2pbgg  You barely miss the kobold. You feel sick. The kobold closely misses you.pbggu2=-2.9pbggdpbgg&7 _You block the kobold's attack. x3pbgg pbggz 8-pbgg[ pbgg F _Unknown command.pbgg :  You slash the kobold!pbgg" ( 2You kill the kobold!You feel sick. You block the kobold's attack.pbgg.  (The kobold throws a curare-tipped dart. The curare-tipped dart hits you.You are more poisoned.You have difficulty breathing.pbgg 9(pbggA c64===--4.4pbggl pbgga 9--pbgge /  --more--qbgg1? _You feel as though you will be slow longer.qbgg`8You hit the kobold.  The kobold is heavily wounded.qbgg=You feel very sick.A kobold comes into view. It is quivering curare-tipped darts.qbgg>qbgg'JK.K 3 kobolds (missiles)KqbggK_59-5.9qbggXqbgg&l/ _You block the kobold's attack. x3qbgg 8  You hit the kobold.qbgg ( 2You kill the kobold!You feel very sick.qbgg V((((qbgg} ....The kobold throws a curare-tipped dart. You block the curare-tipped dart.qbgg̮ n6--7.3 (1.4qbgg qbgg 4 _You block the kobold's attack.qbgg5| :  You slash the kobold!qbgg Y  You kill the kobold!qbgg qbggގ (K   kobold (missile).qbggq ^4-8.7qbgg qbggn $ _You feel sick.qbgg)..........##........####.......... .......#.# ##........###.##....#.. ######.###..#.... ..... .. .###.(.##[..... #....(>...#  .... ...##.#(...##  ... #.#.#.#####qbgg*.. #.#...#(@†..##.. .........†...... .....(.......... ....(.....K..... ...(...........<(.....# ....###..... ####....##... ....#qbgg.qbgg@RK.qbgg~A#3qbggA/-80.2 (1.5rbgg rbgg"n _You feel sick. _You see here a curare-tipped dart.rbggc6s## .#.# #..###.##.######.###..#.... ..... ..###.(.##[..... #.....(>...#  .... ...##.#(...# ... #.#.#.#####rbgg> #.#...#((†..##.. ........@†...... (...K(.....(.<(.....#.....## ####....## ....# rbggNrbggvP0=1.7rbgg2_ _You feel sick. The kobold misses you. You block the kobold's attack.rbgg&rbggr'_1=-3.2rbgg2rbggn8 _You barely miss the kobold. You feel sick. The kobold misses you.rbgg  _You feel sick. The kobold misses you. You block the kobold's attack. _You barely miss the kobold. You feel sick. The kobold misses you.  You hit the kobold.  The kobold is moderately wounded.  ck.  You are no longer poisoned.rbggˬ b=-4.7rbggg rbgg | _The kobold hits you but does no damage. The kobold closely misses you.rbggy :  You slash the kobold!rbgg D(rbgg -6.1 (1.4rbgg rbgg J _You kill the kobold!rbgg:##.###.##....#.. ######.###..#.... ..... .. .###.(.##[..... ....(>...# .... ...##.#(...##  ... #.#.#.##### ... #.#...#((†..##.... .........†..... .....(...@.....(.........(..<(.....#.....###..... ####....###rbgg;[15;8H... ....# .##..sbggsbggk5=-7.6 (1.5sbggsbgg  Things that are here: _a curare-tipped dart; a kobold corpsesbgg"sbgg'#B-9.1sbgg,sbgg+1. _S - a curare-tipped darttbgg .##... .......#.#....##........###.##....#..######.###..#.... ..... ..###.(.##[..... #............(>...#.... ...##.#(...##  ... #.#.#.##### . .. #.#...#((†..##.... ........@†. .....(...†tbggq . ....(... ...(..<. (.....#. ....###.......... .... ####....###... ....#.##..tbggtbggW6=90.6tbgg$tbgg'tbggM..##..###.... ...#...##........###.##....#######.###..#.... ..... .. .###.(.##[..... tbgg#............(>....... ...##.#(...## . #.#.#.##### . #.#...#(@†..##.......†.(...†.(....(...........<.............#tbggtbgg(2.1tbggtbggtbgg^c7=3.6 (3.0tbggtbgg: _S - 2 curare-tipped darts (gained 1)tbgge.##..##.......... tbgg.#.#.##........###.##....#...######.###..#.... ..... ...###.(.##[.....  #tbgg0G...(>...#tbgg_< .... ...##.#(...## ... #.#.#.##### .tbgg .. #.#...#@.†..##... . .†tbgg. .....(...†.tbggd ....(.tbggM: ...(.<. (.....#.. ....###tbgg.. .... ####....##  ... ....#tbggtbgg-5.1 (1.5tbggtbgg=I  S - 6 curare-tipped darts (gained 4)tbgg[8=6.6 (3.0tbgg] tbgg N _Items here: ( †††.ubggbubggEubggڸubggO,ubggubggubgg$9ubggHubggubggubgg@C60ubggKubggj _You feel yourself speed up.ubggubggubggubggubgg_ubggi1=ubggubggQubggubggubggubgglubggubggubgg;K2=ubggubgg& ubgg ubgg ubggubgg"ubggubggWubgg23ubggubgg/ubggubgg<"ubgg'ubgg|(94ubgg.ubgg5ubgg5ubggp7ubgg<ubgg6=ubgg>ubggBubgg7CS5=ubggEubggJubggJubggLubggQubggQubggRubggXa6=ubggZubgg^,ubgg`ubggfubggbgubggiubgglubggLm97ubgg!oubggt,ubggvubggzubggzubgg~|ubggubgg98ubgg.ubgg;ubggubggubggÏubggBN69=ubggZubggubggubgg֘ubgg?,ubggFubggubggX70=ubggubgg,,ubggubggԱubgg3ubgg˳ubggubgg%1ubggӽubgg*ubggubgg#ubgg,ubggOubggubggK%2ubggeubgg=,ubggubggubggrD3=ubggubgg,ubggCubggubggXubggjubgg%ubgg#4ubgg2=ubggubgg0ubggubggubggN ubgg ubgg+ ubggE;5ubggubgg,ubggubgg ubggoubggubgg#;6ubgg$ubgg(,ubgg*ubgg00,ubgg%2ubgg>6ubgg6K7=ubgga8ubgg1=ubgg=ubggr?ubggOCubggCN8=ubggEubggIubggGJubggKubggPubggxPubgg-RubggPWubggW%9ubggZubggY^,ubgg*`ubggxe,ubggzgubggkubggk&80ubggAnubggs,ubgg1=2=ubgg6,ubggo3ubggbubgg1Bubggubgg<ubggubggQ4ubgg,ubggeubggV,ubgg?ubggubggK5=ubggubgg,ubggubgg,ubggsubggubggU6=ubggubggCBubgg ubggu%7ubgg ubgg,ubggubgg,ubggubggubggg%8ubgg4ubgg#,ubgg%ubgg*,ubgg,ubgg1K9=ubggi2ubgga4ubgg9,ubgg:ubgg?,ubggBubggCFubggFO90=ubggIubggM,ubggLPubgg]TubggT%1ubggVubgg],ubgg>`ubggte,ubgghiubggEo;2ubggrubggv,ubggZyubgg~ubgg^~ubggubggubggtK3=ubgg ubgg%ubggoubggubgg,ubggubggk4=ubgg&ubggD896.1 (99.5)ubggubggT _Key pressed, stopping explore.ubgg 3ubggubggubgg$ _ubggubggubggFubggubggubgg%5ubggaubggDBubggubgg0%6ubggubggubggubgguubgg,ubggubggS K7=ubgg ubggxubggubgg ##. #..##........###.##....#.######.###..#.... ..... ...###.(.##[.....  #......(>...#  .... ...##.#(...## ... #.#.#.##### . ...#.#...#(.†..##... . .......@..†.......904.1 (8.0) (...†...<.(.....#........###...[.... #bgg(m###....####.... ....# .##..ubgg++5.1 (9ubgg6ubgg;) _Found a chain mail.ubgg= 3ubgg? ubgg!E ubggJ ubggK ubggP ubggY ,ubgg^ ubggc o _f - 11 poisoned darts (gained 1)ubggh ubggi 9=ubggk ubggr ,ubgg-u ubggz o _f - 12 poisoned darts (gained 1)ubggG ubgg ubggā ubggm ubggއ ubggÉ ubggy o _f - 14 poisoned darts (gained 2)ubgg 3ubgg ubgg ubggv  #.....(>...#  ........##.#(...##  ......###.#.#.##### .  ......#.#...#(.†..##... ...............†....... ubggѨ ...............†....... ....................... ∩....................<. (@....#..........12.1 (7?......###..........[.....#####....###4.# ....#...###. .##..#.# ... #. #.....##... . ......# ... ubgg ubgg +3.1 (8ubgg ubgg 8 _Found Hiroito's Assorted Antiques.ubggL 3ubggO ubggT ubgg1Z ,ubggf^ ubgg(c ,ubgge ubgg5l o _f - 15 poisoned darts (gained 1)ubggp 3ubgglx ubgg{} ubggY ,ubggy ubggt ubgg; ubgg ubgg" ubgg ubgg? ubgg ubgge I _J - 2 scrolls of identify (gained 1)ubgg͛ 3ubgg ubgga ubgg ,ubggɦ ubgg ubgg% ,ubgg1 ubgg ubgg Welcome to Hiroito's Assorted Antiques! What would you like to do?  a -  81 gold an arbalest  b -  720 gold a lightning rod (4/4)c -  63 gold a long sword  d -  414 gold a plate armour  e -  66 gold an embroidered robef -  72 gold a scale mail  g -  135 gold a scroll of enchant armour  ubggc h -  36 gold a scroll of identify You have 467 gold pieces. [Esc] exit[!] buy|examine items[a-h] mark item for purchase [/] sort (type)[A-H] put item on shopping listybggS ybgg ybgg .............###.(.##[.. deadiverson the Carver..#............(>...# Human of the Shining One *****..#........##.#(...## Health: 97/97 ========================........###.#.#.### Magic: 12/12 ========================#.......#.#...#(.†. AC: 20Str: 17##................†. EV: 17Int: 11.................†. SH: 16Dex: 15##................. XL: 12 Next: 50% Place: Dungeon:12..##.@................ybgg = Noise: ---------  Time: 13922.1 (9.0)......?............#.... a) +0 scimitar....##...........###.... Throw: 15 darts (poison)............[.....#####.. .#........#........ .##......###........ .###.#.## ..........#..#.. #.....##...#..... ......# ... _f - 12 poisoned darts (gained 1) _f - 14 poisoned darts (gained 2) _Found Hiroito's Assorted Antiques. _f - 15 poisoned darts (gained 1) _J - 2 scrolls of identify (gained 1)  There is an entrance to Hiroito's Assorted Antiques here.ybgg ybgg/ ybgg . _zbggTzbggaUzbggczbgge*_zbggf)f - 14 poisoned darts (gained 2) _Found Hiroito's Assorted Antiques. _f - 15 poisoned darts _J - 2 scrolls of identify (gained 1) _Unknown command.zbgg||m[?25h[?0c  Search for what [Enter for "scim", or ? for help]? |bgg h [?25l[?1c|bggϹ|bggog2 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] S - 6 curare-tipped darts Results elsewhere ([,] to cycle)  b - [D:11] 2 curare-tipped darts (1 further duplicate)|bggLevel 11 of the Dungeon <<<<>>>>(Press ? for help) #....# #..#.........#....#####...............# #..........## #....#######..#.........#........................# #..........# #.........)...#.....#####........................#######..........#|bgg #....######...###'###..........#####.........###.........##+####..##....#....#................#####...##.......##.#..###'#..#.....#..##....#....'..######........#.#.'.[..#......##..#..#...#..#.....#..##....#....#..#....#........##).####÷####..##...#..#...#..#....>'..###...##'###..#....#........#...#...((..#.##....#..#...#..#######..##...........#....#......####'##.⌠...⌠.###.....#..#...#...........#####...........'....#......#ßßß.##....⌠..##....!.#>.#####...........##..............#....#......'.÷..ß#...⌠...).....[##.............##############.......#....#..(...#ßßß.##..⌠....##......#.....###'##..##.......##'###......####'##.⌠...⌠.###.....#.....#....#..##.....................#...#.......#.##....#.....#....#..##.........#####.......##..####'####..##...#.....#....#..##.........#...#.......#)#.'....#......##..#.....#....#..##.........#...#.......#####...##.......##.#.....#....#..##........<#...#...........#####.........###.....#....#..##.#####...#...#...........................>.....#....#..##.# #...##'##.......#######'###...............######..#|bggK##.# #...............#.........#.......#######.........##..# #...............#.........#.......# #.........#######..# #...............#.........#.......# #..............#}bgg}bgg}bgghdeadiverson the CarverHuman of the Shining One *****.Health: 97/97 ========================Magic: 12/12 ========================AC: 20Str: 17EV: 17Int: 11SH: 16Dex: 15XL: 12 Next: 50% Place: Dungeon:12Time: }bgg_Found Hiroito's Assorted Antiques. _f - 15 poisoned darts (gained 1) _J - 2 scrolls of identify (gained 1) _There is an entrance to Hiroito's Assorted Antiques here. _Unknown command.Search for what [Enter for "scim", or ? for help]? curare}bgg8}bgg}bgg<}bgg/}bgg'9Q _}bggB}bggI,}bgg^K}bggR8 _Found a scale mail.}bgg(W4}bggY}bgg_}bggb,}bgg;d}bggi}bgg~m,}bggn}bggNt}bggw}bggw}bggtx}bgg|}bgg}bggu}bgg/}bgg'}bggވ}bggL}bggŠ}bgg}bgg̒,}bggE}bggc}bggp}bgg3}bggT}bggޠ}bggL}bgg}bggӭ,}bgg,}bgge}bgg}bgg}bgg}bgg}bggS}bgg)}bgg}bgg}bggl}bgg,}bggv}bggb}bgg ,}bgg}bgg}bggF}bgg}bgg3}bgg}bgg,}bgg}bgg}bggb,}bgg}bgg}bgg,}bgg}bgg}bgg}bggg}bgg}bgg}bgg}bgg}bgg}bgg }bggV,}bgg}bgg}bgg| X}bgg"}bggr"}bgg$}bggU'X  There is a stone staircase leading up here.}bgga)}bgg-}bggz-% _}bgg/}bggmZ1}bggo[}bgg\}bgg\}bgg]}bggwql _You climb upwards.  There is a stone staircase leading down here.}bgg8s}bggs _}bgg|t}bgg!}}bgg},}bggc~}bgg}bgg}bgg}bgg}bgg}bggܐ,}bgg[}bgg7}bggE}bgg}bgg)}bgg}bgg}bgge}bgg}bggH}bgg}bgg&}bgg}bgg}bgg,}bgg}bgg9}bgg}bggoX}bgg}bgg}bgg}bgg}bgg1}bgg}bgg}bgg(}bgg}bgg}bggh  There is an escape hatch in the ceiling here.}bgg}bggo _}bgg}bgg9}bgg#}bggx}bgg}bgg}bgg~,}bgg}bgg}bgg}bgg}bgg}bgg}bgg,}bgg}bgg}bgg}bgg}bgg}bggA}bgg }bgg!}bgg"}bgg)&}bgg(}bgg(}bggs*}bggQ-}bgg/,}bgg1}bgg%5}bgg%8}bgg8}bgg:}bggN>}bggA}bgg B}bggC}bggF}bgg-I,}bggK}bgghP}bggP}bgg:R}bgg)]######...###'###..........#####.. #....#................#####...##. #....'..######........#.#.'.[..#. }bgg]F#....#..#....#........##).####÷## ##'###..#....#........#...#...((. ........#....#......####'##.⌠...⌠ ........'....#......#ßßß.##....⌠. ........#....#......'.÷..ß#...⌠.. #.......#....#..@...#ßßß.##..⌠... Noise: --------- 13979.6 (57.5) #.......##'###......####'##.⌠...⌠ a) +0 scimitar #.....................#...#...... Throw: 15 darts (poison) }bgg^#.........#####.......##..####'## #.........#...#.......#)#.'....#. #.........#...#.......#####...##.  #........<#...#...........#####..  #.#####...#...#..................  #.# #...##'##.......#######'### }bggu_}bggh}bgg4l: _S - 8 curare-tipped darts (gained 2)bgg+ [?25h[?0cbggd  Search for what [Enter for "curare", or ? for help]? bgg [?25l[?1cbgg6P  Okay, then.bggfbgg5bgg. _bggE[?25h[?0c  bggFUSearch for what [Enter for "curare", or ? for help]? bggtc [?25l[?1cbgg bggE O2 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] S - 8 curare-tipped darts Results elsewhere ([,] to cycle)  b - [D:9] a curare-tipped dartbgg Level 9 of the Dungeon <<<>>>>__(Press ? for help) #.................#########..............~≈≈≈~...............# #.................##.....................~~≈≈~~~.............# #..................................[......P≈≈≈~..............# #.....................PPP.PPP.............~≈≈≈~~...>.........##.....................PPPPPPP.............~≈≈≈~~.............##......................P...............#.~~≈≈≈~~~..############.....................P................#.~~≈~≈≈~...############.........................ßßßß..[...........~≈≈~~P...........##.##################...P..ß...[########...~.~≈≈~≈~...#.########.##################......ß._..########.....~~≈≈~~.~...#bgg #........................)ß.....(........#...~~≈≈≈~~..###........................(...................P~~~≈~≈####...............########.)#..................~P~~≈≈≈≈####...............##.......................P~~≈≈≈≈≈###...............#####.....................~~~≈≈≈≈≈# #...............###########.......................~.#≈#≈≈##...................................................####≈##......................................................####...............................[......................##...............############.##################...#######....>..........##.##...##...............##.##...##...............############.##################...#bggϪbggbggudeadiverson the CarverHuman of the Shining One *****.Health: 97/97 ========================Magic: 12/12 ========================AC: 20Str: 17EV: 17Int: 11SH: 16Dex: 15XL: 12 Next: 50% Place: Dungeon:11Time: bgga_There is a stone staircase leading down here. _There is an escape hatch in the ceiling here. _S - 8 curare-tipped darts (gained 2)  Search for what [Enter for "curare", or ? for help]? _Okay, then.Search for what [Enter for "curare", or ? for help]? bggJbggbggabgg _bgg bgg bggKbggbggbgg bggIbggbggbggRbggbggTbgg=bggbggbggbggbgg'bggpbgg!bggbgg7,bggbggbggnbggbggKbggWbggbggRbggbggX  There is a stone staircase leading up here.bgg'bggbggU% _bggbggCh0bgg:EbggSl _You climb upwards.  There is a stone staircase leading down here.bgg6VbggV _bggWbgg[bgg]bggL^bgg^bggabgg[c,bggcbgg fbggg,bggphbggPjbggl,bgglbggnbggp,bggqbggWybggM|bgg|bgg}bggmbggY,bggbggbggm,bggƉbggߌbggӏ,bggbgg/bgg,bggabgg@bggB,bggbggSbggd,bggbgg bgg3,bgg[bggbgg,bggbggbggbggZbgg/bggCbggHbggbggbggbgg,bggbgg*bggbggZbggbgg$bggp,bggbggpX  There is a stone staircase leading up here.bggbggbgg% _bggZbgg!9bggbgg,bggbgg.l _You climb upwards.  There is a stone staircase leading down here.bgg0bgg1 _bgg2bgg8bgg:bgg?;bggJ<bggAbggmDbggDbgg[FbggKbgg9N,bggObggTbggWbggWbggYbgg`]bgg`,bggSabggebgghbgg|hbggTibgg mbggo,bggppbgg(rbggsbggLtbggtbggxbggy,bggszbgg}bgg?bggbggObggbggÄbggbggbggيbgg,bggbggbggbggbgg"bggbgg,bggbggbgg,bgg!bggKbgg)bggbggbggbgg',bgg.bggbggQ,bgg bggbggR,bggObggYou climb upwards. _There is a stone staircase leading down here.up _You climb upwards. _There is a stone staircase leading down here.  S - 9 curare-tipped darts (gained 1)bggIbgg bggD>.............PPP.PPP............. .............PPPPPP.............. ..............P...............#.~ .............P................#.~ .................ßßßß..[......... ###########...P..ß...[########... ###########......ß._..########... ................)ß.....(........# bgg1................@................ Noise: --------- 14035.6 (56.0) .......########.)#............... a) +0 scimitar .......##.................. Throw: 15 darts (poison) .......#####............... .......###########............... .................................  .................................  .......................[.........bggF  .......############.############# bggbgg.:_bgg1x _Items here: ( )) ÷.bggo 3bgg`t bgg ...........0.0).... .bgg B_bgg _ _Partly explored, can't reach some places.bggl 3bggq bgg :_bgg bgg{ bgg _ _Partly explored, can't reach some places.bggS:bgg:;bggh@bgg?:_bgg@bggK:_bggRO_ _Partly explored, can't reach some places.bggx}bgg.~bggBbgg~4bggس:_bgg_ _Partly explored, can't reach some places.bgg3bggqWhere to? (Tab - D:9 @ (x,y), ? - help)  D - Dungeon  T - Temple L - Lairbggn bgg .............PPP.PPP............. deadiverson the Carver .............PPPPPP.............. Human of the Shining One *****. ..............P...............#.~ Health: 97/97 ======================== .............P................#.~ Magic: 12/12 ======================== .................ßßßß..[......... AC: 20Str: 17 ###########...P..ß...[########... EV: 17Int: 11 ###########......ß._..########... SH: 16Dex: 15 ................)ß.....(........# XL: 12 Next: 50% Plbgg& ace: Dungeon:9 ................@................ Noise: ---------  Time: 14035.6 (0.0) .......########.)#............... a) +0 scimitar .......##.................. Throw: 15 darts (poison) .......#####............... .......###########............... .................................  .................................  .......................[.........  .......############.############# S - 9 curare-tipped darts (gained 1) _Items here: ( )) ÷. _Partly explored, can't reach some places. _Partly explored, can't reach some places. _Partly explored, can't reach some places. gg M23d_Partly explored, can't reach some places.bgg bggð bgg6 bggz bggy bgg` $ _bgg bgg bggL ,bgg bggG bgg bgg# bgg bgg bggi ,bgg_ bgg bgg bgg bgg bggW bgg ,bgg bgg bgg- ,bggu" bgg# bgg% bgg% bgg& bgg6) bgg+ ,bgg, bgg- bgg. ,bgg/ bgg1 bgg3 ,bgg3 bggy5 bggX7 ,bgg8 bgg; bgg< ,bgg= bgg@ bggfC bggC bggD bggG bggNI ,bgghJ bggL bgg(N ,bggO bggQ bgg~R ,bggPS bggV bggXX bggX bggY bgg[ bgg] bgg9^ bgg_ bgga bgg4d ,bggme bggg Y  There is a stone staircase leading down here.bggh bggl : _bggn bgg 10bgg bggQ bgg ,bggE r   #...#.#####..########  #.....#####..#$$$$$°°  #.....'...#..########  #.###.#...#..#.......  #.....#...#..##+#####  #.....#####......#### bgg4  #..#..# #.##.#.# #  #.....# #....#.#   #...@.# #....#.# 58.1 (22.5)  #..##.#####....#.# #  #..............#.# #  #..............#.####  #........###bgg   #.....############  #.###.# #.....#.#  #.....### #####'#  #.....bgg A........ _You climb downwards.bgg bgg bgg[ a _There is a stone staircase leading up here.bggnWhere to? (Tab - D:10, ? - help)  D - Dungeon  T - Temple L - Lairbgg*bggUQ+  #...#.#####..######## deadiverson the Carver  #.....#####..#$$$$$°° Human of the Shining One *****.  #.....'...#..######## Health: 97/97 ========================  #.###.#...#..#....... Magic: 12/12 ======================== bggR #.....#...#..##+##### AC: 20Str: 17  #.....#####......#### EV: 17Int: 11  #..#..# #.##.#.# # SH: 16Dex: 15  #.....# #....#.#XL: 12 Next: 50% Place: Dungeon:10  #...@.# #....#.#Noise: ---------  Time: 14058.1 (0.0)  #..##.#####....#.# # a) +0 scimitar  #..............#.# # Throw: 15 darts (poison)  #....ggRm..........#.####  #..............###...  #.....############...   #.###.# #.....#.#.   #.....### #####'#...   #.....#.#####........  _Partly explored, can't reach some places. _Partly explored, can't reach some places. _Partly explored, can't reach some places. _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here.bggSbgg_bggdP _bgggbggbh,bgghbgg,kbgg7n,bggnbggpbggar,bggvbgg>xbggz,bgg{bgg~bgg,bggbggރbggօ,bggqbggbggt,bggbgg^bggٌbgg$bggzbgg&bgg9,bggbggbgg,bggMbggnbggԖ,bggbgg™bgg?bggbggbgg<bgg[,bggbggbggbggbggpbggbgg,bggnbggPbggM,bggbggbgg bgg,bgg^bgg,bggbbggbggv,bggbggZY  There is a stone staircase leading down here.bggbggٷbgg4$ _bgg~bgg1bggbggnbgg,bggb* ####...........'....#......#ßßß. #..............#....#......'.÷..ß ########.......#....#......#ßßß. #.......##'###......####'# #.....................#... #.........#####... #.........#...#.......#)#. #.........#...#.......#### #........@#...#...........80.6 (22.5) #.#####...#...#........... #.# #...##'##.......### ##.# #...............#... #..# #............... #..# #............... #..# #....#gg+4m######<...#.. #..#####....# #.... #...... #....# _You climb downwards. _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here.down here. _You climb downwards. _There is a stone staircase leading up here.bggbggfWhere to? (Tab - D:11, ? - help) bggjR D - Dungeon  T - Temple L - Lairbggsbgg####...........'....#......#ßßß.# deadiverson the Carver bggf#..............#....#......'.÷..ß Human of the Shining One *****. ########.......#....#......#ßßß.# Health: 97/97 ========================#.......##'###......####'# Magic: 12/12 ========================#.....................#... AC: 20Str: 17#.........#####.......##.. EV: 17Int: 11bgg#.........#...#.......#)#. SH: 16Dex: 15#.........#...#.......#### XL: 12 Next: 50% Place: Dungeon:11#........@#...#........... Noise: ---------  Time: 14080.6 (0.0)#.#####...#...#........... a) +0 scimitar#.# #...##'##.......#### Throw: 15 darts (poison)##.# #...............#...bgge#..# #...............#...#..# #...............#... #..# #....#######<...#... bgg-#..#####....# #....#... #...........# #....#...  _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here. _There is a stone staircase leading down here. _You climb downwards. _There is a stone staircase leading up here.bggbgg@bggK%bggH&bgg&$ _bgg*,bgg*,bgg*bggc.bgg0,bgg+1bgg2bgg3,bgg4bgg6bggb7,bgg8bgg :bgg ;,bgg;bgg=bggM@bgg@bgg@bggwBbggVC,bggCbgg+EbggE,bggnFbggGbgg=HbggHbggHbggYJbgg:K,bggKbggfNbgg(P,bggPbggGRbgg.S,bggSbggqUbggPV,bggWbggXbggY,bggZbgg]bgg_bgg_bggz`bggabggc,bggdbgg\ebggGf,bggfbggAhbggJibggibggxjbgglbggn,bggobggrbggsbggsbgg|tbggXvbggwbggxbggxbggU{You climb downwards. _There is a stone staircase leading up here.down here. _You climb downwardsbgg{V. _There is a stone staircase leading up here.  down here.bggw|bggk~bgg$ _bggbgg32 _There is a stone staircase leading up here.down here. _You climb downwards. _There is a stone staircase leading up here.down here.  You climb downwards.bggbgg ,bgg^bgg  #[.............  #.##########.###..........#.....  #..........#..####..............########.##............... ###.......>.... #.......... #.......... #.......... #............. 105.1 (24.5)bggWy##................#..... ##..............#......  #................. #.........#...........  #...#....##.........#  #..[###...#.........#  ##.###.............##  ####..........##...#Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHubggbggbbggla _There is a stone staircase leading up here.bgg bgg bgg bgg7 bgg bgg : _bgg bggU ,bgg6 bgg bgg bgg5 bgg bgg bgg ,bgg bgg bggx ,bgg3 bgg bgg bgg bgg| bgg{ bgg ,bgg bgg bggc,bggXbggbggm,bgg bggC bgg,bggbggbgga,bggKbggtbgg^,bgg$bggbgg ,bgg!bgg$bgg%bgg&bgg'bgg*bggk,bgg,bggQ-bggd/bgg/1,bgg1bgg3bgg"5,bgg5bgg7bgg::,bgg<,bgg[>,bgg$?bgg}@bggB,bggfCbgg@EbggF,bgg-HbggIbggK,bggLbggNbggO,bgg^QbggRbggS,bggTbgglX,bggXbggx[o _f - 16 poisoned darts (gained 1)bggl]3bgg{^bgg8a,bggbbggdo _f - 17 poisoned darts (gained 1)bggg3bgghbggm,bgg&obgg.xo _f - 18 poisoned darts (gained 1)bggz3bgg |bgg~bggсbgg@bggbggcbggZ,bggbggbgg`Bbggtbgg bggbggßbggbggrbggbggibggbgg,bggbgg]bggbggjbggKbggbgg,bggbggbggbgg{bggEbggbggbggbggbgg^  There is an entrance to Hiroito's Assorted Antiques here.bggMbgg _bgghbgg,bggbgg[x _x - 4 scrolls of teleportation (gained 1)bggbggbggbgg0 bgg ,bggZbggJbgg,bggbggbgg%###.#..######.# #.................###.. ..........#............. bggx&.......#..#........##.#. ..................###.# ###.......#.......#.#... #...##.##............. ###....#.......... ###............50.1 (45.0 #.##.∩........... ..........8bgg&.##.....## ........[.....# [...[...#........#.....bgg' ........##......###... #......#####.#.## ... ###### #..#.. #.....#bgg4bggRi,1.1 (46bggrbggv( _Found a ring mail.bggNbggObggQbgghZbgg^bggg_bggQebggjbggo,bgg/qbggxbgg:{bgg.F .......#..#........##.bgg ..................### ###.......#.......#.#. #...##.##........... ###....#............. #.........##.......##........##.∩..#..............x.##.............[#[...[...#........# #bggw.##......###... #######.#.## .... ######## #..#.. #x   unseen horror (invisible) #...... ####.  bggQ13.1 (2.0)bggGbggN..xbggl+4.1 (3bggbggޞa _An unseen horror comes into view.bggP ........... ###.......#.. #...##.##.. ###....#.... #.........# ##........##.∩ .#............. ...x...@...# ...................[ .#[...[...#.... #........##... ##......#####.#.##  ########   bgg1####.  bgg: ........... ###.......#.. #...##.##.. ###....#.... #.........# ##........##.∩ .#............. ...x...@...# ...................[ .#[...[...#.... #........##... ##......#####.#.##  ########  bggH ####. bggbggbgg:bgge _An unseen horror is nearby!bgg ........... ###.......#.. #...##.##.. ###....#.... #.........# ##........##.∩ .#............. ...x...@...# ...................[ .#[...[...#.... #........##... ##......#####.#.##  ########   ####.  bgg\{ ........... ###.......#.. #...##.##.. ###....#.... #.........# ##........##.∩ .#............. ...x...@...# ...................[ .#[...[...#.... #........##... bggj|##......#####.#.##  ########   ####. bggibggObggcbggDe _An unseen horror is nearby!bgg9 A .#..#.##bgg  ............### ###.......#.......#.# #...##.## ###....#.... #.........## ##........##.∩.#.......x.##.[.#[...[...#.# #.##......### ##......#####.#.##  # #..#.. # # ####. bgg bgg bgg u..x=5.1 (1bgg> bggo ; _You block the unseen horror's attack.bgg_  You slash the unseen horror!  The unseen horror is moderately wounded.bggwa bggl k.@x bggm 5=6.0 (0.9bggQy bgg~ ; _You block the unseen horror's attack.bggR  You slash the unseen horror!  The unseen horror is heavily wounded.bggFTbgg_S.xbgg`5-7.0 (1.0bggibggmD _The unseen horror hits you but does no damage.bgg  You slash the unseen horror!  The unseen horror is severely wounded.bgg ox. bggn2---8.1 (1.1bggbggkw _The unseen horror hits you. The unseen horror closely misses you.bgg.#..#.##.............###.###.......#.......#.#.#...##.##.###....#.....#.##.##.##.∩...#..x..##..[.bggZy..#[...[...#.#.#.##......###.##......#####.#.## .# #..#.. #.#.####. .bggbggbgg(M.xbgg),90bgg3bgg9S _The unseen horror misses you.bggTL....####.......#... #...##.##....###....#..............##.###.∩..#......##........[#[...x...## #........##......#########.#.## . ######## #..#.. # #.......###. bgg|ObggRbgg]Hx[bgg_`3=-60bggBhbgglS _The unseen horror misses you.bgg˶ ( .### ###.......#.......#.# #...##.## ###....#.... #.## ##.##.∩ ..# .## ......x.[ ..#[...[...#.# #.##......### ##......#####.#.##  bgg% # #..#.. # # ####. bggS bggn bgg bgg &1bgg bgg6 ; _You block the unseen horror's attack.bggc~  You hit the unseen horror but do no damage.The unseen horror is severely wounded.bgg bgg bgg֌ bgg e4=2.2 (1.1bgg bgg Z _The unseen horror barely misses you.bgg  You hit the unseen horror.  The unseen horror is severely wounded.bgg-3.1 (0.9bgg. bgg > _You block the unseen horror's attack. x2bgg8B  You hit the unseen horror.  The unseen horror is severely wounded.bggDbggNSx.bggO-4.1 (1.0bggXbgg[S _The unseen horror misses you.bggޑ#..#......####.......#.#.# #...##.####....#.... .##. ##........##.∩#....x......##.................[..#[...[...#........#...##......#####......#####.#.## ######## #..#.. #.........####. .bggbggZbggI..xbgg.55bgg>bggZ _The unseen horror barely misses you.bgg i.#..#.##.............###.###.......#.......#.#.#...##.##.###....#.....#.##.##.##.∩...#......x..##..[.bggjy..#[...[...#.#.#.##......###.##......#####.#.## .# #..#.. #.#.####. .bgglbggdnbggxL..xbggIy&6bggvbggD _The unseen horror hits you but does no damage.bgg$ .#..#.##.#..................###.####.......#.......#.#.#...##.##...###....#.....#.##..##.##.∩...#.x..##.#.[...#[...[...#.#.#.bgg& ##......###.##......#####.#.## .# #..#.. #.#.####. .bgg_( bgg+ bggF5 bgg,6 &7bggB bggG ^ _The unseen horror completely misses you.bgg؉ .#..#.##.#...................###.#.###.......#.......#.#.#...##.##...bggɋ ###....#.......#.##..##.##.∩...#.x..##.#.[.....#..#[...[...#.#.#.##......###.##......#####.#.## .## #..#.. #.....##.#####. .bggǍ bgg bgg Gx.bggS .68bgg bggT D _The unseen horror hits you but does no damage.bgg$ , poisoned)You throw a poisoned dart.  The poisoned dart hits the unseen horror.  The unseen horror is poisoned.bggu  The unseen horror is severely wounded.bgg-bggS bgg"]9.2 (1.17bgg)bggf.y _You block the unseen horror's attack. The unseen horror misses you.bgg4  You hit the unseen horror.  The unseen horror is severely wounded.bgg(x700bgg"bggX%; _You block the unseen horror's attack.bggA  You hit the unseen horror.  The unseen horror is almost dead.bggF bgg mx. bgg T1-1bgg bgg9 1 _The unseen horror hits you.bgg t...........#..#...................###.####.......#.......#.# #...##.##....##....#....... ..##.. ##bgg y.x##.∩#........##.....#..................[.....#..#[...[...#........#...##......#####......#####.#.## ......######## #..#.. #............#####. ....bggb bgg bgg+ Px.bggK, &2bgg5 bgg<  _The unseen horror barely misses you. _You see here a poisoned dart.bgg+##.###..........#...................#..#..............##.####.......#.......#.# #...##.##....##...x#....... .##... ####.∩..#(.....##...........#..................[.....#..#[...[...#........#.bggX,..##......#####......#####.#.## ......######## #..#.. #............#bgg/bgg1bggLAo.x)bggjBT2-3bggFMbgg%Sa _The unseen horror looks more healthy. You block the unseen horror's attack.bgg\A  You slash the unseen horror!bggo.bgg=834.1 (0.9bggbggQ _You kill the unseen horror!bgg_bgg_bggbbggogbggk,bggobgg"pK3=bggubgg{bggC|bgg~bggM,bgg<bgg94bgg2=bggbggg,bggbgg,bggbgg;5bggQbggÚ,bggvbgg,bgg`bgg;6bggbgg'bggbgg.bgg~bggK7=bgg,bgg1 _HP restored.bgg3bggbgg,bggbggo _f - 18 poisoned darts (gained 1)bggj3bggbggsbggbggB9=bggbggbgg,bggbggbgg/bggbgghbgg bgg ,bgg bgg bgg ,bgg bgg  bgg ,bggD bgg bgg bgg bgg bggP bgg bgg bggv bggr bgg" bgg# bgg# bggL) bgg, ,bgg. bgg1 bgg5 bggU6 bggu7 bgg8 bgg2; bgg; bgg?@ bgg)F bggI ,bggJ bggdL bggwO ,bggP bggS bggU bggV bggV bgg3Z bgg=\ bgg\ ,bggpa bggd ,bgge bggg bggh ,bgg6i bggj bggol ,bggm bggbn bggLp ,bggq bggs bgg/v ,bggv bgg{ bgg~ ,bggw bggք bggr ,bgg bgg& bggH ,bgg bgg bggݘ bggi bgg˚ bggG bggٟ ,bgg bggڢ bgg ,bgg bggU bgg[ bgg bgg bgg" bggR ,bggȳ bggz bgg bgg bgg bgg bggǿ bggZ bgg( bgg bgg+ ,bgg$ bgg bgg bggK bgg) bggY bggv ,bgg bgg bgg> bgg bggZ bgg R  There is a stone staircase leading down here.bggV bgg  _bgg bgg bggq bgg bgg  bggz bggC bgg bggw bgg bggn$ bgg% bgg& bgg* bgg- bgga. bgg/ bgg:3 bgg6 ,bgg7 bgg; bgg> bgg? bggJ@ bggC bggG bggG bggyH bggL bggX ##.......##..###.......##.......>.  #.................. . .... bggY ##.................. .! .... #................... ... .. .........<.............. #................#...... ###.......#......  ##............. -233.1 (59.0)  #.........#..... .^#...#....##.........#.) ..bgg'Z 8#..[###...#.........# .........##.###.............## ....####..........##...##.....)bggZ Z#...........##.........##............#..............##.............#.#####.#...#bgg...... #......$.. . #.......!. . ....[..bgg` <...... .#....#.. ##...0.0) #.#......^. #...#....##.........#.).. #..[###...#...# . bgg` ##.###.......## .####..........##...##.....).#...........##.....bgg` ##............#.....##....#.#####.#...##.bggm bggr +5.1 (1bgg.w bgg{ $ _Found a cloak.bggbggUbgg bgg|&bggu1...#..##.. .##...## .##.......>.......... ............$... .............!.< ...........[.<.......... ........#.. #.bggL2......#.0...... .........#.....^ ...#....##.#.). ..[# ... #....## ...........) #####...##.....)#..##......##.#...............bggO>bggC+6.1 (1bggHbggK; _Found an escape hatch in the ceiling.bgg3bgg%bggWbgg,bgg¯bggmbgg,,bggbggbggP,bgg!bggbggA,bggpbggbgg,bggbgg,bggbgg N _You now have 481 gold pieces (gained 14).bggd 3bgg bgg&u  You see here a potion of degeneration.bggbgg _bggbgg"bgg@&,bgg'bgg-bgg~3,bggu6bggK<bggA,bggGbggMbgg,TbggTbggAVbgg[bgga,bgggdbggSjbgg o,bgg)rbggpybgg~bggbggbggbgg?,bgg*bggbgg,bggbggbggbgg]bgg(bgg\bggO,bggbggobgg,bggަbggNbggbggbggbggbgg,bggbgg?bgg"bggbggHbgg6bgg,bggbbggjbgg(bggbggbggbgg,bggbggbgg5bggbggbggbgg,bggbggbgg,bggCbgg bgg0Bbgg3bgg[,bggsbggcbgg bggc bgg-!bgg#bgg&,bgg'bggc*bgg-,bgg8/bggK1bgg3,bggV4bggD6bgg8,bgg9bgg>bggrA,bgg/Bbgg"DbggF,bggsGbggJbgg%MbggMbggNbggObggbRbggRbgg;SbggWbggZbggN[bgg[bgg]bgg`bgg`bgg`bgg:cbgge,bggGfbgghbggrj,bggjbggmbggKn,bggnbggSsbggzubggubgg@vbggxbgg;{bgg{bggL|bggQXbggbgg,bggJbggbggGbggَbggbggGbgg%bggbggbgg-bggbggEbggbgg2bggߦbgg1bggbgghbggRbggŭbggbggbggѳ,bggŴbgg bgg,bgg(bggjbggtBbgg,bggbggN _You now have 501 gold pieces (gained 20).bggIbggbggbggNbggbggbgg,bgg^bgg@  There is an open door here.bgg0bgg! _bggbggbgg bgg bgg bgg)bgg,bggwbggFbgg!,bggbggbggJbggbggCbggL bgg"bggK#bgg#bggL&bggD)bgg)bggw*bgg1######### #..#..##.....##...##### #............#....# # bgg:2-####..............#  #..............#  ...####.......##  #..#..#........#  #..'..'..#.....#  ##.#..#..#.....#  bgg2#@####.#......#  #......##.#..##  ############## 22 bggwS307.1 (71.0)8.1 (72 _f - 22 poisoned darts (gained 4)bggGi_bggkbggl,bggpbggq,bggnrbggtbggw,bggxxbggzbggj},bgg\~bggbgg,bggAbggbgg,bggbggdbggSbgg,bggbggXbgg,bgg^bggobgg,bggbggNbggbggbgg0bggbggbggabggbggXbggSbgg,bggbgg5bggbggbggbgg$bgg?bggABbggGbggLL,bggMbggQTbggWbggXbgg;Zbgg^bggbbggcbggebgg:ibgglbggmbggnbggsbggpv,bggwbgg{bggbggbggbggXbggBbggbgg,bggݑbgg_bgggbggºBbggǻbgg',bgg۾bggHbggh,bggNbggbgg,bgg/bggbggmbggbgg=bggbggs,bggtbggbggbgg:bgg0bgg]bggbggbggPbggbggbggbggbgg/bggbggbggbggd$nbggA*Bbgg/bggo4bgge5bgg6bgg;bgg?bgg @bgg8BbggFbgg!KbggKbgg.MbggjQbggYUbggUbggXbggs\bggtabggabgghbggNnbggrbggjrbggubggY{bgg  The centaur warrior shouts!  Ravn's ghost turns its malevolent gaze towards you.bggԞbggm _You hear a shout! x2  You see here an ugly thing skeleton.bggEbggbggybggbggw3bggVbgg= _The tengu reaver shouts!bggbggbggr_bggmbggbgg8 bgg%bggy)bgg,bggm-bgg/bggX= .....##......#...# .............#..#### ................##. .<..........##....##### .............##..##.ß!## ............###..#$..$.# .............#...+$$$.ß# ### ............##...+V_I$∩###.# ................@+QT$$ß#...## 62.1 (54 ..^..............#Wc$$.#....# .................##oß.##.... ..........gg>3m.#.....÷#####..#### ..........)#.....#.......# ....)......#..........<..# Q   tengu reaver (repels missiles) .......................### I   obsidian statue ............##........## o   orc knight ##.#...##.............#c   centaur warrior(…)_The troll shouts!bggdO:_bgghWT _Key pressed, stopping explore.bggIbggԎbggƒbgg)bgg›bgg$ _bggRbgg8bgg4bgg;bggcbggbggbggbggXbggbgg_bggbgg"bgg)bgg/bggB2,bgg4bgg>bggObgg],bggNebggfbggcgbgg?mbggMbgg,bggвbggbggDbgg?bgg,bggbggbgg  bgg bgg( ,bgg< bgg}( bgg2 bgg7 ,bgg9 bggpG bggJW ,bggZ bggf bggk ,bggm bggv bggy ,bgglz bgg+ bgg, ,bgg: bggW bgg ,bggm bgg bggv ,bgg bgg bgg bgg" bggN bgg} bgg bgg޳ bggǶ bgg bgg/ ,bgg bgg bgg1 bgg bggF bgg bgg bgg bgg bgg; bgg bgg2 bggC bgg bgg ,bggn bggP bgg ,bgg> bgg bgg bgg bgg bgg bggV bgg bgg bgg bgg ,bggN bgg{# bgg& bggl' bgg.- bgg4 bggG9 bgg: bgg; bggq@ bgg E ,bggkF bggQ  ##..#....## ##### ##.......... #### ###...# #.##......## #..####.....####........... #...#.......##............. bgg^S ##..........###.....>....... #....[...................... #..................... +.†................90.1 (28 #[................. ######.###....#............#..###................ ####..................##..  #.......##.>..............  #............... ##.......!.<....... #........[............bggT bgg\ bgg_ T _Key pressed, stopping explore.bgg]} Ibgg P _bgg. bgg bgg\ bgg bggY bggř bgg ,bgg bgg bggS bggǨ bggg bgg bgg/ bgg bgg> bgg bggU ,bgg bgg5 bgg bgg bgg bgg bgg9 bgg bgg bgg bgg{ ,bgge bgg* bgg bgg0 bgg bgga bgg  ##### ## #### ###...# #. #..####.....#### #...### ##..........### +## #....[ #ooo# #oßo'bgg K.... #ooo#[.  #.##########.###.#..  #..........#..####.  ########.......##.... #.......##.......>oo 2 orc wizards (asleep) #............oooooo 6 orcs (1 missile, asleep) ##........ ##.[bgg) 400.1 (10 _Key pressed, stopping explore. _Key pressed, stopping explore.  You open the door.  2 orc wizards and 6 orcs come into view.  An orc wizard is wielding a +2 antimagic dagger. An orc is wielding a +2 dagger of draining.bgg_+ bggG, bggE@ 0ooooßoooo.oooooooo)bgg@A K====1.1 (11bggR bgg a O _The orc shouts! The orc wizard shouts! The orc shouts! x5bggI #####  ####   #..####. #...#... ##....... +## #....[... #ooo#........ #oßoo@.......... #oo.#[.......  #####.###....  #..####..  ....##... #.......> #....... ##........ [bggG #####  ####   #..####. #...#... ##....... +## #....[... #ooo#........ #oßoo@.......... #oo.#[.......  #####.###....  #..####..  ....##... #.......> #.......bgg݁ ##........ [bggȔbggݕbggdbggۯd _There are monsters nearby!bggbggbggbggF _Unknown command.bgg^ Bbgg` bgga bgg?b bggc bggy .o.#oooobggz f=---2.0 (0.9)bggǍ bgg͔ N _You barely miss the orc.bgg:I>  You slash the orc wizard!bggO]  You kill the orc wizard!bggwPbggRbggSbgghTbgg;Ubggfo.ßoo   orc wizardbggkP=--9bggzbgg1 _You block the orc's attack.bgg`{7  You slash the orc!bggbgg|V  You kill the orc!bggbgg2bgg.o. 5bgg-3.9 (1.0bggbgg1 _You block the orc's attack.bgg8X  You hit the orc.  The orc is lightly wounded.bgg09bgg9bggCw.ooobggC.-4bggNbggU1 _You block the orc's attack.bggq  You hit the orc but do no damage.The orc is lightly wounded.bgg@-5bggbgg{ _You block the orc's attack. x2; The orc wizard completely misses you.bggoT 7  You slash the orc!bgg] V  You kill the orc!bgg ` bgga bgg>b bggp o.o#o 4bggu &6bgg bggG 1 _You block the orc's attack.bgg   You slash the orc wizard!  The orc wizard is severely wounded.You block the orc's attack. You block the orc wizard's attack.bggݎ 5=7.8 (0.9bgg bgg( I _The orc misses you.bgg#  You hit the orc wizard but do no damage.The orc wizard is severely wounded.The orc closely misses you. You block the orc wizard's attack.bgg$5-8.8 (1.0bgg 1bggR7: _The orc hits you but does no damage.bgg$K  You hit the orc wizard but do no damage.The orc wizard is severely wounded.The orc hits you but does no damage.bggZU9*bgg0 o(invisible)  The orc wizard casts a spell.bgg oThe orc wizard flickers and vanishes for a moment.bggE====9bggbggt1 _You block the orc's attack.bgg   You barely miss the orc wizard.The orc wizard is severely wounded.You block the orc's attack.bggs  The orc wizard casts a spell at you.bggE  The puff of flame hits you but does no damage.==--10.9 (1.1bggRbggaW: _The orc hits you but does no damage.bgg?  You slice the orc wizard!!bgg- )oooo 4 orcs (1 missile)  You kill the orc wizard!bgg 3V---10bggqHbgg M4 _You block the orc's attack. x2bgg7  You slash the orc!bgguV  You kill the orc!bggbggJj. 3bgg@-2bggbgg1 _You block the orc's attack.bgg!  You hit the orc.  The orc is moderately wounded.bggk R)obggL (You block the orc's attack. The orc throws a boomerang.bggB ^)3bggҬ bgg . _You block the boomerang.bggU  You barely miss the orc.The orc is moderately wounded.bggFa E.obgg #........ ##......... ##.[bgg|bggk7=-20.7 (1.0 _bggbgg  There is an open door, spattered with blood here. _Items here: ( )))) [[ †.bgg3 #####  #### ###...#  #..####..... #...#.## ##..### +####....[ #...#) #.ß@) #...#) #.##########.###.# #.#..#### #.......## #.......##.>bgg(5G #....... ##........ ##.[bgg5>bgg6?G-1 _bggIbggLbgg / ##### #### ###...#  #..####.....## #...#.......## ##....### +####....[ #.@.#)....bgg  #.ß.) #...#)... #.##########.###. #..........#..############.##. ###> # ##.bggA bgg[ &2bgg bgg bgg?    #####   #### ###...#   #..####.....   #...#.   ##.   +####....[   #@..#)   #.ß.)  bgg@ #...#)   #.##########.###   #.#..####   #.##   #.##.>   #   ##bggiJbggAK&3bggWbggZbgg+###$$#$>$$$##'bggbggB=4bgglbgg _You open the door. _Found 87 gold pieces. Found a staircase to the Orcish Mines.bggbggbgg!bggm%F _Unknown command.bgg0 `       ###   +### #### ###...   #$$$ #..####.....  #$>$ #...#.......  #$$$## ##...bggd 8#  ####....[ #...#)..   #.ß.)  #...#)..  #.##########.###.   #..........#..####  ########.##.   ###   #bgg bgg| &5bgg bgg n _Found 42 gold pieces. _There is an open door here.bggd0      ###  +###+ #### ###  #$$$# #..####  #$>$# #...#...... bgge#$$@## ##... +###'####....[ #...#).  #.ß.)..  #...#)..  #.##########.###.  #..........#..#### ########.##  ###bggpbgg@# #...##$$.## ##....+###'####....[  ##...#)...........#). #bggRbggS+8.7 (1bgg[bgg_mbggvn+9.7 (2bggwubgg@y? _You now have 531 gold pieces (gained 12).bgg<M ###+###+ #### ###$####>.# #...##$$.## ##....  +###'####....[........ß ..###bggFbggG,30.7 (1bggKMbgg TbggT+1.7 (2bggXbggZ? _You now have 557 gold pieces (gained 26).bggH F          +###+ #### ###  #$@.# #..####  #$>.# #...#  #$$.## ##  +###'####....[  ##...#)  #.ß.)  #...#)  #.###.###  #.#..####bgg3 W2.7 (1bggw6 bggD7 +3.7 (2bggs@ bggC ? _You now have 568 gold pieces (gained 11).bggs 9          +###+ #### ###  #@..# #..####  #$>.# #...#  #$$.## ##  +###'####....[  ##...#)  #.ß.) bggiu  #...#)  #.####.###  #.#..####bggd} bggI~ +4.7 (1bggĄ bgg bgg +5.7 (2bgg bgg՝ ? _You now have 592 gold pieces (gained 24).bggxY #+###+ #### ###...# #..####..>.#..$.## ##....+###'####....[#..# ########.......##.... bgg_cbggc+6.7 (1bggibggrbggr+7.7 (2bggxbgg}> _You now have 598 gold pieces (gained 6).bgg3 #+###+ #### ###...# #..####..>.#..$.## ##....+###'####....[ ##...#)....ß..## #.......##.... bggbgg+8.7 (1bggebgg= bgg +9.7 (2bggbgg? _You now have 614 gold pieces (gained 16).bggq     # +###+ #### ###. #...# #..####. #.>.# #...#. #.@.## ##. +###'####....[. ##...#). #.ß.). #...#). #.##.###. #.#..####. #.##. #.##.bggB40.7 (1bggbggܬbgg+1.7 (2bggԲbggs? _You now have 630 gold pieces (gained 16).bgg         +###+ #### ###  #...# #..####  #.>.# #...#  #@..## ##  +###'####....[ bgg S ##...#)  #.ß.)  #...#)  #.##.###  #bgg; T.#..####  #.## bgg[ G #.##bggL$ bgg$ +2.7 (1bgga+ bgg[. bggg#'oo##oßo#oo##.o   orc priest (asleep)#o   orc wizard (asleep)oooo 4 orcs (2 missiles, asleep)bgg  You open the door.  An orc wizard, 4 orcs and an orc priest come into view.The orc shouts! The orc wizard shouts! The orc shouts! The orc priest shouts!bggbggbggVoooßo.oooooooo1 wandering)bggE====3bgg bgg* _You hear a shout! x6bggd9     +###+ #### #  #...# #..####.  #.>.# #...#. #...## ##... ###'##[ #ooo## ##...#)... #oßo #.ß.)  #.oo #...#)  ##o##########.###  #..........#..####  ########.......o 2 orc wizards (1 wandering)  #.##o 5 orcs (2 missiles, bggb2 wandering)  #..bgg&w  An orc and an orc wizard come into view.bgg'bggo)bgg+bgg.bggs=S.ooooo.oooo 4 orcs (1 missile)4bggSFbggxOh _The orc shouts! _There is an open door here.bggܚ?  You slice the orc wizard!!bggbgg;bggNbgg5bggCo.o..o   orc wizard2s)bggj4===-5.6 (0.9bggbggN _You kill the orc wizard!bgg- 5  You hit the orc.bgg. bgg/ bggW1 bgg3 bggF .oooßoo.bggF W---6.6 (1.0bgg"Q bggT 1 _The orc is lightly wounded.bgg"r >  You slash the orc wizard!bggHs bggu bggb W 'ooo. o 5 orcs (1 polearm, 2 missiles)The orc wizard is almost dead.bggτ O=-7bgg bggל t _An orc comes into view. It is wielding a +0 trident.bggp>  You slash the orc wizard!bggvbggwbggybggw|bgg.oo.ß.oooooo 5 orcs (1 polearm, 2 missiles)bgg֏.-8bggbggN _You kill the orc wizard!bggh7  You slash the orc!bggTbgg!bgg|bgg o.You kill the orc!bgg5=9.5 (0.9bggsbgg1 _You block the orc's attack.bggi7  You slash the orc!bggmbggqV  You kill the orc!bggubggAwbggt= o...o(wandering) 4 orcs (1 polearm, 1 missile)An orc priest comes into view. It is wielding a +0 morningstar.bgg6-50.5 (1.0bggؘbggˬ1 _You block the orc's attack.bggOU  The orc priest shouts!  You slash the orc!bggjV  You kill the orc!bggbggabgg$bgg .oo..oo 2 orc priests 2You hear a shout!bggyE====1bggvbgg? 1 _You block the orc's attack.bggH K  You hit the orc.bggI bggM V  You kill the orc!bggN bggx\ k o>obgg] .oo 3 orcs (1 polearm)An orc comes into view. It is wielding a +0 dagger.bgga [=---2bggl bggy 1 _You block the orc's attack.bgg&   You slice the orc priest!!  You kill the orc priest!bggӼ g  The Shining One accepts your kill.bgg> bgg .o).ooo 3 orcs (1 polearm)bgg W=--3.4 (0.9bgg1 bgg& 4 _You block the orc's attack. x2bgg~  You hit the orc.  The orc is almost dead.bggbggbggH o>ooo   orc priestoooo 4 orcs (1 polearm)The orc hits you but does no damage. The orc misses you.bgg5-4.4 (1.0bgg+3 _An orc comes into view. It is wielding a +0 club.bgg<7  You slash the orc!bgg  You kill the orc!You block the orc's attack.  The orc priest mumbles some strange prayers to Beogh against you.bgg.o) 3bgga80-----=5bggbggǶc _Beogh smites you! The orc closely misses you.bggM7  You slash the orc!bggbggV  You kill the orc!bgg>.oo 2 orcs (1 polearm)bggn.-6bgg$bgg6'1 _You block the orc's attack.bgga7  You slash the orc!bggգbgg; )oo   orc priesto   orc (polearm)You kill the orc!bggq1=-----7.3 (0.9bggwbgg  You slash the orc!  You kill the orc! _You block the orc's attack.  You slash!  You kill the orc! _You block the orc's attack.bggZO      # o###+ #### ### #...# #..#### o>.# #...# ##@..## . bggO  #'###'####....[ #o.)## ##...#) #.ß. #.ß.).. #... #...#).... ##.##########.###...bggP oo 2 orcs (1 polearm, 1 wandering) #..........#..## bggKP q########.##. #.##bggc bggoe bggh @You kill the orc! _You block the orc's attack.  You slash!  You kill the orc! _You block the orc's attack.  An orc comes into view. It is wielding a +0 club.bggx E o.oo   orc priestooo 3 orcs (1 polearm)You block the orc's attack.bggEy &8.3 (1.0bggL bgg| _An orc comes into view. It is wielding a +0 whip. _Items here: ))) †.bgg 7  You slash the orc!bgg bgg3 bggt bgg '.o 2 orcsbgg2 .=9bggV bggA G _You kill the orc!bgg:7  You slash the orc!bgg">bggI.   orcbgg0Nn2=-60.2 (0.9bggBVbgg [G _You kill the orc!bgg7  You slash the orc!bgg7)  You slash the orc! _You kill the orc!  You slash the orc! _You kill the orc!  You slash the orc!  You kill the orc!bggubgg9bggxG-1.2 (1.0bggSbggF bggkT_The orc priest miscasts a cantrip.bggq    #  '###+ #### #  #...# #..####.  #)>.# #...#. #)..## ##...  #@###'##[ #..o## ##...#)...  #.ß. #.ß.)  #... #...#)  ##.##########.###  #..........#..####  ########.......  #bggErY.##  #..bggbggbggbggo.32bggbgg _The orc priest casts a cantrip, but nothing happens. _There is an open door here.bggw  You slash the orc priest!  The orc priest is almost dead.bgg.=3bgg bggiX _The orc priest closely misses you.bgg|x  You barely miss the orc priest.The orc priest is almost dead.bggfy .-4bgg" bggb P _The orc priest misses you.bgg,%  You hit the orc priest but do no damage.The orc priest is almost dead.bgg% V4-5bgg0 bgg5 8 _You block the orc priest's attack.bggR~  You slash the orc priest!  You kill the orc priest!bgg'\f)bgga.56bggMibggJmX _The Shining One accepts your kill.bggWbggbggbggЕH _No target in view!bgg  .ß .. # #o '###+ #### # #. #...# #..## #. #)>.# #...#. #.##)..## ##... ##.#'###'##[ #..@## ##...#)...  #.ß.# #.ß.)  #...# #...#)  ##.##########.###  #..........#..####  ########.......o   orc priest (wandering)  #.##..  #.....ggR=H #bggYbggc.oobgg\7=-7bgg$bgg8 _An orc priest comes into view. It is wielding a +0 whip. _Items here: ( )))))))) [[[[[ ††††††.bgg۞m   .ß.  ...#  #.#'###+ ####   #o##...# #..  #.##)>.# #...#  #.##)..## ##bgg  ##.#'###'####....[  #.@)## ##...#)  #.ß.# #.ß.)  #...# #...#)  ##.###.###  #...#..#### bgg ########.##  #.##  #  ##bgg+bggbgg.o##)oo   orc (wandering)bgg߸9==-8bgg3bggr _An orc comes into view. It is wielding a +0 flail.bgg 7..ß. ...# '###+ #### .##...####o##)o.# #...# #.##)..## ##....##@#'###'####....[.)## ##...#)ßbgg ß.)....# #...#)...##.##########.###............#..############# bggf bggk L.obgg @90=bgg7 9bgg bgg bgg~  You slash the orc priest!  You kill the orc priest!bgg?p#)bggz0==70bggbggX _The Shining One accepts your kill.bgg4bggbggbggH _No target in view!bggpM#####.ß. ...# '###+ #### ..####.##)o.# #...# #@##)..## ##....##.#'###'####....[bggCh#..)## ##...#) #.ß.# #.ß.)......bggbggmoo   orc (wandering)bggV52--1 bgg _bgg2bgg%  Things that are here: _a +0 whip; an orc corpsebggA ######...#ß. ...# '###+ #### ..####@##)o.# #...# #)##)..## ##....#.#'###'####....[bgg4BT#..o## ##...#)#.ß.# #.ß.)....# #...#)...##.##########.###............#..###########bggCJbggSo)obggaTE====2bgg]bggb% _The orc shouts!bgg  ####...##.ß.#...# '###+ #### ..####.##)o.# #...# #)##)..## ##....#o#'###'####....[.)## ##...#)#.ß.# #.ß.).#...# #...#)...##.##########.###............#..####bggjbggFo.bgg E----3bggbggXbggx k ###.#.ß.##...# '###+ #### ..####.##)o.# #...# #o##)..## ##....#.#'###'####....[.)## ##...#)ßß.).#...# #...#)...##.##########.###..bgg2" bgg" J3=----bgg" 4bgg+ bgg- bggc  ###.ß#.@.# ##.#'###+ #### ..####.##)>.# #...# #o##)..## ##....#.#'###'####....[.)## ##...#)ß.ß.)....# #...#)...bgg6g bgg s No)bgg_s &5bgg9| bgg bggyT        #####  #...#  #.ß@#  #...#  ##.#'###+ ####  bggDz#.##...# #..#### #o##)>.# #...# #)##)..## . ##.#'###'####....[ #..)## ##...#) #.ß.# #.ß.)..bggh~bggFo.bgg?4=bgg6bggʘbgg{bgg=#####...ß.#.#'###+ #### # #o##...# #..###.##)>.#.#..#)##)..## ##....##.#'###'####....[bggJ>\..)## ##...#)....ß.# #.ß.)....#)bggAbggYKFo.bgg*L&7bggdTbggXbgg D=8bgg bgg j _You barely miss the orc. You block the orc's attack.bgg"L  You hit the orc.  The orc is moderately wounded.bggNM 559.1 (0.9bgg4V bgg Z 1 _You block the orc's attack.bgg%7  You slash the orc!bgg/j)bgg4)80.0bggr;bgg:>G _You kill the orc!bgg{4bggbgg֦H _No target in view!bgga     ##### #...#  #.ß.#  #...# ##)#@###+ #### ## #.##...# #..####. #.##)>.# #...#... #)##)..## ##..... ##.#'###'####....[ #..)## ##...#).....bggp #.ß.# #.ß.).. #...# #...#) ##.##########.###bggdbgg;<-1.0 (1.0 _bggbgg Q _There is an open door here.bgg    ##### #...#  #.ß.#  #...## ##)#'###+ #### ### .##@..# #..####.. #.##)>.# #...#... #)##)..## ##..... ##.#'###'####....[ #..)## ##...#)..... #.ß.# #.ß.).. #...# #...#) ##.##########.### ..........#..####bggs6-2 _bggy#bgg;'bgg v   ##### #...#  #.ß.#  #...### ##)#'###+ #### ###. .##...# #..####... #.##)@.# #...#... #)##)..## ##..... ##.#'###'####....[ #..)## ##...#)..... #.ß.# #.ß.).. #...# #...#)bgg  ##.##########.### ..........#..#### ########.......##..bgg- bgg &3bgg9" bgg% d _There is a staircase to the Orcish Mines here.bgg1      #####  #...#  #.ß.#   #...##### ##)#'###+ #### ### #.##..@# #..#### #.##)>.# #...# )##)..## .bgg3 ; ##.#'###'####....[ #..)## ##...#) #.ß.# #.ß.).. #...# #...#).... ##.##########.###... #..........#..##bggC bggD -4 _bgg9N bggQ bgg###oo#oßo##oo'#bggo   orc warrior (asleep)ooooo 5 orcs (1 polearm, asleep)bgg  You open the door.  An orc warrior and 5 orcs come into view.bgg&oooßo.oooooooo1 wandering)bgg's7=====5bgg/9bgg# S _The orc warrior shouts! The orc shouts! x3; You hear a shout!bggmf  You hit the orc but do no damage.bggp6  You hear a shout!bggrtc  The orc completely misses you.bggubggubggއooß.oo)bggÈ[===-6bgg/bggM _An orc comes into view. It is wielding a +1 flail of holy wrath.bggk7  You slash the orc!bggbggzbggp V  You kill the orc!bgg[Lo.bggT!P---7bgg2bggIq _An orc comes into view. It is wielding a +0 club.bgg P5  You hit the orc.bggPbggGRbggSm  The orc is moderately wounded.bgg5e..oo 4bggfH--8.1 (1.1bggpbggt1 _You block the orc's attack.bgg 7  You slash the orc!bggF bgg׳ bggz bgg0 bgg6 bgg Koo.bgg H=90bgg bgg G _You kill the orc!bggR 5  You hit the orc.bggU f  The orc is almost dead.bggV ,bgg3X bggf ..ooo 3bggf .90.2 (1.1bggq bggw 1 _You block the orc's attack.bgg|h  You hit the orc warrior.  The orc warrior is lightly wounded.bgg,10bggbggyQ _The orc warrior misses you.bgg  You slash the orc warrior!  The orc warrior is severely wounded.bgg|5=2.3 (1.1bggsbgg9 _You block the orc warrior's attack.bgg  You hit the orc warrior but do no damage.The orc warrior is severely wounded.bgg4-30bggbgg9 _You block the orc warrior's attack.bgg _You block's attack.  You hit the orc warrior but do no damage.  The orc warrior is severely wounded. _You block the orc warrior's attack.  You hit the orc warrior but do no damage.  The orc warrior is severely wounded.bggK @-4bggbgg1#  You hit the orc warrior but do no damage.The orc warrior is severely wounded. _You block the orc warrior's attack.  You hit the orc warrior but do no damage.The orc warrior is severely wounded. _You block the orc warrior's attack.bggΓ  _You block the orc warrior's attack.  You hit the orc warrior but do no damage.  The orc warrior is severely wounded. _You block the orc warrior's attack.  You hit the orc warrior.  The orc warrior is almost dead.5 _You block the orc warrior's attack.bggG9 } _You block the orc warrior's attack.  You hit the orc warrior.  The orc warrior is almost dead. _You block the orc warrior's attack.  You hit the orc warrior.  The orc warrior is almost dead.6bggG bggL ?  You hit the orc warrior.  The orc warrior is almost dead. _You block the orc warrior's attack.  You hit the orc warrior.  The orc warrior is almost dead. _You block the orc warrior's attack.bgg? _You block the orc warrior's attack.  You hit the orc warrior.  The orc warrior is almost dead. _You block the orc warrior's attack.  You hit the orc warrior but do no damage.  The orc warrior is almost dead.bggf&7bggbgg@Q _The orc warrior misses you.bggE?  You slash the orc warrior!bgg[bggB&.oooo 3 orcs (1 polearm)bggJ.w 68 _You kill the orc warrior!bggx;bgg=Ah _Your Dodging skill increases to level 9!bggx7  You slash the orc!bggػbggżbggbggJSo)bgg>&9bggbggG _You kill the orc!bggoz      ##### ####  #...# o..#  #.ß.# oß.#  #...## ##oo.# #### ##)#'###@# #### ### #.##...## #..#### #.##)>.# #...# )##)..## ......# ##.#'###'####....[ #..)## ##...#)o 4 orcs (1 polearm)bggq #.ß.# #.ß.).. #...# #...#).... ##.##########.###...bgg!bgg(500bggbgg9 bgg_You block the orc's attack. x2  There is an open door, spattered with blood here. _Items here: )))) [[ ††.bgg 7  You slash the orc!bgg: bgg . 3You kill the orc!bggQ -1.2 (0.9bgg-% bgg * Q _The orc closely misses you.bgg 7  You slash the orc!bgg\ g) 2bgg (2.1bgg] bgg G _You kill the orc!bgg8i       ##### #####  #...# #o..#  #.ß.# #oß.#   #...## ##@..# #####   ##)#'###)######## ###...#   #.##...## #..####.....#   #.##)>.# #...#  bgg9 )##)..## ......##   ##.#'###'####....[ #..)## ##...#) #.ß.# #.ß.)..   #...# #...#)....bgg bgg -3.1 (1.0bggbgg$! _The orc hits you but does no damage.  Things that are here: _a +0 falchion; a +0 war axebggUbggl.o4.0 (0.9bggbgg-N _You barely miss the orc.bggGbggVD.obggW-5.0 (1.0bggRjbggnj _You barely miss the orc. You block the orc's attack.bggX  You hit the orc.  The orc is lightly wounded.bgg&6bggbggG _The orc barely misses you. The orc completely misses you.bggJ  You barely miss the orc.The orc is lightly wounded.bggK +9 (0.9bggW bgg] 4 _You block the orc's attack. x2bgg 7  You slash the orc!bgg^ )   orc (You kill the orc!bggO -7.9 (1.0bgg bggK 1 _You block the orc's attack.bgg7  You slash the orc!bgg!e)bggP&-9.0 (1.1bgg,bggj0G _You kill the orc!bggQ4bggZbgg]H _No target in view!bgg o[?25h[?0c  Search for what [Enter for "curare", or ? for help]? bggDS [?25l[?1cbggN bgg! $bggy e7 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] R - a +4 long sword bgg[  b - [carried] a - a +0 scimitar (weapon)  c - [right here] a +0 falchion (1 further duplicate) Results elsewhere ([,] to cycle)  d - [D:12] a long sword (63 gold)  e - [D:10] a +4 falchion of freezingf - [D:10] a falchion  g - [D:8] a +0 long sword (3 further duplicates)bggbggbgg$ deadiverson the Carver  Human of the Shining One *****.  Health: 97/97 ========================  Magic: 12/12 ========================  AC: 20Str: 17  ##### #####EV: 18Int: 11  #...# #...#bggSH: 16Dex: 15  #.ß.# #)ß.#XL: 12 Next: 56% Place: Dungeon:12  #...## ##@).###### Noise: =--------  Time: 14509.0 (0.0)  ##)#'###)######## ###...# a) +0 scimitar  bggd#.##...## #..####.....# Throw: 22 darts (poison)  #.##)>.# #...#.......#  #)##)..## ##..........##  ##.#'###'####....[........   #..)## ##...#)............   #.ß.# #.ß.).............  bgg #...# #...#)............ You kill the orc! _You block the orc's attack.  You slash the orc! _You kill the orc! bggí_No target in view!  Search for what [Enter for "curare", or ? for help]? long bbgg`bggbgg bgg . _bgg"bgg[#bgg3bgg.7F _Unknown command.bggA bggeC Wield which item (- for none)?- - Unarmed Inventory Items bggC .Hand Weapons (go to first with ))  a - a +0 scimitar (weapon)  R - a +4 long sword Floor Items ([,] to select) Hand Weaponsa +0 falchiona +0 war axe [*] show all[?] describe selected bggC [!] equip|wield|wear|put on[tab] equip|unequip bgg_ bggSg bggr  deadiverson the Carver  Human of the Shining One *****.  bgg%s Health: 97/97 ========================  Magic: 12/12 ========================  AC: 20Str: 17  ##### #####EV: 18bgg{s cInt: 11  #...# #...#SH: 16Dex: 15  #.ß.# #)ß.#bggs XL: 12 Next: 56% Place: Dungeon:12  bggs x#...## ##@).#bggs ##### Noise: =--------  Time: 14509.0 (0.0)  bggt ##)#'###)######## ###...# a) +0 scimitar  bgg1t #.##...## #..####.....# Throw: 22 darts (poison) bggFt  bgg[t ~#.##)>.# #...#.......#  bggt #)##)..## ##..........## bggt y ##.#'###'####....[........bggt 2   bggt #..)## ##...#)............bggt 2   bggu z#.ß.# #.ß.).............bgg$u 2   bgg9u N#...# #...#)............bggMu -  bggbu 9_You block the orc's attack.  bggvu :You slash the orc! _You kill the orc! bggu 9_No target in view! bggu _Search for what [Enter for "curare", or ? for help]? long b _Unknown command.bgg bgg 3-5 (0.5bgg LR) +4 long swordbgg0 bgg 2 _R - a +4 long sword (weapon)bgg5 bgg% Drop what?45/52 slots (_ for help) bgg% Hand Weapons (select all with ))  R - a +4 long sword (weapon)a - a +0 scimitar Missiles (select all with ()  b - 3 throwing nets  f - 22 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+}bgg & f l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)bgg3& rD - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  bgg[& O - an amulet of reflection [Up|Down] select [PgDn|>] page down [PgUp|<] page upbgg& B[Esc] exit bgg& Letters toggle [.|Space] toggle selected[top]bggz(1 turn)  R - a +4 long sword (weapon)  a + a +0 scimitarbggE{f[Enter] accept (1 chosen)bggibgg8 deadiverson the Carver  Human of the Shining One *****.  Health: 97/97 ========================  Magic: 12/12 ========================  AC: 20Str: 17  bgg=##### #####EV: 18Int: 11  #...# #...#SH: 16Dex: 15  #.ß.# #)ß.#XL: 12 Next: 56% Place: Dungeon:12  #...## ##@).###### Noise: ---------  Time: 14509.5 (0.0)  ##)#'###)######## ###...# R) +4 long sword  #.##...## #..####.....# Throw: 22 darts (poison)  bgg#.##)>.# #...#.......#  #)##)..## ##..........##  ##.#'###'####....[........   bggd#..)## ##...#)............   #.ß.# #.ß.).............   #...# #...#)............ You slash the orc! _You kill the orc! _No target in view! _Search for what [Enter for "curare", or ? for help]? long b _Unknown command. bgg3_R - a +4 long sword (weapon)bgg?,10.5 (1bggbgg]- _You drop a +0 scimitar.bgg Y  Adjust (i)tems, (s)pells, or (a)bilities? bgg\ bggc WAdjust which item? bggOd Hand Weapons (go to first with ))  R - a +4 long sword (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 22 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn) bgg{d p w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) bggd Jewellery (go to first with "=)  d - an amulet of faith (around neck) bggd h p - a +5 ring of evasion (left hand)D - a ring of poison resistance  bggd H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /)bgg e 4h - a wand of roots (14) bgg1e [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]bggzbgg v deadiverson the Carver  Human of the Shining One *****.  Health: 97/97 ========================  Magic: 12/12 ========================  AC: 20Str: 17  ##### #####EV: 18Int: 11  #...# #...#SH: 16Dex: 15  bgg:W#.ß.# #)ß.#XL: 12 Next: 56% Place: Dungeon:12  #...## ##@).###### Noise: ---------  Time: 14510.5 (0.0)  ##)#'###)######## ###...# R) +4 long sword  #.##...## #..####.....# Throw: 22 darts (poison)  #.##)>.# #...#.......#  #)##)..## ##..........##  ##.#'###'####....[........   #..)## ##...#)............   #.ß.# #.ß.).............   #...# #...#)............bgg  _Unknown command. _R - a +4 long sword (weapon) _You drop a +0 scimitar.  Adjust (i)tems, (s)pells, or (a)bilities? R - a +4 long sword (weapon)  Adjust to which letter? (? for menu, Esc to quit)bggy bggz #abggz bgg bggm _R - a +4 long sword (weapon) _You drop a +0 scimitar.(i)tems, (s)pells, or (a)bilities?   R - a +4 long sword (weapon)  bggދ Adjust to which letter? (? for menu, Esc to quit) _a - a +4 long sword (weapon)bggIbgg,bgg8bgg=: _bggK [2M There is an open door, spattered with blood here.  Items here: )))) [[ ††.bggQbgg&R _bggVbgg[bgg{d,bggjbggqbggCw,bggbggΆbggY,bggbggL@  There is an open door here.bggbgg _bgg+bggbgg,bggöbgg~bggbggAbggbggbggbggbggbgg  #.ß.# #)ß.#  #...## ##)).###### #  ##)#'###)######## ###...# # #.##...## #..####.....#### #.##)>.# #...#.......##.. #)##)..## ##..........###..  ##.#'###'####....[...........  #..)## ##...#)...............  #.ß.# #.ß.@................  #...# #...#)............... bggP ##.##########.###..........#. #..........#..####... ########.......##.. #.......##.......> #........ bgg##......... ##.........[There is an open door, spattered with blood here.bgg  #...## ##)).# ##### ####)#'###)######## ###...# #..##...## #..####.....####.#.##)>.# #...#.......##...#)##)..## ##..........###.bggT##.#'###'####....[...#..)## ##...#).....#.ß.# #.ß.)..#...# #...###.##########.####..........#..####..bgg}########.......##... #.......##.>bgg#...........##.....##......bggR[#..<bggb.Items here: ( )))) [[ †.bgg+9.5 (9bgg720.5 (10.0) _bggbgg$ _Items here: ))) [[[ ÷ ††.bgg Ibgg$ ...'...0.0)bgg bgg bgg ^ _Partly explored, can't reach some items.bggE 3bggE bgg bggB bgg bgg ^ _Partly explored, can't reach some items.bgg3bggXbggQbggVbgg^bggFa^ _Partly explored, can't reach some items.bggbggWhere to? (Tab - D:12, ? - help)  D - Dungeon  T - TempleL - LairbggO - Orcish Mines bggb bggD#  #...## ##)).###### ## deadiverson the Carver##)#'###)######## ###...# #. Human of the Shining One *****.#.##...## #..####.....####. Health: 97/97 ========================bgg# m#.##)>.# #...#.......##... Magic: 12/12 ========================#)##)..## ##..........###... AC: 20Str: 17##.#'###'####....[............ EV: 18Int: 11#..)## ##...#)................ SH: 16Dex: 15#.ß.# #.ß.)................. XL: 12 Next: 56% Place: Dungeon:12bgg$ *#...# #...#@................ Noise: ---------  Time: 14520.5 (0.0)bggU$ ##.##########.###..........#.. a) +4 long sword#..........#..####........... Throw: 22 darts (poison)########.......##............bgg$ #.......##.......>....#..................... ##.....................bgg$  ##...................[.. #.........<.............bgg$ { There is an open door, spattered with blood here. bgg$ _Items here: ( )))) [[ †. _Items here: ))) [[[ ÷ ††. bggK% _Partly explored, can't reach some items. _Partly explored, can't reach some items. _Partly explored, can't reach some items.bgg% bgg( bgg> bggoF bgg K $ _bggBL bggT bggZ ,bgg _ bggf bgg}p ,bggt bggw bgg_ bgg bgg bgg֘ B  You see here a +0 chain mail.bgg bgg  _bgg bgg bgg ,bgg bggf bgg ,bgg bggR bgg ,bgg bgg bgg bggP bgg bgg bgg bgg bgg bgg= bgg BbggH bggh ,bgg bgg bgg} bgg bgg bgg bgg Bbgg0 bgg bgg bgg0 bgg bgg ,bgg bgg bgg# bgg` bgg bgg# bgg! bggV! bggz" bgg&% bgg>( ,bgg) bggo, %  bgg, 4There is a stone staircase leading down here.bgg. bgg1 bgg 2 $ _bgg3 bgg23bgg2bgg4bgg 5bgg06bggM  #...... #...... #...... #...... #...... #......######  #...........#  #......@....# 41.2 (20.bgg~N7) #..............  #..............  #..............#......##+##...#...... ..#...>.. . #...... _You climb downwards.  Found a stone staircase leading down.bggObgg9UbggWa _There is a stone staircase leading up here.bggbgg]bggbggbggbggH: _bggbgggbggbggbggI ######## #......# #......# #......# #......#  #bggq+  ####### #...........#  #<....#  #.bgg #.............. #.............. #......##+##...bgg #......# ...#...>..#bgg#.bgg #####.................'......3.2 (2.0bgg/ )bgg1bgge======4.2 (3 _As you open the door, it creaks loudly!bggi bgg bgg bgg bggj bgg bgg bgg @  There is an open door here.bgg bgg K _bgg ,bggj bgg bgg ,bgg bgg bgg bgg bgg bgg bgg ,bggV bgg! bggB# bgg# bgg0$ bgg% bgg( ,bgg( bgg+ bgg:. bggz. bgg/ bgg1 bgg4 bggG4 bgg4 bgg6 bggw9 ,bggK: bgg7B XbggED bggE bggF bggF bgg....  ...... ........+bggM5........#...........bgg5.bgg=bggBL------8.2 (1bggCbgg[H~ _Found a stone staircase leading down. _There is an open door here.bgg~ _bgg,bggFbggbggbgg}bggbggbgg7bgg$7 _You open the door.bgg=<....#######...#######.. ......... #...##.......... #....'.....# .......... #....####### ##+##..... #....# h.# # ......####'# ..h## ....>....# #'### ........#...p÷# .......@'...$$#------ ........####### ..+.##hh 2 hogs (asleep)###p   human (asleep)bgg C 71.2 (3  2 hogs and a human come into view.bggDbggFbggU.hh..phhpbggyV5===2.2 (4bgg_bggoW _The human shouts! You hear a bellow! x2; The hog squeals angrily.bgg<....#...#..  #...##. bgg #....'.....#  #....####### ##+##..... #....#..Y..# bgg=# ......####'#.Yhh.# # ....>....###'### bggbj .#....÷# bgg...p$$# bgg>.# bgg .. ..+..#..# YY 2 yaks (wandering)bgg*.### hh 2 hogsbggJ~. p   humanbggbgge  2 yaks come into view.bgg,bgg.Yhp.bgg+3.2 (1bgg!bggi _The yak bellows! _There is an open door here.bgg`....#...#..  #...##.  #....'.....#  #....####### +##..... #....#.....#  ......####'#.YhY.# bggG ....>....###h### .#....÷# .'@p.$$# .bggp^# ... bggp.........+bggp.........#bggٕn.........# bgg.......### ....... bggDbggbgggl.Yhbgg/--4bggSbgg3 _You block the human's attack.bgg  You slash the hog!  The hog is heavily wounded.bggV=-5.1 (0.9bgg:'bgg'e _The hog misses you. You block the hog's attack.bgg  You hit the hog.  The hog is heavily wounded.bgg8 bggP Q.Ybgg 5-6.1 (1.0bgg{ bgg= _The human closely misses you. The hog closely misses you.bgg  You completely miss the hog.The hog is heavily wounded.bgg bggw bgg& hY.Ybgg' G-7.0 (0.9bgg2 bgg6 R _The human barely misses you.bggP  You slash the yak!  The yak is moderately wounded.bgg/]V'hbgg ^.=9bgg0hbggl3 _You block the human's attack.bgg8  You slice the yak!!bgg f  The yak is almost dead.bggCy.hY.bgg0=8.8bggbggi3 _You block the human's attack.bgg<....#...#... #...##.. #....'.....#. #....########+##..... #....#.....# # ......####'#.....# # ....>....###h### bgg x.#Y.h.÷# .@.pY$$# .# ... .........+ .........# .........# .......###bggo E .......bggobggbggbggbgg 'h.pYhbgg!6--9.8 (1.0bgg+bgg1t _You block the yak's attack. _There is an open door here.bggg~  You hit the yak.  The yak is almost dead.bggtB--80bgg bggAO _You block the human's attack. You block the yak's attack.bgg 7  You slash the yak!bgg bggz h.   yakYou kill the yak!bgg .81bgg bgg 3 _You block the human's attack.bggI 7  You slash the hog!bggVZ h.The hog is heavily wounded.bgg<[ 5=2.9 (1.1bggd bggl _You block the hog's attack. The human misses you. The hog closely misses you.bggk  You slash the hog!  The hog is severely wounded.bgg9l-3.8 (0.9bggqvbggzO _You block the human's attack. You block the hog's attack.bgg  You hit the hog.  The hog is almost dead.2---4.8 (1.0bggbggDb _The hog bites you but does no damage. The human hits you with a +0 hand axe.bgg@}  You hit the hog but do no damage.The hog is almost dead.bgg~G-5.7 (0.9bggbggn _The hog barely misses you. You block the human's attack.bgg  You barely miss the hog.The hog is almost dead.You block the hog's attack. You block the human's attack.bgg-6.7 (1.0bggbgg!1 _You block the hog's attack.bgg ~  You hit the hog.  The hog is almost dead.bggq _3=-7bggp bgg O _You block the human's attack. You block the hog's attack.bgg 7  You slash the hog!bggj bgg$ .   hogYou kill the hog!bgg_( .98bgg:2 bgg86 3 _You block the human's attack.bgg  You hit the hog.  The hog is heavily wounded.The hog closely misses you. The human hits you but does no damage.bgg-9.6 (0.9bgg?bggе1 _You block the hog's attack.bggL  You hit the hog.  The hog is heavily wounded.bggWJ=90.6 (1.0bggbgg&x _The human hits you with a +0 hand axe. The hog closely misses you.bgg2  You slash the hog!  The hog is almost dead.bgg5=1.5 (0.9bgg^bggO _You block the hog's attack. You block the human's attack.bgg7  You slash the hog!bgg\bggd Y.p   human  You kill the hog!bggdm89-60-2.5 (1.0bgg~bggѩ< _The human hits you with a +0 hand axe.bgg   You slash the yak!  The yak is moderately wounded.90-=3.4 (0.9bgg7 bggv n _You block the yak's attack. The human barely misses you.bggq  You hit the yak.  The yak is moderately wounded.bgg 5-4.4 (1.0bgg bgg g _The yak misses you. You block the human's attack.bgg  You slash the yak!  The yak is severely wounded.bgg.=5bgg(bggx _The yak closely misses you. The human hits you but does no damage.bgg5i  You slash the yak!  bgg#6AThe yak is almost dead.bgg6516.3 (0.9bggX?bggiBO _You block the yak's attack. You block the human's attack.bggZ  You hit the yak but do no damage.The yak is almost dead.-7.3 (1.0bggbggO _You block the yak's attack. You block the human's attack.bgg 7  You slash the yak!bgg †p   human  You kill the yak!bgg^22-8bgg-I _You block the human's attack.bggR  You are illuminated by a large divine halo.  You are glowing. Your movement speed is average.  Your attack delay is about 0.9 (and is slowed by your shield).bggrS bggY[ bgg5`  Your damage rating with your +4 long sword is about 19 (Base 10 x 112% (Dex) x _141% (Skill) + 4 (Ench)).bggbggbggbggPF _Unknown command.bgg  You slash the human!  The human is moderately wounded.bgg d86-=9.2 (0.9bgg ( bggn+ < _The human hits you with a +0 hand axe.bggY  You hit the human but do no damage.The human is moderately wounded.bggaZ 7-600.2 (1.0bgga bgge 3 _You block the human's attack.bggwr  You slash the human!  The human is heavily wounded.bgg"s\7--1bgg |bgg3 _You block the human's attack.bgg  You slash the human!=2.1 (0.9bggbgg#"Y _The human is almost dead.bgg]9  You slash the human!bggC)bgge 3-3.1 (1.0 _You kill the human!bgg bgg _Your Gell's gravitambourine (2/2) jingles faintly as it regains its power.bggy....#...#..  #...##.  #....'.....#  #....####### +##..... #....#.....#  ......####'#.....#  ....>....###'### .#†...÷# .bgg'@..$$# .# ... .........+.........#.........#.......###.......bgg'bgg(^8--4 _bgg-bgg5  Things that are here: _a +0 hand axe; a +0 animal skin; a human corpsebgg #...#..  #...##.  #....'.....#  #....# +##..... #....#.....# ......####'#.....# ....>....###'### .#†...÷# .')@.$$# bgg .# ......... .........+.........#....... bgg bggC G-5 _bgg bgg$ bgg #...#..  #...##.  #....'.....#  #....# ##..... #....#.....# ......####'#.....# bggy ....>....###'### .#†...÷# .').@$$# .# ......... .... bgg bgg &6bgg( bgg)+ bgg~bggH  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1  bgg         b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0  bgg(             f - Armour   8.0   9.0   0      g + Dodging9.4  10.5   0       h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1                          bggà                    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  bgg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsbgg bgg bgg ..#######...#######..deadiverson the Carver ..... #...##.......Human of the Shining One *****. ..... #....'.....#Health: 88/97 =====================--- ...... #....#######Magic: 12/12 ======================== ##..... #....#.....#AC: 20Str: 17......####'#.....#EV: 18Int: 11bgg (....>....###'###SH: 16Dex: 15........#†...÷#XL: 12 Next: 63% Place: Dungeon:13........').@$$#Noise: ---------  Time: 14606.1 (0.0)........#######a) +4 long sword.........Throw: 22 darts (poison).........+.........#.........#.......###....... _The human is almost dead.You slash the human! _You kill the human! _Your Gell's gravitambourine (2/2) jingles faintly as it regains its power.  Things that are here: _a +0 hand axe; a +0 animal skin; a human corpsebgg bggD bgg bgg bgg0F #...#..  #...##.  #....'.....#  #....# ..... #....#.....#  ......####'#.....# bggF c....>....###'### .#†...÷# .')..@$# .# ......... bggF bggO bggQP 59=bgg}P $7.1 (1bggV bggJ` A8.1 (2bggd bggi ? _You now have 640 gold pieces (gained 10).bggX .#...#..  #...##.  #....'.....#  #....# ..... #....#.....# ......####'#.....# ....>....###'### .#†...÷# .')...@# .# . bgg bgg6 +9.1 (1bggq bgg! bggR e90=10.1 (2bgg U _You now have 662 gold pieces (gained 22).bggBIbgg,bggg1bggd,bggbgg,bggbggWbgg%2bggbggPbggbggJbggubggbggtbggbggK3=bggmbggnbgg{bggμbggU4=bggbggڿ,bggbggo,bggKbgg~bgg%5bggbgg,bggKbgg;6bggbgg,bggbggH,bggbggbggk57=bggbggbggz _HP restored.bgg=bgg.bgg\   Things that are here:  a +0 hand axe; a +0 animal skin; a human corpsebggbgg> _bgg{bgg6V  There is an open door, spattered with blood here.bgg=bgg _bgg3bggbggH ,bggS!bggg&bgg)bgg?)bggS*bgg.7 _You open the door.bggB8......... #....####### ##+##......#....#.....# # ......####'#.....# # ....>....###'### bgg8........#†...÷# ........')....# ........####### bgg9.........#...# ........@'...# .........#...... .........######. .......### ....... .......c   centaur warrior (asleep) ...... .c...bggF0377.0)bggrG,8.1 (28bggObggab _A centaur warrior comes into view.bgg4   ..#.... # ......####' # ....>....  ........#†...÷#  ........')....#  ........#######  bgg֣ b.........#...#  ........@'...#  .........#......  .........######.  .......### ....... ....... ...... .c...bgga< s  ..#....  ......####'  ....>....  ........#†...÷#  ........')....#  ........#######  bgg= Q.........#...#  ........@'...#  .........#......  .........######.  .......### ....... ....... ..... .c... bggF 4bggTL bggNN f _A centaur warrior is nearby!bggKf h  ..#.... # ......####' # ....>....  ........#†...÷#  ........')....#  ........#######  .........#...#  ........@'...#  bgg!g .........#......  .........######.  .......### ....... ....... ...... .c...bgg  ..#....  ......####'  ....>....  ........#†...÷#  ........')....#  ........#######  .........#...#  ........@'...#  bgg`.........#......  .........######.  .......### ....... ....... ..... bggB.c... bggl bgg bggjbggf _A centaur warrior is nearby!bggǵ  (((((c(You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggeA bggU | .....(launcher)c(The centaur warrior shouts!  The centaur warrior wields a +0 shortbow.(((((((bgg .@.....==9.3 (1.2)1bgg bggW w _The centaur warrior shoots an arrow. The arrow barely misses you.bggP (((((You throw a poisoned dart.bgg# bgg3 v....c.(bgg g--40.4 (1.10bgg bgg A _The poisoned dart hits the centaur warrior.bgg \ (((bgg(, poisoned)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggr#S....bgg'+ ((((The centaur warrior is poisoned. The centaur warrior shoots an arrow.bgg>bggV[...c.bgg̺=-1.519bgg:bgg* _You block the arrow.bgg (((You throw a poisoned dart.bgg ...The poisoned dart hits the centaur warrior.bggDS(((bgg&{...=2.6bgg'08bggG1bgg5O _The centaur warrior shoots an arrow. You block the arrow.bgg{ (((very poiso…)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggK...bggB (((The centaur warrior looks even sicker. The centaur warrior shoots an arrow.bggܧK...bggBS(((bgg5:K...bgg;Z82----3.7bggR;07bgg%EbggHc _You block the arrow. The centaur warrior shoots an arrow. The arrow hits you!bggjM((( _You block the arrow. The centaur warrior shoots an arrow. The arrow hits you!  You throw a poisoned dart.  The poisoned dart hits the centaur warrior.  The centaur warrior looks even sicker.bggC .bggM..The centaur warrior is lightly wounded.bgg@S(((bgg+AK...bggGB1----4.86bggLbggION _The centaur warrior shoots an arrow. The arrow hits you.bgg (((extremely The centaur warrior is lightly wounded. _The centaur warrior shoots an arrow. The arrow hits you.  You throw a poisoned dart.  The poisoned dart hits the centaur warrior.  The centaur warrior looks as sick as possible!bgg=W ...The centaur warrior is lightly wounded.bgg] Z((((bgg bggB ~@..c(bgg `25.95bgg bgg2 p _The centaur warrior shoots an arrow. The arrow misses you.bgg۴ ##+##......#....#.....# .# ......####'#.....# .# ....>....###'### . ........#†...÷# .')....# .####### ...#...# ..'...# .#...... .######. .....c.###  ....(.. ....... ...(......bgg .....bgg! bgg K(((bggG bggQ s.@c..bggR :3=60bgg!Z bgg)] w _The centaur warrior shoots an arrow. The arrow barely misses you.bggEextremely poisoned) _The centaur warrior shoots an arrow. The arrow misses you. _The centaur warrior shoots an arrow. The arrow barely misses you.You hit the centaur warrior.  unwields a +0 shortbow.  You block the centaur warrior's attack.bgg/--7bgg bgg ` _The centaur warrior completely misses you.bggX verYou hit the centaur warrior.  The centaur warrior is lightly wounded.bggD84--bgg&8.8 (0.9bggbgg _The centaur warrior closely misses you. You block the centaur warrior's attack.bgg,) is lightly wounded. _The centaur warrior closely misses you. You block the centaur warrior's attack. You slash the centaur warrior!  bgg)The centaur warrior is moderately wounded.You block the centaur warrior's attack  ompletely misses you.bgg*=3=9.8 (1.0bgg3bgg6[ _The centaur warrior hits you. You block the centaur warrior's attack.bggʋ  You slash the centaur warrior!  The centaur warrior is heavily wounded.bgg6=50.7 (0.9bggLbgg bgg=R_The centaur warrior misses you. x2bggO   You hit the centaur warrior.  The centaur warrior is severely wounded.4--1.7 (1.0bgg bgg _You block the centaur warrior's attack. The centaur warrior barely misses you.bggS bggaT  bggT BThe centaur warrior is severely wounded. bggT u_You block the centaur warrior's attack. The centaur warrior barely misses you. bgg5U ? You slash the centaur warrior!  bggwU >The centaur warrior is almost dead.bggU tYou block the centaur warrior's attack. The centaur warrior barely misses you. bggV  bgg7V bggX bggY )=-bggY &2.6 (0.9bggb bggf G _The centaur warrior kicks you but does no damage.bgg  You slash the centaur warrior!  The centaur warrior is almost dead.bggu-3.6 (1.0bggbgg@ _You block the centaur warrior's attack. x2bgg/C  You slash the centaur warrior!bggW:D)bggF@e5=70-4bgg8HbggrJS _You kill the centaur warrior!bgg@.# ......####'#.....# ..# ....>....###'### .. .........#†...÷# .')....#.#######..#...#.'...#.#.......######...### (..+ ....#(...#.#......#######bggIbgg*J|92==--bggkJ5bggbQbggUQ _You see here a +0 shortbow.bgg% bgg& bgg( bggG- bgg1 3== _bgg3 bgg3 bgg5 bgg9 ,bgg: bgg/> bgg> U4=bgg@ bggC ,bggE bgggH bggH bgggJ bggM bggQM %5bggN bggR ,bgg T bggZ ,bggk 6bggl ,bggn bggq bggq D7=bggt bggw bggj >..# ....>....###'###.......#†...÷# .')....#.#######..#....'...#.#......)..######.### -683.0)(..+ ....#(...#....#<........#######.bgg bgg ,9.6 (14bggʔ bgg 9 _Found a stone staircase leading up.bgg 3bgg bgg bgg bgg{ bgg bgg bgg7 bggg bgg o _f - 18 poisoned darts (gained 3)bggh O=bgg bgg bgg ,bgg bgg bggi bgg bggo _f - 19 poisoned darts (gained 1)bgg3bggbgg ,bgg bggo _f - 20 poisoned darts (gained 1)bgg3bggbggcbgg,bggPbgg'bggbgg. bgg bggd#bgg)&,bgg1'bgg[*7 _You open the door.bgg'-bggr-bgg\.bgg0bgg2bggJ2bgg3bgg8@  There is an open door here.bgg]:bgg: _bgg;bgg{=bgg?,bgg?bggAbggC,bggDbgg GbggH,bggIbggKbggNbggNbgg!ObggTbggV,bggWbggYbgg[,bgg\bgg5^bggi`,bggabggbbggd,bggebggjgbgg i,bggibgg)p #.........+.....#  #.........#.....#  #.........#.....#  #.........#.....# ##<........#.....# bggp......######.....# ......#..........# ......'..........# ......#.........@+ ......#....# ......#..# bggp20 ......#.....# ......#..bggp....# #############+#### bggqbggxh#+##...........'......92.6 (23...........bgg#y,......c..c   centaur warrior (asleep).bgg+/ cclauncher)As you open the door, it creaks loudly!  A centaur warrior comes into view.The centaur warrior shouts! You hear a shout! x2bgg ((((((The centaur warrior wields a +0 orcbow. The centaur warrior shoots an arrow.bggd'.....bggM======3.6 (24bgg&bgg-8* _You block the arrow.bgg8 .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... ........#...... ........# ..... ........# .... ........# ..c ####+#### ..  . bgg .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... bgg........#...... ........# ..... ........# ............# ..c####+#### ..  . bggbggbggbggf _A centaur warrior is nearby!bggΠ .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... ........#...... ........# ..... ........# .... bggn........# ..c ####+#### ..  . bgg: .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... bgg,;........#...... ........# ..... ........# ............# ..c####+#### ..  . bggDbggEbggAMbgg|Qf _A centaur warrior is nearby!bgg[a8 .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... ........#...... ........# ..... ........# .... ........# ..c ####+#### ..  . bgg .  ....#.....#  ....#.....#  #.........#.....#<........#.....#.######.....# #+## .#..........# ..... .'..........#...... .......@'...... ........#...... ........# ..... bgg........# ............# ..c####+#### ..  . bggbggbggbgg f _A centaur warrior is nearby!bgg6 ((((((You throw a poisoned dart.bgg( '.....The poisoned dart hits the centaur warrior.bgg V((((((bgg$ bgg. ~'.....c(bgg. =-----4.7 (1.1)19bgg04 bgg(8 O _The centaur warrior shoots an arrow. You block the arrow.bggj (((((, poisoned)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bgg bgg} D '...c.c   centaur  The centaur warrior is poisoned.  A centaur comes into view.bgg, U(((((bgg '....(launcher)  The centaur warrior shoots an arrow. The arrow hits you!!bggJ (((The centaur wields a +0 shortbow. The centaur shoots an arrow.bggC)\'..bgg*70-------==---5.88bggI3bggBbggN/  --more--bgg,* _The arrow hits you!bggc  ...#.. ##<.... ......#######+##bgg .#............'.......#..........'...@#...... ..... c....c...bgg͐ bgg; '---bgg 60bggy bgg bggo6u ##< ......#######+##...........'.....#'......#......  cbgg6] .c(bggB@bggAB---7bggbggbggbggĪbggbgg=bgg1-------cc   centaur (launcher)bgg&0bggrB(bggQ:.bggR'===bggR8.8 (1bggZbggE^r _You start resting. The centaur shoots an arrow. You block the arrow.bggy  #. ##<........ ##### ##+###.....'#......bgg] cc..c.....c... ......#..........# .c( bgg#############+#### ..c   centaur warrior (launcher, poisoned)bggWcc 2 centaurs (1 launcher, 1 wandering)bggKA centaur comes into view.bgg<Wc')  The centaur shouts!bggB(bggVjbggn'c...   centaur (  The centaur warrior shoots an arrow. You block the arrow.bggwo&9bggEwbggiy, _The centaur moves out of view.bgghs   You completely miss the centaur. The centaur unwields a +0 shortbow.bggz (You block the centaur's attack. x2; The centaur warrior shoots an arrow.bgg bgg; bgg& &'bgg7 B(bgg0 '  The arrow hits you! The centaur warrior shoots an arrow. You block the arrow.58---700.9 (1.1bggح  _The centaur barely misses you. The centaur misses you.bggr bggM (((((((You hit the centaur but do no damage. The centaur warrior shoots an arrow.bggV bgg^ c.@....c 2 centaursbgg_ e9---1.8 (0.9bggh bggFm u _The arrow barely misses you. You block the centaur's attack. x2bgg?  You slash the centaur!  The centaur is heavily wounded.bggP@bggCl  The centaur warrior looks more healthy. You block the centaur's attack.bgg N& c.)   centaur  The centaur completely misses you. The centaur closely misses you.bggN5-2.8 (1.0bgg$VbggY5 _You block the centaur's attack.bgg;  You slash the centaur!bggbggbggېc'.c bggG-3.7 (0.9bggnbgguK _You kill the centaur!bgg:>  You slash the centaur warrior!  The centaur warrior is moderately wounded.The centaur warrior unwields a +0 orcbow.bggD }.  bggE -4.7 (1.0bggK bggO \ _You block the centaur warrior's attack. The centaur warrior kicks you.bgg  You barely miss the centaur warrior.The centaur warrior is moderately wounded.bgg cc   centaur (launcher)  You block the centaur warrior's attack. x2; The centaur wields a +0 orcbow.bgg< C((bgg '.The centaur shoots an arrow. The arrow hits you but does no damage.  The centaur warrior hits you but does no damage.5bgg bggι G _The centaur warrior kicks you but does no damage.bgg  You hit the centaur warrior.  The centaur warrior is moderately wounded.The centaur warrior hits you but does no damage.bgg ((The centaur warrior misses you. The centaur shoots an arrow.bggQ'.bggS$60bggr6bggn#bgg%* _You block the arrow.bgg5  You slash the centaur warrior!  The centaur warrior is heavily wounded.bgg> (((((((You block the centaur warrior's attack. x2; The centaur shoots an arrow.bgg  '...@..The arrow closely misses you. The centaur warrior closely misses you.bggN ((You block the centaur warrior's attack. The centaur shoots an arrow.bgg^Q'.bggQ_d56-7.6 (0.9bggfbggj) _The arrow hits you.bggR&  bggYou hit the centaur warrior but do no damage.The centaur warrior is heavily wounded.The centaur warrior hits you but does no damage.bgg ((The centaur warrior closely misses you. The centaur shoots an arrow.bggQ'.bggH1--bgg!8.5bggbgg) _The arrow hits you.bgg  You hit the centaur warrior.  The centaur warrior is heavily wounded.bgg (((((((You block the centaur warrior's attack. x2; The centaur shoots an arrow.bggT '...@..The arrow completely misses you. The centaur warrior misses you.bggU^2-9.4bgg^bggb= _You block the centaur warrior's attack.bggs  You slash the centaur warrior!  The centaur warrior is severely wounded.bgg| C((bgg  '.The centaur shoots an arrow. The arrow hits you but does no damage.  The centaur warrior hits you but does no damage.  The centaur warrior kicks you but does no damage.bgg C((bgg) Q'.bgg .10.4 (1.0bggݛ bgg G _The centaur shoots an arrow. You block the arrow.bgg-v  The centaur warrior hits you but does no damage.  The centaur warrior kicks you but does no damage. _The centaur shoots an arrow. You block the arrow.  You slash the centaur warrior!  The centaur warrior is almost dead.  warrior hits you. You block the centaur warrior's attack.bggt} W(((((((bgg  '...@..The centaur shoots an arrow. The arrow completely misses you.You block the centaur warrior's attack.bgg ]46-1bggbggG _The centaur warrior kicks you but does no damage.bgg  You slash the centaur warrior!  The centaur warrior is almost dead.bgg C((bgg; '.The centaur shoots an arrow. The arrow hits you.bgg ((You block the centaur warrior's attack. x2; The centaur shoots an arrow.bgg!NQ'.bggNg3--2bggXbgg[* _You block the arrow.bgg^C  You slash the centaur warrior!bgg1 )c   centaur (launcher)  You kill the centaur warrior!bggiC((bggGQ'.bggnQo 63 _The centaur shoots an arrow. You block the arrow.bggYbgg=ci _Your Dodging skill increases to level 10!bgg³+  #. ##<........ ##### ##+###.'.#..'.c..........bggŴ......... ......#..........# .(( #############+#### ...bggVbgg:((bggUH'.bgg\ ((The centaur shoots an arrow. You block the arrow. The centaur shoots an arrow.bggKQ'.bggZ2-4bggbgg _The arrow hits you.  Things that are here: _a +0 orcbow; a +0 shortbow; a centaur corpsebgg ;#.+.....# #.#.....# #.#.....# #.#.....# <.#.....# ######.....####+##.#..'.#.#.)@.c.#.#.#.#..#.#...#.#....((#+####......+......#......#bggu bggO 8(bgg 0.bgg f50===5bgg bgg _The centaur shoots an arrow. You block the arrow. _There is an open door here.bgg9b.+.....# .#.....# .#.....# .#.....# <.#.....# ######.....####+##..#.'.bgg9t#.#.)'@c.#.#.#..#.#...#.#....#....((#++####......+ ..bggG(bgg]Hq3===--6bgg QbggTZ _The centaur unwields a +0 orcbow. You block the centaur's attack. x2bggI  You slice the centaur!!  The centaur is severely wounded.The centaur closely misses you. You block the centaur's attack. x2==7.3 (0.9bggbggM _The centaur misses you.bgg\;  You slash the centaur!bggdC)bggil4=7--8.3 (1.0bggobggsK _You kill the centaur!bggdt+.....# #.....# #.....# #.....# .#.....# ######.....####+##.bgg ..#.'.#.#.)'.@.#.#.#...#.#..........#.#..........#....((#+## bggbggP---9bgg bgg#O _You see here a +0 orcbow.bgg8 .+.....#.#.....#.#.....#.#.....# <.#.....#.######.....####+#####.#...#..'.#..#.)'@)..#.#..#...#..#..........#.bgg6 .#..........#....((#+###+####......+  .#  .#bgg| ^-20 _bggj" bgg% bgg% 3#.+.....# #.#.....# #.#.....# #.#.....# #<.#.....#.######.....####+#####.#..#..'.#..#.)@.)..#.#..#..#..#...#...#....#....((#+##+####......+ .......# .......#bgg bggɋ B51bggf bgg6 Q _There is an open door here.bgg #.+.....#  #.#.....#  #.#.....#  #.#.....##<.#.....#.######.....####+#####.#.#...'.#bgg..#.@'.)..#.#..#.#...#.#......#.#....((#+##+####......+ .......# .......#bggbggbgg-2 _bggbggg  Things that are here: _a +0 orcbow; a +0 shortbow; a centaur corpsebgg9bggbggbggbggcO6bggbggbggbggbgg/bggbggbgg5S7=bggEbggU,bggbggbggIbggbgg bggr K8=bgg bggZ)m9bgg.P60bgg/bggf2bgg2bgg44bgg8bggB9S1=bgg;bgg=,bggAbggCbggDbggEbggdIbggIK2=bgg5Kbgg{ObggObggCQbggfT,bggUbggZbggZ93bggt^bgga,bggcbggJi,bgglbggobgg;p94bggrbggLwbggwbgg$ybgg{bgg+|S5=bgg~bgg,bggăbgg,bggbggbggČ56=bggbggbggLbggbgg bggbgg6bggbgg(bggs97bgg!bggbgg)bggШbggbgg\bggbgg bggܵ98bgg$bgg,bggbgg[Bbgg_bgg&69bgg(=bggbggbggbggbggn70=bgg(bggbgg$bgg5bgg?,bggbggDbgg%1bgg"bggbggLbggbggZ,bggbggpbgg%2bggbggXbggbgg bgg^bggbgg]bggbggWbgg{D3=bgg7bgg_,bgg- bggg94bgg2=bggbgglbggbgg,bggbggbggbggbbgg%5bgg"bgg(bggN(bgg*bgg-bgg(.bgg0bgg4;6bgg%6bgg9,bgg;bgg ?,bgg@bggDbggnDK7=bggEbggI,bggKbggN,bggQbggUk8=bgg[Zbgg^,bgg[abgge;9bgghbgg\j,bggkbggVp,bggqbgg9u<80bggvbggzbggU{bgg|bgg,bggbgg.bggqK1=bggHbgg,bggbggk,bggbggk2=bggbgg,bggwbgg]bgg%3bgg:bggbggEbggbgg ,bggӬbggbgg%4bgg}bgg,bggbgg߿Bbgg{bggK5=bggbgg,bggBbggbggbggP#6bggw2=bgggbggBbgg,bggbgg:bgg%7bggvbgg,bgg9bggbgg%8bggbgg,bggbgg,bggbggbggK9=bggbgg; ,bgg bgg,bggbggl90=bggFbggA,bgg#bgg',bgg)*bgg.bgg.%1bggA0bgg3,bgg5bgg9bggF9%2bgg;bgg+>,bgg?bggD,bggHa3=bggHbggJbggN,bgg PbggkS,bggUbgg6YbgguYU4=bgg[bgg_bgg_bgg~bbggf,bggwbggzbggh{%5bggs}bggbggނbggbggQ,bggbggbggP%6bggbgg,bgg9 _You start resting.83614.0)7=75 _HP restored.bgg5bgg#6bgge9bggCbgg:HbggL,bgg&Q@  There is an open door here.bggUbgg>V _bgg`Xbgg[bgg aBbggebggq@.......#.....# .......#.....# ..######.....####+#####. ..#....#.......... ..'..#..........#.........)'.)........ #..........#.......... #..........#.... #..........#..@....... 40.3 (3bgg>r.0)#..........#....((#+## #########+####......+  ........# ...# ...........#...........#........[..#bgg}bgg~G=1.3 (4bggׄbggƇ) _Found a scale mail.bgg 3bgg bggq bgg ,bggH bgg bgg\ ,bgg bggi ,bgg bgg o _f - 19 poisoned darts (gained 1)bgg 3bgg bgg ,bgg bgg* W #.....# #####.....####+#####............#.............#....bggf* h)'.)..#......#.....#......bgg* i#.....@#+## ######+####......+  ..........# 20bgg* 8...................[..##+########bgg1+ s# _f - 20 poisoned darts (gained 1)bgg4 86.3 (5'.......................#####bggs< bggE= L======7.3 (6bggG bggJ = _As you open the door, it creaks loudly!bgg bgg bgg" bgg bgg bgg ,bgg޶ %  bgg There is an open door here.bggȹ bgg  _bgg bgg[ bggf bgg bggZ bgg bgga bgg bgg bgg bgg ,bgga bggY bgg< bgg bgg4 bgg bgg bgg bggw bgg bggp ####+#####.... ...#................... #...........c bgg )'.)............... #................ #.........# #.........# #......#+#####'## ####......'.....@..# bgg G------ ..........#........# ..........#..# ..........#bggA .## ..........######### .......[..# bgg c   centaur warrior (asleep) #+######### bgg F 54.3 (7  You open the door.bggd J------5.3 (8bgg  bggo b _A centaur warrior comes into view.bgg3...... ....c ).... ... ..# ..# .#+#####'## .'.....@..# .#........# #........# #.......## #########[..#bggdJ...... ....c ).... ... ..# ..# .#+#####'## bggd^.'.....@..# .#........# #........# #.......###########[..# bggkbgglbgg1sbggvf _A centaur warrior is nearby!bggTW...... ....c ).... ... ..# ..# .#+#####'## .'.....@..# .#........# #........# #.......## #########[..#bgg...... ....c ).... ... ..# ..# .#+#####'## .'.....@..# .#........# #........# #.......###########[..# bggRbggbggbggf _A centaur warrior is nearby!bggQW (((bggR((cYou throw a poisoned dart.  The poisoned dart hits the centaur warrior.bgga c....'(launcher)The centaur warrior shouts!bggQV (((bgg((((The centaur warrior wields a +0 orcbow. The centaur warrior shoots an arrow.bggu....'@.bggwg==6.5 (1.219bgg~bggV _The arrow completely misses you.bggo (((((, poisoned)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggU....'bgg- (((((The centaur warrior is poisoned. The centaur warrior shoots an arrow.bggTU....'bgg](((((bgg U....'bggy!75------=7.6 (1.18bgg)bgg,d _The arrow hits you!! The centaur warrior shoots an arrow. You block the arrow.bgg (((((very poiso…)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggmU....'bgg3u (((((The centaur warrior looks even sicker. The centaur warrior shoots an arrow.bggU....'bgg](((((bgg....'4--------8.7bggO07bggңbgg}c _The arrow hits you. The centaur warrior shoots an arrow. You block the arrow.bggH (((((You throw a poisoned dart.bggbgg' (c...'  The poisoned dart hits the centaur warrior.bggl(((((((bggj...'@..bggl5--9.86bggpsbggw{ _The centaur warrior shoots an arrow. The arrow completely misses you.bgg _ ((((bgg bYou throw a poisoned dart.  The poisoned dart hits the centaur warrior.bggK N...'bggaR V (((bgg3S i(The centaur warrior looks even sicker. The centaur warrior shoots an arrow.bgge N...'bgg` Y60.95bgg` @ _You block the arrow.bgg; I (bgg= Y((((((You throw a poisoned dart.bgg [ .c...bgg r'  The poisoned dart barely misses the centaur warrior.bgg V((((bggz bgg g(...'bggJ bggń X2.04bgg bggߍ a _The centaur warrior shoots an arrow. The arrow hits you but does no damage.bggbggvbggbggH _No target in view!bggbggrbggCbggH _No target in view!bggu4bggzbgg|H _No target in view!bgg&*#####+#####..........#.................(.#..............)'.)..............(#................ #...............# #...............# ..#......#+#####@## ###'........# #.# bgg&=#.##.........######### ......[..# +#########bgg)bggg+bgg:>Dcc   centaur warrior (launcher, very poiso…)D   acid dragon (wandering)bgg;bggH<<6-30bggEbggK _An acid dragon comes into view. _There is an open door here.bgg=# # #..####+#####.D#.(.#... )'.)(#.c #.# #........@# bggU?~.#......#+#####'## ##'........# #........##..##.......##..######### .....[..# #########bggVbgg^;(bggbgg' D..The centaur warrior shoots an arrow. You block the arrow.bgg?n(((((((bggچ.@'....bggY`82=====4bggȓbgg'x _The centaur warrior shoots an arrow. The arrow closely misses you.bgg ####.####### D.$###+#####......... .#...(.... )'.)bgg =.(.....c............... .#+#####'## ##'........................##...######### .....[..bgg\  Found 15 gold pieces.  The acid dragon roars!  The centaur warrior unwields a +0 orcbow.bggv ,.Dvery poisoned)D90====-bggM 5bggM bgg# \ _You block the centaur warrior's attack. The centaur warrior kicks you.bggf  You slash the centaur warrior!  The centaur warrior is heavily wounded.bggs .D You block the centaur warrior's attack. x3bggt @-6bggp~ bgg G _The centaur warrior kicks you but does no damage.bggC  You slash the centaur warrior!bgg .D The centaur warrior is severely wounded.You block the centaur warrior's attack.bgg}&7bggbbggG _The centaur warrior kicks you but does no damage.bgg^  You hit the centaur warrior.  The centaur warrior is severely wounded.bggk (DYou block the centaur warrior's attack. The centaur warrior kicks you.bggkh89==-8bggTubgg\x _You block the centaur warrior's attack. The centaur warrior barely misses you.bggZ  You slice the centaur warrior!!bgg(DD   acid dragonbgg783=9bggqbgg%S _You kill the centaur warrior!bggw%n  You hit the acid dragon but do no damage.bgg4&/-70bggl+bggb0| _The acid dragon barely misses you. You block the acid dragon's attack.bggK (catching breath)You hit the acid dragon.  The acid dragon is lightly wounded.bgg q  The acid dragon spits acid at you.bgg3n bgg;o 72-----16 ======9 (0.9+0 long swordCorr (-4) bggz bgg~ t _The splash of acid hits you!! The acid corrodes you!bgg  You slash the acid dragon!  The acid dragon is heavily wounded.bggփd=-----1.9 (1.0bggcbgg< _You block the acid dragon's attack. x2bggW  You hit the acid dragon.  The acid dragon is heavily wounded.bggD-----2bggbgg/< _You block the acid dragon's attack. x2bgge hit the acid dragon.  The acid dragon is severely wounded.  bgg?b3=----3bggbggiC _The acid dragon claws you but does no damage.bggv You hit the acid dragon but do no damage.The acid dragon is severely wounded.bggnw&4bggbggO| _The acid dragon barely misses you. You block the acid dragon's attack.bgg ( bgg6  You slash the acid dragon!  The acid dragon is almost dead.bggD -5.8 (0.9bggY  _You block the acid dragon's attack. The acid dragon closely misses you.bgg ?  You slash the acid dragon!bgg# C)bgg m4=56.8 (1.0bgg1 bggg O _You kill the acid dragon!bgg@# # '. #. # #.####.######## # #.$ ####+#####bggAz. #.(. #... '.)( #........ #.######## #.........# ......#+#####'## #'........##........##........##.......#..#########bggMKbggK]80=-7bggiSbgg_  Things that are here: _a +0 orcbow; a centaur corpsebggG W+.  '. #.  #.####.######### #.$##+#####. .(. ... .) .bgg)........ .######### .........# ......#+#####'##'..# W   Gzone5's ghost (dormant)#........##........##.......bgg  Found a scroll of blinking. Found a runed translucent door.bggE?bggu3==-8bggbgg  _Gzone5's ghost turns its malevolent gaze towards you.bggC!^9.8 (25bgg/(bgg,,` _f - 15 poisoned darts (gained 1)bgg♣)#  ?+. '. #. #.####.######### #.$ ##+#####.(......#.# ).+)........##########........##+#####'##'........##........##.#bgg%)bggYd4=80.8 (1bggbgg ) _Found the +8 Vampire's Tooth {megavamp}.bggƺ5=1.8 (29bggFbgg` _f - 19 poisoned darts (gained 4)bggk7)M.## #♣)#  ß?+.'. W#. ####.######### $ ##+#####.. .# ).+)........ ..............##########W   Gzone5's ghost....bggEA)bggFc7=2.8 (1bggEObggb: _Found 20 gold pieces.bggc_3.8 (220bggLmbggq` _f - 20 poisoned darts (gained 1)bggk& 4bgg( bggK/ bggE3 <8bgg`8 bgg8 920 bggh; bggC _You are no longer corroded.bgg#F bggfK bggK K9=bggrN bggT ,bggOW bgg\ ,bggH_ bgge bgge O90=bggnh bgg}m ,bggyo bgg} Q1bgge ,bgg bgg ,bgg bgg bgg %2bgg bgg+ ,bgg6 bgg ,bgg bgg~ bggڵ D3=bgg bgg ,bgg bgg ,bgg bgg k4=bgg bgg ,bggT bgg ;5bgg bggc ,bgg bgg ,bgg bgg;6bggbgg ,bgg bgg|,bgg@bggbggK7=bgglbgg"bgg*,bgg,bgg4 _Gzone5's ghost whispers, "You will understand me better in a moment."bgg,:3bgg=bggo@bggD,bggBFbggHbggFKbggK9=bggLbggR,bggSbggW bggXH_You now have 677 gold pieces (gained 15).bgg[3bgg`,bggm .....# ...[.+## .....##♣)# .....#ß?+. .....#  '. W#. .....#  #.####.#########.....#  #....+ 915.8 (32.0) ##.# bgg|n+4 long sword ..###### ...+)........#...##########...# +#####'##bggwbggMx,6.8 (33bgg~bgg) _Found a chain mail.bggF%3bgg.bgg?4bgg7bgg2=Bbgg@BbggGbggJ,bggKbggO7 _You open the door.bggtR3bggSbggiX@  There is an open door here.bggi[bgg[ _bgg&]bgg_bgg6b,bggcbgg=fbggn  ).  ...  ##+###...  .......#........ bggo .......#........  .......#.....#   .......#...[.+  bgg9o ## .......#@....#  22.8 (6bggfo .0) bgg8p #♣)# .......#.....#   ß?+. .......#.....#  '. W#. .......'.....# #.####.#########.....# #.............+   #.............#  ........######   ................#  bggyA3.8 (7bgg}&)bgg7& _Found a war axe.bgg,bgg,bgg-bgg13bgg7,bgg<bgg@bggA,bggDbggGbggKbggKbggMbgg Qbgg~WbggWbggYbggJ]bggabggbbgggbggxn     ######   #.)....#   +#   ##+##bgg o.#  .......#...........#  .......#.....@.....#   .......#.....#+#####  .......#...[.+  bggo .......#.....#  # .......#.....#  +. #.....#   .'.....#  #.#########.....#  +bggo# bggowL8.8 (5'.......#....#....#....#....#bgghbggAL======9.8 (6bggbgg#= _As you open the door, it creaks loudly!bggoBbggBbggEbggJbggHTbggX,bgg6\@  There is an open door here.bgg`bggb _bgg&cbggibggkbgglbggmbggs bggt: There is an open door here.bggybgg(z _bggt|bggbggbggwbggbgg"bggGbggbggbggXbgg$ bgg_You open the door.bgg.3bggbgg@  There is an open door here.bggbgg _bgg6bgg׬bggvbggbgg8bggPbggbgg3bgg¿bgg}bggbggbggbggbgge.... ..... bgg)... ....# . ..... #...##....# ..... #..... ...# ...... #...# ....# ......##...##....#  ......#  bgg.......@.........# ------41.8 (12.0) bgg......##.........#  bgg ########...########  bgg2........#.)....#  ........'......# bgg ....##+###......#  .......#...........#  bgg.......#...........#  #.....#'##### bggbggK------2.8 (13bggqbgg$ _Found a sling.bgg bgg bgg} bgg bgg bgg Bbgg6 ,bgg bgg bgg bgga bgg9 bgg bgg bgg4 bgg̴ bggԷ bgg bgg& bgg^ bgg bggt ,bgg bgg; bgg   #.....#  ........#.....+  ........#.....#  #.......#..... .B  #.).....#....# ...  bgg -#.......##...##....#  #.......###  #.......##.@.# ....#  '.......##...##....#  #..................#  #..................#  #.......##.........#  ##########...########   B   entropy weaver (asleep)bgg v ........#.)....#   ........'......#   ....##+###......# bgg . bggu 18.8 (6.0)bgg +9.8 (7bgg bgg b _An entropy weaver comes into view.bggD,A #.....#  #.....+  #.....#  #..... .B  ....# ...  #...##....#  #.........#  bgg,#.@.# ....#  .##...#  ............#  .............#  #.......##.........#  ##########...########  ........#.)....#  bgg,G........'   bgg #.....#  #.....+  #.....#  #..... .B  ....# ...  #...##....#  bgg#.........#  #.@.# ....#  .##...#bgg6  ............#  bgg\.............#  bgg#.......##.........#  bggņW##########...########  ........#.)....#  ........'  bgg bgg5bggbgg$bggf _An entropy weaver is nearby!bgg #.....#  #.....+  #.....#  #..... .B  ....# ...  #...##....#  #.........#  #.@.# ....#  .##...#  ............#  .............#  #.......##.........#  ##########...########  ........#.)....#  ........'   bgg. #.....#  #.....+  #.....#  #..... .B  bgg....# ...  #...##....#  #.........#  #.@.# ....#  .##...#  bgg ............#  .............#  #.......##.........#  bgg6R##########...########  ........#.)....#  ........' bgg[  bgg bggǽbggbggjf _An entropy weaver is nearby!bgg/' #######   #.....#  .#.....+  ..#.....#  #.......#..... .B#  #.).....#....# ...#  #.##...##....#  #.##..@......#  #.##...##....#  '.##...##....#  #..................#  #..................#  #.......##.........#  bgg'##########...########   ........#.)....#   ....'......#   bgg-bgg-350.8 (1 _bgg2bgg5bggu0M##### #+.# .. .B#).....#....# ...###....#..##..'.......##...##....#  .....# .......######.......#bgg8bgg9&1bgg?bggxAbgg-M##### #+.# ..# .B).....#...@# ##...##....#......#bggJ#.......##...##....#  ...#..# .#.##.........#####...##bggbgg&2bggbggbggn     #######   #.....#  .#.....+  ..#.....#  #.......#.B#  #.).....#....## ...#  #.##...##....#  #.##.........#  #.##...##....#  '.##...##....#  #.......#  #...........#  #.......##.........#  bgg bgg> &3bgg bggbggbgg bgg]bgg bggEbgg,bgg;Xbggk #######.+ ....# .....# .Bbggsk#.).....#....## ...#  #.......##...##....#  .......bgg:a####....#'....#5.8 (2....#..B#..#.##B   entropy weaver (asleep)bggCnB.BbggL======6.8 (3bggbggU _As you open the door, it creaks loudly! You hear an angry hiss.bgg ?      bggO ############  #.....#....#  .#.....@....#  .bggw C#.....#....#  #.#.....#l.B.#  bgg #.).....#....##....#  #.bgg ##...##....#  #.bgg ##.........#  #.bgg ##...##....#  l   basilisk (wandering)'.bgg2 ##...##....#  #.#  bgg bgg bggu bgg# vBl...bgg>$ L------7.8 (1bgg* bgg. _A basilisk comes into view. _There is an open door here.bgg  You hit the basilisk but do no damage. You block the basilisk's attack.  The entropy weaver hits you but does no damage.  You block the entropy weaver's attack. x2bgg|Z=-----8.7 (0.9bggQbgg<_ _The entropy weaver completely misses you.bgg2 u     ############  #.....#....# ........#.....'B...#  .#....@#l...#  #.#.....#....#  #.).....#....##....#  #.......##...##....#  #.##.........#  #.##...##....#  '.##...##....#  #............#  #.# bggZ4 bgg4 bggQ9 l..l   basiliskbgg9 5-9.7 (1.0bgg< bgg> bgg5Jb  You hit the basilisk.  The basilisk is lightly wounded.bggK6=60.6 (0.9bggPbgg=S6 _You block the basilisk's attack.bgg b  You hit the basilisk.  The basilisk is lightly wounded.bggлi  The basilisk gazes at you.bgg*>bggG yy   hornetYou resist with almost no effort.bgg|H-1.6 (1.0bggTo _A hornet comes into view.bggc b  You barely miss the basilisk.bgg .  The basilisk is lightly wounded.bgg i  The basilisk gazes at you.bggΎ C2.7 (1.1bgg bgg 7 _You resist with almost no effort.bgg5 <  You slash the basilisk!bgg< r  The basilisk is moderately wounded.bgg. 9 bggQ -3.6 (0.9bggbggy6 _You block the basilisk's attack.bgg3bgghdeadiverson the Carver (Human Fighter) Turns: 14789, Time: 00:26:30 Health: 97/97AC: 20 Str: 17 XL: 12 Next: 85% Magic: 12/12EV: 18 Int: 11 God: the Shining One [*****.] Gold: 677bggXSH: 16 Dex: 15 Spells: 11/11 levels left rFire . . .a - +4 long sword rCold + . . l - +1 kite shield rNeg + + . c - quicksilver dragon scales of the Indigo Skies {rC+ WillrPois .(no helmet) rElec .w - +2 cloak {Stlth+} rCorr .bgg٬lP - +0 pair of gloves SInv .A - +0 pair of boots Will +....d - amulet of faith Stlth +p - +5 ring of evasion HPRegen 0.36/turn (no ring) MPRegen 0.13/turn bgg.%: faith @: glowing A: explore regen, iridescent scales 1, large bone plates 1, inability to drink after injury 1bggebggR  deadiverson the Carver  Human of the Shining One *****.  Health: 97/97 ========================  Magic: 12/12 ========================  AC: 20Str: 17############   EV: 18Int: 11#.....#....#   SH: 16Dex: 15........#.....l....#   XL: 12 Next: 85% Place: Dungeon:13bgg........#....@#....#   Noise: =--------  Time: 14963.6 (0.0)#.......#.....#....#   a) +4 long sword#.).....#....##....#   Throw: 20 darts (poison)#.......##...##....#  #.......##.........#  #.......##...##....#   l   basilisk'.......##...##....#  #..................#  #..................#  The basilisk is lightly wounded.  The basilisk gazes at you. _You resist with almost no effort.  bggYou slash the basilisk!  The basilisk is moderately wounded. _You block the basilisk's attack.bggbggbggYbgg7p:  You hit the basilisk.bggv} yy   hornetThe basilisk is moderately wounded.bgg5i  The basilisk gazes at you.bgg?#4.5 (0.9 _You resist with almost no effort.bggj:  You hit the basilisk.bgg .  The basilisk is moderately wounded.bggi  The basilisk gazes at you.bgg2bggyy   hornetbgg:-5.5 (1.0bggbgg7 _You resist with almost no effort.bggc <  You slash the basilisk!bggݐ .  The basilisk is heavily wounded.bgg; 5=6.4 (0.9bgg bgg 6 _You block the basilisk's attack.bgg =  You slice the basilisk!!bggZ bggj yy   hornetbgg6 067.3bggn bgg  bgg >_You kill the basilisk!bgg8  You hit the hornet.  The hornet is lightly wounded.  You block the hornet's attack.bgg5-8.3 (1.0bggbggW? _The hornet stings you but does no damage.bgg  You barely miss the hornet.The hornet is lightly wounded.bggw@-9bggbgg? _The hornet stings you but does no damage.bgg2  You closely miss the hornet.The hornet is lightly wounded.bgg '70bggl bgg# r _The hornet barely misses you. You block the hornet's attack.bgg  You closely miss the hornet.The hornet is lightly wounded.bgg; &1bgg bgg^ 4 _You block the hornet's attack.bgg@  You slash the hornet!  The hornet is heavily wounded.bgg5=2.2 (0.9bgg! bgg 7 _You block the hornet's attack. x2bggF ((You throw a poisoned dart.bggH yThe poisoned dart closely misses the hornet.bggoI f-3.3 (1.119bggQ bggOT 4 _You block the hornet's attack.bggs b  You throw a poisoned dart. The poisoned dart hits the hornet.bgg  The hornet is heavily wounded.-4.48bggK bgg k _You block the hornet's attack. The hornet misses you.bgg z (You throw a poisoned dart.bgg= ww   brain worm shaped shifter  The poisoned dart barely misses the hornet.bggފX5.57bggbgg?; _The hornet changes into a brain worm!bggy (poisoned)  You throw a poisoned dart. The poisoned dart hits the brain worm.bgg~`n6.66bgggbggi1 _The brain worm is poisoned.bgg} very poiso…)You throw a poisoned dart. The poisoned dart hits the brain worm.bggNIbggI]7.8 (1.25bggPbggPT bggoTO_The brain worm looks even sicker. You block the brain worm's attack. x2bggC  You throw a poisoned dart. The poisoned dart hits the brain worm.  The brain worm looks even sicker.bgg)  The brain worm is lightly wounded.  The brain worm's throbbing head pulsates.Something gnaws on your mind!bgg* 2--0----9.04bgg/ bgg2 a _You feel your power leaking away.bgg8 8 extremely  bgg%9 AYou throw a poisoned dart. The poisoned dart hits the brain worm.bgg %  bgg )The brain worm looks as sick as possible!bggm .80.1 (1.1bgg 03bgg bgg 8 _You block the brain worm's attack.bgg>d  You slash the brain worm!  The brain worm is heavily wounded.bgg e5=1.0 (0.9bgg|kbggn8 _You block the brain worm's attack.bgg  You slash the brain worm!  The brain worm is almost dead.bgg,@You kill the brain worm!bgg"(bggCbgg_bggo3=-972.0 (1.0bggqbgglX _The Shining One accepts your kill.bggS      bgg ############   #.....#(...#  .#.....@....#  ..#.....#....#  #.......#.....#....#  #.).....#....##....#  #.##...##....#  #.##.........#  #.bggkg##...##....#  '.##...##....#  #.#  bgg bgg L------3bgg bgg  f - 18 poisoned darts (gained 5)  There is an open door, spattered with blood here.bgg "--bgg T4.0 (28bggP bgg  Y _You see here a shapeshifter corpse.bgg >      bgg6 "  ############   #.....#@...#  .#.....†....#  ..#.....#....#  bggf ?#.......#.....#....#  #.).....#....##....#  #.bgg ##...##....#  #.bgg ##.........#  #.bgg ##...##....#  '.##...##....#  bgg bgg bgg 84=bgg $5.0 (1bgg bgg bggN +6.0 (2bggs 120bggd bgg ` _f - 20 poisoned darts (gained 2)bgg_4bgg/5bgg9bggf<bggbgg2bggbgg5bggL1==bggg5bgg3,bggbggbggn%6bggbggbggf:==bggbggbggCbggbgg_ _You start resting.bgg ,92.0 (6bgg Y7=3.0 (7bgg bgg^" _HP restored.bggBbggbggbggbgg&0bggZ2==4.0 (1bggbggqX _You start resting. Magic restored.bggz< bgg = bgg= bggE bgg&H bggH bggHL bgg/O &  bggfO {There is an open door, spattered with blood here.  You see here a shapeshifter corpse.bggpQ bggR  _bggS bggW bggNY bggY 9=bgg [ bgg^ bgg&_ bgg_ :==bggI` bgg,d bgg f bgg\f bggg bggkj bggm bggm bgg o bggr bggu ,bgg6w bgg({ bgg #.....#....# ........#.....†....# ........#.....#....# #.......#.....#....# bgg #.).....#....##....# #.......##...##....# #.......##.........# #.......##...##....# '.......##@..##....#  #....9.............# bgg  #..................#  #.......##.........#  ##########...########  ........#.)....# 9   gargoyle (wandering) bggƅ ..'......#   bgg ....##+###......#   bgg+ e.......#...........#  bggv .5001.0 (7bgg .99bgg $2.0 (8bgg bgg { _A gargoyle comes into view. It is wielding a +0 dire flail.bgg ........#.....†....#  .#.....#....#  #.......#.....#....#  #.).....#....##....# bggg #.......##...##....#  #.......##.........#  #.......##...##....#  '.......##...##....#  #.....9..@.........#  #.....bgg.#  ###.#  ##########...########  ........#.)....#  ........'......# bgg##+###......# .......#...........#  .#.# bggvbgg62.9bgg+3.0 (1bgg&bggK)bgg .#.....†....#  ........#.....#....#  #.......#.....#....#  #.).....#....##....#  #.......##...##....# bggv #.......##.........#  #.......##...##....#  'H......##...##....#  #......9.#  #.#  #bgg.##.#  ###...#bggV ........#.)....# ........'......# H   manticore (wandering) ....##+###......# 9   gargoylebggJ .#...........# .#.#bggk  A manticore comes into view.bggG.Hbgg2.=4bgg bgg#6 _You block the gargoyle's attack.bggU:  You hit the gargoyle.bgg` .HHThe gargoyle is lightly damaged.bgg`-5.1 (1.1bggmfbggj6 _You block the gargoyle's attack.bgg Z k  You hit the gargoyle but do no damage.bgg2c .HThe gargoyle is lightly damaged.bggc -6.0 (0.9bggjj bggl 6 _You block the gargoyle's attack.bggo$  _You block the gargoyle's attack.  You hit the gargoyle but do no damage.  The gargoyle is lightly damaged _You block the gargoyle's attack.  You hit the gargoyle.  The gargoyle is lightly damaged.bgg)+w  The gargoyle hurls a stone arrow at you.bggjbggQ.Hbgg45=7.0 (1.0bgg<bgg0 _You block the stone arrow.bggpb  You barely miss the gargoyle.bgg| .HThe gargoyle is lightly damaged.bgg}3-9 (0.9bgg6bggˉ6 _You block the gargoyle's attack.bggF<  You slash the gargoyle!bgg7S .H The gargoyle is severely damaged.bggSbggZw  The gargoyle hurls a stone arrow at you.bgg1bgg&==bgg 8.8bgg{bggt0 _You block the stone arrow.bggcX  You completely miss the gargoyle.bggdKThe gargoyle is severely damaged.bggkw  The gargoyle hurls a stone arrow at you.bgg  You block the stone arrow. You block the manticore's attack. x2-9.8 (1.0bggbggV _The manticore barely misses you.bgg   You block the manticore's attack. x2 _The manticore barely misses you.  You hit the gargoyle but do no damage.The gargoyle is severely damaged.manticore's attack. The manticore completely misses you.  You block the manticore's attack.bgg w  The gargoyle hurls a stone arrow at you.bgg bgg A-10bgg  bgg" 0 _You block the stone arrow.bgg4' _You block the stone arrow.  You hit the gargoyle but do no damage.The gargoyle is severely damaged.  The manticore bites you but doesbgg'_ no damage.  The manticore claws you but does no damage.  The manticore claws you.bgg*/w  The gargoyle hurls a stone arrow at you.bggwbgg4xT3-1bggbggbgg`/  --more--bggQ0 _The stone arrow hits you.bgg  You hit the gargoyle.  The gargoyle is almost destroyed.You block the gargoyle's attack. You block the manticore's attack. x2bgg` \4--2bgg< bgga O _The manticore closely misses you.bggs~The manticore closely misses you.manticore's attack.  The manticore claws you but does no damage.  You block the manticore's attack.bgg>V81---=bgg3.7 (0.9bggvbggA _The gargoyle hits you with a +0 dire flail!bggu  You hit the gargoyle but do no damage.The gargoyle is almost destroyed.You block the manticore's attack. x3bggOw  The gargoyle hurls a stone arrow at you.bggbgg3bgg^c75-----4.7 (1.0bggsbgg"/ _The stone arrow hits you.bgg]The gargoyle hurls a stone arrow at you. _The stone arrow hits you.  You hit the gargoyle but do no damage.  The gargoyle is almost destroyed.You block the manticore's attack. x2; The manticore closely misses you.bgg^]6---5bggebggg6 _You block the gargoyle's attack.bggq  You completely miss the gargoyle.The gargoyle is almost destroyed.bgg v ````  The gargoyle hurls a stone arrow at you.bggn @...The stone arrow misses you. You block the manticore's attack.  The manticore misses you.bgg @-6bgg bgg A _The manticore claws you but does no damage.bgg9The manticore misses you. _The manticore claws you but does no damage.  You hit the gargoyle but do no damage.  The gargoyle is almost destroyed.  You block the manticore's attack. x2  66--=7bggB@bggBA _The gargoyle hits you with a +0 dire flail!bgg(<  You slash the gargoyle!bgg=4 )  You destroy the gargoyle!You block the manticore's attack. x2bgg7790-8bgg=bgg0@A _The manticore claws you but does no damage.bggbgg Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  b - 3 throwing nets  f - 20 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Wands (go to first with /)h - a wand of roots (14)  y - a wand of digging (6)  B - a wand of mindburst (29)  M - a wand of flame (12)  bggu `N - a wand of charming (3) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 3 scrolls of fear  n - a scroll of immolationr - a scroll of silencebgg4bgg........#.....†....#deadiverson the Carver........#.....#....#Human of the Shining One *****.#.......#.....#....#Health: 66/97 ================--------#.).....#....##....#Magic: 12/12 ========================#.......##...##....#AC: 20Str: 17#.......##.........#EV: 19Int: 11bgg=#.......##...##....#SH: 16Dex: 15'.......##...##....#XL: 12 Next: 90% Place: Dungeon:13#......)@..........#Noise: =--------  Time: 15018.7 (0.0)#......H...........#a) +4 long sword#.......##.........#Throw: 20 darts (poison)bgg##########...########........#.)....#........'......#H   manticore....##+###......#.......#...........#.......#...........#You destroy the gargoyle!You block the manticore's attack. x2 _The manticore claws you but does no damage.  Throw: 9 darts (curare)Press: ? - help, Shift-Dir - straight line, f - manticoreAim: a manticore (haloed, 91% to hit)bgg+Uv........#.....†....#deadiverson the Carver........#.....#....#Human of the Shining One *****.#.......#.....#....#Health: 66/97 ================--------#.).....#....##....#Magic: 12/12 ========================#.......##...##....#AC: 20Str: 17#.......##.........#EV: 19Int: 11#.......##...##....#SH: 16Dex: 15'.......##...##....#XL: 12 Next: 90% Place: Dungeon:13#......)@..........#bggVNoise: =--------  Time: 15018.7 (0.0)#......H...........#a) +4 long sword#.......##.........#Throw: 20 darts (poison)##########...########........#.)....#........'......#H   manticore....##+###......#.......#...........#.......#...........#Throw: 9 darts (curare)Press: ? - help, Shift-Dir - straight line, f - manticoreAim: a manticore (haloed, 91% to hit)  You throw a curare-tipped dart.  The curare-tipped dart hits the manticore.  The manticore is poisoned. The manticore struggles to breathe.bggQ]/  --more--bgg6  (very poisoned, slow)The manticore seems to slow down.bgg! The manticore is moderately wounded.The manticore completely misses you. The manticore misses you.bgg" -9.8 (1.1bgg* bgg, / _You block the manticore's attack.bggd=3You hit the manticore.bgg>I7200bggFbggnI\ _The manticore is moderately wounded.bggk  You hit the manticore.  The manticore is heavily wounded.The manticore barely misses you. The manticore misses you.bggpc4-1.7 (0.9bggbgg. _The manticore claws you.bgg;  You hit the manticore.bggș-2.7 (1.0bggbgg|a _The manticore is heavily wounded.bgg _You slash the manticore!  The manticore is severely wounded.The manticore barely misses you.  The manticore claws you but does no damage.bggŊ[5==bgg 3bggbgg7 _You block the manticore's attack.bggO   You hit the manticore but do no damage.The manticore is almost dead.You block the manticore's attack. The manticore closely misses you.bggBP .-4bggX bgg[ 7 _You block the manticore's attack.bggt) =  You slash the manticore!bgg5 N(bgg; wNimble3-5bggJ bggQ M _You kill the manticore!bggO .#.....#....# #.#.....#....# #.).....#....##....# #.......##...##....# #.##.........# #.##...##....# '.##...##....# #)...........# #.......# #.......##.# ##########...######## ........#.)....# ........'......###+###bggsP......#.......#...........# .#...........# .#.....#'#####bggYbggZ\6=-6bgg`bgghbgg\i!-bgg~i$7.7 (2bggSobggOr: _S - 9 curare-tipped darts (gained 1)bggd\bgg\bgg]bggcBbgg6ebgge97bggfbggjbggDjbgg{kbggnbggqn98bggobggrbggrbggtbgg_wbggwbggxbggE{bgg{N69=bgg|bgg8bggnbggȀbgg"bggabggЅbggRn70=bggbgg,bgg7bggbgg܎bggLbgg,bgg%1bggbggΗ,bggbgg2bggj%2bgg/bggbggbggVbgg̠bggbggbggma3=bggbgg,bggߩbgg],bgg'bggbgg#4bgg)2=bggkbggbggܳbggwbgg2,bggabggbgg3%5bggbggTbggbggEbggݿ,bggLbggbgg%6bggbgg,bggbggbggrK7=bggAbggbggbggbgg,bggbggbggAU8=bggbgg,bggbgg,bgg&bggbgg%9bggbggbgg bggbgg,bggbgg9bggy&80bgg$bgg&,bgg-bggIbggK1=bggDbggbggbggbggbggbggbgg bggSU2=bgg bggbggbggcbgg bgg8bggbgg2bgg%3bggbggWbggbggbgg>bggpbggbggbggL%4bgg]bggrbggbgg bggu bgg bgg*bggbgg[D5=bggbggO,bgg!bggbggU6=bggbgg1,bgg bgg,bggbggbgg%7bggw!bgg#,bgg$bgg-+bggj+bggl,bgg<.bgg.%8bggy/bgg^1bgg1bgg2bgg4bgg4bgg5bgg7bgg7K9=bgg8bgg:bgg:bgg;bgg=bggK>V90=bggK?bggPAbggAbggCbggDbggDbggEbggGbgg H%1bggHbggKbggVKbggfLbgg NbggANbgg-Obggb23=bggcbggmebgge#4bgge2=bggfbggh,bggjbggkbggCl%5bggAmbgg[rBbggZu,bggvbggybggy%6bggM{bggn}bgg}bggbggubggbggbgg_ _You start resting.bgg^1111.7 (84.0)bgg̒Z7=2.7 (85bggbgg" _HP restored.bggjU3bggVbgg9\bgg\,bgg_,bggkY #.....#....# ..#.....†....# ........#.....#....# #.......#.....#....# #.).....#....##....# #.......##...##....# #.......##.........#..#.......##...##....#..'##...##....#3.7 (1.0)<.#......)..# #..................##.......##.........###########...######## ........#.)....# ...'......# ....##+###......# .......#...........#bggsbgg3t+4.7 (2bggJybgg {9 _Found a stone staircase leading up.bggbggbgg\bggibgg,bgg|bggݰbggbgg9=bggBbggbggpbggbggLbggbggbgglbggbggobggzbggbgg=bggbgg:bggbgg9bgg bggbgg#bggbgg3bggbggbgg4bggbgg,bggbggbgg,bggbggbgg~bgg-bggbggbgg+.............#.....#..#.............#.....†..#.............#.....#...#######.......#.....#.......u.#.).....#....##.........#.......##...##.. #.........#.......##....... ........#.......##...##.. .##.......##...##.. ###....<.#......)... .##......#.......... .##......#.......##....... ###......##########...#### ÷##...... ........#.). u   cyan uglybgg7 thing (asleep) .##...... ........'... ###...... ....##+###... # .......#..bgg 25.7 (11.0)  A cyan ugly thing comes into view.bggD.uubgg5bgg '===bgg 6.7 (12bgg'bgg*; _The cyan ugly thing gurgles horribly! bgg*C_There is an open door here.bggx .......† ....... .#######....... .......#.)..... ......u#....... .......#....... .......#....... #......@....... #....<.#......) #......#....... #......#.......bgg% #......######## ÷# #...... ) #......  #...... #bggM  .......† ....... .#######....... .......#.)..... bggKN \......u#....... .......#....... .......#....... #......@....... #....<.#......) #......#.......bggzN  #......#....... #......######## bggN -÷# #...... ) #......  #...... bgg`X bggX bgg_ bggc f _A cyan ugly thing is nearby!bgg. ((You throw a poisoned dart.bggbggt(u.bggl---7.8 (1.1)19bgg3)bggT,A _The poisoned dart hits the cyan ugly thing.bgg ((poisoned)You throw a poisoned dart.  The poisoned dart hits the cyan ugly thing.bggbggZ(ubggct---8.98bggbggX6 _The cyan ugly thing is poisoned.bggv?  You throw a poisoned dart.bgg  The poisoned dart hits the cyan ugly thing.  The cyan ugly thing completely misses you.bggR a=30.07bgg bgg U _The cyan ugly thing misses you.bggw A  You hit the cyan ugly thing.bggf +9 (0.9bgg bgg~ = _The cyan ugly thing is lightly wounded.bgg  You slash the cyan ugly thing!  The cyan ugly thing is moderately wounded.bgg %=bgg! 1.8bgg*bgg-= _You block the cyan ugly thing's attack.bgg  You hit the cyan ugly thing.  The cyan ugly thing is moderately wounded.bgg5-2.8 (1.0bggbgg= _You block the cyan ugly thing's attack.bgg-g _You block's attack.  You hit the cyan ugly thing.  The cyan ugly thing is moderately wounded. _You block the cyan ugly thing's attack.  You slash the cyan ugly thing!  The cyan ugly thing is heavily wounded.bgg.5=3.9 (1.1bgg>bggA= _You block the cyan ugly thing's attack.bgg  You slash the cyan ugly thing!  The cyan ugly thing is severely wounded.40bggˆbggN\ _The cyan ugly thing barely misses you.bgg8  You slash the cyan ugly thing!  The cyan ugly thing is almost dead.bgg .=5bgg bgg = _You block the cyan ugly thing's attack.bgghk You completely miss the cyan ugly thing.The cyan ugly thing is almost dead.bggCl 6--6.8 (0.9bggw bggz e _The cyan ugly thing looks more healthy. You block the cyan ugly thing's attack.bgg  You barely miss the cyan ugly thing.The cyan ugly thing is almost dead.bggC--7.7bggbggG _The cyan ugly thing kicks you but does no damage.bgg>C  You slash the cyan ugly thing!bggw(bgg 88.7 (1.0 _You kill the cyan ugly thing!bgg7bgg$i _Your Dodging skill increases to level 11!bgg0t Ibggt bgg x bggG| : _bggY~ bgg~ bgg bgg o _f - 18 poisoned darts (gained 1)bggT bgg bgg bgg bgg bgg bgg o _f - 19 poisoned darts (gained 1)bggi bgg bgg bggS bgg bggo bggZ o _f - 20 poisoned darts (gained 1)bggm bgg bgg bggc bggÚ bgg bgg} bgg bggם bgg bgg bgg bggK bgg bgg bgg bggH bgg bgg} bgg bgg$ Bbggl bgg( bgg bgg bgg bgg` bgg bgg bggw bgg bggX bgg bggt bgg ,bgg bgg% bgg bgg bggl bggu bgg bgg bgg{ bgg bgg bgg0 bgg bgg, ,bgg bgg T _B - a wand of mindburst (38) (gained 9 charges)bgg. 3bgg= bgg bggd bgg bggz bgg bgg ,bgg! bgg $ bgg& bggE& bgg' bggl) bgg5+ bgg+ bgg , bgg. bgg0 bgg0 bgg1 bgg^4 bgg47 bgg7 bgg_8 bgg; bgg > ,bgg? bggB bggdE bggE bggF bgg}I bggK bgg6L bggM bggP bggR ,bggaT bggV bggX ,bggX bggZ bggv_ Bbgg` bggd bggd bgg/f bggj bggn bggBo bggp bggUt bgg$y bggy bgg bgg @  There is an open door here.bgg bgg$  _bggؓ bgg bgg- bgg bggš bggB bgg0 bggq bgg bgg bgg/ bgg bgg bggѭ bgg߰ bgg) bgg bgg bgg ,bggJ bgg5 bgg 1..#.....# #......#....... #'#.....#...h..h#......#.......## ..###'###.......#......########## ..#†...÷#.......#......#....... ..')....#......#....... bgg. 7..#######.#......'.......## ...#...#.#......#.......#'...#.#......#.......# ...#............#.......#- bgg_ )..######......####...# .####.#bgg #20+.....# .#♣)#.........# .#.....# .bgg, .#ß?+.........#. .#.....# .'.# W#..'. hh 2 hogs (asleep).....# .#.####.#########. .#.....# .#................#.....####+#####.bgg^ !bggT 080.7 (42.0)bggG F-1.7 (43bgg bgg _2 hogs come into view. _There is an open door here.bgg  #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.# .......#.#♣) .......#.#ß?+ .......'.#  .......#.# .......#..bgg3* #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.#bggS .......#.#♣) .......#.#ß?+ .......'.#  .......#.# .......#..bggubggbggK')bggd _There are monsters nearby!bgg #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.# .......#.#♣) .......#.#ß?+ .......'.#  .......#.# .......#..bgg0 #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.# .......#.#♣) .......#.#ß?+ .......'.#  .......#gga10;1m.# .......#..bgg?B)bggbggbggd _There are monsters nearby!bgg66 #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.# .......#.#♣) .......#.#ß?+ .......'.#  .......#.# .......#..bggz* #......h..h#......#.......#......#†...÷#.......#......#)....#.......#......#.......#......' .......#......# .......#......#.......@......#.......#......# .......#.####.#bgg~7 .......#.#♣) .......#.#ß?+ .......'.#  .......#.# .......#..bggB)bggbggNbggd _There are monsters nearby!bgg ((((((h1 aslebggr ep, 1 poisoned)You throw a poisoned dart. The poisoned dart hits the hog. The hog is poisoned.bgg bgg bggD bgg ? The hog squeals angrily. x2bgg bgg1 @.h...hh....@   Kirke (wandering)hhh 3 hogs (1 wandering, 1 poisoned)bgg k==2.8 (1.1)19bgg7 ')bgg _Kirke, Weaver of Myths comes into view. A hog comes into view.bgg (((() very poisoned)You throw a poisoned dart. The poisoned dart hits the hog.bgg ?  The hog looks even sicker.bgg‘ bgg$ bgg bgg bgg #(..@h.(hh...@hbgg+ X3.98bgg² bgg) < _Kirke shouts! The hog squeals angrily.bggՄH(((bgg ,bgg. .h(.h..You throw a poisoned dart. The poisoned dart hits the hog.bgg)j  Kirke casts a spell at you.bggbggWbgg]J.hbgg3a--5.07bgg9bgg2 _You resist with some effort.bggh ((You throw a poisoned dart. The poisoned dart hits the hog.  The hog looks even sicker.bggbggbggbggbggbgg)bggBv.@...hhbggs--6.16bggX')bggU)1 _The hog is lightly wounded.bggI ((((((()You throw a poisoned dart.bgg)z,bgg{,bgg|bgg~bggl...(....@.hhbgg`=7.25bggqbggd^ _The poisoned dart barely misses the hog.bgg; bgg֔"bggextbggsremely poisoned)bggWYou throw a poisoned dart. The poisoned dart hits the hog.  bgg"The hog looks as sick as possible!bggf @  The hog is lightly wounded.bgg;"   You block the hog's attack. The hog completely misses you.bgg13 s(@.hbgg&4 X8.34bggD@ bgg?D 1 _You block the hog's attack.bgg  You slash the hog!  The hog is severely wounded.bggbggt.@.h)bggp4=90bggFC)bggt _You block the hog's attack. x2; The hog completely misses you.bggm7  You slash the hog!bggV  You kill the hog!bgg.@ 2 hogsbgg/990bggbggE4 _You block the hog's attack. x3bgg )  You slash Kirke!  Kirke is lightly wounded.  You block the hog's attack. x2bgg U*)bggw  Kirke gestures at you while chanting.You turn into a filthy swine.  Your +4 long sword melds into your body.  --more--bgg  27 4-) Nothing wieldedr +2 cloak of stealth melds into your body.  Your +0 pair of gloves melds into your body.r +0 pair of boots melds into your body.  Your +1 kite shield melds into your body.  The quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+} melds intobgg/  --more--bgg C 5 ring of evasionbggN 8hbgguP 090=1Teeth14 darts (poison)Pig bggA] ')bgg_ % _You feel less stealthy.bggB)bggsbggHbgg\> _Unknown command.bggbggbggbgg> _Unknown command.bgg #.....# #......#. '#.....#(..(...#......#.##. .###'###.......#......##. .#†...÷#....(..#......#. .')....#.....(.#......#.#......(#......'.##+bgg~X#...# .......#......#.#.'...# ......h#......#.#.#.@'h.....#.#. ..######......h#......#.#. ###...# .......#.####.#.#. +.....# .......#.#♣)#.#. #.....# .......#.#ß?+.#. #.....# .......'.# W#.'. #.....# .......#.####.#. #.....# .......#... #.....####+#####.bggbgg>O.h)bgg'e8----2.0 (0.7bggC)bggC _The hog attacks as it pursues you! The hog bites you!bggg Y#.....# #......#. #.....#(..(...#......#.##. ###'###.......#......##. #†...÷#....(..#......#.. ')....#.....(.#......#. #......(#......'.##+# .#...# .......#......#.bggf ;#. .'...# .#......#.#. .#.@h.h....#.#. .######......h#......#.#....# .......#.####.#.#. .....# .......#.#♣)#...#. .....# .......#.#ß?+.........#. bgg .....# .......'.# W#.'. .....# .......#.####.#. .....# .#... .....####+#####.bggY bgg bggz bggH ^h@h.bggأ P---7bgg! bggF bggP>##### #....<.#......) .....# #......#... .....#(..(...#......#.......##. ##'###.......#......########## †...÷#....(..#......#. )....#.....(.#......#..... ######......(#......'.......##+## bgg'3#...# .......#......#.#. '...# .......#..h...#.#. #...........h@h.....#.#.####.......#......#.#...[ #...# .......#.####.#.......#.# .......#.#♣)#.........#.bgg*# .#.#ß?+.........#.# .'.# W#.........'.# .#.####.########## .......#.bggHbggbggbggx@h(h.)bgg8---=-3.4bgg C)bggKd _The hog attacks as it pursues you! The hog misses you.bggw[....#########......'.##...# ##### bgg8x#....<.#......)# #......#... ....#(..(...#......#.......##. #'###.......#......##########...# ...÷#....(..#......#.# bgg y....#.....(.#......#.....' #####......(#......'.......##+### ...# .#...h..#.#. ...# .......#@h....#.#. ...........(h......#.#..... #####.#......#.#...[# .......#.####.#.......#.bgg@y# .......#.#♣)#.........#.# .bgguy#.#ß?+.........#.# .'.# W#.........'.bggyU# .#.####.#########bggT~bggbgg]0h.bggݍb'h)bggH%-bggx 4.1bgg–')bggbgg..............#.##...# ...#########......'.##...## #### #....<.#......)# #......#... bgg͌...#(..(...#......#.......##..... '###.......#......##########...#÷#....(..#......#..#. ...#.....(.#......#.....'. ####......(#....h.'.......##+#### .#..h...#.......#.bgg3/# .......#@.....#.......#. ..........('h.....#.......#.....# ####.#......#.#...[.+# .bggۍ^#.####.#.#.....## .#.#♣)#.........#.....## .#.#ß?+.........#.....## .'.# W#.........'.....#bggbggbgg_h..@)bggU@-8bggC)bgg"bggI#.##...##.##......'.##...##. #....<.#......).# bgg͎#......#.#(..(...#......#.##. ###.#......##########...# .÷#....(..#......#...#.)#.....(.#......#.bgg9'.......(#...h.h'.##+###. .# .#......#.#. .# .#.@....#.......#.bggw('h.....#.......#.....#'.#......#.......#...[.+. .bgg;# .......#.####.#.......#.....#. .# .bgg#.#♣)#.........#.....#. .# .#.#ß?+...#.....#. .# .'.# W#.'.....#.bggbggbgg9bgg{bggfH.h.@bgg3.hbgg^2-=5.5bgg#bggK _The hog attacks as it pursues you! The hog bites you.bgg ##.................# ..#########......'.##...## ##<) .. ..#(..(.......##...... ###.....#########...### .÷#....(.......#.) ..(.#.....h#............' ###(#....h.'#+###....#.# bgg 0.#..@...#.... ...('.h....#' ###.#......#....[.+####.#......#♣)#........#.#ß?+#bgg bgg 7  The hog bites you.bgg a@h..bgg B-6.2bgg C)bggK _Kirke whispers, "You'd look cute with a curly little tail."bggh.## ##.............# ..#########......'.##...## ##<) .. ..#(..(.......##...... ###.....#########...### .÷#....(.bgg#.) ..(.#......#............' ###(#....h.'.......##+###..@..#...... .# .#.h....#........ ...('....#.....#' ###.#......#.......#...[.+bgg5 ####.#......♣)#bgg bggFbgg4h.bgge:h.bgg.-9bggD2bggm.#.#.).....#....## ..#.#.......##...## ###.#.......##..............#.......##...## ...#########......'.......##...## ####bggun) #....<.#).# #......#.. ...#(..(...#......#.......##..... '###.......#....h.##########...##÷#.#......#.# ...#.#.....h#......' bggzo;####(#......'.##+### ..# .#..h@..#.## .......#......#.#...... ....('......#.......#.....# ####.#......#.#...[.+ ..# .#.####.#.#.....#bggPtbggdubgg%wbggRvh.h@..bgg5B-7.6bggՎbggbgg#######...).....#. .....## ###.............#. ...#########......'.##...## ###<) .. bgg...#(..(.......##..... '###.......##########...##÷#....(.h# ...(.#......#.....' ####(#...h@.'.#+###.# .#.... ....('.....# ####....[.+bggbgg,bgg vh.@h..bgg (8.3bggpbggKbggF......#######......).....#. .......## ###................#... ...#########......'.......##...## ###<) .. ...#(..(bgg)H..#.......##..... '###.....h.##########...##÷#....(..#.....# ...(.#...@h.#.....' ####('.#+###.# .#... ....('..#bgg5MbggNbgg]hh.h.bgg^83=9.0bggdjbggdnl _The hog attacks as it pursues you! The hog misses you.bggeZ†#...........#######.....).....#. ....## ###................bggf4#..... ...#########......'.......##...## ###) #....... ...#(..(h.#.......##..... '###.......##########...##÷#....(..#....h# ...(.#...@..#.....' ####('#+#### .#.bggPkbggtlbggmbggz`h.h@.bgg){.bgg{U78-7bgg|bgg _The hog attacks as it pursues you! The hog bites you. _There is a stone staircase leading up, spattered with blood here.bgg*jbggjbggwbgg|,bgg^h@.bgg/200.7 (1.0bggbbggœv .....#.....#.......#.#####.#...##...............###.#....##....#....................##........bgg~...##..................#. .....##........###.##....#######.###..#...................###...##[.......2 ..#...........##....#bgg m#........##.#h...#####.##.......###.#.#.######......## ..#.#.#...#(.÷..##.... .##................÷#...bgg@................÷.#..## h   hog ........................###.∩....................<......#.......#... _The hog closely misses you.You climb upwards.bgg8-bggŬbgg+=9-2.2 (2.5bgg6bgg:  Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHu _There is a stone staircase leading down here.bggey bggz e0--==3.0 (0.8bggт bgg e _You completely miss the hog. The hog bites you!bgg>58-----7 (0.7bggbgg.j _You hit the hog but do no damage. The hog bites you!bggbggm9----4.5 (0.8bggbgg _You hit the hog but do no damage. The hog closely misses you.bgg@F=  You hit the hog.  bggFThe hog is lightly wounded.bgg GG-5.2 (0.7bggVRbggTT _The hog completely misses you.bgg  You hit the hog.  The hog is lightly wounded.6.0 (0.8bgg bggP _The hog barely misses you.bgg  You hit the hog.  The hog is moderately wounded.bgg &8bgg bgg ( _The hog bites you.bgg)O  You hit the hog.  The hog is moderately wounded.77.5 (0.7bggqW bggZ   You hit the hog.  The hog is moderately wounded. _The hog bites you.  You hit the hog.  The hog is moderately wounded. _The hog bites you.bggM _The hog bites you.  You hit the hog.  The hog is moderately wounded. _The hog bites you.  You hit the hog.  The hog is moderately wounded.bggxm4---=8.3 (0.8bggbggY  You hit the hog.  The hog is moderately wounded. _The hog bites you.  You hit the hog.  The hog is moderately wounded. _The hog bites you!bgg  You hit the hog.  The hog is heavily wounded.-9.1bggjbggNT _The hog completely misses you.bgg  You hit the hog.  The hog is severely wounded.bggf8----9bggbggT _The hog completely misses you.bgg4  You bite the hog!  The hog is almost dead.=10.7bggf< bgg-E Q _The hog closely misses you.bgg 5  You hit the hog.bgg4 p.bgg bggt L.......#.................##...... deadiverson the Nimble ........#.#####.#...##........... Human of the Shining One *****. ............###.#....##....#..... Health: 48/97 ===========------------- .......................##........ Magic: 12/12 ======================== ...........##..................#. AC: 0Str: 17 bggR z...........##........###.##....#. EV: 19Int: 11 ........######.###..#............ SH: 0Dex: 15 ..........###...##[.............. XL: 12 Next: 100% Place: Dungeon:12 ..#.............h...##..........# Noise: =--------  Time: 15211.4 (0.7) ..#........##.#....####......#.## -) Teeth ..........###.#.#.######......## Throw: 14 darts (poison) ..#.......#.#...#(.÷..##.......## Pig bgg .##................÷........#.... ...................÷........#..##  ..##............................#  bgg4 ].##.∩....................<......#  ................#................ The hog is severely wounded. _The hog completely misses you.You bite the hog!  The hog is almost dead. _The hog closely misses you.You hit the hog.bgg - _You kill the hog!You have reached level 13!bggQ /  --more--bgg3[51/1033/133 0% bgg bgg4 _bggJ 4bggK bgg P bggT j2=bggX bgg\X bgg/[ bggIb Bbggvc bggc L3=bgge bggh bggi bggj bggm bggm bggo bggr bggVs :4bggt bggy W _You start resting.bggz <Pig bgg 5bgg bgg bgg( ,bggU bgg bggN T6=bgg bgg bgg bgg bgg, bggx bgg bgg bgg L7=bgg bgg &-bggܳ T874-26.4 (15.0)a) +4 long sword14 darts (poison) _You start resting. _Your transformation is almost over.bgg You feel less porcine.  Your +4 long sword unmelds from your body.  Your +2 cloak of stealth unmelds from your body.  Your +0 pair of gloves unmelds from your body.bggt /  --more--bgg,- @  Your +0 pair of boots unmelds from your body.  Your +1 kite shield unmelds from your body.  The quicksilver dragon scales of the Indigo Skies {rC+ Will+ Stlth+} unmelds 5 ring of evasionbgggK209167.4 (16bgg_bgg _You feel stealthy.bggb bgggc bggd bggHh bggh 98bgg$m bggm ,bggUp bgg\s ,bggNu bggw bgg]x 99bggy bgg| bgg0} bgg~ bgg ,bgg bgg bggՅ :60bgg] bgg bgg bgg" bggߒ bgg! bgg bggm bgg S1=bgg@ bgg bgg bgge bggf a2=bgg bggM ,bggu bgg ,bgg bgg O3bggݳ bggy ,bgg bgg bgg bgg bgg3 bgg 94bgg Bbgg bgg+ bgg S5=bgg) bgg ,bgg' bgg ,bggq bgg bgg= K6=bggK bgg bgg bgg bgg ,bgg bgg bgg 97bgg bgg ,bgg bgg O8bgg bgg ,bgg bgg ,bgg bgg i9=bgg bgg ,bgg bggt ,bgg bgg bgg L70=bggM bgg ,bgg bgg ,bgg bgg bgg 91bgg+ bggb% ,bggG' bggX, O2bgg- bgg1 ,bgg83 bgg.7 ,bgg8 bgg< bggE= S3=bgg? bggB ,bgggD bggG ,bgg?J bggYR 74=bgg`Y bgg Z bggZ^ bgg[_ ;5bgga bggd ,bgghf bggi ,bggj bgg{l bggl %6bggm bggoo ,bggvp bgg r ,bggs bgg9u ;7bggv bggy ,bgg~z bgg| ,bgg} bgg~ bgg D8=bgg bgg: ,bggG bggK k9=bgg; bgg ,bgg\ bgg ,bgg bgg͌ <80bgg bggɏ ,bgg bgg ,bgg bgg ;1bgg bgg ,bgg bgg bgg K2=bgg bgg ,bgg! bgg# ,bgg bggd bgg U3=bgg bggd bgg bggַ bggM ,bgg bgg bgg %4bgg bgg ,bgg bgg bggM %5bgg bgg ,bgg% bgg ,bggk bgg bgg K6=bgg bggf ,bggE bgg bggQ bgg\ bggc bgg U7=bgg bgg bgg bgg bgg ,bgg bgg bggP %8bgg bgg ,bggt bggc bgg %9bggz bgg ,bgg bgg ,bgg bgg bggT &90bgg bggP ,bgg: bgg ,bgg bgg a1=bgg bgg ,bgg\ bgg& bgg' N2=bgg}( bgg, ,bgg/ bgg2 ,bgg4 bgg5 bgg 6 %3bgg6 bgg09 ,bgg: bgg!< ,bggn= bgg? ;4bgg@ bggC ,bggD bggF a5=bgg5H bggxM ,bggBN bggO bggP bggDQ bggR bggVS U6=bggxT bggV ,bggV bgg*Y ,bgg _Unknown command.bgg bgg rEvoke which item? Wands bgg  h - a wand of roots (14)y - a wand of digging (6)  B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (3) Miscellaneous  I - a Gell's gravitambourine (2/2) [!] read|quaff|evoke[?] describe selectedcgge cggymn..#.........#.............#.....† deadiverson the Nimble ..#.........#.............#.....# Human of the Shining One *****. ..#.........#######.......#.....# Health: 103/103 ======================== cggKn..#...............#.).....#....## Magic: 13/13 ======================== ..#...............#.......##...## AC: 20Str: 17 ###...............#.......##..... EV: 19Int: 11 ..................#.......##...## SH: 16Dex: 15 ...#########......'.......##...## XL: 13 Next:  0% Place: Dungeon:13 #####....@.#......)....... Noise: =--------  Time: 15352.9 (0.0) ...##...h@.#.............. a) +4 long sword cggBo...#(..(...#......#.......##..... Throw: 14 darts (poison) '###.......#......##########...## ..÷#....(..#......#............#. ...#.....(.#......#............'. @   Kirke ####......(#......'.......##+###. h   hog ..# .......#......#.......#...... ..# .......#......#.......#...... _There is a stone staircase leading up, spattered with blood here. _Unknown command.cgg..#.........#.............#.....† deadiverson the Nimble ..#.........#.............#.....# Human of the Shining One *****. ..#.........#######.......#.....# Health: 103/103 ======================== ..#...............#.).....#....## Magic: 13/13 ======================== cgg..#...............#.......##...## AC: 20Str: 17 ###...............#.......##..... EV: 19Int: 11 ..................#.......##...## SH: 16Dex: 15 ...#########......'.......##...## XL: 13 Next:  0% Place: Dungeon:13 #### #....@.#......)....... Noise: =--------  Time: 15352.9 (0.0) ...# #...h@.#.............. a) +4 long sword cggD...#(..(...#......#.......##..... Throw: 14 darts (poison) '###.......#......##########...## ..÷#....(..#......#............#. ...#.....(.#......#............'. @   Kirke cgg ####......(#......'.......##+###. h   hog ..# .......#......#.......#...... ..# .......#......#.......#...... _There is a stone staircase leading up, spattered with blood here. _Unknown command.cggAiming: CharmPress: ? - help, Shift-Dir - straight line, f - KirkeAim: Kirke (haloed, chance to affect: 1%)cggYhh@hoga hog49%)cgg ..#.........#.............#.....† deadiverson the Nimble ..#.........#.............#.....# Human of the Shining One *****. ..#.........#######.......#.....# Health: 103/103 ======================== ..#...............#.).....#....## Magic: 13/13 ======================== cgg ..#...............#.......##...## AC: 20Str: 17 ###...............#.......##..... EV: 19Int: 11 ..................#.......##...## SH: 16Dex: 15 ...#########......'.......##...## XL: 13 Next:  0% Place: Dungeon:13 ####cgg #....@.#......)....... Noise: =--------  Time: 15352.9 (0.0) ...##...*@.#.............. a) +4 long sword ...#(..(...#......#.......##..... Throw: 14 darts (poison) '###.......#......##########...## ..÷#....(..#......#............#. ...#.....(.#......#............'. @   Kirke ####......(#......'.......##+###. h   hog ..# .......#......#.......#...... ..# .......#......#.......#...... _There is a stone staircase leading up, spattered with blood here. _Unknown command.Aiming: [0;cggR 10;1mCharmPress: ? - help, Shift-Dir - straight line, f - hogAim: a hog (haloed, chance to affect: 49%)cgg' h   hog (charmed)cgg2 ;hcgg3 h99/103 -==3.9 (1cggQ= cgg? 1 _The hog is charmed. Kirke hits you.cggb<cgg~=cggq\ _Unknown command.cgg (ally target)You slash Kirke!  Kirke is lightly wounded.cgg5-4.8 (0.9cgg'cggq4 _Your hog closely misses Kirke.cgg HH   sphinx (summoned)h   hog (charmed)You barely miss Kirke.  Kirke is lightly wounded.  Kirke mumbles some strange words.cggZ100/103-====cggq!5.7cgg/cggK _Kirke summons a sphinx! Your hog barely misses Kirke.cgg 5Kirke mumbles some strange words.Kirke summons a sphinx! Your hog barely misses Kirke.hit  You block Kirke's attack. Your hog closely misses Kirke.  The sphinx mumbles some strange words.cggG 87/103 ---===-6.7 (1.0cgg cgg U _Something smites you!cggQ   You slash Kirke!  Kirke is moderately wounded.Your hog closely misses Kirke.  cgg Kirke whispers, "Not even holy moly will save you."  You block Kirke's attack. You block the sphinx's attack.  The sphinx hits you but does no damage. The sphinx closely misses you.cgg| O--7cgg cgg 3-cgg^ /  --more--cgg,) _Your hog bites Kirke.cggO4cggQcggcggLKirke casts a spell at you.cggY/You easily resist.cggaWThe sphinx mumbles some strange words.cgg.cgg^8---=8cggcgg_^ _You easily resist. Your hog bites Kirke!  You climb upwards.cgg .....#.....#.......#.#####.#...##...............###.#....##....#....................##...........##..................#. .....##........###.##....#######.###..#...................###...##[.......2 ..#............h@...##....##........##.#@...#####.##.......###.#.#.######......## ..#.#.#...#(.÷..##.... .##................÷#...................÷.#..##cgg` ........................# h   hog (charmed, unaware)##.∩....................<......#.......#...The sphinx disappears in a puff of smoke!cgg0cggl#cgg+8---60.2 (2.5cggcgg5---cgg/  --more--cgg5  Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHu _There is a stone staircase leading down here.cgg<9(ally target))You slash Kirke!  Kirke is heavily wounded.cgg:>9==1.1 (0.9cgg~BcggRE> _You block Kirke's attack. Your hog misses Kirke.cgg/~  You hit Kirke.  Kirke is heavily wounded.cggE(2.0cggcgg˴E _Your hog bites Kirke! You block Kirke's attack.cgg  You barely miss Kirke.  Kirke is heavily wounded.Your hog bites Kirke! Kirke hits you but does no damage.cgg5-3.1 (1.1cggcgg3 _Your hog barely misses Kirke.cgg  You barely miss Kirke.  Kirke is heavily wounded.cgg  Kirke points at you and mumbles some strange words.cggR @@  distracted, ally target)cggS >90==40cggt^ cggf > _You easily resist. Your hog bites Kirke!cggN @@You slash Kirke!  Kirke is severely wounded.cggL.-5cggcggo] _Kirke misses you. Your hog bites Kirke! cgg  You slash Kirke!  Kirke is almost dead. cggɢG-6.0 (0.9 cgg cggM _Your hog barely misses Kirke. You block Kirke's attack. cggT  You slash Kirke!  Kirke is almost dead.Your hog bites Kirke! cgg  p†p   human (charmed)  Kirke dies! cggc1=67.0 (1.0 cgg cggNW _No longer under Kirke's spell, the hog returns to its human form! cggw..#.#####.#...##.........###.#....##....#.............##..##....#.##..###.##....#######.###..#.............###...##[.#......p>...##. #..#........##.### cgg#...###.#.#.######.....#.#.#...#(.÷..##.......# #.##..........÷........#... #......÷........#..###.................∩..........<...... ......#.........##### cgg cgg/--8 cgg cgg} _You see here the human corpse of Kirke. cgg,[#.................###.#####.#...##........###.#....##....#....##.##............#...##........###.##....#######.###..#.###...##[..... ..#............p...#..##.#†...####......#.###.#.#.######......## ..#. cgg\=#.#...#(.÷..##.......## .##...÷........#.........÷........#..##.................# .##.∩.........<#...#. cggwf cggZgZ2=-- cggg&9 _ cggSo cggsc _There is a stone staircase leading down here. cggS 4 cgga  cggi  cggo .70 _ cggN cggvQ7 _You open the door. cggVS3 cggqT cggLWYou open the door. _There is an open door here. _You open the door. _There is an open door here. _You open the door.  There is an open cggW door here. cggP[5 _ cgg[ cggYcg #...#.....#. #...#..)..# ##...##.........###. cggc #.....#.........+... #.....#.........#... #.....#.........# #.....#.........#... ########'##<........#... .........######467.5 (96.0) cgg^dt.........# .........'...20 .........#........ ... cggd......#. .........#. cggda..#####........#........  .. #........#..  ###############+# cgg2eE  cgge cggm cggp _There is an open door here. _You open the door. _There is an open door here. _You open the door. _There is an open door here. _Key pressed, stopping explore. cggI cgg cgg cgg$ _ cgg, cgg cgg> cggc cgg  cgg cgg cgg cgg[ cggw, cggL cgg cggs, cgg cggB cgg cgg cgg cggu cggT, cgg cggO cgg cgg cgg7 cgg_ cggC cgg cggr cgg, cgg cgg@N _You now have 698 gold pieces (gained 21). cgg cggb cgg cggF cgg cgg cgg cgg cgg , cgg# cggr cgg=, cgg# cgg- cgg, cgg cgg7 _You open the door. cggz3 cgg cgg@  There is an open door here. cggo cgg _ cgg cgg cgg cgg cgg cgg cgg cgg cggW cgg cgg, cggX cgg  cgg9 , cgg  cgg cggC%  #......#...#...  #......#...>..#...#....  #......#......#...'...  #?.....# #####.  #......# #...#.  #......# #...#. cggC #.C....# #...'.  #......# #...#.  #@# #...#.  ##.########...##  #........#.....#  #........#.....#  #........#.....#  #........#.....# cggzrC   cyclops (missile, asleep)  #######'##########'##<  #.................  #....................... cgg-88.5 (21 cgg&P.CC) cggf',9.5 (22 cgg- cgg^=Z _A cyclops comes into view. cggQ #......#...> #......# #?.....#  #......#  #......#  #..C...#  #......#  #@#  ##.# #... #.... #..... #...... #######'#####< ... cggR7. .. cggxA  #......#...> #......# #?.....#  #......#  #......#  #..C...#  #......#  #@#  ##.# #... #.... #..... #...... #######'#####< .... .. cgg cgg] cgg cggc^ _A cyclops is nearby! cggny ` #......#...> #......# #?.....#  #......#  #......#  #..C...#  #......#  #@#  ##.# #... #.... #..... cgg1z x#...... #######'#####< .... .. cgg P  #......#...> #......# #?.....#  #......#  #......#  #..C...#  #......#  #@#  ##.# #... #.... cgg6  #..... #...... #######'#####< .... .. cgg  cgg4  cgg  cgg# ^ _A cyclops is nearby! cgg;  #......##+##  #......#......#...#  #......#...>..#...#  #......#......#...'  #?.....# #####  #......# #...#  #......# #...#  #..C...# #...'  #....@.# #...#  #...##.# #...  ### ##.########...##  #..#.....#  #. cgg.#.....#  #..#.....#  #........#.....#  #######'##########'##<  #....... cgg[! cgg$$((( cgg^.@. cgg :=90.5 (1.0) cggn cgg?q _The cyclops throws a large rock. The large rock misses you. cgg (, poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops. cggi(.C cgg„f-1.6 (1.119 cgg֊ cgga. _The cyclops is poisoned. cggc  You throw a poisoned dart. The poisoned dart hits the cyclops. cgg cgg`=2.78 cgg1$ cgg%5 _The cyclops is lightly wounded. cgg׾ m  You slash the cyclops!  cgg LThe cyclops is moderately wounded. cgg l86/103 ----==30 cgg  cgg + _The cyclops hits you! cggu  You slash the cyclops!  The cyclops is heavily wounded. cggn v72---------4 cggؚ  cgg + _The cyclops hits you! cgg  )You slash the cyclops!  The cyclops is severely wounded. cggrG-5.6 (0.9 cggt cgg85 _The cyclops looks more healthy. cggs  You hit the cyclops.  The cyclops is severely wounded. cggts3=----6.5 cgg} cgg5 _You block the cyclops's attack. cgg  You slash the cyclops!  The cyclops is almost dead. cggPn62---=7.5 (1.0 cgg  cggH + _The cyclops hits you! cgg9  You hit the cyclops. cggצ.-8 cgg cgg/[ _The cyclops is almost dead. cgg]1  You hit the cyclops but do no damage.The cyclops is almost dead. cggF2 f3----9 cgg89  cgg< 5 _You block the cyclops's attack. cgg  You hit the cyclops.  The cyclops is almost dead.500 _You block the cyclops's attack.cgg5Q#The cyclops is almost dead. _You block the cyclops's attack.  You hit the cyclops.  The cyclops is almost dead. _You block the cyclops's attack.  You hit the cyclops.cggJYe(cgg]J491cggrccgge _You block the cyclops's attack.  You hit the cyclops.  The cyclops is almost dead. _You block the cyclops's attack.  You hit the cyclopscgg5fG. _You kill the cyclops!cggcggQcggccggH _No target in view!cggx cgg\y cggz cgg} cggE : _cgg ,cgg cgg i5=cggˌ cgg ,cgg- cgg ,cgg cgg֘ cgg D6=cgg cgg ,cgge cgg cggk 97cggן cgg{ ,cggA cggK ,cgg cgg cgg̨ 98cgg cggM ,cgg( cgg ,cggq cgg3 i9=cgg cgg] cgg cggǸ cgg% cggz cgg{ cggϾ cgg< L70=cgg cgg cgg cggZ cgg cgg 21cgg cgg ,cgg cgg` ,cgg cgg cgg 92cgg cgg2 cgg cgg cggL ,cgg cgg: cgg S3=cgg cgg ,cgg cggf cgg X74=cggp cgg` ,cgg- cggN cgg cgg cggD cgg %5cgg cggZ cgg cgga cgg cgg cggT cgg cgg' %6cgg cgg ,cgg[ Q7cggK cggY ,cgg cgg ,cggj cgg cgg2 K8=cgg cgg! ,cgg" cggO% ,cgg& cgg) cgg) U9=cgg* cgg/ ,cgg1 cggf4 ,cgg5 cgg8 cgg]9 &80cgg= cggU@ ,cggA cggC cgg^D %1cgg4E cgg@G ,cggeH cggMJ ,cgg{K cgg{M cggM K2=cgg O cgg(Q ,cggR cggT ,cggU cggW cggsX U3=cggY cggq[ ,cgg\ cgg`_ ;4cgg` cggb ,cgg$d cggf ,cggg cgg*j cggj %5cggk cggm ,cggo cggq cggKr cggs cggu cggfv D6=cggy cgg[z ,cggu{ cggU~ cgg~ U7=cgg cgg= cgg cgg cgg ,cgg cgg cgg %8cgga cggЏ cgg< cgg| cggr ,cgg Q9cggĚ cggv cgg cggL cgg ,cgg cgg cggn &90cgg cgg cgg> cggA cgg a1=cgg? cgg cgg cgg cggh ,cgg cggӷ cggP U2=cgg cgg# ,cgg~ cggu ,cgg cgg cgg %3cgg cgg ,cgg cgg cgg %4cgg cgg ,cgg cgg ,cgg cgg cggH K5=cggY cgg ,cgg cggB h6=789=cgg# Bcgg, q100/103=cgg1 ,cgg12 cggN3 cgg36 cgg6 %1cgg7 cgg: ,cgg; cgg= cgg= cgg? cggcA cggA %2cggB cgg/E cggpE cggF cggH ,cggM w3=cggM cggP cggR cggR cgglW cgg\  f - 19 poisoned darts (gained 1)cgg` v _You see here 5 large rocks.cggcb cggb cggc cgg@g cggg 9=cgg i cgg2n o _f - 20 poisoned darts (gained 1)cggx cgg B _J - 3 scrolls of identify (gained 1)cgg* Bcgg ,cgg cgg; XcggN cgg ,cgg cggw cgg Bcgg7 cggq cgg cgg2 cgg@ cggQ ,cggا cgg cgg ,cggز cgg cgg ,cggp cgg cgg. ,cgg cgg cgg cggE cgg cgg[ cgg ,cgg cgg9 cgg& ,cggO cgg cgg( JcggJ cgg Bcgg cgg cgg cgg cggB cgg  ,cgg cgg8 cgg ,cgg cgg cgg' cggl cgg cggI! cggr# cgg# cggK% cgg(( cgg`+ ,cggd, cgg=/ cgg0 cgg;1 cgg2 cgg8 cgg: ,cggC   There is an open door here. _cggb cggf Bcggg cggi cggk ,cggsl cgg_n cggo cggQp cggp cggtx cggz cggz cggt{ cggn} cggR ,cggC cgg! cgg# ,cgg cgg cgg cggh cgg cgg cggZ cgg cggE cgg cgg$ ,cgg cgg cggh ,cgg5 cggܘ cgg cgg cggW cgg cgg1 ,cgg؟ cgg  #..................# #..................'cgg  #........................# #..................# #........................#cggO  ######......#####........#cgg  #......# #........# #......# ############ #.....@#  -cgg l6660.0) #......+  cggާ #......#20 ########cggP #cgg¨ 8-cggu cgg T _Key pressed, stopping explore.cgg Icggp cgg cgg ,cgg 7 _You open the door.cgg6 cgg cgg cggn cgg cgg cgg cgg  cggJ : There is an open door here.cggP cgg  _cgg cgg cgg$ ,cgg cgg cgg ,cgg cggK ,cgg cgg N _You now have 713 gold pieces (gained 15).cgg 3cgg{ cgg cgg cgg/ cgg cgg& cgg ,cgg} cgg cgg cggS cgg cggU 7 _You open the door.cgg K#......#..... #..................#..... #.................#..... ######......#####.#..... #......#...#........#..... cggm #......#...################+ #......#....# .....  #......'....#.C....  cgg #......#...@'....... ########....#....... #....##....... #....# ..... #..... ..... ##....# ....C   cyclops (missile, asleep) #....# .... .... cgg C72.5 (11.0)C)A cyclops comes into view.cggB K====3.5 (12cggv cgg* ) _The cyclops shouts!cgg #### #... #......#...######## #......#....# .....  #......'....#.C....  #...@'......  #....#......  #....##......  #....# .....  #..... .....  ##....# ....  #....# ....  ....cggH#### #... #......#...######## #......#....# .....  #......'....#.C....  #...@'......  #....#......  cgg`#....##......  #....# ..... #..... ..... ##....# ....  #....# .... .... cgg cggcgg8cggc^ _A cyclops is nearby!cggE)#### #... #......#...######## #......#....# .....  cgg[*#......'....#.C....  #...@'......  #....#......  #....##......  #....# .....  #..... .....  ##....# ....  #....# ....  ....cgg#### #... #......#...######## #......#....# .....  #......'....#.C....  #...@'......  #....#...... cgg #....##......  #....# ..... #..... ..... ##....# ....  #....# .... .... cggcggncgg{cgg^ _A cyclops is nearby!cgg ((, poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.cggCcggL.('CcggMP----4.6 (1.1)cgg3N119cggUcggiY. _The cyclops is poisoned.cgg ( very poisoned)You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker.cgg M '  The cyclops is lightly wounded.cgg *(((((cgg 3 W...@'cgg4 |=---5.78cggu8 cgg; y _The cyclops throws a large rock. The large rock closely misses you.cgg (You throw a poisoned dart. The poisoned dart hits the cyclops.  The cyclops looks even sicker.cggQ cggV MC(cggQW 0-6.8cggW 07cggo^ cggoa 5 _The cyclops is lightly wounded.cggC7e  You slash the cyclops!cgg685==70cggD>cggAb _The cyclops is moderately wounded.cgg)  You slash the cyclops!  The cyclops is severely wounded.cgg!*5=8.7 (0.9cgg0cgg4> _The cyclops hits you but does no damage.cggd;  You slash the cyclops!cggC(cgg+>11-9.7 (1.0cggcgggK _You kill the cyclops!cgg cgg 8-cgg cgg H _No target in view!cggO cggP cggQ cgg T cggW cggZ : _cggba  There is an open door, spattered with blood here.  Things that are here:  4 large rocks; a cyclops corpsecggHc cggc  _cggFd cggf ,cggah cggwj o _f - 19 poisoned darts (gained 2)cggk cggdl cggl cggn cggFo cggo cgg#y _f - 20 poisoned darts (gained 1)cggy cggF| cgg~ cgg! cggP cgg3 cggх ,cggQ cgg cgg\ cggΌ cgg cgg" N.....######....# .....#...##....# .....#...################+#### .....#....#......# .....'....#......# .....#....(......# ........ cgg3 e######....#......# ........#....##......# ........#....##.....@# #+#####--#.....#......+  ##....#......#  20#....#......#.... #......##...#####+## cggK e88.7 (9'.....#.....#.....#....+....#.###cgg @.#cgg cgg7 M======9.7 (10.0)cgg& cgg = _As you open the door, it creaks loudly!cgglcggcggcggcggE ...#cggJ###############+###.#......# . ....'......#....(..... . ######....#.......  #....##......# .......#O....# #+#####.'.....# ## .cggr....#O   two-headed ogre (wandering)cgg2.#cgg~& cgg}0.0)  A two-headed ogre comes into view. It is wielding two +0 giant clubs.cgg.O--90.7 (1 _The two-headed ogre shouts in stereo!cgg]#########......# . .#......# .. .(......# ... #......# ....  #......# .....  #......#.....#  #.....@O.....#  #......#.....#  #....#......#.....#  .... #......# ....+  #...#### ....#  #+## .###  .# cgghH/#########......# . .#......# .. .(......# ... #......# ....  #......# .....  #......#.....# cggH4 #.....@O.....#  #......#.....#  cggH#....#......#.....#  cgg I.... #......# ....+ cgg3I3#...#### ....# #+## .### cggXI8 .# cggI cgg8Qcgg)R9--cggWcgg[f _A two-headed ogre is nearby!cggg#########......# . .#......# .. .(......# ... #......# ....  #......# .....  #......#.....#  #.....@O.....#  #......#.....#  #....#......#.....#  cgg.... #......# ....+  #...#### ....#  #+## .###  .# cggf#########......# . .#......# .. cgg:g.(......# ... #......# ....  #......# ..... cggg #......#.....#  #.....@O.....#  #......#.....#  cggg`#....#......#.....#  .... #......# ....+cggh #...#### ....# cgg9h#+## .###  cggch=.# cggrcggrcgg_zcggo~f _A two-headed ogre is nearby!cgg/G ?  You throw a poisoned dart.cgg P  The poisoned dart hits the two-headed ogre.cgg$ =---1.8 (1.119cgg cgg _The two-headed ogre barely misses you. You block the two-headed ogre's attack.cgg  cgg (poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.cgg cggx t---2.98cggL cgg a _The two-headed ogre is poisoned. You block the two-headed ogre's attack. x2cggr{ very poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.cggcggsX4.07cggcgg  cgg 6_The two-headed ogre looks even sicker.cggW?  You throw a poisoned dart.cgg  The poisoned dart hits the two-headed ogre.  You block the two-headed ogre's attack.cgg(5.1cgg06cggcgg ` _The two-headed ogre completely misses you.cgg@  You slash the two-headed ogre!  The two-headed ogre is moderately wounded.cgg@5=6.0 (0.9cggHcggM@ _You block the two-headed ogre's attack. x2cgg A  You hit the two-headed ogre.cggP!.-9cgg)cggz,j _The two-headed ogre is moderately wounded.cgg  You hit the two-headed ogre.  The two-headed ogre is moderately wounded.cggX G-7.9 (1.0cgg cgg[ _ _The two-headed ogre barely misses you. x2cgg  You slash the two-headed ogre!  The two-headed ogre is heavily wounded.cgg/ %=cggR 8.8 (0.9cggn" cggf%  cgg% w_The two-headed ogre closely misses you. You block the two-headed ogre's attack.cggiV  You hit the two-headed ogre.-9.8 (1.0 _The two-headed ogre is severely wounded.cgg`   You slash the two-headed ogre!  The two-headed ogre is almost dead.You block the two-headed ogre's attack.cgg cgg 0=700.7 (0.9cggHcggF _The two-headed ogre hits you but does no damage.cgg3w  You hit the two-headed ogre.  The two-headed ogre is almost dead.-1.8 (1.1cggt}cgg} _The two-headed ogre misses you. You block the two-headed ogre's attack.cgg7C  You slash the two-headed ogre!cggAC)cggD5=2.7 (0.9 _The two-headed ogre misses you. You block the two-headed ogre's attack.  You slash the two-headed ogre! _You kill the two-headed ogre!cggDTraining target 12.0 for Dodging reached!  Your Dodging skill increases to level 12!need to enable at least one skill for training.cggO/  --more--cggwcgg|M  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1      cggl|+     b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1  cgg|E     l - Evocations   0.0   1.0   0   d - Short Blades   6.6   1.0   0       e - Long Blades  10.7  12.0   0              cgg7} f - Armour   8.0   9.0   0       g - Dodging  12.0  15.0   0  cggZ}T    cgg}i h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1      cgg}        cgg}        cgg}        cgg ~_    cgg,~        cggJ~T    cgg~You need to enable at least one skill.[?] Help[=] set a skill target  cgg~}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetscgg?4 = e + Long Blades 10.7cggw cggV cgg .....#...#........#..........#... deadiverson the Nimble .....#...################+####... Human of the Shining One *****. .....#....#......# . ....... Health: 103/103 ======================== .....'....#......# .. ....... Magic: 13/13 ======================== .....#....(......# ... ........ AC: 20Str: 17 ######....#......# .... ........ EV: 19Int: 11cgg۶ #....##......# ..... ........ SH: 16Dex: 15#....##......#.....# #+##### XL: 13 Next: 15% Place: Dungeon:13#.....#.....@).....#Noise: ==-------  Time: 15702.7 (0.9)##....#......#.....#a) +4 long sword#....#......#.....#Throw: 16 darts (poison).... #......# ....+#...#### ....#cgg #+##.###.# _The two-headed ogre misses you. You block the two-headed ogre's attack.  You slash the two-headed ogre! _You kill the two-headed ogre!Training target 12.0 for Dodging reached!  Your Dodging skill increases to level 12!You need to enable at least one skill for training.cgg cgg cgg . _cggt _  f - 19 poisoned darts (gained 3)  There is an open door, spattered with blood here.  Things that are here: _a +0 giant club; a +0 giant clubcgg,cgg,cgg cggXcggWcggQ,cggIcgg.cgg`,cggLcgg cgg>#,cggL$cgg&cgg),cgg*cgg(.cggA1,cgg2cggP4cggF6,cgg7cgg;cgg=cgg=cgg>cgg@cggJB,cggCcggDcgg6F,cggFcggHcggsJcggJcggrKcgg/McggNcggOcgg=PcggWScggU,cggVcggY7 _You open the door.cgg2\3cgg]cgge@  There is an open door here.cgg hcggh _cggicgglcggn,cgg~r,cgglt,cggkucggBwcggTy,cggezcggcgg,cgg:cggcggq,cgg_cggbcggV,cggcggcgg ,cggJcggcggz,cggȦcgg@  There is an open door here.cggQ5 _cggƮcgg?cgg/,cgg cggcggʸ,cggcggKcgg,cggcggcgg}cggcggcggcgg,cggcggcgg,cggcggcgg,cgg=cggTcggcgg cggcggWcggT,cggcggo_You open the door. _There is an open door here. _There is an open door here.  cggcgg  _cggJcggcggcgg#cggucggcggcggcgg=cggqcgg,cggcgg cgg[cggcggcggcgg. cggZ cgg cgg 7 _You open the door.cgg3cggXcggcggZ,cgg&cgg@  There is an open door here.cggGcgg _cggxcggfcgg^,cggIcggI"cgg#cgg$cggj$cgg%cgg',cggU(cgg;cgg<cgg<cggo=cggDcggFcgg8FcggFcggMcgg\Q,cggQcggMZcggZ,cgg[cggbcggdcggdcggecggmcggocggocggpcggCwcgg ycggfycggzcggcggσ,cggcggcggȍcggcggcggՓcgg_cggcggmcggПcggy,cggcggw@  There is an open door here.cgg7cgg _cggcggScgg],cggϵcggcggO,cggqcggcggcggcggcggcgg,cggVcggcgg_cggcggcgg*cgg,cggcggcgg,cggMcgg>cggb,cggcggcggcggcggWcgg*cggcgg#cggcgg@  There is an open door here.cgga _cggcggcggcggcggcggMcggcggcgg8cggfcggcggcggcgg,cggcgg cggE cgg} cgg cggcgg9cgglcggcggcgg,cggcgg!@  There is an open door here.cggcgg _cggcggcgg!cggQ!cgg!cgg$cgg%cgg%cgg&cggc(cgg)cgg)cggU*cgg.V  There is an open door here.cggC/ _cgg/cgg0cggw2,cgg2cgg#5cgg6cggE6cgg6cggm9TThere is an open door here. _You open the door.cgg:cgg:cgg;cgg>@  There is an open door here.cgg@cgg@ _cggAcggCcggGEcgguEcggFcgg IcggMI,cggJcggKcggM,cggNcggqPcggNR,cggRcggmcggocggocgg}pcggxcgg;zcgg\zcgg={cggcggcggcggcgg'cggcgg̍cggcggUcggcggcggcggMcggcggCcggcggYcgg cgg`cgg٫cgg)cggCcggqcggDcggcgg}cggcggcggcgg/cggcggvcggcgg;cggscggcgg3cgg ,cgg<cggcgg,cggcggcgg,cggBcgg P.....#....'.....######...........#....#######...##'##......#....#.....#cggf~.#...#......####'#.....#>..#...#......>....###'### .....#...'...........#÷...÷# cgg.....#####...........')....# .....#...#...........#######..... .....#...#......#...##.....--cggK809.7 (107.0) .....#...'.cgg.....'...##..... .....#...#......#..........9 cgg/ .....#...#...)..######..... ######...##.........###...##..... cggV....#.....#.........+.....##.....  cgg2....#.....#.........#.....##.....  ....#.....#.........#.....#......  cggz....#.....#.........#.....#...... cggH9--cggcggT _Key pressed, stopping explore.cgg'Icgg8cgg;cgg<@: _cggDcggG,cggIcggOcggR,cggTcgg]cgg_,cggIacggggcggj,cggmmcggrcggu,cgg vcgg{@  There is an open door here.cgg}cgg,~ _cggcggcgg ,cggcgg?cggq,cggcggcggBcgg}cgg,cggߦcggթcgg,cggcggKcggM,cggrcggcgg;cggcggcgg cggOcggcggcggcgg cggcgg>,cggScggcggm,cggcgg cgg,cggcggcggLcgg~cggjcgg@  There is an open door here.cggcgg; _cgg^cggcggcggcgg'cgg+cgg,cgg_cggUcgg,cgg cgg cggv,cgggcggicgg&cgg[cggcggecgg cgg cgg"cgg9%cgg'cgg+,cgg-cgg/0cgg7  Gzone5's ghost turns its malevolent gaze towards you.cggf9cgg9cgg:cgg= _Gzone5's ghost screams in joy, "As in life, so in death: Kill! Kill!! Kill!!!"cgg@3cgg7EcggKcgg2McggXMcggOcggRcggT,cggUcggVcggX,cgg,YcggZcgg"\,cgg\cgg]cggr^,cgg^cggd`cggja,cggacggIc7 _You open the door.cggUd3cggdcggh@  There is an open door here.cggap[#ß?+#.....#....#  .# W#.........'.....#....#  .####.#########.....#....#  ....................+....#  ..................#....#  ............######  ...........#....#  ..........'....+  .)........#@...#  .##########....#  cggp.# #....#  ####'## '....#  ......# #....#  cggp..# #...##   c   centaur warrior (asleep)..# #...#  .## .c...   ###### cggXy 45.7 (36.0)clauncher)cA centaur warrior comes into view.The centaur warrior wields a +0 shortbow.cggf((((((cggn ......The centaur warrior shoots an arrow. You block the arrow.cgglf((((((cgg7^......cggVh99/103 -=6.7 (37cggrcgg,N _The centaur warrior shoots an arrow. The arrow hits you.cgg?+   .#### ....... ...... ............###### ...........#....# ..........'....+ )cggE#@...# #....#  #....#  '....#  #....#  #...##  #...#  .c... cgg /?+   .#### ...... ...... ............###### ...........#....# ..........'....+ )cgg{ #@...# #....#  #....#  '....#  #....#  #...##  #...#  .c... cgg̒ cgg cgg cgg f _A centaur warrior is nearby!cgg, D?+   .#### ....... ...... ............###### ...........#....# ..........'....+ )#@...# #....# cgg_-  #....#  '....#  #....#  #...##  #...#  .c... cgg ?+   .#### ...... ...... ............###### cgg :...........#....# ..........'....+ )#@...# #....#  #....#  '....#  #....#  #...##  #...#  .c... cgg" cgg cgg? cgg f _A centaur warrior is nearby!cggI (((((((You throw a poisoned dart.cgg ......cThe poisoned dart closely misses the centaur warrior.cggl(((((((cggpv@......cggWq100/103-7.8 (1.1)8cggzcgg}x _The centaur warrior shoots an arrow. The arrow closely misses you.cggi (((((cgg, poisoned)(You throw a poisoned dart.  The poisoned dart hits the centaur warrior.cgg1~'...... ((((((The centaur warrior is poisoned. The centaur warrior shoots an arrow.cggv^......cgg\ (((((((You block the arrow. The centaur warrior shoots an arrow.cggv@......cggіX8.97cggcggŠV _The arrow completely misses you.cgg)lX (((cgglM((((You throw a poisoned dart.cggcgg .....cThe poisoned dart closely misses the centaur warrior.cgg_(((((cggW.....cgga150.06cgg>cggO _The centaur warrior shoots an arrow. You block the arrow.cgg1 i (((((cgg very poiso…)You throw a poisoned dart.  The poisoned dart hits the centaur warrior.cgg W.....cggՆ g (((((cgg> aThe centaur warrior looks even sicker. The centaur warrior shoots an arrow.cggw W.....cggG X1.15cgg) cgg6 < _The arrow hits you but does no damage.cgg2 (((((You throw a poisoned dart.  The poisoned dart hits the centaur warrior.cggZ W.....cgga (((((((The centaur warrior looks even sicker. The centaur warrior shoots an arrow.cgg s.@.....cggH cgg (((((The arrow closely misses you. The centaur warrior shoots an arrow.cgg\}W.....cggM~86/103 ---=2.24cggcgg0) _The arrow hits you!cgg# (((((You throw a poisoned dart.cggk .....The poisoned dart hits the centaur warrior.cggr_(((((cggd .....The centaur warrior shoots an arrow. You block the arrow.cggQk(((((((cggV.@.....cgg7----3.4 (1.23cggcggfp _The centaur warrior shoots an arrow. The arrow misses you.cggT5#.#♣)#.#.....#....# #.#ß?+.#.....#....# '.# W#.........'.....#....# #.####.#########.....#....# #..cgg&6.......+....# #.........#....# ..###### ...........#....# ..........@....+ .)........#....# .##########....# .......# #....# #####'## '....# .# #....#cgg_6 .# #...## ..#cgg6 #c..# ......##.(... cggA$)cgg'Il)((((((cggz)......cgge74---=40cggOA)cggD _The centaur warrior shoots an arrow. The arrow hits you! _There is an open door here.cggQ .#.#ß?+.#.....#....# .'.# W#.'.....#....# .#.####.#########.....#....# .#....................+....# #......#....# ..###### .#....# .'....+ )#....# .##########....# .# #....# +#####'## '....# ........# #....#.# #...##.# #c..## .(... ########cgg cgg 6--5 _cggw cgg cgg 5---cggղ g6cggC cgg7 cgg cggu ,cggƹ cggw pc--c   centaur warrior (launcher, very poiso…)cgg p   human (wandering)cgg ?+  .. ########. ......... ......... cgg[ B..p.....###### ........#....# ........c....+ ).......@#....# 9.4 (4#########....#     cggI     #c..#  .(...  _You start resting.cgg?+  .. ########. ......... ......... ..p.....###### ........#....# ........c....+ cgg).......@#....# #########....#        #c..#  .(cggcgg'cggl*f _A centaur warrior is nearby!cggC  You slash the centaur warrior!cgg] .pcggsvery poisoned)The centaur warrior is lightly wounded.  The centaur warrior unwields a +0 shortbow.cgge?5==60.3 (0.9cggcgg\ _You block the centaur warrior's attack. The centaur warrior kicks you.cggOC  You slash the centaur warrior!cggY .p cggZ=The centaur warrior is heavily wounded.cggZd72-1.3 (1.0cgg^bcggd[ _The centaur warrior hits you. You block the centaur warrior's attack.cgg {  You slash the centaur warrior!  The centaur warrior is severely wounded.You block the centaur warrior's attack.cggV .   The centaur warrior kicks you but does no damage.  The centaur warrior hits you but does no damage.cgg%=cggJ 2cggcggG _The centaur warrior kicks you but does no damage.cgg  You slash the centaur warrior!  The centaur warrior is almost dead.cgg cgg 5-3.2 (0.9cgg cgg @ _You block the centaur warrior's attack. x2cgg/ &  You hit the centaur warrior but do no damage.The centaur warrior is almost dead.You block the centaur warrior's attack. The centaur warrior barely misses you.cgg/ =3=cggQ0 J--4.1cgg6 cggH: @ _You block the centaur warrior's attack. x2cgg`  You hit the centaur warrior.  The centaur warrior is almost dead.cggau2--5.1 (1.0cggicgg@j[ _The centaur warrior hits you. You block the centaur warrior's attack.cggcC  You slash the centaur warrior!cggC)cgg5 96 cgglF_You kill the centaur warrior!cggcgg2W _Your Long Blades skill increases to level 11!cggvcgg m#.#♣)#.#.....#....#  #.#ß?+.#.....#....#  '.# W#.........'.....#....#  #.####.#########.....#....#  #......+....#  #.....#....#  ######  #....#  .....+ cgg&nz )........#....#  ##########....#  .......# #....#  #####'## '....#  # #...C#   C   cyclops (missile, wandering)# #...##  #(..# cggunx .......(... cggi  A cyclops comes into view.cgg۔C.C)3===7cggA)cggk _The cyclops shouts!  There is an open door, spattered with blood here. _You see here a +0 shortbow.cgg? m) ?+   ####### ....... ....... .......###### .......#....# .......@....+ )........#....# ########....#  #....# cgg@ '...C#  #....#  #...##  #(..#  .(... cgg j) ?+   ####### ....... ....... .......###### .......#....# .......@....+ )........#....# ########....#  #....#  '...C#  #....#  #...## cgg #(..#  .(... cggQ cgg cgg cggb ^ _A cyclops is nearby!cggܭo.#ß?+.#.....#....#  .# W#.'.....#....#  .####.#########.....#....#  ....................+....#  .......#....#  .######  #....#  )....+  )........#@...#  ##########....#  # #....#  ####'## '...C#  ......# #....#  # #...##  # #(..#  ## .(...  ######   cgg-cgg7---8 _cggcggcgg|*# W#.'.....#....#  ####.#########.....#....#  ...................+....#  ......#....#  ######  .....#....#  .....)....+  )........#....#  ##########.@..#  cgg+# #....#  ###'## .'...C#  .....# ...#....#  # ....##...##  # .... #(..#  ## ... .(...  ##### .. ..... cggF,U   cgg5cgg=$(cgg8.cgg49------====9cggcgggP _The cyclops throws a large rock. The large rock hits you!!cggcggcgg cgg^ _You are too injured to fight recklessly!cggoFcggFcggOcggzR^ _You are too injured to fight recklessly!cggR ##.#########.....#....#  ..................+....#  #....#  ######  ....#....#  ..)....+  )#....#  ##########....#  # #..@.# cggS 7 ##'## ....'...C#  ....# ....#....#  # ....##...##  # .... #(..#  ## ... .(...  #### .. ......  cgg%T z .#.....   cggh cggri 35---------===-70cggs cggBw + _The cyclops hits you!cgg:N-cgg9BcggdD^ _You are too injured to fight recklessly!cgg 4cgg cgg ^ _You are too injured to fight recklessly! cgg cgg|Drink which item? Potions  e - 2 potions of enlightenment  i - 2 potions of cancellation  k - 5 potions of mutation  q - 2 potions of attraction  t - 2 potions of heal wounds  u - a potion of magic  cgg z - a potion of haste  C - 4 potions of curingE - a potion of brilliance  G - a grey potion  Q - 2 bubbling red potions [!] read|quaff|evoke[?] describe selected!cgg,!cgg"!cggU###.#########.....#....#   deadiverson the Nimble ..................+....#   Human of the Shining One *****. ..................#....#   Health: 35/103 ========---------------- .............######!cgg6  Magic: 13/13 ======================== .............#....#  AC: 20Str: 17 .............)....+  EV: 19Int: 11 ....)........#....#  SH: 16!cgg(Dex: 15 ....##########....#  XL: 13 Next: 19% Place: Dungeon:13 ....##..@.#!cggQ  Noise: ===------  Time: 15870.1 (0.0) ##'## ....'...C#  a) +4 long sword !cggt....# ....#....#  Throw: 13 darts (poison) !cgg....# ....##...## !cgg....# .... #(..# !cgg,...## ... .(...  C   cyclops (missile) !cgg#### .. ...... .#.....!cgg,w  _The cyclops throws a large rock. The large rock hits you!! !cggP_You are too injured to fight recklessly! _You are too injured to fight recklessly! !cgg_The cyclops hits you! _You are too injured to fight recklessly! _You are too injured to fight recklessly!!cgg!cggo56=====--1.1 (1!cgg!cggK _You feel much better. You block the cyclops's attack.!cgg> e  You slash the cyclops!!cggh? b7======-!cgg? &2.0 (0.9!cggdJ !cgg/M b _The cyclops is moderately wounded.!cgg+n  You slice the cyclops!!  !cggR,JThe cyclops is severely wounded.!cgg,5=3.0 (1.0!cgg7K _You block the cyclops's attack."cggOc  You hit the cyclops.  The cyclops is almost dead."cgg*d4--9 (0.9"cggkk"cggn5 _You block the cyclops's attack."cgg@9  You hit the cyclops."cgglA_8--4.8"cggH"cgg K[ _The cyclops is almost dead."cgg;  You slash the cyclops!"cggyj("cgg"1215.7"cgg)"cggu,K _You kill the cyclops!"cggKE .................+....#  #....#  ######  ...#....#  )....+  )#....#  ##########....#  # ...#....#  #'## ....'...@#  "cggE c...# ....#....#  # ....##...##  # .... #(..#  ## ... ..(...  ### .. .......   ..#.....  ###....   "cggbK "cggK \61=-"cggK 6.7 (1.0"cgg6S "cggU q _You see here 6 large rocks."cgg "cggr "cgg" "cgg% "cggt& K2="cgg.* "cgg/ X"cgg^1 ,"cgg>2 "cggx2 93"cgg3 "cgg4 ,"cggP8 e4"cggW9 "cgg: ,"cggv< "cgg> ,"cgg? "cggA i5="cggA "cggRC "cggC "cgggI "cggQ 6="cggPR ,"cggR "cggT "cgg@T 97"cggT "cggV "cgg/V "cggV "cggW "cggX "cggX "cggY O8"cggZ "cgg[ "cgg[ "cgg\ "cgg] "cgg!^ "cgg^ "cgg_ "cgg ` S9="cgg` "cggb ,"cggb "cggc L70="cgg1d "cggd "cggf ,"cggf "cggUh ,"cgg%i "cggij "cggj 91"cggl "cggOn ,"cggn "cggQp ,"cgg6q "cggGr "cggfr 92"cgg7s "cggt "cggt "cgg)v "cggbx "cggx "cggy "cgg~ "cggb~ S3="cggF "cggc ,"cgg "cgg˄ "cgg# X74="cggJ "cggD ,"cgg "cgg "cgg "cgg< "cggȒ "cggs %5"cggڔ "cggU ,"cgg X"cgg ;6"cgg "cggv ,"cgg "cgg ;7"cggs "cgg ,"cgg "cggʲ "cgg "cgg` "cgg' "cggg 58="cgg "cgg "cgg5 ,"cgg3 "cgg ,"cgg "cgg 99"cgg 2="cggF "cgg "cgg "cgg "cgg] "cgg &80"cgg "cggF "cgg "cggN "cgg 1"cgg ,"cgg "cgg "cgg "cgg^ "cgg3 "cggp D2="cgg "cgg ,"cggX "cgg ,"cggf "cgg 93"cgg 2="cgg5 "cgg "cgg "cgg "cgg ;4"cgg "cgg ,"cgg "cgg$ ,"cgg "cgg( ;5"cggn "cgg7 ,"cgg "cgg ,"cgg "cgg a6="cgg "cgg,"cgg"cgg97"cgg 2="cggV"cgg,"cgg "cgg! ,"cgg"cgg "cgg=%8"cgg"cgg,"cggN"cgg,"cgg"cggR"cgg%9"cgg#"cgg&,"cggX("cgg*,"cgg-"cggl."cgg.&90"cgg0"cgg2"cgg2"cgg>4"cgg6"cgg\7D1="cgg8"cgg:,"cggT<"cgg>"cgg>"cgg?"cgg-B"cgg{B?2="cggB"cggC"cggMF,"cggH"cggJ,"cggPg3"cggjQ,"cgg?R"cggT"cggT%4"cggXV"cggX,"cggWZ"cgg[,"cggq]"cgg=_"cggl_K5="cgg`"cggb"cgg!c"cggd"cggUg,"cggh"cggj"cgg8k"cgg[kN6="cggl"cggo"cgg"p"cggCq"cggv;7"cgg(x"cggz,"cggW}"cgg,"cgg?"cgg"cggA%8"cgg~"cggs"cgg"cgg"cgg,"cggN"cgg"cggK9="cgg"cgg,"cgg"cgg100/103="cggu"cgg"cggU"cgg"cgg=%1"cgg2"cgg"cgg˭"cgg#"cggn"cgg"cggW"cggε;2"cgg׶"cgg/,"cgg"cggú,"cgg"cgg - _You start resting."cgg72987.7 (111.0)"cgg #3"cgg:7=82"cgg"cgg" _HP restored.#cgg3u#cgg4,#cgg:#cgg D###### .....#....# .....)....+ )........#....# ##########....# ..# ....#....# ###'## ....'...(# ..# ....#....# .....# ....##.@.## 9.0)..# .... #(..# .## ... ..(.... ##### ..>..........  ....#..........  #####....##....  ##...# [0;#cggD^10;1m....  ..... ...  #cggJIB90.7 (2#cggL#cggKN; _Found a stone staircase leading down.#cggA I#cgg-C #cggE #cgg\E #cggI #cggJ 9=#cggJ #cggL #cggO o _f - 16 poisoned darts (gained 3)#cggFR #cggR #cggHZ B#cgg[ #cgga o _f - 19 poisoned darts (gained 3)#cgg/e 3#cggg #cggpj #cggl ,#cggo #cggq #cggt #cggu #cggav #cgg*y #cgg{ #cgg| #cgg} #cggs #cggȂ #cgg #cgg #cgg #cggW #cgg #cggu #cgg #cgg ,#cgg– #cgg% #cgg: #cggx #cgg #cgg #cgg #cgg/ #cgg} #cgg ,#cgg #cgg p _z - 2 potions of haste (gained 1)#cgg7 #cggy #cggi #cgg #cgg\ #cgg #cgg #cgg #cgg{ #cgg #cgg #cggZ #cggb #cgg #cgg #cgg6 #cgg #cggA #cggZ #cgg. #cgg #cgg #cgg #cggX #cgg #cgg #cgg #cgg #cgg #cgg #cgg #cgg #cgg5 #cggt #cgg0 #cgg #cgg ,#cgg #cgg) #cgg #cgg& #cgg #cgg #cgg #cgg #cgg_ #cgg #cgg$ #cgg\ #cgg #cgg #cgg #cggF #cgg #cgg #cggO #cgg #cgg8 #cgg, #cgg #cggX #cgg #cgg #cggY #cgg #cgg #cgg #cgg ,#cgg #cgg #cgg #cgg #cggB #cgg #cgg ,#cgg #cgg #cgg #cgg& #cgg #cgg  @  There is an open door here.#cgg #cgg   _#cgg #cggV #cggy ,#cggK #cgg #cgg  ,#cgg #cgg @  There is an open door here.#cgg< a _#cgg ,#cgg #cgg #cgg ,#cgg #cgg&" #cgg# ,#cgg$ #cgg% #cggM' ,#cgg( #cgg) #cgg+ ,#cgg+ #cgg6- #cgg1 X#cgg1 ,#cgg2 #cggu4 #cgg5 #cgg6 #cgg6 #cgg;8 #cgg9 #cgg9 #cgg: #cgg)C u  There is an open door here. _#cggC #cgg{G #cggH #cgg[I #cggI #cggN B#cggO #cgg7R #cgggS #cggT ,#cgg&W #cggX ,#cggY #cgg] B#cggA^ #cgg` #cggb #cgg.b #cggb #cgg;e #cggf #cggg #cggg #cggxj #cggk #cggk #cggnl #cggo @  There is an open door here.#cgg"q #cggq  _#cggHr #cgg.t #cggu #cggu #cggv #cggy @  There is an open door here.#cggz #cggG{  _#cgg{ #cgg} #cgg~ #cgg  #cgg #cggل X#cgg0 #cggF #cggv #cgg #cgg #cgg #cggN #cgg #cgg #cgg #cgg #cgg #cgg #cggΓ #cgg #cgg #cgg #cgg #cgg; #cgga #cgg #cgg #cgg #cggҠ #cgg #cggr #cgg #cgg% #cgg #cgg ,#cggӲ #cgg2 #cggG #cgg #cgg #cgg1 #cgg #cgg #cgg #cgg #cggD #cgg} #cggW #cgg} JThere is an open door here.  #cgg #cgg9  _#cgg} #cgg #cgg #cgg #cgg, #cgg\ #cggc #cgg #cgg #cgg #cgg #cgg #cgg #cggQ G  , spattered with blood here. #cgg  You see here a +0 shortbow.#cgg #cgg&  _#cggc #cgg #cgg] #cgg #cgg0 #cggM #cgg #cgg@ #cgg8 #cgg #cgg ,#cgg]" #cgg% #cgg( #cgg( #cgg, #cgg0 #cgg4 ,#cgg7 #cgg9 #cgg< ,#cgg> #cggC #cgg[G #cggJ #cggkJ #cggL #cgg*P #cggFT ,#cggZ #cggG_ #cgge #cgge #cggsj #cgg #cggϋ #cgg6 #cgg #cgg ####......'.......##+###.. .###......#.......#....... .###......#.......#............'......#.......#.....#' ###.......#......#.......#...[.+. .##.......#.####.#.......#.....#. .##.......#.#♣)#.........#.....#. .##.......#.#ß?+.........#.....#. .#........'.#♣W#@........'.....#.6078.7 (88.0)#........#.####.#########.....#. .##.......#....................+.9 .####+#####....................#. .#..................######. .#........................#....#. W   Gzone5's ghost )'.)......................)....+.[#cgg J39;49m .#...............)........#....#. .#...............##########....#.#cgg #cggJ #cgg #cgg q)0.0)........#cgg 8..)..#cgg  _Could not explore, unopened runed door.$cgg Z3$cgg7\$cgg=B)$cggx$cgg4$cgg] _Could not explore, unopened runed door.$cggT3$cggKV$cggD4$cgg$cgg\] _Could not explore, unopened runed door.$cgg 3$cggʛ $cgg &)$cgg $cggs B)$cggy ] _Could not explore, unopened runed door.%cgg]%cggc^%cgga%cgg4%cgg%cggh] _Could not explore, unopened runed door.%cgg###.......#......'.......##+###.. deadiverson the Nimble .##.......#......#.......#....... Human of the Shining One *****. .##.......#......#.......#....... Health: 103/103 ======================== %cgg..........'......#.......#.....#' Magic: 13/13 ======================== ###.......#......#.......#...[.+. AC: 20Str: 17 .##.......#.####.#.......#.....#. EV: 19Int: 11 .##.......#.#♣)#.........#.....#. SH: 16Dex: 15 .##.......#.#ß?+.........#.....#. XL: 13 Next: 21% Place: Dungeon:13 %cgg!.#........'.#♣W#@........'.....#. Noise: ---------  Time: 16078.7 (0.0) .#........#.####.#########.....#. a) +4 long sword .##.......#....................+. Throw: 19 darts (poison) .####+#####....................#. %cggR&.#........................######. .#........................#....#. W   Gzone5's ghost )'.)......................)....+. .#...............)........#....#. .#...............##########....#. %cggf_Could not explore, unopened runed door. _Could not explore, unopened runed door. _Could not explore, unopened runed door.  Press: ? - help, v - describe, . - travelThe floor.  This square is lit by a halo.%cgg c+@A runed translucent door.&cgg{C)+  Press: ? - help, v - describe, . - travel, g - get itemItem here: the +8 Vampire's Tooth {megavamp}.  The floor.&cgg! ###.......#......'.......##+###.. deadiverson the Nimble .##.......#......#.......#....... Human of the Shining One *****. .##.......#......#.......#....... Health: 103/103 ======================== ..........'......#.......#.....#' Magic: 13/13 ======================== ###.......#......#.......#...[.+. AC: 20Str: 17 .##.......#.####.#.......#.....#. EV: 19Int: 11 &cgg .##.......#.#♣)#.........#.....#. SH: 16Dex: 15 .##.......#.#ß?+.........#.....#. XL: 13 Next: 21% Place: Dungeon:13 .#........'.#♣W#@........'.....#. Noise: ---------  Time: 16078.7 (0.0) .#........#.####.#########.....#. a) +4 long sword .##.......#....................+. Throw: 19 darts (poison) .####+#####....................#. .#........................######. .#........................#....#. W   Gzone5's ghost )'.)......................)....+. .#...............)........#....#. .#...............##########....#. _Could not explore, unopened runed door. _Could not explore, unopened &cgg: runed door.  Press: ? - help, v - describe, . - travel, g - get itemItem here: the +8 Vampire's Tooth {megavamp}.  The floor.  This square is lit by a halo.&cggp &cgg &cgg . _'cggK$)'cgg٩'cggϲB)'cgg|F _Unknown command.(cggH5(cgg6Where to? (Tab - D:13, ? - help)  D - Dungeon  T - TempleL - LairO - Orcish Mines (cggv(cgg֢###.......#......'.......##+###.. deadiverson the Nimble .##.......#......#.......#....... Human of the Shining One *****. .##.......#......#.......#....... Health: 103/103 ======================== ..........'......#.......#.....#' Magic: 13/13 ======================== ###.......#......#.......#...[.+. AC: 20Str: 17 .##.......#.####.#.......#.....#. EV: 19Int: 11 .##.......#.#♣)#.........#.....#. SH: 16Dex: 15 .##.......#.#ß?+.........#.....#. XL: 13 Next: 21% Place: Dungeon(cggs:13 .#........'.#♣W#@........'.....#. Noise: ---------  Time: 16078.7 (0.0) .#........#.####.#########.....#. a) +4 long sword .##.......#....................+. Throw: 19 darts (poison) .####+#####....................#. .#........................######. .#........................#....#. W   Gzone5's ghost )'.)......................)....+. .#...............)........#....#. .#...............##########....#. _Could not explore, unopened runed door.  Press: ? - help, v - describe, . - travel, g - get itemItem here: the +8 Vampire's Tooth {megavamp}.  The floor. _This square is lit by a halo. _Unknown command.(cgg(cgg_(cggk(cgg$ _(cgg(cggY(cggS(cgg(cgg(cggO(cgg(cgg;(cggC(cgg1(cgg,(cgg(cgg!(cgg,(cgg)(cgg(cgg,(cgg(cgg (cgg (cgg(cgg(cgg,(cgg4(cggE(cgg,(cggY(cgg(cgg!(cggW"(cgg#(cgg:)y  There is an open door, spattered with blood here.  You see here a +0 shortbow.(cggf+(cgg+ _(cgg-(cgg/(cgg1,(cgg3(cgg5(cgg7(cgg7(cgg;(cggi>(cggA(cggPB(cgg5F(cggH%  (cggIThere is an open door here.(cggK(cggNL _(cgg@N(cggP(cggS,(cggU(cggY(cgg\,(cgg_(cgga(cgg3d,(cgge(cggh(cggj(cggBj(cggqk(cggmY  There is a stone staircase leading down here.(cgg@q,(cggPr$ _(cggr(cggO 4(cggP (cggj  You climb downwards.  The two-headed ogre shouts in stereo! x2; You hear a shout!(cggz @You climb downwards.  The two-headed ogre shouts in stereo! x2; You hear a shout! _You hear an angry buzzing noise. You hear a shout!  Found five items. Found a gate to the Vaults  Found a stone staircase leading down.re is a stone staircase leading up here.(cggg5(cggIA #........# ..?.  (cggA>#.../...)# [...  #........#.....  #........#.....  #............O#  (cggA#...........O∩#  #...........###  (cgg*B#..^... ===100.5 (21.8) #....>......#.#  #..............  (cggB#.........###.. #...# . #..#OO 2 two-headed ogres (cggB#......$..# ...# (cggC(cggQ(cggR(cgg^/  --more--)cgg b _There are monsters nearby!)cgg9 l((((You throw a poisoned dart.)cgg, )cgg- )cgg? ?....O)cgg@ ).)cgg i-1.6 (1.1)8)cgg? )cggq 9 _The poisoned dart hits the two-headed ogre.)cgg0 ((((1 poisoned)You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.)cggKm,)cggn)cgg/0OO(O(..O   ogre mageThe two-headed ogre is poisoned.)cggeq---2.8 (1.27)cgg)cggÔ)cggx _An ogre mage comes into view. It is wielding a +0 flail.*cggA ((You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.*cgg[b  The two-headed ogre is lightly wounded.*cgg,*cgg*cggg.OO..(.Og   boggart (wandering)*cggcx--3.9 (1.16*cgg*cggZ _A boggart comes into view.*cggAnM( very poisoned) _A boggart comes into view.  You throw a poisoned dart.  The poisoned dart hits the two-headed ogre.  The two-headed ogre looks even sicker.*cggbL  The two-headed ogre is lightly wounded.*cggz gO(g  The boggart shouts!*cgg:**cggH fast, 1 very po…)The ogre mage casts a spell at the two-headed ogre.*cgg4*cgg5*cggO.g.O*cggvPa==5.05*cgge3*cgg~/  --more--*cgg/ : _The two-headed ogre seems to speed up.+cgg+cgg+cgg+cgg+cgg+cgg7OThe two-headed ogre hits you with a +0 giant club!+cgg+cggg..OO..+cggp a95/103 --60+cggn+cgg$ ..........)........#....#....# ..........##########....#....# ..........#........#....#....# .#+#####'##+cgg% .'...(#....# .'........#.#....#....# .#........###...##....# .#........###...##....# .#.......##..................#3 .#########......@............# .#+cggb% .O..#..........# ###########....##....# .#+cgg% J ##...##....# .# #.....#....# .# #.....#....#   two-headed ogre (very poisoned) +cgg' C## ##############....#....###............#....#....##....#........#...##....# _The two-headed ogre hits you but does no damage.  You climb upwards.+cgg' 9--+cgg9 +cgg[ >6--7.5 (2.5+cggf +cgg _Level annotation: 1 runed translucent door, Gzone5's ghost, journeyman MiBe _There is a stone staircase leading down here.+cgg5   You hit the two-headed ogre.  The two-headed ogre is lightly wounded.=-8.5 (1.0 _You block the two-headed ogre's attack. x2,cgg`1n  You slice the two-headed ogre!!,cgg126==9.4 (0.9,cggW>} _The two-headed ogre is heavily wounded.,cgg  You slash the two-headed ogre!  The two-headed ogre is almost dead.,cgg1710.3,cggɉ,cggɌ@ _You block the two-headed ogre's attack. x2,cggC  You slash the two-headed ogre!,cgg\D),cggW>5--1.4 (1.1,cgg,cggS _You kill the two-headed ogre!,cgg,cgg(9--,cgg,cggH _No target in view!,cgg ).#....#....# #....#....# ,cgg? /#.#....#....# #+#####'##.'...(#....# '.#.#....#....# #.#.##...##....# #.#.##...##....# #.##.# #......># # #.....)..#.#  #....##....# # ##... # #.....#....# # #.....#....# #....#....# ,cgg ,cgg! C8-20 _,cgg' ,cgg+ ,cgg).#....#....# ###....#....# #..#....#....# +#####'##..'...(#....# .#..#....#....# .#.##...##....# .#.##...##....# .##.# ......>.# ,cgg #.....)..#.#  ##....##....#  ##. #... #....  #....##.#....#....# ,cgg,cgg@-3,cgg,cgg-cgg).#....#....#  ##########....#....#  #........#....#....#  #####'##........'...(#....#  #........#....#....#  #.##...##....#  #.##...##....#  ##.#  ......>.#  #.....)..#.#  ###....##....#  ##...##....#  #.....#....#  #.....#....#  -cgg #....#....#   ##.#....#....#   #....#.#...##....#   -cgg-cgg{&4-cgg-cgg>-cgg##########....#....#  #........#....#....#  ####'##........'...(#....#  ......#........#....#....#  #.##...##....#  #.##...##....#  ##...........#  ######......>#  -cggh #.....)..##  ##########....##....#   ##...##....#  #.....#....#  #.....#....#  ##############....#....#  ##............#....#....#  #....##...##....#  #....#.##'###....#  -cggo-cggT9=5-cgg-cgg-cggO#........#....#....#  ###'##........'...(#....#  .....#.#....#....#  #.##...##....#  #.##...##....#  ##...........#  #####......>-cggQ&#   #.....)..##  ##########..@.##....#   ##...##....#  #.....#....#  #.....#....#  ##############....#....#  ##............#....#....#  #....##...##....#  #....#.##'###....#  #....#.#.........#  -cgg(Z-cgg[&6-cgg`-cggkc-cgg -cgg nLevel 13 of the Dungeon <<<>>>(Press ? for help)  #........................#.........)'.)......................)....+....#   #........................#..........#...............)........#....#....#   #........................#..........#...............##########....#....#   ######......#####........#..........#...............#........#....#....#  #......#...#........#..........#......#+#####'##........'...(#....#  #......#...################+####......'........#........#....#....#  #......#....#......#..................#........#.......##...##....#  #......'....#......#..................#........#.......##...##....#  -cggf #......#....(......#..................#.......##..................#  ########....#......#..................#########......>............#  #....##......#...............[..##.....)..#..........#  #....##......#.....####'###################..@.##....#  #.....#......).....#............###...##....#  ##....#......#.....#............##.....#....#  ##....#......#.....#............##.....#....#  #.....#......#.....+.....######## ##############....#....#  #....##...####.....#.....###............#....#....#  #....##'###......###.....##....#........#...##....#  #.........#......#.......##....#........##'###....#  #.........#......#.......##....#........#.........#  #.........#......#.......##....'........'.........#  #.........#......#.......##....#........#.........#  ###########......###############........###########-cgg& T.@.cggB...cgg2B...cggB...cgg]5A...cggA...cggY/A...cggWA...cggI   #........................'..........#........................#....#....##..cgg   #........................#..........#........................######....#.#.cggL   #........................######.....####+#####....................#....#...cggY   #######'##########'##<........#.....##.......#....................+....#...cgg z  #........#.....#.........#.....#........#.####.#########.....#....#.cgg 5...cgg  #........#.....#.........#.....#........'.#♣W#.........'.....#....#...cggP  #........#.....#.........#.....##.......#.#ß?+.........#.....#....#...cgg  #........#.....#.........+.....##.......#.#♣)#.........#.....#....##..cgg` 7.#/cggz7#./cggl7.#/cgg7../cggS)../cgga)../cggS)../cgg   ######.########...##.........###...##.......#.####.#.......#.....#....#)..0cgg%k   #...##.#......#...#.........)..######.......#......#.......#...[.+....#..0cgg   #...(..#......#...#............#............'......#.......#.....#'######.0cggn^   #......#......#...'............'...##.......#......#.......#...........###0cgg   #......#......#...#............#...##.......#......#.......#...........###)0cggbL   #......#......#...#...........#######.......#......'.......##+###......#.#)0cggmM0cggV   #......#......#####...........')....#.......#......#............'......#..0cgg   #......#......#...'...........#÷...÷#.......#......#............#.)....#0cgg]5#.0cgg-   #......#...>..#...#......>....###'###.......#......##########...##########0cgg3q   #......#......#...#......####'#.....#.......#......#.......##.........#.#)0cggD   #......#......##'##......#....#.....#.......#......#..................#..)0cggj   #......#.................#....#######.......#....<.#......)...........#..0cgg{ E..)0cgg: 7>.1cgg,&1cggG.....#........#....#....#   deadiverson the Nimble ###'##........'...(#....#   Human of the Shining One *****. .....#........#....#....#   Health: 99/103 =======================- .....#.......##...##....#   Magic: 13/13 ======================== .....#.......##...##....#   AC: 20Str: 17 ....##..................#   EV: 19Int: 11 #####......>............#   SH: 16Dex:1cggH[40m 15#.....)..#..........#   XL: 13 Next: 25% Place: Dungeon:13##########..@.##....#   Noise: ---------  Time: 16116.4 (0.0)##...##....#   a) +4 long sword#.....#....#   Throw: 15 darts (poison)#.....#....#  ##############....#....#  ##............#....#....#    #....#........#...##....#    #....#........##'###....#    #....#........#.........#   You slash the two-headed ogre!  The two-headed ogre is almost dead. gg I49m_You block the two-headed ogre's attack. x2  You slash the two-headed ogre! _You kill the two-headed ogre! _No target in view!1cggJ1cggc1cgg^f1cggf1cggl1cggMs1cgg^vA100/1031cggw1cgg1cggÈ,1cggK1cgg1cgg1cggF1cggQ11cgg1cggv1cgg&,1cgg1cgg1cgg,1cgg1cgg1cgg 1cggm%21cggD1cggj1cggG1cgg1cgg^1cgg 1cgg ,1cgg1cggs1cgg1cgg/K3=1cgg1cgg(The two-headed ogre is almost dead. _You block the two-headed ogre's attack. x2  You slash! _You kill the two-headed ogre! _No target in view! _HP restored.1cgg+1cggP+1cgge,1cgg8y  There is an open door, spattered with blood here.  You see here a +0 shortbow.1cggL;1cgg; _1cgg0=1cggH1cggK,1cggM1cggW1cggY1cgg4Z9=1cggB\1cgge1cggj,1cggDk1cggyt1cggw1cggw1cgg z1cgg1cggƇ1cgg1cgg1cgg}1cgg,1cggY1cgg01cgg1cgg1cgg٭1cgg)y _Gzone5's ghost keens inconsolably.1cggt31cgg:1cgg1cgg,1cgg1cgg1cgg,1cgg1cgg'1cgg1cgg1cggG1cggB1cgg1cgg1cgg,1cgg1cgg/ 1cgg81cgg1cgg1cggX1cgg%@  There is an open door here.1cgg(1cggN) _1cgg*1cgg*01cgg13,1cgg41cgg~91cgg;1cgg4<1cgg=1cggEX1cgg0I1cggK,1cgg L1cggP1cggS,1cggT1cggX1cgg\,1cgg]1cgga1cggc1cgg(d1cgg'e1cggh1cggk1cggl1cggBm1cggp1cggr,1cggt1cggv1cggx,1cggQz1cgg|1cgg,1cgge1cggi1cggB1cgg1cgg1cgg@  There is an open door here.1cgg1cggݍ _1cgg1cgg1cgg,1cgg1cgga1cggp1cgg1cggT1cggy1cgg1cgg®1cgg1cggҲ1cgg,1cggC1cgg¸1cgg,1cggռ1cgg#####...............#...... ..........#...............#......<....#######...#######..........#...##...............#....'.....######..#....#######..... .....##'##......#....#.....#..... 1cggD$.....#...#......####'#....p#..... ..>..#...#......@....###'###.....62.4 (46.0) .....#...'...........#÷...÷#..... 1cggm .....#####...........')....#..... .....#...#...........#######..... 1cgg.....#...#............#...##..... .....#...'............'...##..... .#............#.......... .#.........)..######..... #1cggH#####...##.........###...##.....1cgg]1cgg1cggTc _There is a stone staircase leading down here.1cgg8o[?25h[?0c  Search for what [Enter for "long b", or ? for help]? 2cgg2 [?25l[?1c2cgg tower2cggs 2cggE 2cggo X _Can't find anything matching that.3cgg3cgg3cgg3cggF _Unknown command.3cgg 3cggi 3cgg 3cggx F _Unknown command.4cgg4cgg4cgg4cggJ4cgg83.4 (1.0) _4cgg4cggf    #.#  #.#  #.#  #.#  #.#  #.#  #.#4  #@#  #.# 4cgg  #.#  #.#  #.#  #.#  #.#  #.# 4cggx 4cgg* 4cgg -4.1 (1.74cgg 4cgg } _You climb downwards. _There is a stone staircase leading up here.4cggj 4cggk 4cggJo 4cgg{r F _Unknown command.5cgg #5cgg#5cgg$5cggm&5cgg-5cgg#2P _5cgg:R.<R   efreet (wandering)#.#5cgg E,505cggLT○R5cggM+6.1 (25cggS5cggh _An efreet comes into view. It is wielding a +0 scimitar of flaming.5cgg #○# #R# #.# #.# #.# #.# #.# #@# #.# #<# #.# #.# #.# #.# #.# #.#5cgg`  #○# #R# #.# #.# #.# #.# #.# #@# #.#5cgg@ #<# #.# #.# #.# #.# #.# 5cggB5cggƐ5cggb5cgg^ _An efreet is nearby!5cgg.○R..<5cgg\RR5cgg ***###The efreet gestures at you.5cgg @ 5cggE ○○....@.5cgg| n95/103 --=======7.1 (15cggB 5cggh ##.○R.< _The fireball explodes! The fireball engulfs you!5cgg 5cgg n°°○R5cgg m6---------85cgg 5cggT 5cggw  ##.°○R.<5cgg 5cggM a..○°R5cggA \7-------95cgg 5cgg 6cgg^  You hit the efreet.  The efreet is lightly wounded.6cgg` ******The efreet gestures at you.6cgg°@....<6cgg|8--====70.0 (0.96cgg6cgg0 _The bolt of fire hits you!6cgg . You hit the efreet.  The efreet is moderately wounded.The efreet hits you with a +0 scimitar of flaming!6cggx7-----==--6cgg96cgg6cgg/+ _The efreet burns you.6cgg  You slash the efreet!  The efreet is heavily wounded.6cgg$ L ****6cgg T**The efreet gestures at you.6cgg" .@....<6cgg# p8=----1.9 (1.06cgg/) 6cgg. R _The bolt of fire misses you.6cggd  You hit the efreet but do no damage.The efreet is heavily wounded.6cggh [ ******6cggi EThe efreet gestures at you.6cgg @....<6cggt &26cggA 6cggj R _The bolt of fire misses you.7cgg b  You hit the efreet.7cggç5-3.8 (0.97cgg7cgg5_ _The efreet is severely wounded.7cgg}  You slash the efreet!  The efreet is almost dead.9==4.8 (1.07cgg7cggw4 _You block the efreet's attack.7cgghZ  You hit the efreet.  You kill the efreet!The Shining One accepts your kill.7cggaE)7cggf\82=6-7cggef5.7 (0.97cggaj7cggm& _You feel better.7cgg jM ##.7cgg/ .  #.#.#.#7cgg% 7cggI' V--6.7 (1.07cgg- 7cgg/  7cgg0 n_You see here a +0 scimitar of flaming.8cggZ8cggx3=-78cgg8cggR _R - a +0 scimitar of flaming9cggC  Adjust (i)tems, (s)pells, or (a)bilities? 9cgg 9cggş9cggAdjust which item? Hand Weapons (go to first with ))  a - a +4 long sword (weapon)  R - a +0 scimitar of flaming Missiles (go to first with ()  b - 3 throwing nets  f - 15 poisoned darts (quivered)9cggF - 6 atropa-tipped darts  S - 9 curare-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)D - a ring of poison resistance  9cggH - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /) 9cggL[Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]:cggU:cgg>g deadiverson the Nimble :cgggHuman of the Shining One *****. Health: 83/103 ===================-----  ###Magic: 13/13 ========================  #..AC: 20:cgggStr: 17  #.#EV: 19Int: 11:cggh  #.#SH: 16Dex: 15  #.#XL: 13 Next: 26% Place: Dungeon:14  #@#Noise: ---------  Time: 16177.7 (0.0)  #.#a) +4 long sword :cggh #.#Throw: 15 darts (poison)  #.#:cggh  #.#  #.# :cggOit #<#  #.#  #.# _You feel better. _You see here a +0 scimitar of flaming. :cggvi_R - a +0 scimitar of flamingAdjust (i)tems, (s)pells, or (a)bilities? R - a +0 scimitar of flaming  :cggiAdjust to which letter? (? for menu, Esc to quit):cgg*OR:cgg.:cggl2 _You see here a +0 scimitar of flaming. _R - a +0 scimitar of flaming(i)tems, (s)pells, or (a)bilities?   R - a +0 scimitar of flaming  Adjust to which letter? (? for menu, Esc to quit) _a - a +0 scimitar of flaming; R - a +4 long sword (weapon);cgg ;cgg ;cgg ;cgg ] page down [PgUp|<] page up[Esc] exit cgg>cgg deadiverson the Nimble Human of the Shining One *****. Health: 83/103 ===================-----  ###Magic: 13/13 ========================  #..AC: 20Str: 17  #.#EV: 19Int: 11  #.#>cgggSH: 16Dex: 15  #.#XL: 13 Next: 26% Place: Dungeon:14  #@#Noise: ---------  Time: 16178.2 (0.0)  #.#a) +0 scimitar (flame)  #.#Throw: 15 darts (poison)  #.#  #.#  #.#  #<# >cgg2 #.#  #.#Adjust (i)tems, (s)pells, or (a)bilities? R - a +0 scimitar of flaming  Adjust to which letter? (? for menu, Esc to quit) _a - a +0 scimitar of flaming; R - a +4 long sword (weapon)  Your +0 scimitar of flaming bursts into flame! >cgg!&_a - a +0 scimitar of flaming (weapon)>cgga+9.2 (1>cgg,>cggc/ _You drop a +4 long sword.>cggm4>cggq>cggtF _Unknown command.>cgg>cggF>cgg>cggl>cgg,4 _>cgg>cgg>cgg>cgg.>cggB>cgg>cgg%5>cggd>cgg,>cgg >cgg>cggK6=>cggU>cgg,>cgge>cgg,>cgg>cgg>cggN7=>cgg >cgg,>cggB >cgg ,>cgg >cgge;8>cgg>cgg,>cgg(>cgg<,>cgg>cgg;9>cgg>cggo>cgg>cgg>cggR90>cggb,>cgg>cggT",>cgg">cgg$w1=>cgg+>cggm+,>cgg1,>cgg/2>cgg7>cgg8U2=>cgg8>cgg=,>cgg>>cgg!G}3>cggG>cggL,>cggM>cggP>cggQ%4>cggEQ>cggT>cggT>cggTU>cggY\,>cgg\>cgga>cgg&bK5=>cggob>cggg,>cggxg>cgg2l>cgglU6=>cgg/m>cggq,>cggq>cggv,>cgg w>cggz>cgg[{%7>cgg{>cgg>cggހ>cggB>cgg8>cgg~>cgg>cgg>cggp%8>cgg>cggB>cgg>cggԏ>cggW,>cgg>cgg>cgg~K9=>cggܙ>cggȞ>cgg>cgg>cggI>cgg[100/103=>cgg>cggI,>cgg>cgg,>cgg>cgg>cggg%1>cgg>cgg/n>cgg>cggº>cgg42>cgg>cgg>cggd>cgg>cggK3=>cgg>cgg1 _HP restored.>cggW3>cgg>cgg>cgg3,>cggA>cgg>cgg,>cgg>cgg/>cgg>cgg<O=>cgg>cggt,>cgg>cgg>cgg,>cgg3>cggi>cgg >cggQ>cgg>cgg>cgg>cgg>cggz>cgg>cggB>cggV>cgg ,>cgg >cgg >cggv ,>cgg >cgg >cgg ,>cggp >cgg9 >cgg N    ################# #................ #.######.@....... #.# #......... #.# #......... #)# #......... #.# #....###.# #.# #....# y>cgg Sy   killer bee (asleep) #.# #....# #.# #....# >cgg 243.2 (64.0)  A killer bee comes into view.>cgg(   The killer bee buzzes angrily. You hear an angry buzzing noise. x2>cgg?) >cgg5 yyyyyy 3 killer bees (2 wandering)  A killer bee comes into view. x2>cgg6 5==4.2 (65>cgg; >cgg}> 9 _You hear an angry buzzing noise. x3>cgg 1>cgg  #################  #................  #.######.@.......  #.# #.........  #.# #......... >cgg #)# #......y..  #.# #....###y#  #.# #....# y >cgg p #.# #....#  #.# #....#  #.#>cgg  #################  #................  #.######.@.......  #.# #.........  #.# #.........  #)# #......y.. #.# #....###y# #.# #....# y  #.# #....# #.# #....# >cgg >cggp >cgg >cggy d _There are monsters nearby!?cgg- ((((, 1 poison…)You throw a poisoned dart. The poisoned dart hits the killer bee.?cgg> ?cgg4?: The killer bee is poisoned.?cgg^@?cgg B?cggC?cggKg  The killer bee buzzes angrily. You hear an angry buzzing noise. x2?cggL?cgg+M?cggN?cggrO?cggk\ ..y.y#yyy   meliaiyyyy 4 killer bees (1 poisoned)  A meliai comes into view. It is wielding a +0 hand axe.A killer bee comes into view.?cgg1]a5.3 (1.1)4?cggc?cgg2l9 _You hear an angry buzzing noise. x3?cggo (((You throw a poisoned dart.  The poisoned dart closely misses the killer bee.?cgg٧  The poisoned dart hits the killer bee.?cgg ?cgg ?cgg H  You hear an angry buzzing noise. x3?cgg¯ ?cgg{ ?cggN ?cggw ?cgg& ?cggl ?cgg ?cggn ?cgg ?cgg ?cgg  yy.yy.(y.yyy 6 killer bees (1 wandering, 1 poi…)A killer bee comes into view. x2  You block the killer bee's attack.6.43?cggY ?cgg ?cgg /  --more--@cgg 7 _You hear an angry buzzing noise. x3@cgg$         #################  #.......@..  #.######..y......  #.# #..y.y....  #.# #...y.(y..  #)# #......y..  #.# #....###.#  #.# #....# y 5 killer bees (1 poisoned)   #.# #....#  #.# #....#@cgg+@cgg<.FThe killer bee attacks as it pursues you!@cgg7/@cgg1@cgg<The killer bee stings you.  The meliai calls down the wrath of its god upon you.@cgg>@cggC@cggZD@cgg^F@cgg)H@cggDI@cggK@cgg^eyyy.y....y(.y.y 6 killer bees (1 poisoned)  Something smites you!@cgg^\88/103 -----@cgg_70@cggl@cggqM _The killer bee buzzes angrily. You hear an angry buzzing noise.@cgg          #  #.y.  #.######yy.y.....  #.# #.  #.# #....y(..  #)# #....y.y..  #.# #....###.#  #.# #....# .  #.# #....#   #.# #....#@cgg @cgg| E  You hear an angry buzzing noise.@cggl @cgg @cgg& @cggF @cggT  You block the killer bee's attack. x2; The killer bee stings you.  The meliai calls down the wrath of its god upon you.@cgg @cgg @cggT D yyy@cgg ...yy..(Something smites you!@cgg v71--------=8@cgg$ @cgg) 6 _You hear an angry buzzing noise.@cggX }         #  #.yyy......  #.######y.@cgg[Y   #.# #..y......  #.# #..y.y(...  #)# #....(..  #.# #....###.#  #.# #....# .  #.# #....# @cggY n  #.# #....#@cgga @cggg  The killer bee looks more healthy.  The meliai calls down the wrath of its god upon you.@cggh @cggrj @cggm @cggn @cggr @cgg@s @cgg, yyy.y.y... 5 killer bees@cgg u57--------9@cgg @cggw _Something smites you! The killer bee completely misses you.@cgg6t         #@cgg  #....@.yyy.  #.######y.  #.# #.y.y.....  #.# #.....(...  #)# #......(..  #.# #....###.#  #.# #....# . 4@cgg~   #.# #....#   #.# #....#@cgg@cggdX@cgg@cggi@cgg@cgg yyyyy...y 5 killer bees  You block the killer bee's attack.  @cgg2^The meliai calls down the wrath of its god upon you.@cggt4------=50@cggk _Something smites you!Acgg|>t         #Acgg ?(  #...@.yyyy.  #.######yy.  #.# #.........  #.# #.....(...   #)# #......(..  #.# #....###.#Acgg?N  #.# #....# .   #.# #....#   #.# #....#AcggzG,Acgg]HAcgg=JAcggcNAcggQAcggbdyyyy.Acgg[c.-1AcggnAcggZu8 _You block the killer bee's attack.AcggAcgg.Drink which item? Potions  e - 2 potions of enlightenment  i - 2 potions of cancellation  k - 5 potions of mutation  q - 2 potions of attraction Acgg t - a potion of heal wounds  u - a potion of magic  z - 2 potions of haste  C - 4 potions of curingE - a potion of brilliance  G - a grey potion  Q - 2 bubbling red potions [!] read|quaff|evokeAcggG[?] describe selectedBcggwQ Bcgge^ V deadiverson the Nimble Human of the Shining One *****. Health: 47/103 ==========-------------- Magic: 13/13 ======================== AC: 20Str: 17 EV: 19Int: 11 SH: 16Dex: 15  #################XL: 13 Next: 26% Place: Dungeon:14  #...@yyyyy.......Noise: =--------  Time: 16251.4 (0.0)  #.######y........a) +0 scimitar (flame)Bcgg_ i  #.# #.........Throw: 13 darts (poison)  #.# #.....(...  #)# #......(..  #.# #....###.#y   meliai  #.# #....# .yyyyy 5 killer bees  #.# #....#  #.# #....#The meliai calls down the wrath of its god upon you. _Something smites you! The killer bee completely misses you.You block the killer bee's attack.  The meliai calls down the wrath of its god upon you. _Something smites you! _You block the killer bee's attack.Bcggl P  Okay, then.Bcggm Bcggy Bcgg2~ . _Bcggp Bcgg2 Read which item? Scrolls  g - 3 scrolls of vulnerability  j - a scroll of blinking Bcgg n m - 3 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 4 scrolls of teleportationJ - 3 scrolls of identify  K - a scroll of amnesia [!] read|quaff|evoke[?] describe selectedDcgg Dcgg# Dcgg0  deadiverson the Nimble Dcgg0 Human of the Shining One *****. Health: 47/103 ==========-------------- Magic: 13/13 ======================== AC: 20Dcgg%1 pStr: 17 EV: 19Dcgg2 ,Int: 11 SH: 16Dex: 15  #################XL: 13 Next: 26% Place: Dungeon:14  #...@yyyyy.......Noise: =--------  Time: 16251.4 (0.0)  #.######y........a) +0 scimitar (flame)  #.# #.........Throw: 13 darts (poison)  #.# #.....(...Dcggj7   #)# #......(..  #.# #....###.#y   meliai  #.# #....# .yyyyy 5 killer bees  #.# #....#  #.# #....# _Something smites you! The killer bee completely misses you.You block the killer bee's attack.  The meliai calls down the wrath of its god upon you. _Something smites you! _You block the killer bee's attack. _Okay, then.Dcgg<  As you read the scroll of fear, it crumbles to dust.  You assume a fearsome visage. The killer bee looks frightened!Dcgg> Dcgg+A DcggdE DcggfG DcggbL e  The meliai looks frightened! The killer bee looks frightened! x4DcggON Dcgg]O DcggEP DcggR Dcggf N.y..yyyyy(fleeing)yyyyy 6 killer bees (4 fleeing)-2.4 (1Dcggn Dcggu > _Cornered, the killer bee turns to fight!Dcggo3Dcgg48-DcggH@EcggF _Unknown command.EcggJ 7     EcggeK N    #  #..@.y.y..yy.....  #.######yyy......  #.# #.........   #.# #.....(...   #)# #......(..EcggL   #.# #....###.#  #.# #....# .yy 5 killer bees (3   #.# #....#   #.# #....#EcggR EcggR EcggS EcggT EcggCX Ecgg.Y Ecgg] Ecgg^ Ecggk y.y..y....yyy 3 killer bees (1 fleeing)Ecggl d8==3Ecgg{u Ecggz 8 _You block the killer bee's attack.Ecggv         #Ecgg1  #.@.y.y..y.y.....  #.######.  #.# #.  #.# #.....(...  #)# #......(..Ecgg]  #.# #....###.#  #.# #....# .  #.# #....#   #.# #....#Ecgg*EcggEcgggEcggEcgg&yy..... 2 killer bees4EcggEcggX _The killer bee closely misses you.Fcgg        #################  #..yy......y.....  #@######.........  #.# #..  #.# #.....(...  #)# #......(..  #.# #....###.#  #.# #....# .  #.# #....#  #.# #....#  #.#FcggF Fcgg FcggYFcgguFcggJyy..Fcggk\9=-5FcggS%Fcgg(Fcgg#################yy........y......######.... ().(.###.# . <FcggFcgg Fcggy!.y=6 _You block the killer bee's attack.Fcgg>#################y.........y.....######.....# ().(.###.# . <.FcggAFcggFN  The killer bee attacks as it pursues you!Fcgg\UR.yFcgg7V&7Fcgg[Fcgg'^{ _You block the killer bee's attack. The killer bee closely misses you.Fcgg#################..........y.....y######.... .(.(.###.# .  <.FcggUFcggFcggL.yFcggnC508FcggFcgg _You block the killer bee's attack. _You see here a +4 long sword.Fcgg #################..........y.....######....y# ().(###.# . <.Fcggx Fcgg Fcgg,- L.yFcgg. &9FcggG6 Fcgg: C _The killer bee stings you but does no damage.Fcggp #################..........y.....######.... y(.(.###.# . <.Fcgg6u FcggKv Fcgg֊ L.yFcgg '60Fcggz Fcgg 8 _You block the killer bee's attack.Gcgg?wU#################..........y.....######.... (y.(###.#.GcggRx .  <.Gcgg{GcggmGcggԒL)yGcggB11GcggiGcgg.8 _You block the killer bee's attack.Gcgg)..........y.....######.... ().(y###.# ..  <.GcggGcggGcggL.yGcgg&2Gcgg! Gcgg[ _The killer bee completely misses you.Gcgg3######.... ().(.###.#y . . <.Gcgg,7Gcgg8GcggKL.yGcggL&3GcggRTGcggAYX _The killer bee closely misses you.Gcggk ().(.###.# .y .# .GcgglGcggoN  The killer bee attacks as it pursues you!GcggR.yGcggȁ\2=4Gcgg?Gcgg _You block the killer bee's attack. x2 _There is a stone staircase leading up here.Gcgg0  You hit the killer bee but do no damage.The killer bee is moderately wounded.Gcgg~&5GcggGcgg!S _The killer bee misses you. x2HcggT  You barely miss the killer bee.The killer bee is moderately wounded.HcggUT3=6Hcgg\HcggU` Hcgg`x_The killer bee completely misses you. You block the killer bee's attack.HcggGW  You slash the killer bee! You burn the killer bee.HcggoJHcgg^ .   killer bee  You kill the killer bee!Hcgg7d&7HcggjHcggAn8 _You block the killer bee's attack.Hcggm  You hit the killer bee but do no damage.HcggI&8Hcgg[Hcgg ; _You block the killer bee's attack. x2Hcgg  You closely miss the killer bee.The killer bee stings you but does no damage.HcggsI49.3 (0.9Hcgg Hcgg8 _You block the killer bee's attack.HcggJ  You hit the killer bee. You burn the killer bee.  The killer bee is heavily wounded.HcggK .70.3 (1.0HcggQ Hcgg?U _The killer bee completely misses you. The killer bee misses you.Hcgg  You hit the killer bee. You burn the killer bee.  The killer bee is almost dead.Hcgg &1Hcgg Hcgg _The killer bee misses you. The killer bee closely misses you.IcggJ  You hit the killer bee but do no damage.The killer bee is almost dead.Icgg4B52Icgg-Icgg~ _The killer bee completely misses you. You block the killer bee's attack.IcgglX  You slice the killer bee!! You burn the killer bee.IcggE†Icgg573.2 (0.9IcggIcggӍN _You kill the killer bee!Icgg 8 ####..(.)..(..##.#..# #....#<#.#IcggI IcggVJ 5-4.2 (1.0Icgg%P IcggS w _You see here a killer bee corpse.Icggt  ().(.###.# . †# .Icgg Icgg u6=-5 _Icgg Icgg a _There is a stone staircase leading up here.JcggJcggJcgg"JcggH/Jcgg4-6 _Jcgg5JcggOI  .....######...............#...... ..........#...............#...... .....<....#######...#######...... ................#...##........... ................#....'.....###### ................#....#######..... .....##'##......#....#.....#..... .....#...#......####'#....p#.....3 ..>..#...#......@....###'###..... .....#...'...........#÷...÷#..... .....#####...........')....#..... .....#...#...........#######..... .....#...#............#...##..... .....#...'............'...##.....  .....#...#............#..........Jcgg1J M  .....#...#.........)..######.....  ######...##.........###...##..... You climb upwards.JcggJ :=JcggS Jcgg I77.7 (2.5Jcgg Jcgg _Level annotation: 1 runed translucent door, Gzone5's ghost, journeyman MiBe _There is a stone staircase leading down here.JcggHuJcggFM,JcggMJcggOJcggSJcggrS98JcggUJcggXJcggYJcggZJcggU]Jcgg]#9Jcgg]Jcgg7_Jcgg)b,JcggcJcggfJcgg'gJcgghJcggkJcggl:60JcgglJcggJcggBKcgg9KcggzKcggKcgg#8Kcgg=(=KcggKcgg| Kcgg Kcgg KcggKcggU9=Kcgg$Kcgg,KcggKcggnKcggKcggKcgg8Kcgg&80KcggKcgg%,Kcgg Kcgg!,Kcgg"Kcgg0(Kcgg(%1Kcgg[*Kcgg.,Kcgg0Kcgg4Kcggr4K2=Kcgg6KcggH:Kcgg:Kcgg<Kcgg?Kcgg*@KcggBKcggkDKcggEU3=KcggPFKcggIKcggVIKcggJKcggM,KcggOKcggNRKcggR%4KcggNTKcggVKcgg#YKcggYKcgg]Kcgg_^KcggM`,KcggaKcggdKcggfKcggf%5KcgghKcggikKcggXlKcggOmKcggoKcgg@p56=KcggpKcggqKcggxtKcgg'uKcgg%vKcggxKcgg|yKcggzKcgg~Kcgg`~Kcgg~N7=Kcgg+KcggKcggKcggKcggPKcggKcggKcggKcgg%8KcggNKcggKcggKcggSKcggKcgg%9KcggKcggGKcggKcggKcggKcggKcggKcggKcggb&90KcggKcgg,KcggDKcgg,KcggKcggKcggcK1=KcggKcgg+KcggKcgg~KcggKcgglU2=KcggoKcgg,KcggKcgg,KcggKcggKcggEKcgg%3Kcgg7KcggKcggKcggXKcggKcggKcggKcggRKcggKcggKcggKcgg%4KcggKcgg~Kcgg}KcggKcggKcggKcggKcggKcggTKcggKcgg,K5=KcggKcggHKcggcKcgg-KcggoKcggR Kcggy Kcgg U6=KcggKcggKcggKcggrKcggKcgg<Kcgg,KcggKcggKcggF Kcgg %7Kcgg!Kcgg[#Kcggs%Kcgg%Kcgg'Kcgg)Kcgg +Kcggj+Kcgg+-Kcgg0Kcgg1%8Kcgg 5Kcgg8,Kcgg!:Kcgg >Kcgg@Kcgg/AKcggeAD9=KcggCKcggKHKcggJKcggKKKcggLKcggPKcggRKcggSKcggUKcggXKcgg\YKcggY)100/103KcggZ2=Kcgg[Kcgg"^Kcggk_,Kcgg`KcggdKcgggKcgggKcggpkKcggnKcggpKcgg#q%1KcggPrKcggmtKcggvKcggTwKcggtxKcggzKcgg|Kcgg }%2KcggKcggKcggم,Kcgg-KcggKcgg KcggKcggKcgg7 p   human (wandering)p ######...##.........###...##..... KcggQ_You start resting.Kcgg2400.7 (123.0)Kcgg.p3=14 _HP restored.Kcgg$ n[?25h[?0c  Search for what [Enter for "tower", or ? for help]? Lcgg [?25l[?1cLcgg Lcgg 8 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] a - a +0 scimitar of flaming (weapon) Results elsewhere ([,] to cycle) Lcgg A b - [D:12] a +0 falchion (1 further duplicate)c - [D:12] a +0 scimitar  d - [D:14] a +4 long sworde - [D:12] a long sword (63 gold)  f - [D:10] a +4 falchion of freezingg - [D:10] a falchion  Lcgg 0h - [D:8] a +0 long sword (3 further duplicates)Mcgg1/ Mcgg: Mcgg8? .....######...............#...... deadiverson the Nimble ..........#...............#...... Human of the Shining One *****. .....<....#######...#######...... Health: 103/103 ======================== ................#...##........... Magic: 13/13 ======================== ................#....'.....###### AC: 20Str: 17 Mcgg@ ................#....#######..... EV: 19Int: 11 .....##'##......#....#.....#..... SH: 16Dex: 15 .....#...#......####'#....p#..... XL: 13 Next: 27% Place: Dungeon:13 ..>..#...#......@....###'###..... Noise: ---------  Time: 16401.7 (0.0) .....#...'...........#÷...÷#..... a) +0 scimitar (flame) .....#####...........')....#..... Throw: 13 darts (poison) .....#...#...........#######..... .....#...#............#...##..... .....#...'............'...##..... p   human (wandering) .....#...#............#Mcgg@ .......... .....#...#......p..)..######..... ######...##.........###...##.....You climb upwards. _Level annotation: 1 runed translucent door, Gzone5's ghost, journeyman MiBe _There is a stone staircase leading down here. _You start resting. _HP restored.  Search for what [Enter for "tower", or ? for help]? long bMcggG McggH McggO Mcgg Q . _Mcgg Mcgg0 Mcgg Mcgg  Mcgg 8_Unknown command.Ncgg-GNcgg HFire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  b - 3 throwing nets  f - 13 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Wands (go to first with /)NcggHh - a wand of roots (14)  y - a wand of digging (6)  B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (2) Scrolls (go to first with ?)  g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolationr - a scroll of silenceOcggOcgg.....######...............#...... deadiverson the Nimble ..........#...............#...... Human of the Shining One *****. .....<....#######...#######...... Health: 103/103 ======================== ................#...##........... Magic: 13/13 ======================== ................#....'.....###### AC: 20Str: 17 ................#....#######..... EV: 19Int: 11 .....##'##......#....#.....#..... SH: 16Dex: 15 .....#...#......####'#....p#..... XL: 13 Next: 27% Place: Dungeon:13 Ocgg"n..>..#...#......@....###'###..... Noise: ---------  Time: 16401.7 (0.0) .....#...'...........#÷...÷#..... a) +0 scimitar (flame) .....#####...........')....#..... Throw: 13 darts (poison) .....#...#...........#######..... .....#...#............#...##..... .....#...'............'...##..... p   human (wandering) .....#...#............#.......... .....#...#......p..)..######..... ######...##.........###...##..... _There is a stone staircase leading down here. _You start resting. _HP restored. _Search for what [Enter for "tower", or ? for help]? long b _Unknown command.Okay, then.OcggOcgg D _PcggT0 Pcgg-2 Where to? (Tab - D:13 @ (x,y), ? - help)  D - Dungeon  T - TempleL - LairO - Orcish Mines  Pcgg2 V - VaultsQcgg.Qcgg(F![?25h[?0c.....######...............#...... deadiverson the Nimble ..........#...............#...... Human of the Shining One *****. QcggFd.....<....#######...#######...... Health: 103/103 ======================== ................#...##........... Magic: 13/13 ======================== ................#....'.....###### AC: 20Str: 17 ................#....#######..... EV: 19Int: 11 .....##'##......#....#.....#..... SH: 16Dex: 15 Qcgg:Gc.....#...#......####'#....p#..... XL: 13 Next: 27% Place: Dungeon:13 ..>..#...#......@....###'###..... Noise: ---------  Time: 16401.7 (0.0) .....#...'...........#÷...÷#..... a) +0 scimitar (flame) QcggGF.....#####...........')....#..... Throw: 13 darts (poison) .....#...#...........#######..... .....#...#............#...##..... .....#...'............'...##..... p   human (wandering) .....#...#............#.......... .....#...#......p..)..######..... ######...##.........###...##..... _You start resting. _HP restored. QcggH_Search for what [Enter for "tower", or ? for help]? long b _Unknown command. _Okay, then.What level of the Lair of Beasts? (default 1, ? - help) QcggGT [?25l[?1cQcggn 3Qcggp Qcgg QcggU Qcgg Qcggz : _Qcggی Qcgg Qcgg$ Qcggs Qcggw Qcgg Qcgg Qcgg Qcgg Qcgg Qcgg] Qcgg QcggK ,Qcgg Qcgg[ Qcggc Qcgg QcggC QcggF Qcggù Qcgg Qcgg[ QcggO Qcgg߿ Qcgg ,Qcggi Qcgg Qcgg Qcgg Qcgg Qcgg Qcgg Qcgg Qcgg QcggS QcggS Qcgg Qcgg] QcggI Qcgg ,Qcggw Qcgg\ QcggY Qcgg Qcgg Qcgg Qcgg Qcggb Qcgg, Qcgg W  There is a stone staircase leading up here.Qcgg Qcgg Qcgg Qcgg+ $ _Qcgg Qcgg$G 2  You climb upwards.Qcgg%Qcgg*,Qcgg,QcggC  Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHuThere is a stone staircase leading down here.QcggLK _QcggiOQcggnRQcggRQcggSQcggFXQcgg[Qcgg\Qcggz]Qcgg0aQcggdQcgg eQcgggfQcggiQcggmQcggmQcggPoQcggrQcgg v,QcggwQcggzQcgg}Qcgg ~QcgggQcggQcgg,QcggQcgg`QcggŐQcgg;,QcggQcggQcggܙQcgg?QcggaQcggȡQcgg,QcggiQcggߦQcgg,QcggQcggF%  Qcgg2There is a stone staircase leading up here.QcggmQcgghQcgg $ _QcggRcggs1RcggtRcggv,RcggvRcgg _You climb upwards.  There is a stone staircase leading down here. _RcggQBRcggRcggKnRcgg,RcggRcgg˞  There is a stone staircase leading up here. _Rcgg ;0RcggH,RcggRcgg$There is a stone staircase leading up here. _You climb upwards.down here. _There is a stone staircase leading up here. _You climb upwardsRcggH%.  down here.RcggR*5 _Rcgg+Rcgg3Rcgg5,Rcgg6Rcgg;;Rcgg=RcggG>Rcgg@Rcgg%FRcggI,Rcgg@LRcgg,SRcggURcgg VRcggWRcggk\Rcgge_,Rcgg`RcggcRcggfRcgggRcgg?hRcggmRcggp,RcggqRcggtRcggx,RcggyRcgg%~Rcgg؁,RcggRcggRcggo,RcggRcgg+RcggRcgg9RcggRcggiRcgg ,Rcgg:Rcgg{Rcgg,RcggRcggRcgg,RcggRcggRcggb,Rcgg"Rcgg[You climb upwards. _There is a stone staircase leading down here.up _You climb upwards. _RcggQThere is a stone staircase leading down here.  n open doorRcggRcgg4 _Rcgg2RcggRcggRcggJRcggRcgg)RcggRcggRcggRcggRcgg,RcggRcggRcggRcggRcggRcggXRcgg,RcggRcgg@  There is an open door here.Rcgg5 _RcggRcggFRcgg,RcggRcgg Rcggi,RcggRcggRcgg^,Rcgg*RcggKRcgg,RcggRcgg+Rcgg,Rcgg]Rcgg@  There is an open door here.RcggRcgg _RcggZRcggqRcgg2RcggRcggRcggRcgg!Rcgg|RcggRcggRcgg ,RcggRcgg RcggKBRcggRcgg'BRcggRcggNBRcggRcgg,Rcgg>Rcgg W  There is a stone staircase leading up here.Rcgg!Rcgg."Rcgg"$ _Rcgg"Rcggdf9Rcgg _You climb upwards.  There is a stone staircase leading down here. _RcggBRcggRcggRRcggRcgg"RcggxRcggdRcggGRcggRcggBRcggRcggRcggRcggRcggRcgg,RcggRcgg͵RcggG,Rcgg_RcggRcggRcggRcggRcggNRcggRcggRcggRcggpRcggRcggGRcggRcggRcggRcgg Rcgg2RcggRcgg RcggWRcgg&RcggRcgg~RcggRcggpRcggRcgg,RcggRcggRcgg%RcgguRcggRcggSBRcggoRcggqRcggXRcggoXRcgg#RcggxRcggRcggyRcgg,RcggQRcggRcgg,Rcgg Rcgg* h  There is a staircase to the Lair here.RcggP _RcggXiGenerating dungeon...o\\/o/ building the DungeonRcgghj< \o\Rcggtbuilding the Lair of Beasts /o/Rcgg#i Rcgg :deadiverson the NimbleHuman of the Shining One *****.Health: 103/103 ========================Magic: 13/13 ========================AC: 20Str: 17EV: 19Int: 11SH: 16Dex: 15XL: 13 Next: 27% Place: Lair:1Time: _There is an open door here. _There is an open door here. _There is a stone staircase leading up here. _You climb upwards. _There is a stone staircase leading down here. _There is a staircase to the Lair here.Rcgg X  You climb downwards. Welcome to the Lair of Beasts!Rcgg RcggV Rcgg O _The water moccasin hisses angrily.  Rcgg3 .There is a staircase back to the Dungeon here.RcggS Rcgg ..# . ##.# .. ...# #. ##..# .. .... ####.#..# Rcgg ...S.F..# #@#  Noise: =-------- 16506.5 (104.8)........#  a) +0 scimitar (flame)###.###.#  Throw: 13 darts (poison)#.# ..# ..#  F   cane toadRcggJ B#.#  S   water moccasin..# Rcgg Rcggɺ Rcggt d _There are monsters nearby!ScggRJScggF _Unknown command.Scgg{   .#  ..#  ##.# .. ...# #. ##..## .. ....#####.#..# Scgg^ [...S.F@.# ###.##.#<#  ........# ###.###.# ## #.#  ..#  ..#  #.# ..# Scgg Scgg D.SScggF17.5 (1.0)Scgg$Scgg(*j _Found a ring mail. The cane toad closely misses you.Tcgg .#  ...#  Tcgg T.. ##.#  ...#  #. ##..## .. ....# .####.#..#  [....SF..#  ###.##.#@#  ........#  ###.###.#   ## #.#   ..#  ..#  #.#  ..#    Tcgg~ Tcgg Tcgg E..FTcggs .-8Tcgg Tcgg d _There is a staircase back to the Dungeon here.UcggbUcggc8-UcgghUcggjUcggqlUcggqUcggv.=9UcggwUcggiJ  #...................###   #......................   #......................   #......................  .#################..##  Ucggpj#.#################..##   #......................   #............[...Dungeon:9   #.....@................   #.####################.  UcggBk #.##.  #.##.  #.##.  #.####################.  #......................  #.................#####  #.................##... _You block the cane toad's attack.UcgglUcggsUcgg6-11.0 (2.5UcggUcgg _You climb upwards. Welcome back to the Dungeon! _There is a staircase to the Lair here.Ucgg Ucgg^! 3=9 (0.9Ucggf( Ucgg!+ v _You barely miss the cane toad. You block the cane toad's attack.Ucggd  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded.Ucgge (2.8Ucggcl UcggEo 7 _You block the cane toad's attack.Ucggha  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded.UcggXb(3.7UcggiUcgglz  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded. _You block the cane toad's attack.  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded. _You block the cane toad's attack.Vcgg_t _You block the cane toad's attack.  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded. _You block the cane toad's attack.  You slash the cane toad! You burn the cane toad.  The cane toad is almost dead.Vcgg< _You block the water moccasin's attack.Ycggq  You hit the water moccasin but do no damage.Ycgg.20.0 (1.0YcggYcggk? _You block the water moccasin's attack. x2Ycgg Ycggi +9 (0.9Ycgg Ycgg _You barely miss the water moccasin. The water moccasin barely misses you.Ycggp Ycggqq (1.8YcggTx Ycgg _You closely miss the water moccasin. You block the water moccasin's attack.Ycgg  You slash the water moccasin! You burn the water moccasin.  The water moccasin is heavily wounded.Ycggj0=2.7YcggYcgg4\ _The water moccasin closely misses you.ZcggB^  You slash the water moccasin! You burn the water moccasin.†93.6 _You kill the water moccasin!Zcggn4ZcgggrZcggvH _No target in view!Zcgg7 o[?25h[?0c  Search for what [Enter for "long b", or ? for help]? [cggK [?25l[?1c[cgg [cgg" 27 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] A - a +0 pair of boots (worn)  b - [carried] P - a +0 pair of gloves (worn)  c - [carried] c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ d - [carried] l - a +1 kite shield (worn)  e - [carried] w - a +2 cloak of stealth (worn) [cgg 'Results elsewhere ([,] to cycle)  f - [Lair:1] a ring mail (3 further duplicates)g - [D:9] a +0 leather armour (14 further duplicates)  h - [D:9] a +0 ring mail (4 further duplicates)  i - [D:9] a +0 robe (27 further duplicates)  j - [D:9] a leather armour (5 further duplicates)  k - [D:9] a robe (1 further duplicate)  l - [D:8] +0 acid dragon scales  m - [D:10] a +0 plate armour  n - [D:8] a +0 scale mail (5 further duplicates)  o - [D:10] a scale mail (6 further duplicates)  p - [D:7] a +0 chain mail (7 further duplicates)  q - [D:11] a +0 troll leather armour  r - [D:11] a cloak (1 further duplicate)  [cgg5 os - [D:7] a pair of gloves  t - [D:7] the +1 robe "Rucaif Ixti" {+Inv rF- rCorr Dex+5} [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]]cgg   f - [Lair:1] a ring mail (3 further duplicates)  g - [D:9] a +0 leather armour (14 further duplicates)  h - [D:9] a +0 ring mail (4 further duplicates)  i - [D:9] a +0 robe (27 further duplicates)  j - [D:9] a leather armour (5 further duplicates)  k - [D:9] a robe (1 further duplicate)  l - [D:8] +0 acid dragon scales  m - [D:10] a +0 plate armour  n8scale mail (5  o10] a scale mail (6  p7chain mail (7 further duplicates)  q11] a +0 troll leather armour  r11] a cloak (1 further duplicate)  s - [D:7] a pair of gloves  t - [D:7] the +1 robe "Rucaif Ixti" {+Inv rF- rCorr Dex+5}u12] a chain mail (1 further duplicate)  v2] a plate armour (414 gold)  w12] a scale mail (72 gold)  x - [D:12] an embroidered robe (66 gold)y3] a +0 animal skin  z5] a +0 buckler (2 further duplicates)  A - [D:5] a +0 cloakbotacggH ] b - [carried] P - a +0 pair of gloves (worn)  c - [carried] c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ d - [carried] l - a +1 kite shield (worn)  e - [carried] w - a +2 cloak of stealth (worn) Results elsewhere ([,] to cycle)  n - [D:8] a +0 scale mail (5 further duplicates)  s - [D:7] a pair of gloves28%ecggc ecggD ecgg i.#  deadiverson the Nimble...#  Human of the Shining One *****... ##.#  Health: 103/103 ========================.. ...#  Magic: 13/13 ========================#. ##..## AC: 20Str: 17.. ....# EV: 19Int: 11ecggP .####.#..#  SH: 16Dex: 15[......†.#  XL: 13 Next: 29% Place: Lair:1###.##.#@#  Noise: ==-------  Time: 16523.6 (0.0)........#  a) +0 scimitar (flame)###.###.#  Throw: 13 darts (poison)## #.# ..# ..#  #.#  ..#   The water moccasin is heavily wounded. cgg@ g9d_The water moccasin closely misses you.You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view!  Search for what [Enter for "long b", or ? for help]? armorecgg[ ecggP ecgg ecgg . _ecgg"ecgg.ecgg9ecgg<F _Unknown command.fcgg& fcgg Inventory: 44/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar of flaming (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 13 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  fcgga O - an amulet of reflection Wands (go to first with /)h - a wand of roots (14) [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]gcggԽf  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (go to first with /)h - a wand of roots (14)  y - a wand of digging (6)  B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (2) Scrolls (go to first with ?) gcgg۾ g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 4 scrolls of teleportation  J - 3 scrolls of identify50%jcggjcgg jcggq jcgg .#  deadiverson the Nimble...#  Human of the Shining One *****... ##.#  Health: 103/103 ========================.. ...#  Magic: 13/13 ========================jcgg& -#. ##..## AC: 20Str: 17.. ....# EV: 19Int: 11.####.#..#  SH: 16Dex: 15[......†.#  XL: 13 Next: 29% Place: Lair:1jcggr g###.##.#@#  Noise: ==-------  Time: 16523.6 (0.0)........#  a) +0 scimitar (flame)###.###.# jcggC  Throw: 13 darts (poison)## #.# ..# ..#  #.#  ..#    _The water moccasin closely misses you.You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view! _Search for what [Enter for "long b", or ? for help]? armor _Unknown command.jcgg jcgg jcggs jcgg kcgg*kcggPut on which piece of jewellery? Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)D - a ring of poison resistance  H - a ring of willpower  L - a ring of ice  kcggnpO - an amulet of reflection[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip ncgg% ncgg]i.#  deadiverson the Nimble...#  Human of the Shining One *****... ##.#  Health: 103/103 ========================.. ...#  Magic: 13/13 ========================#. ##..## AC: 20Str: 17.. ....# EV: 19Int: 11ncgg2.####.#..#  SH: 16Dex: 15[......†.#  XL: 13 Next: 29% Place: Lair:1###.##.#@#  Noise: ==-------  Time: 16523.6 (0.0)........#  a) +0 scimitar (flame)###.###.#  Throw: 13 darts (poison)## #.# ..# ..#  #.#  ..#    _The water moccasin closely misncgggses you.You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view! _Search for what [Enter for "long b", or ? for help]? armor _Unknown command.ncggncggƐ6--4.1 (0.5ncggdncgg  You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view!Search for what [Enter for "long b", or ? for help]? armorUnknown command. _D - a ring of poison resistance (right hand)ocggCocggMnDrop what?44/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 13 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance (right hand)H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands (select all with /) ocgg]O[Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]pcggJewellery "=)pcggĻd - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance (right hand)  H - a ring of willpower  L - a ring of ice  O - an amulet of reflection Wands /h - a wand of roots (14)  y - a wand of digging (6)  B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (2) Scrolls (select all with ?) pcggn g - 3 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence pcggb s - a scroll of enchant weapon41%qcggi(1 turn)  d - an amulet of faith (around neck)  O + an amulet of reflection[Enter] accept (1 chosen)rcggA2 turns)  L + a ring of ice  O + an amulet of reflection2scggm3  H + a ring of willpower  L + a ring of ice3scgg .#  deadiverson the Nimble...#  Human of the Shining One *****... ##.#  Health: 103/103 ========================.. ...#  Magic: 13/13 ========================#. ##..## AC: 20Str: 17.. ....# EV: 19Int: 11.####.#..#  SH: 16Dex: 15[......†.#  XL: 13 Next: 29% Place: Lair:1###.##.#@#cgg ;49m  Noise: ---------  Time: 16524.1 (0.0)........#  a) +0 scimitar (flame)###.###.#  Throw: 13 darts (poison)## #.# ..# ..#  #.#  ..#   You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view! _Search for what [Enter for "long b", or ? for help]? armor _Unknown command. _D - a ring of poison resistance (right hand)scggL scggT scgg- scgg +5.1 (1scgg scgg B _You drop a ring of willpower.scgg6 +6.1 (2scgg scgg < _You drop a ring of ice.scggp +7.1 (3scgg scgg scgg scggf$ 7 _You drop an amulet of reflection.tcggWtcggtcggtcgg[F _Unknown command.tcggef tcggh Pick up what? 41/52 slots (_ for help) Jewellery (select all with "=)tcggvcgg?vcggBvcggEF _Unknown command.vcgg; vcgg vcggy vcggh vcgg͜ vcggΠ : _vcgg j  You see here a water moccasin corpse.vcgg{ vcgg  _vcgg/ vcgg1 vcgg߬ ,vcgg vcggJ vcgg vcgg vcgg( vcggg vcggػ ,vcggȼ vcgg vcgg vcgg vcgg vcgg vcgg   ## ..####.#..# .>......#  .............####34.1 (6vcggo ..........###.###..##...........##.####.#..##[......†###.##.#<......####.###.#vcgg vcgg_ +5.1 (7vcgg. vcgg ; _Found a stone staircase leading down.vcgg vcgg vcggN vcgg vcgg vcggBvcggvcggvcggavcgg2vcgg ,vcgg vcgg vcgg ,vcggvcgg&vcgg$,vcggvcggvcgg,vcggvcgg6vcgg#".##. .....  ?. . #F##...  # ######.#..#  ..>......#  .........# .........vcgg$4F   bullfrog (asleep)....#####..........###.###..##vcgg'y 41.1 (6  A bullfrog comes into view.vcgg)vcggo.f..FFvcgg/+2.1 (7vcgg<5vcggF:1 _Found a scroll of identify.wcgg  .##..#  . ....#  .. ....#  ?. ...#  #.##...  .F..#  # #..#  #@#  ..........#  wcgg.#####.#..#  ..>......#  .........#  ..........#  ....#####.#  ..# wcgg#Lt .##..#  . ....#  .. ....#  wcgg(Me?. ...#  #.##...  .F..#  # #..#  #@#  ..........#  .#####.#..#  ..>......#  .........#  ..........# wcggM ....#####.#  ..# wcgg_Z4wcgg^wcggb_ _A bullfrog is nearby!wcggqXw  ...# .##..#  ....# ... ....# ?. ...###.$#.##...#......F..#  # #@.# wcggY ###.#####.#  ..........# #####.#..#  ..>......#  .........#  ..........#  ....#####.#  ..........# wcggdl  Found 4 gold pieces.=3.1 (1wcgg0jwcggm? _The bullfrog hits you but does no damage.wcgg+  You slash the bullfrog! You burn the bullfrog.  The bullfrog is almost dead.wcgg 5=4.0 (0.9wcgg wcgg N _The bullfrog misses you.wcgg($ T  You slice the bullfrog!! You burn the bullfrog.wcgg, o.wcgg2 .-9wcggE7 wcgg: L _You kill the bullfrog!wcggwcgg8-wcggwcggH _No target in view!xcggxcggxcggxcggtxcggxcggԵ$ _xcggJ,xcggxcggFxcgg0xcgg^xcggOxcggxcggxcggxcgg- ....####.#.#  .......l...# ###.#...##..# .........# P#..........#  .^..?......##xcgg'##.#.$#.##...#.......@....# - ##.##..###..#  ###.#####.#  ..........#  .#####.#..# .. ..>......# l   komodo dragon (asleep) . .........#  ..........#  ....#####.# xcgg -7.9 (3.0xcggE-8.9 (4xcggxcgg` _A komodo dragon comes into view.xcgg ....####.#.#  .......l...#  ###.#...##..#  ............#  P#..........#  .^..?......## ##.#.$#.##...# .......@....#  ##.##..###..#  ###.#####.#  ....  .##  .. ..>  .      xcggV ....####.#.#  .......l...#  ###.#...##..#  ............#  xcgg:P#..........#  .^..?......## ##.#.$#.##...# .......@....#  ##.##..###..#  ###.#####.#  ....  .##  .. ..>  .    xcgg  xcggN!xcgg!xcgg-(xcgg+d _A komodo dragon is nearby!xcggL ....####.#.#  .......l...#  ###.#...##..#  ............#  P#..........#  .^..?......## ##.#.$#.##...# .......@....#  ##.##..###..#  ###.#####.#  ....  .##  .. ..>  .      xcgg; ....####.#.#  .......l...#  ###.#...##..#  ............#  P#..........#  .^..?......## ##.#.$#.##...# .......@....#  ##.##..###..#  ###.#####.#  ....  .##  .. ..>  .      xcggxcggcxcggxcggd _A komodo dragon is nearby!ycgg{ (((((lpoisoned)You throw a poisoned dart.  The poisoned dart hits the komodo dragon.  The komodo dragon is poisoned.ycggycggu(l....ycgg^50.0 (1.12ycggycgg7 _The komodo dragon hisses angrily.ycgg/OMycgg ((((very poisoned) _The komodo dragon hisses angrily.  You throw a poisoned dart.  The poisoned dart hits the komodo dragon.  The komodo dragon looks even sicker.ycggiycggXn(l...ycgg;X1.11ycggycgg; _The komodo dragon is lightly wounded.ycgg@9M((( _The komodo dragon is lightly wounded.  You throw a poisoned dart.  The poisoned dart hits the komodo dragon.  The komodo dragon looks even sicker.ycgg 1ycgg8=.l..2.20ycggCycgg_G; _The komodo dragon is lightly wounded.ycgg;K M((extremely poisoned)The poisoned dart hits the komodo dragon.as sick as possible!ycgg( ycgg, b(l.ycgg h3.39 darts (poison) ycgg ycgg ; _The komodo dragon is lightly wounded.ycgg B..... .....####.# .......(...####.#..(##..#............#P#.....(....# ..^..?.l....####.#.$#@##...#...........##.##..###..ycgg ###.#####.#..........# .#####.#.. ..>. .....ycgg 8 ycgg 4=40ycgg ycgg S _The komodo dragon misses you.zcgg  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is heavily wounded.zcggy.=5zcgg!zcgg|%; _You block the komodo dragon's attack.zcgg  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is almost dead.zcgg-6.2 (0.9zcggzcgg!; _You block the komodo dragon's attack.zcggfn^  You slice the komodo dragon!! You burn the komodo dragon.zcggyo.zcgg~931-7.1zcgg-zcggQ _You kill the komodo dragon!zcgg[\ zcgg] 8-zcggLe zcggh H _No target in view!zcgg zcgg zcgg zcggy zcgg zcgg : _zcggt zcgg= ,zcgg< zcgg ,zcgg zcgg% o _f - 10 poisoned darts (gained 1)zcgg#* 3zcggY+ zcgg, zcgg. zcgg-/ zcgg/ zcgg^3 ,zcgg4 zcgg5 o _f - 11 poisoned darts (gained 1)zcgg7 zcgg48 zcgg8 zcgg; ,zcgge< zcgg> o _f - 12 poisoned darts (gained 1)zcggA 3zcggNB zcggC zcggG ,zcggH zcggK zcggQM ,zcggN zcggO zcggR ,zcgg S zcggW zcggYW zcggJX zcgg.[ I _J - 4 scrolls of identify (gained 1)zcgg_ Izcgg_ zcgg` zcgg` zcgg+c M _You now have 717 gold pieces (gained 4).zcgg f 3zcgg4g zcggj zcgg/l ,zcgg%m zcggm zcggp ,zcggp zcggr zcgg\x d##. .F ... #.. .. .  ...#  P#.#  ...# #####.#.# ............# ..###.#@..##..# -zcggy .......# .P#..........# 12 darts (poison)....^.........##.###.#..#.##...#..............##F   cane toad (wandering)####.##..###..#  ####.#####.#  ..# zcgg{ 075.1 (18.0)zcgg) .A cane toad comes into view.zcggӀ F-6.1 (19zcgg zcggD 6 _The cane toad moves out of view.zcggU zcgg zcgg< zcgg; zcggC J##.P.#PP###. .....F.. ... #.... .. .  ........ ...# ###.#...# P#.# ......... ...# zcgg< ##.....####.#.# .......@.......# ###.#...##..#  ..............#  #.P#..........# .....^.........##..###.#..#.##...#F   cane toad (wandering)...............######.##..###..# ####.#####.# zcggG ,0.0)zcggQ M.Fzcgg' +7.1 (1zcggI zcgg {cggF/ ...##.P.#PP###.  .........F. ...  .......... .. .  ........ ...#  .###.#...# P#.#  ......... ...#  .##.....####.#.#  .......@.......#  {cggH...###.#...##..#  ..............#  #.P#..........#  .....^......... ..###.#..#.##.. ............... ####.##..###..#   {cgg~ ...##.P.#PP###.  .........F. ...  .......... .. .  ........ ...#  .###.#...# P#.#  ......... ...#  .##.....####.#.#  .......@.......#  ...###.#...##..#  ..............#  #.P#..........#  .....^......... .[0;{cgg#10;1m.###.#..#.##.. ............... ####.##..###..#   {cggR{cgg{cggo{cgg` _A cane toad is nearby!{cgg- ...##.P.#PP###.  .........F. ...  .......... .. .  ........ ...#  .###.#...# P#.#  ......... ...#  .##.....####.#.# {cggl." .......@.......#  ...###.#...##..#  ..............#  #.P#..........#  .....^......... ..###.#..#.##.. ............... ####.##..###..#   {cgg ...##.P.#PP###.  .........F. ...  .......... .. .  ........ ...#  .###.#...# P#.#  ......... ...#  {cgg.##.....####.#.#  .......@.......#  ...###.#...##..#  ..............#  #.P#..........#  .....^......... ..###.#..#.##.. ............... ####.##..###..#   {cgg{cgg{cgg{cgg{` _A cane toad is nearby!{cgg (((((FYou throw a poisoned dart. The poisoned dart hits the cane toad.{cgg{cgg%n(.F....{cgg-'f==8.3 (1.21{cgg-{cggU2+ _The cane toad croaks.{cgg2 l (((((({cgg3 You throw a poisoned dart.  The poisoned dart barely misses the cane toad.{cgg2 ~  The poisoned dart hits the fungus. The fungus is poisoned.  You hear an angry hiss.{cgg7 {cgg [...F..{cgg; a--9.50{cgg {cgg c _The fungus begins to die. Something bites the plant. The plant begins to die.{cggRu F(({cgg {cgg* X(F..{cgg --80.6 (1.19 darts (poison) {cggl {cgg V _You throw a poisoned dart. The poisoned dart hits the cane toad.|cgg9;(|cgg9|cggL(F|cggX1.78|cgg#|cggV _You throw a poisoned dart. The poisoned dart hits the cane toad.|cgg  You slash the cane toad! You burn the cane toad.  The cane toad is moderately wounded.|cgg6==2.6 (0.9|cggz|cgg+7 _You block the cane toad's attack.|cgg{D  You hit the cane toad. You burn the cane toad.  The cane toad is moderately wounded.|cggTOo .A nearby fungus withers and dies.|cggcP0-3.5|cggU|cggWB _The cane toad stings you but does no damage.|cggf  You hit the cane toad but do no damage.The cane toad is moderately wounded.|cggB8.|cgg B-4.4|cgg|cgghx _A nearby plant withers and dies. The cane toad closely misses you.|cgg  You slash the cane toad! You burn the cane toad.  The cane toad is heavily wounded.|cgg (5.3|cggN( |cgg+ ] _The cane toad completely misses you. x2|cggE^  You hit the cane toad but do no damage.The cane toad is heavily wounded.|cggm_ (6.2|cgge |cggBh 7 _You block the cane toad's attack.|cggc  You barely miss the cane toad.|cgg kk   wyvern (wandering)The cane toad is heavily wounded.A wyvern comes into view.|cggm(7.1|cggA|cggZW _The cane toad closely misses you.}cggw  The wyvern hisses angrily.  You slash the cane toad! You burn the cane toad.}cggl  The cane toad is almost dead.}cgg(k k}cgg0=8.0}cggH}cggN7 _You block the cane toad's attack.}cgg^  You hit the cane toad but do no damage.The cane toad is almost dead.The wyvern bites you but does no damage.}cgg_.-9}cgg/h}cggl7 _You block the cane toad's attack.}cgg`U  You slash the cane toad! You burn the cane toad.}cgg' †k   wyvern  You kill the cane toad!}cggX3-9.8}cgg,}cggE!4 _You block the wyvern's attack.}cgg  You slice the wyvern!! You burn the wyvern.  The wyvern is severely wounded.}cggܘ 2==90.7}cgg~ }cggҩ 7 _You block the wyvern's attack. x2}cggY O  You slash the wyvern! You burn the wyvern.}cggb o.}cggg =4-1.7 (1.0}cggo }cggat J _You kill the wyvern!}cggU,}cgg:-8-}cgg.5}cgg]8H _No target in view!~cggI~cgg~cgg%~cgg): _~cgg)-e  You see here a cane toad corpse.~cgg1/~cgg/ _~cggr0~cgg5,~cgg06~cgg8n _f - 9 poisoned darts (gained 1)~cgg;3~cggt<~cggk@,~cggA~cggDo _f - 10 poisoned darts (gained 1)~cggE3~cggF~cgg%I~cggJ,~cggK~cggM~cggO,~cggO~cggT,~cgg]U~cggYo _f - 11 poisoned darts (gained 1)~cgge\3~cggO]~cgg_~cgga,~cgga~cggb~cgg d,~cggd~cgg$f~cggg,~cggOh~cggi~cggDk~cggk~cggl~cgg-m~cggn~cgg o~cggqo~cggp~cggr~cggfr~cggr~cggt~cggu~cggu~cggJv~cggw~cggx~cggjy~cggy~cggz~cggm|,~cgg|~cgg~~cgg%,~cgg~cgg͂~cgg~cgg:~cgg~cggT~cgg  ### ##### #..#######.#####.#P##...........P#--612.7 (21.0)[............P.....##..#....##.P.#..###.# 11 darts (poison)...................##~cgg.................#.................###P.#.###.#...#..P#.# ...................# .##....†####.#.# ~cgg~cggG--3.7 (22~cgg~cgg% _Found a helmet.~cgg~cgg~cgg ~cgg~cgg,~cgg~cgg?~cgg~cgg~cggO~cgg~cgg~cggS~cgg~cgg ~cgg~cggr~cgg~cgg~cgg,~cgg|~cggh~cgg~cggG~cgg:~cgg5~cgg~cgg~cgg~cgg~cggI#### ### ##########..#######.#####................................[............P............#....##.P.#..#................20.7 (7.0)..####........... .................... ......#P.#.###.#...#.............#.######.P...##....†####. ................ .#[#...###.#...# ............~cgg~cgg +1.7 (8~cgg~cgg# _Found a robe.~cgg\\~cggY]~cggb~cggeg~cgg>m~cggp,~cgg/s~cgglv~cggv~cggw~cggy{~cggQ~cgg~cgg~cgg~cgg,~cggJ~cgg~cggɘu###P#########..#######.[....................................[.........................#....##.P .......................##P...####............#...#P.#.###.#.5.7 (4~cgg;##...#.######.P...##....... ..#...... .#[#...### ....### ###.P#..... .....^#....###~cgg?~cggƣ+6.7 (5~cgg~cgg( _Found a ring mail.~cgg, 3~cgg). ~cgg;1 ~cgg2 ~cggM= A ###P#..#.[...............[ .........#....##.. ...........#.##P...####..#.#...........#P.#.###.#.#...#.######.P...##.....F #........ .#[#...###........ #...####.## ###.P#. F   bullfrog (wandering) .... .. .....^~cgg= #.. .## ..###. ~cggcD &0~cggH +7.7 (1~cggJ ~cggM [ _A bullfrog comes into view.~cgg  .[........ ..............[ .............. . ............. #.##P...####... ............... #.#...........# .......@....... ###...#.######. ........F  ##........ .#[ ...........  ##...####.##  .... .. .....^ #.. .## ~cggE3 .[........ ..............[ .............. . ............. ~cgg4#.##P...####... ............... #.#...........# .......@....... ###...#.######. ........F  ##........ .#[ ...........  ##...####.##  .... .. .....^ #.. .## ~cgg?~cgg?cggcggH _ _A bullfrog is nearby!cgg; .[........ ..............[ .............. . ............. #.##P...####... ............... #.#...........# .......@....... ###...#.######. ........F  ##........ .#[ ...........  ##...####.##  .... .. .....^ #.. .## cggl .[........ ..............[ .............. . ............. cgg#.##P...####... ............... #.#...........# .......@....... ###...#.######. ........F  ##........ .#[ ...........  ##...####.##  .... .. .....^ #.. .## cggcggcggicgg_ _A bullfrog is nearby!cggZ.[.............................[ ...#....##. ...........#.##P...####.............#.##P.#.###.#.............###...#@######.P...##........F............##.............#[#...###........................##...####.##.## ###.P#..... .. .. .....^.#.. .## # ..###... ...cgg_[B ####cgg4]cgg^cggjR.Fcggk-8 _cggvcgg8zcggF.[ ...#....##. ..........#.##P...####..................#.#...........#P.#.###.#........................###...#.######.P...##.......@.............##....F#[#...###................##...####.##.## ###.P#..... .. .. .....^#.. .## # ..###.... .. ......## # #### ##cgg[40m  The bullfrog croaks. You hear an angry hiss.  A water moccasin comes into view.FS   water moccasinSF   bullfrog====9cggd _The bullfrog misses you.cgg>  You slash the bullfrog! You burn the bullfrog.  The bullfrog is heavily wounded.cggJpS. cggKc==--30.6 (0.9cggTcggnW9 _You block the bullfrog's attack. x2cggt Q  You hit the bullfrog. You burn the bullfrog.cgg p  The bullfrog is severely wounded.cgg|  S.F   cane toad (wandering)S   water moccasinFF   bullfrog  You block the bullfrog's attack.cgg4 R---1.5cgg cgg \ _A cane toad comes into view.cgg)`  The cane toad gives a loud, deep croak!  You slice the bullfrog!! You burn the bullfrog.cggc cggd cgg>f cggv .S.FF.cgg{ 0=2.4cgg݂ cgg L _You kill the bullfrog!cgg* ...#....##................##.##P...####............ #.#....#P.#.### .................###...#.######.P...##$.................... ###[#...##......S.........cgg ###...####.##.## ###.P#...... ... .. ....#.# .### # ..###.F.. .. .....## # ####.   # cggrcggv F.Found 19 gold pieces.cgg5-3.4 (1.0cggecggL_ _The water moccasin completely misses you.cgg+3  You slash the water moccasin! You burn the water moccasin.  The water moccasin is heavily wounded.cgg3<^F. cgg=.=4cgg Dcgg#H< _You block the water moccasin's attack.cgg}  You closely miss the water moccasin.The water moccasin is heavily wounded.cggCF.cgg5-5.3 (0.9cggcgg? _You block the water moccasin's attack. x2cgg$_  You slash the water moccasin! You burn the water moccasin.cggcggYNF.cgg<85=6.2cggh _You kill the water moccasin!cgg  You slash the cane toad! You burn the cane toad.  The cane toad is moderately wounded.-cggR 7.1cgg cgg 7 _You block the cane toad's attack.cggPN  You slash the cane toad! You burn the cane toad!  The cane toad is almost dead.cggxO 0=8.0cggU cgg[ y _The cane toad closely misses you. You block the cane toad's attack.cgg~  You hit the cane toad but do no damage.The cane toad is almost dead.cgg~\94/103 ---9cggcgg7/ _The cane toad stings you!cgg  You hit the cane toad. You burn the cane toad.  The cane toad is almost dead.cggj5=---9.8cggQcgg7 _You block the cane toad's attack.cgg%  cgg.You hit the cane toad. You burn the cane toad.cgg.F†cgg77-cgg?"40.7cggTcgg$M _You kill the cane toad!cggdcgg/cggcggBcggk6=cggPcggH,cggcggq,cggcggcgg%7cggqcggcggcgg{cggcgg%8cggCcgg,cggcgg,cggcgg|cggK9=cggVcgg5 ,cgg cgg cgg[ cggM cgg= cgg [100/103=cgg` cggY cgg cgg cgg cgg3 %1cgg6 cgg ,cggL cgg^" cgg" cgg$ cggM' cgg' %2cgg( cgg, ,cggA. cggv1 cgg1 cgg2 cggu7 cgg7 D3=cggp8 cgg; 1 _HP restored.cggy? 3cgg)A cgg2E cggH cggrI cggJ cgg]M cggP cgg7Q cggR cggV cggY cggFZ 9=cgg[ cgg] cgg_ cgg` cgg` cggc cggzf ,cggOg cggh cggNk cggk cggDl cggp cggVp cggp cggu N _You now have 736 gold pieces (gained 19).cggw cggw cgg{x cgg{ cgg} cgg~ cgg~ cgg cgǵ cgg cgg cgg cgg( cggo cgg cgg cgg cggы cgg; cgg9 cgg cgg cgga cgg cgg˒ cgg cgg cgg cgg  ..###.###.##P ... ###....##.# .........cggJ S#.##..####..P.###...#.## ..................####.#####.#####..........†.#.####@########...####.-76.7 (36.0).cgg  #####.#####.#...... . .. ....... ... ...###.#.##cggŝ  .... .. .....cggL J ..)...cgg cgg) F-7.7 (37cgg. cgg ' _Found a shortbow.cggF cgg cgg\ cgg cgg cgg. cgg ,cgg ,cgg* cgg cgg\ cgg cgg cgg cgg #.##..####..P.###...#.....####.#####.#### ............† .#.####.######cgg 5#..................... #####.#####.#...... .... .#####@........###.#.## ##  ............. #.#.##...)....... .. ..........## #.# ..#.#.####F   bullfrog (asleep).. .........F. .......cgg H80.0)cgg vFF.cgg +1.7 (4cgg cgg [ _A bullfrog comes into view.cggzr  † .#### ...  #########.#####  ............... .#####@....... #..........#  .............  #.#.##...).....  .. .. .......... cggs ## #F# ..#.#.####  .. ........  ... ....... cggv  † .#### ...  #########.#####  ............... .#####@....... #..........#  .............  #.#.##...)... .. .. ........ ## #F# ..#.#.####  .. ........ ... ....... cggpcggcggcgg_ _A bullfrog is nearby!cggA  cggg6† .#### ...  #########.#####  ............... .#####@....... #..........#  .............  #.#.##...).....  .. .. ..........  cggΣ## #F# ..#.#.####  .. ........  ... ....... cgg9@  † .#### ...  #########.#####  ............... .#####@....... #..........#  .............  #.#.##...)... cggA.. .. ........ ## #F# ..#.#.####  .. ........ ... ....... cgg=JcggKcggRcggV_ _A bullfrog is nearby!cgg  † .#### ...  #########.#####  ............... .#####@....... #..........#  .............  #.#.##...).....  .. .. ..........  ## #F# ..#.#.####  .. ........  ... ....... cgg<  † .#### ...  #########.#####  ............... cgg*>.#####@....... #..........#  .............  #.#.##...)... .. .. ........ ## #F# ..#.#.####  .. ........ ... ....... cgg Z _A wolf comes into view. x2cgg  ......................####..P................. .............##.# ..................##..##..######............... #####.@$. ##.).cgg S ...h#..#.###..h..##### ....h.. ..#.### ..cgg cgg cggo cggL cgg h.hh 4 wolves (3 wandering)cggn /--3cggcgg W _A wolf comes into view.cgg'=e .. cggT>]..####..P. .......... .......##.# . ............... ...##..##..######................. #####..$ ##@)......h......h.#..#.###....h..##### ...hhh.. .##.##hhhhhh 6 wolves (5 wandering)..##cggJg  2 wolves come into view.cgg&M4  The wolf howls!cggNcggOcggPcggZRcggXcggboh.hhhh3cggf0===4cgg(ocggs5 _You block the wolf's attack. x2cgge  The wolf howls! x2  You slash the wolf! You burn the wolf.cgg!cggcggGcgg8cggXcggcggcggcggkcggfl  The wolf is severely wounded.cgg#hhh..hh...hhhhhcgg&5cggfcgg2 _You block the wolf's attack.cggXa  You hit the wolf but do no damage.The wolf is severely wounded.cggacggubcggdcggqhh#h...cgg>r4--9 (0.9cggR~cgg5 _You block the wolf's attack. x2cggPK  You slash the wolf! You burn the wolf.cggcggcggcggW  You kill the wolf!cggcggR Fh.h#. 5F   bullfrog (wandering)cggG Q=-6.8cgg cgg [ _A bullfrog comes into view.cggX y  The bullfrog gives a loud, deep croak!  You slash the wolf! You burn the wolf.cgg l  The wolf is severely wounded.cgg  The wolf bites you but does no damage.  A komodo dragon comes into view.The Shining One will bless your weapon with holy wrath... once.cgg$ .............F.....cggJ ...cgg .##ll   komodo dragon (wandering)hhhhh 5 wolvescgg TF   bullfrogcggP O*====7.7cggR cgg cgg /  --more--cgg: _The wolf bites you but does no damage.cgg"You hit the wolf but do no damage.The wolf is severely wounded.You block the wolf's attack. x2; The bullfrog completely misses you.cggtl.lcgg]=---8.6cgg$cgg(* _You block the wolf's attack.cgg  You hit the wolf. You burn the wolf.  The wolf is severely wounded.The wolf closely misses you. You block the bullfrog's attack.cgg D---9.5cgg cgg _The wolf barely misses you. The wolf misses you.cgg7'  You completely miss the wolf.The wolf is severely wounded.You block the wolf's attack.cggr3 l.The bullfrog hits you but does no damage.cgg3 )20.4cggS; cgg> o _You block the wolf's attack. x2; The bullfrog misses you.cgg  You hit the wolf. You burn the wolf.  The wolf is almost dead.cgg5 .lThe wolf bites you but does no damage. You block the wolf's attack.  The bullfrog hits you but does no damage.cgg(1.3cggcggQ _The wolf barely misses you.cgg  You hit the wolf but do no damage.The wolf is almost dead.You block the wolf's attack.cggm( .lThe bullfrog hits you but does no damage.cgg((2.2cgg5cgg;5 _You block the wolf's attack. x2cggI  You hit the wolf. You burn the wolf.cggcggW  You kill the wolf!cggcgg0L .l. 4  The wolf barely misses you. The bullfrog barely misses you.The wolf completely misses you. You block the wolf's attack.cggv093.1cggecgg? _The bullfrog hits you but does no damage.cggN  You hit the bullfrog. You burn the bullfrog.  The bullfrog is moderately wounded.cggv l. You block the wolf's attack. The wolf completely misses you.4.0 _The bullfrog closely misses you.cgg  You block the wolf's attack. The wolf completely misses you.The bullfrog closely misses you.  The bullfrog is severely wounded.  The wolf misses you. The wolf closely misses you. The bullfrog misses you.  The wolf bites you but does no damage. The komodo dragon bites you!cggz c95/103 --=9cgg cgg U _The wolf completely misses you.cgg?c S  You slash the bullfrog! You burn the bullfrog.cggr .  You kill the bullfrog!You block the wolf's attack. x2; You block the komodo dragon's attack.cggw _6---5.8cgg cggC Q _The wolf barely misses you.cgg  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is moderately wounded.cgg+G-6.8 (1.0cgg&cggt _You block the wolf's attack. x3; The komodo dragon misses you.cgg[ .. .............. .....####..P..............cggR ........##.#.. ...................##..##..######..........#####@.$. cggQ`##.). .....hhhl........ .....h#..#.###...cgg} .......#####... ..........##.###cgg}   wolf ..##cggcggBcgg/hl†h.h 2 wolvescgg!.-7cgg$cggR cggQ  You slash the wolf! You burn the wolf.  The wolf is severely wounded.cgg|]@l)cgg ^>7==8.7 (0.9cgghcgg5mJ _The wolf misses you.cgg K  You slash the wolf! You burn the wolf.cgg cgg+ cgg [†   wolfcgg 940-9.6cgg cggR H _You kill the wolf!cggC p  You hit the komodo dragon but do no damage.cggG w  The komodo dragon is moderately wounded.cggP hh 2 wolves  The wolf closely misses you. You block the komodo dragon's attack.cggQ C-30.5cggY cgg;] 2 _You block the wolf's attack.cgg0 ]  You slash the komodo dragon! You burn the komodo dragon.cgg u  The komodo dragon is severely wounded.cgg cgg4Vh) cgg98==1.4cggcgg#X _You block the komodo dragon's attack. You block the wolf's attack.cggwj]  You slash the komodo dragon! You burn the komodo dragon!cgglcgg}n`  You kill the komodo dragon!cggv|h$hhhh 3 wolvescggE{QCarver12.3cgg҄cgg5 _You block the wolf's attack. x3cgg:I  You hit the wolf. You burn the wolf.cggT<n  The wolf is moderately wounded.cgg>CcggC1--3.2cggLcggO5 _You block the wolf's attack. x2cgg  You hit the wolf but do no damage.The wolf is moderately wounded.cgg;,† 2cggz cggZi9=--4.1cggPcgg cggO_You block the wolf's attack. x3; The wolf bites you but does no damage.cgg^ K  You slash the wolf! You burn the wolf.cggw cgg> W  You kill the wolf!cgg n†   wolfcggٜ =2=5.1 (1.0cgg cgg` 2 _You block the wolf's attack.cggJ;  You slash the wolf! You burn the wolf.  The wolf is heavily wounded.cggl< cggJH 9 cggH &6cggS cggAV 5 _You block the wolf's attack. x2cgg  You slash the wolf! You burn the wolf.  The wolf is almost dead.cggcggIh†hh 2 wolvescgg{k100/103=7.0 (0.9cggcgg2 _You block the wolf's attack.cggVL  You slice the wolf!! You burn the wolf.cggXcggb †h†   wolf  You kill the wolf!cggg.-9cggpcggvu2 _You block the wolf's attack.cgg`cggB-8.8cgg3!cgg% _You barely miss the wolf. The wolf closely misses you.cggs  You slash the wolf! You burn the wolf.  The wolf is moderately wounded.cgg( 519.6 (0.8cggv cgg g _The wolf misses you. You block the wolf's attack.cggf  You closely miss the wolf.The wolf is moderately wounded.cgg .40.5 (0.9cgg cgg J _The wolf misses you.cggqYK  You slash the wolf! You burn the wolf.cgg`cF†cgg}h93==1.4cggpcggsH _You kill the wolf!cggcgg1cgg cggH _No target in view!cggK'cgg'cgg;-cgg0H _No target in view!cggcggVcgg cggcggnB2 _cggcggcgg1cggj,cggͯcgg#cgg~K3=cggcggݷcggMcgg|cggcgg$  Things that are here:  a wolf corpse; a komodo dragon corpsecggkcgg _cggcgg;,cggcggN _You now have 748 gold pieces (gained 12).cgg0cgg9=cggcgg9  Things that are here:  a wolf corpse; a wolf corpsecggcggL _cggcggL`  You see here a wolf corpse.cggcgga _cggcgg:cgg,cggcggXcggcgg,cggcggo cgg,cggmcggcgg|,cggcggcgg ,cgg!cggx$cgg&cgg&cgg:(cgg*cgg.cgg9,..††  #.......#..#.### #........######.... .............##.###..#P.##. ..........cgg9#..######............#.....@.###..##..#---#.......# P.# ..#F.....!.... .... .....##.##.P###.##... .. .... ..cgg9. #P. ####. F   bullfrog (wandering) .. ...##cgg9=.. cggB058.4 (17.0)cggrCH---9.4 (18cgg9KcggN[ _A bullfrog comes into view.cgg۔ .††  .  .####  ....  #..#P.##.  . ..........  #..######..........  ...................  #.....@.#  #.......# P.# ..#  F.....!.... .... .. cgg] ...##.##.P###.##.  .. .. .... ..  . #P. ####.  .. ..  .## .. cgg*/  .††  .  .####  cgg/ ....  #..#P.##.  . ..........  #..######..........  cgg/ ...................  cgg/ #.....@.#  cgg0 A#.......# P.# ..#  F.....!.... .... ..  cgg0 ...##.##.P## .. .. ....  . #P. ####.  .. .. cgg0 .## .. cggA cggA cggK cggO _ _A bullfrog is nearby!cgg*H m .††  .  .####cggH f  ....  #..#P.##.  . ..........  #..######..........  ...................  #.....@.#  #.......# P.# ..#  F.....!.... .... ..  ...##.##.P###.##. cggH p .. .. .... ..  . #P. ####.  .. ..  cggI =.## .. cgg / .††  .  .####  ....  #..#P.##.  . ..........  #..######..........  ...................  #.....@.#  cgg #.......# P.# ..#  F.....!.... .... ..  ...##.##.P## .. .. ....  cgg 9. #P. ####.  .. .. cgg .## .. cggJ cgg cgg cgg _ _A bullfrog is nearby!cgg?\H #.......#..#.###... #........###.. .............. ...##.###..#P.##. ....................##..######...................... #.......###..##..# #.# P.# ..#.F.....!......... ......##.##.P###.##.  .. ..... ... #P. ####... ... ...### ...cgg_cggacgggkQF.cggwl960.0) _cggscggwcgg #.#..#.###...### #.######...... ........##.###..#P.##. ............#..######......... #.###..##..# #F..@...# P.# ..#.!. ...##.##.P###.##.. ...........cggqE#.. #P..####..... ..... .... .####P .. .. ..cggaF...cgg&1cggKcggrcgg"W7 #.#..#.###....#####.######........ .......##.###..#P.##. ...... ###..######. .. #.F.....###..##..# #.# P.# ..#.!. ...##.##.P###.##... .........#... #P..####..... ..... ....#. .####P. ........ ...cggev FF  The bullfrog croaks.cggeE====2cggelcggo9 _You block the bullfrog's attack. x2cggx=---3.3 (0.9cggcggt _You barely miss the bullfrog. You block the bullfrog's attack.cgg Z---4.2cggj cgg t _You barely miss the bullfrog. You block the bullfrog's attack.cggQX cggX (5.1cggd  _You closely miss the bullfrog. You block the bullfrog's attack. x2cgg  You hit the bullfrog. You burn the bullfrog.  The bullfrog is lightly wounded.6.0cggcgg 6 _You block the bullfrog's attack.cggb$S  You slash the bullfrog! You burn the bullfrog.cgg.E†cgg3.=9cgg;cgg>L _You kill the bullfrog!cggߋcggcggcggH _No target in view!cgg53cgg6cgg:cggN>cgg'C: _cggCcggpFcggFcggNHcggN,cggROcgg\ _z - 3 potions of haste (gained 1)cgg^,cgg `cggAhXcggicggOlcgglcgg΃cggt,cggxBcgg%cgg,cgg5#.†.....###..##..# #.......###P.##..#####.# ........................ ..##.##.P###.##.##.#..## ........................ .##P..####.............. ........... #.####P................Y ................@....... -- ..#..###..##...###.P##.. ...................:... .################## .## # Y   yak (asleep) cggox 83.9 (17.0)  A yak comes into view.cggG--4.9 (18cggcgg|, _Found a book of Frost.cgg †.#P.##..#####.# .................... .##.P###.##.##.#..## ................... .####.............. .................. ................Y ........@....... ..##...###.P##.. ..........:... #### .##.  # cgg? 3cggni †.#P.##..#####.# .................... .##.P###.##.##.#..## cgg,j ................... .####.............. .................. ................Y ........@....... ..##...###.P##.. ..........:... #### .##.cggj U # cggBw cggx cgg\ cgg Z _A yak is nearby!cgg'g †.#P.##..#####.# .................... .##.P###.##.##.#..## ................... .####.............. .................. ................Y ........@....... ..##...###.P##.. ..........:... #### .##.  # cgg9†.#P.##..#####.# .................... .##.P###.##.##.#..## ................... .####.............. .................. ................Y ........@....... cgg)..##...###.P##.. ..........:... #### .##. # cgg9 cgg cggcggZ _A yak is nearby!cgg~ ((((((Ypoisoned)You throw a poisoned dart. The poisoned dart hits the yak. The yak is poisoned.cggcgg}..Y(... cggij==6.0 (1.1)0cggcgg!< _The yak bellows! You hear a bellow! x2cggs (((((You throw a poisoned dart. The poisoned dart hits the yak.cggfUcgg2^v..(....Ycgg^q--7.19 darts (poison) cggfcggi1 _The yak is lightly wounded.cgg ((((You throw a poisoned dart. The poisoned dart hits the yak.cgg cgg( l...Y(cgg( s--8.28cgg0/ cgg32 1 _The yak is lightly wounded.cgg (((((((You throw a poisoned dart.cgg cgg3 m  The poisoned dart barely misses the yak.cgg cgg YY..Y.(..YY 3 yaks (1 poisoned)cgg{ X9.37cgg cgg Y _A yak comes into view. x2cggؙ (( very poisoned)You throw a poisoned dart. The poisoned dart hits the yak.  The yak looks even sicker.cggI cgg"cggd&@  The yak is lightly wounded.cgg'cgg5G.Y.YY.Y.YY 4 yaks (1 wandering, 1 very poisoned)cggc6Y90.46cgg*Bcgg+V _A yak comes into view.cgg.†.....###..##..# .......###P.##..#####.# ................... ##.##.P###.##.##.#..#. ##P..####.Y..YY. .####P..((.........@Y..(.#..###..##...###.P##.......:... ##########.##.###cgg,cggWcggcggYY..YYYcgg(4=10cggacggT _The yak completely misses you.cggD_  The yak bellows!  You hit the yak. You burn the yak.cgg,FcggH@  The yak is lightly wounded.cgguJcggZK Y..Y.((YYY 5 yaks (1 wandering, 1 very poison…A yak comes into view.cgg[/==2cgggcggFl1 _You block the yak's attack.cgg$h  The yak bellows!  You hit the yak but do no damage.cggcggcggcggcgg Y.Y..(Y.Y.Ypoisoned)The yak is lightly wounded.-3.3 (0.9cggcgg&T _The yak completely misses you.cgg.B I  You slash the yak! You burn the yak.cggbC ,cggTD cggsE cggT .YY...Y(cggU 0=4.2cggJ] cgg?b \ _The yak is severely wounded.cgg1_deadiverson the Carver (Human Fighter) Turns: 16628, Time: 00:29:35 Health: 103/103 AC: 20 Str: 17 XL: 13 Next: 43% Magic: 13/13EV: 19 Int: 11 God: the Shining One [******] Gold: 748SH: 16 Dex: 15 Spells: 12/12 levels left rFire . . .a - +0 scimitar (flame) rCold + . . l - +1 kite shield rNeg + + + c - quicksilver dragon scales of the Indigo Skies {rC+ WillrPois + (no helmet) rElec .cgg7`Lw - +2 cloak {Stlth+} rCorr .P - +0 pair of gloves SInv .A - +0 pair of boots Will +....d - amulet of faith Stlth +p - +5 ring of evasion HPRegen 0.37/turn D - ring of poison resistance MPRegen 0.13/turn %: faith @: glowing A: explore regen, iridescent scales 1, large bone plates 1, inability to drink cgga`after injury 1cgg@ cggU J.†.....###..##..#deadiverson the Carver .......###P.##..#####.#Human of the Shining One ****** .......................Health: 103/103 ======================== .##.##.P###.##.##.#..###Magic: 13/13 ======================== ........................AC: 20Str: 17 ##P..####...............EV: 19Int: 11 ..................Y.....SH: 16Dex: 15 .####P...........Y...Y(.cggTV XL: 13 Next: 43% Place: Lair:1 ................@YY.(...Noise: ===------  Time: 16794.2 (0.0) .#..###..##...###.P##...a) +0 scimitar (flame) ..................:...Throw: 6 darts (poison) ###################.##.###YYYYY 5 yaks (1 poisoned)The yak bellows!  You hit the yak but do no damage.The yak is lightly wounded. _The yak completely misses you.You slash the yak! You burn the yak. _The yak is severely wounded.cggV cggE_ cggc cgg.....###P.##..#####.#............... cggp##.##.P###.##.##.#..####....................... #P..#### .........Y ####PY...Y(.....YY.(... #..###..##...###@P##... cgg................:... ##################.##.## cgg5## cggcggcggcgg'..Y..(YYY.Ycggt)4--5.2 (1cgg2cgg73 _The yak misses you.cgg8cgg!4................. .##.##.P###.##.##.#..#### ......................... ##P..####......... .................. .####P............Y..((.. .........YYY.Y.... .#..###..##...###.P## cgg4................@.:...... ###################.##.## ##  4cgg8cgg8cgg9cgg:cggUC.Y(Y---6cggtHcggK1 _The yak looks more healthy.cggs. ..##.##.P###.##.##.#..####.......... .##P..####........................... #.####P...............((.......YYYY(.... .cgg.#..###..##...###YP##....:...... .#.##.## ## 3 yakscggjcgg cgg9R Something gores the plant! The plant begins to die.cgg/cggr T.Ycgge .=7cggpcggT _The yak attacks as it pursues you! You block the yak's attack.cgg,..##.##.P###.##.##.#..####.......... ..##P..####..........cggK-B............... .#.####P...............((......YYY.(.....#..###..##...###YP##....Y.:......  .#.##.## ## 2 yakscgg1cgg5b  Something gores the plant! The yak attacks as it pursues you!cgg?T.Ycgg?&8cgg_Hcgg]LV _The yak gores you but does no damage. Something gores the plant!cgg1ccggp .YY 3 yaksYou hit the yak but do no damage. You block the yak's attack.cggq-9.0 (0.8cggvwcggy0 _Something gores the plant!cgg I  You slash the yak! You burn the yak.cgg cgg .YY 4 yakscgg 4The yak is moderately wounded.cgg +9 (0.9cgg cgg 1 _You block the yak's attack.cgg,  You hit the yak. You burn the yak.  The yak is heavily wounded.cgg7 w. 3 yakscgg8 *800.8cggQB cgg]G L _You block the yak's attack. Something gores the plant!cgg   You slash the yak! You burn the yak.  The yak is almost dead.cggcggocgg}.YYYY 5 yakscggp0=1.7cggcggi _A nearby plant withers and dies. The yak misses you.You slice the yak!! You burn the yak.cggcggrcgg$w. 4 yakscgg'84-2.6cggb1cgg;5G _You kill the yak!cgg#G  You hit the yak. You burn the yak.cgg$cggj2 .YThe yak is lightly wounded.cgg'3!-cggP3&3.4 (0.8cgg >cgg+C1 _You block the yak's attack.cgg9qG  You hit the yak. You burn the yak.cgg~ . 3 yaksThe yak is moderately wounded.cggw-4.3 (0.9cggcgg Q _The yak closely misses you.cggq  You hit the yak. You burn the yak.  The yak is moderately wounded.cgg (5.2cggcggM1 _You block the yak's attack.cgg4  You slash the yak! You burn the yak.  The yak is severely wounded.cgg 5=6.0 (0.8cgg{ cgg 1 _You block the yak's attack.cgg G  You hit the yak. You burn the yak.cggk# YY 4 yaksThe yak is severely wounded.cgg[$ 3-9 (0.9cgg)- cgg2 1 _You block the yak's attack.cgg 4  You slash the yak! You burn the yak. . 3 yaksYou kill the yak!cgg G5=7.8cggk cggcgg-_The yak gores you but does no damage.cggI  You slash the yak! You burn the yak.cggV  You kill the yak!cgg#w. 2 yakscgg(068.7cgg|-cgg0T _The yak completely misses you.cggAw  You hit the yak. You burn the yak.-9.6cggPcgg^ _The yak is moderately wounded.cgg0  You slash the yak! You burn the yak.  The yak is heavily wounded.cgg01=10.5cgg8cgg";e _You block the yak's attack. The yak misses you.cgg H  You hit the yak. You burn the yak.  The yak is severely wounded.-1.4 _You block the yak's attack. The yak closely misses you.cggH  You hit the yak. You burn the yak.  The yak is severely wounded.cggI B-2.3cggP cggS L _The yak misses you. x2cgg7  You hit the yak. You burn the yak.  The yak is almost dead.cgg (3.2cgg cgg 4 _You block the yak's attack. x2cgg`I  You slash the yak! You burn the yak.cggp †   yakYou kill the yak!cggw87=4.1cggӅcggn cggLJC_The yak closely misses you.cggTcggT0-5.0cggj]cggub _You hit the yak but do no damage. The yak barely misses you.cgg|  You hit the yak. You burn the yak.  The yak is moderately wounded.cgg @-9cggcgg{1 _You block the yak's attack.cgg  You slash the yak! You burn the yak.  The yak is heavily wounded.=6.8cgg’cggڕQ _The yak closely misses you.cgg4  You hit the yak but do no damage.The yak is heavily wounded.cgg5 0-7.7cggVC cggG 1 _You block the yak's attack.cggZ  You hit the yak. You burn the yak.  The yak is severely wounded.cgg G-8.7 (1.0cggg cgg ; _The yak gores you but does no damage.cgg]  You barely miss the yak.cggC -9.6 (0.9cggA-r _The yak is severely wounded.cggI  You slash the yak! You burn the yak.cggUC† cgg*98=20.5cggcggʺG _You kill the yak!cggU ##.##.P###.##.##.#..#### ......... ##P..####.......... .............. #.####P...............((.. .......(.... #..###..##..†###..##... ..:...... .#.##.## ## cggO]cgg]6--1.5 (1.0cggacggng  Things that are here: _a yak corpse; a yak corpse; a yak corpsecgg ##.##.P###.##.##.#..#### .cggr........ ##P..####.......... ................ .####P...............((.. ........(.... #..###..##..†###..##... †@.:...... #cgg.##.## ## cggcggH--2 _cggcggcggA 7 ##.##.P###.##.##.#..#### ...... cggB GP..####......... .... ####P...............((.. .........(.... #..###..##..†###..##...#†.@:...... .##.## ## cggHL cggL &3cggS cggV cggi .##.P###.##.##.#..#### ... P..####....... ....... P.........((............(.... ..###..##..†###..##...#.cggj†..@..##.### cggtcgg_u&4cgg|cgg4U  You pick up a book of Frost and begin reading...cgg+5.5 (2cggcgg_ _You add the spells Freeze, Frozen Ramparts and Hailstorm to your library.cgg###P.##..#####.# ..................... #.##.P###.##.##.#..##### .......... P..####.... ............... ###P...............((................(....###..##..†###.@##...#. .............†.......... #################.##.#####6.5 (1cggcggcggb###..##..# ###P.##..#####.# .................... ##.P###.##.##.#..###### .......#### ...... ##P(..............@(......cgg;###..##..†###..##...#.P ............†........... ################.##.######cggf!<7cgg%cgg|(cgg]Gg###..##..# ###P.##..#####.# ......... ##.P###.##.##.#..######.(####. #P.((....#. cggH###..##..†###..##...#.P..†.......######.##.### ##cggCWcggW&8cgg_cgg1j4 _Found 4 stones.cggk[9.5 (27cggqcggt_ _f - 7 poisoned darts (gained 1)cgg7 Z......... ###..##..# ###P.##..#####.# .................. #.P###.##.##.#..######......( #### ..cggp8 ......= P(....# ....................... ##..##..†###..##...#.P ..........†............. ##############.##.####### ##cggD cggmE ,30.5 (1cggM cggPY e _Found an emerald ring.cggZ [1.5 (28cgg` cgg|c _ _f - 8 poisoned darts (gained 1)cggVcggCWcgg0Ycgg0^cggacgg;e,cggjcggkcgg.mcggr$ cggrJ_f - 9 poisoned darts (gained 1)cggwcggwcggbycgg$}cggcggcgg`cggcgg,cggcggAcggBcgg9cggMcggâcggcggcggcgg֭cgg?cgg( ... .... .. ##..# #..# ##... ##..#####.# ##..##.P.. cgg6........... ........ ##.##.#..######........ ....(..... #.##..# ......@.......cgg......###.##..# ..................... 9†###..##...#.P.......# cgg...†.................... #######.##.###cggӺI####### ########cggcgg+9.5 (8cgg,40.5 (9cggcgg". _L - a +4 ring of slayingcggZ3cgg[cgg_cggbcggccggSgcgghcggVjcggjcggkcgg6n;  You see here 4 stones.cggpcggep _cggiqcggxrcggtcgg{#####........ .#P.##. .......cggf{t #####4 ....... ..... ..##..# # #..# ##... cgg{}P.##..#####.##.##..##.P.......... #.##.##.#..######................(....... ...................#.##..#cgg|................. .................###.##..#4   orange demon (reaching, wandering) cggO|....................... . #..†###..##...#.P.......# cggo|N.....†....................cggǃ+3.5 (3cgg+4.5 (4cggPcggG` _An orange demon comes into view.cgg). ..  #####4  ..... ..  # #..# ##... ##.##.##..##.P... .......@......... ..######........ (....... ..#.##..# ......... cgg})y###.##..# ... . †...# † cgg|A. ..  #####4  ..... ..  # #..# ##... ##.##.##..##.P... .......@......... ..######........ (....... ..#.##.......###.##..# ... .†..†cgg7cggcggcggd _An orange demon is nearby!cgg@icggzlPut on which piece of jewellery? Jewellery (go to first with "=)  d - an amulet of faith (around neck)  p - a +5 ring of evasion (left hand)  D - a ring of poison resistance (right hand)H - a ring of willpower  cgglmL - a +4 ring of slaying[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip cggG cgg)cggM#####....deadiverson the Carver .........Human of the Shining One ****** .#P.##..Health: 103/103 ======================== .........Magic: 13/13 ======================== .......#####4AC: 20cggStr: 17 ............ ..EV: 19Int: 11 ..##..## #..# ##...SH: 16Dex: 15 P.##..#####.##.##..##.P...XL: 13 Next: 48% Place: Lair:1 ................@.........Noise: ---------  Time: 16844.5 (0.0) #.##.##.#..######........a) +0 scimitar (flame) cgg4.................(.......Throw: 9 darts (poison) cggW...................#.##..# cggx.......................... .................###.##..#cgg4   orange demon (reaching, wandering) ....................... . cgg#..†###..##...#.P.......# .....†.................... cgg_f - 8 poisoned darts (gained 1) _f - 9 poisoned darts (gained 1) _L - a +4 ring of slaying cgg _You see here 4 stones. _An orange demon comes into view. _An orange demon is nearby!cgg;.}  You're wearing all the rings you can. Remove which one?(? for menu, Esc to cancel)< or p - a +5 ring of evasion; > or D - a ring of poison resistancecgg\h cggAs K.4cggt 545.0 (0.5cgg| cgg҅ | _You remove your +5 ring of evasion.cggW A5 (1.0cgg cgg5 : _L - a +4 ring of slaying (left hand)cgg....  #P.##. .  ..  #####.  ....4 .. ##..# # #..# ##... .##..#####.##.##..##.P...  .##.##.#..######.. .(. ....#.##..#................###.##..#........... . ..†###..##...#.P.......# cggcgg^4.4   orange demon (reaching, wandering)cgg&6cgg6cggcggI. ###.... ... ....... ... P.##. ##..  .... .. #..#####. .... cggs ....4. .. ##..# # #..# ##... ##..#####.##.##.@##.P... ............... ##.##.#..######..#(........#.##..#cgg8........ ###.##..#................... cggBT†###..##...#.P#cgg 44ing)The orange demon screeches! You hear a shout!cggZE====7cggscgg: _You block the orange demon's attack.cggWpd... .###... ###..# ....... ...  .. P.##. ##..  .#..... ..###..#####.##.# ..... ........4...... # #.@# ## ##..#####.##.##..##.P... ........................ ##.##.#..######........#..(.............#.##..#..................###.##..# ............... .cgg>zcgg({[=---8cggcgg _The orange demon closely misses you. You block the orange demon's attack.cgg{ Y  You hit the orange demon. You burn the orange demon.cgg 66   Amaemon (wand)4   orange demon (reaching)The orange demon closely misses you. You block the orange demon's attack.  You hit the orange demon. You burn the orange demon.is lightly wounded.  Amaemon the Diabolical Poisoner comes into view. He is wielding a +1 demon whip of venom and carrying a wand of charming.  The orange demon stings you but does no damage.cggn I---9.4 (0.9cgg cgg : _You block the orange demon's attack.cggb  You hit the orange demon but do no damage.The orange demon is lightly wounded.cggm S.6cggn .50.2 (0.8cggw cgg~ = _You block the orange demon's attack. x2cgg o  You hit the orange demon but do no damage.cggcggz641.1 (0.9cggcgg0: _The orange demon is lightly wounded.cgg2l  You slash Amaemon! You burn Amaemon.  Amaemon is lightly wounded.cgg3+9 (0.8cgg9=cggA: _You block the orange demon's attack.cggl  Amaemon is lightly wounded. _You block the orange demon's attack.  You slash Amaemon! You burn Amaemon  Amaemon is moderately wounded.  Amaemon hisses.  Amaemon's attack. x2; Amaemon closely misses you.cgg5=2.8 (0.9cggcgg7E _The orange demon stings you but does no damage.cgg  You slash Amaemon! You burn Amaemon.  Amaemon is heavily wounded.cgg|cggO4 [  Amaemon zaps a wand. You resist with almost no effort.cgg5 (3.7cggA cggF R _The orange demon misses you.cgg   The orange demon misses you.  Amaemon is severely wounded.hits you but does no damage.  You are poisoned.  You block Amaemon's attack. Amaemon barely misses you.cgg {=4.6Pois cgg cgg! : _You block the orange demon's attack.cgg  You slash Amaemon! You burn Amaemon.  Amaemon is severely wounded.cggs1=-5.5cggcgg/$ _You feel sick.cggF   You slash Amaemon! You burn Amaemon.  Amaemon is almost dead.You block Amaemon's attack. x2; Amaemon closely misses you.-=6.3 (0.8 _You block the orange demon's attack.cgg0  You barely miss Amaemon.  Amaemon is almost dead.You feel sick. You block Amaemon's attack. Amaemon barely misses you.0--7.2 (0.9cggcggV _You block Amaemon's attack. You block the orange demon's attack.cgg  You slash Amaemon! You burn Amaemon.  You kill Amaemon!The Shining One accepts your kill.cgg)4   orange demon (reaching)cggb251--8.1cggcgg Z _You feel better. You feel sick. You block the orange demon's attack.cgg H .....   ##.... ... # ...... ... .##. ##.. # ..... ..  ###..#####.##.## .... ........@4........# #####..####.... #..#####.##.##..##.P.... ....................... #.##.#..######........#(........ ....#.##..#........###.##..#cgg cgg -9.1 (1.0cgg cgg _You feel sick. You block the orange demon's attack. x2  Things that are here: _a +1 demon whip of venom; a wand of charming (5)cgg Things that are here: _a +1 demon whip of venom; a wand of charming (5)  You slash the orange demon! You burn the orange demon.  The orange demon is moderately wounded.  You feel sick.  You are no longer poisoned.cggv1==60.0 (0.9cgg?cgg _The orange demon completely misses you. You block the orange demon's attack.cgg  You hit the orange demon. You burn the orange demon.  The orange demon is heavily wounded.cgg62-9cggcgg= _You block the orange demon's attack. x2cgg  You slash the orange demon! You burn the orange demon.  The orange demon is severely wounded.cgg%=cgg21.9 (1.0cggcgg _You block the orange demon's attack. The orange demon completely misses you.cgg  You slash the orange demon! You burn the orange demon.  You kill the orange demon!The Shining One accepts your kill.cggb E.cgg #3cgg @=32.8 (0.9cgg* cgg & _You feel better.cgg   ..... #.## #.... ... P..##.  ... ..... ##. ##.. P..#  ..... ...  ###..#####.##.# .) ..# #####..####. ..#####.##.##..##.P......... . .##.#..######..(....... cggj L--3.8 (1.0cgg cgg cgg_.. ..#... #.## # ##.... ... P..##.. ...cgg ..... .##. ##.. P..#. ..... .... ###..#####.##.###. .. #..# #####..####..... cgg#..#####.##.##..##.P........... . #.##.#..######........#.(......#.##..#...cggN.. .###.##..#cggcgg?A--4cgg#cgg/R  N - a wand of charming (7) (gained 5 charges)cggU0+5.8 (2cgg6cggs9\ _You see here a +1 demon whip of venom.cgg-cggcggԈcggcgg1cggGO=cggۥcggbcgg,cggӫcggcgg],cggٸcggHcgg,cggcggcgg,cgg cggcgg..###### P[## ........ . .... ........ S. ... ....cggH.. .#.##.. .... ........ ....... ... #.###... ....... ###.## # ####.... .......###.P..##...... cgg|}.. #P.##. .##..###.##P..##.## ...... ...................cgg .###..#####.##.#### cgg...... ........)......... .##..# .#####..####......cggS   water moccasin (asleep)##..#####.##.##..##.P..........cggE..... .##.##.#..######........####cggP 72.8 (7  A water moccasin comes into view.Found a scale mail.cgga.SScgg+3.8 (8cggcgg8 _The water moccasin hisses angrily.cgg3 P[## . .... .S ... ....  .#.##.. ....  ....... ...  ....... ###.## #  .......###.P..##..  .......@..........  .##..###.##P..##.##  ...................  .###.#  ).........  ...... .....   cggA6? P[## . .... .S ... ....  .#.##.. .... cgg6O ....... ...  ....... ###.## #  .......###.P..##..  .......@.......... cgg6 .##..###.##P..##.##  ...................  .###.#cggQ74 ).... ...... .....cggE4cgg=LcggOe _A water moccasin is nearby!cgge? P[## . .... .S ... ....  .#.##.. ....  ....... ...  ....... ###.## #  .......###.P..##..  .......@..........  .##..###.##P..##.##  ...................  .###.#  ).........  ...... .....   cggZ P[## . .... .S ... ....  .#.##.. ....  ....... ... cgg ....... ###.## #  .......###.P..##..  .......@..........  .##..###.##P..##.## cgg ...................  .###.# ).... ...... .....cggcggcggcgge _A water moccasin is nearby!cgg  P[## . .... .S ... ....  .#.##.. ....  ....... ...  ....... ###.## #  .......###.P..##..  .......@..........  .##..###.##P..##.##  ...................  .###.#  ).........  ...... .....   cgg y P[## . .... .S ... ....  .#.##.. ....  ....... ...  ....... ###.## #  .......###.P..##..  .......@..........  .##..###.##P..##.##  ...................  .###.# ).... ...... .....cgg cgg cgg cgg e _A water moccasin is nearby!cgg6y (((((You throw a poisoned dart.cggcggvcgg(.S...cgg]4.9 (1.18cgg- cgg$@ _The poisoned dart hits the water moccasin.cgg& cggl`(((((You throw a poisoned dart.cggVcgg%ck.S..cggdX6.07cgg[ncggTrm _The poisoned dart completely misses the water moccasin.cgg##.#....... ... ..... cgg#..######^ P[##.#..###... ........... ...( ............ )...#.##........... ............(....... ... .#.###........S...####.## # #####....cggUn###.P..##.. ............................ .cgg#P.##. P.##..###.##P..##.##. .................... ..###..#####.##.#### .cgg...... . ........)... ..##..# .#####..####..... cgg]P.##..#####.##.##..##.P...... .....................cggIcgg!G.Scgg"4=70cgg-cgg1< _You block the water moccasin's attack.cggM  You slice the water moccasin!! You burn the water moccasin.  The water moccasin is almost dead.cgg4==8 (0.8cggcggø< _You block the water moccasin's attack.cgg _  You slash the water moccasin! You burn the water moccasin.cgg E.[23;60Hcgg >4--8.7 (0.9cgg% cggl( R _You kill the water moccasin!cgge cggLf 9--cggv ^ _No target in view!cgg^cgg _cggL`cggbcggfcgg7k: _cggklcggn,cggocggqcggscggtcggvcggwcggycggycgg9{cgg}cggq~cggք _f - 8 poisoned darts (gained 1)cggcggcggcggcggEcggvcgg}cgg,cgg.cggun _f - 9 poisoned darts (gained 1)cgg3cggCcggcggcgg<cggcggcgg,cggcggicgg2,cggCcgg}cgg-,cgg:cggcggcggcgg)cggmcgg,cggcggcggKcggcgg cggE####.........###.#.## ### ###....# #..#.## .............. .......#†##...)..... ......  #.##..#.#.####. ....... ... ....... .....###P..##P. ............ -cgg%####..P...#.##.# ...................... 9##.##.##.P#.##.##cggJ................######^.#.P[##.#..###............... ...........##.....#.##cggv"cgg094.7 (16.0)cggF-5.7 (17cggEcggfa _O - a scroll labelled XEPREURAUKKcgga[cgg[cgg^cggbcgge,cggi,cgg\m,cggocgg scggvcggvcgg$ycggcgg,cggRcggcgg,cggAcgg~cggq,cgg՘cgg7cgg,cggcggcgg,cgg;cggcggLcggcggucggBcggcggcgg,cggcggcgg,cggcggcggƵ,cggڶcggXcggqcgg,cggZcggDcggPcgg%,cggcggcggcggcggcggcggcggcgghcggXcggcggF,cgg`cggcggcggcggccggcgg,cggccgg^cgg ,cgg cggcggY,cggcgg]cgg=,cggcgg/"cgg$cgg$cgg2&cgg|(cgg*cgg*cggN,cgg5....#[#...###.#...##..#  ..†.................#  ####.##.## ###.P#..........#  .... ... .. .....^.........##  .###### ..###.#..#.##...# ........ .... ...............## #.#.#### #P. ####.##..###..#  ###..#.#####..#########.#####.#  ......#  ........###........#####.#..#  .........>......#  .....#..#................#  .....................#  ##P..##P.##.##.#........#####.#    .cgge65.............................#   #.##.##..###..##..###.###..##  ..................#  cgg=-922.7 (2cgg>,3.7 (28cgg{EcggH+ _R - a potion of mightcgg8cggcggcgg cgg?'BcggD(cgg*,cgg+cgg.cgg,1,cgg2cgg5cgg+8,cgg9cgg>?cgg~A,cggCcggrDcgg`FcggFcgg]HcggKcggRBcggVcggzX,cgg4Ycgg[cgg]cgg?]cgg_cggacgg]c,cggdcgg!fcgg gcgg-gcgghcggjcggmcgg>mcggncggqcggr,cggscggcggBcggdžcggL,cgg cgg cgg,cggˑcggocggޘcgg cggܚcggcggԟ,cggycgg-cgg~,cgg2cggcggcggcggcggWcgg,cggܰcggfcgg;` ###P#########..#### cgg[...[............. .................[......  .. .....................#....  ... .........................  ..###.###.##P...####... ............................  ###....##.#...........#P.#.##  ...44.7 (21 ##..####..P.###...#.#P...##.................. ##.#####.#####.............#[#............÷...... cgg7.####.########...####.##.#######. ............. ######.#####.#........#######...#...................cgg.cgg,5.7 (22cggxcggl) _Found a chain mail.cgg Icgg"; vcggI cggJ cggM ,cggO cgg\ B  You see here a +0 chain mail.cggN` 5 _cggc cggGe cggf cggg cggg cggDi cggj ,cggKk cggul cggm ,cggo cggYp cggq ,cgg?r cggs cgg(u ,cggu cggw cggx ,cggy cggz cgg%| cgg^| cgg} cggp~ cgg ,cgg| cgg[ cggz  ### ####  ###########.####..###### ................[...[... ...61.7 (16 >..###.###.............. ................ #.####.#...###.###.##P .. .......... ## ..##..###....##.#. cgg .. ........ #.##..####..P.###.. ........cgg cgg ,2.7 (17cggs cgg7 ; _Found a stone staircase leading down.cgg@ cgg 3cgg cgg cgg Bcgg} cgg̾ cgg@ cgg cgg0 cgg^ cgg cgg cgg cgg3 cgg cgg, cggi ### ###################.####..##....................[...............................>..###.###........................#...#.#@####.#...###.###6.7 (4.0).............#####.#..##..###....## .....)............ .###.##..####..P.# .. .............#P ####.#####.####.. ............. .#.####.#######cgg] cgg +7.7 (5cggN cgg % _Found a rapier.cggIcggJcggKcgghRcggW]### ###################.####..##....................[.................>..###.###..............cgg]#...#.#.####.#...###.###.......@................#####.#..##..###....## .....)..............###.##..####..P.#... ...............##P ####.#####.#### hh 2 wolves (asleep).h .. ...............cgg"^#h ## .#.####.#######..............cggkp 0  2 wolves come into view.cggmcggncggqL  The wolf howls! You hear an angry hiss.cggwscgg~hhhh 3 wolves (2 wandering)h.hcggԂ4==8.7 (1cggcggW _A wolf comes into view.cgg7| ### ####  ####### .......[ ....... cgg78-....>..### ......... #...#.#.####.#. .......@....... ..#####.#..##.. .....).. ..###.##.. h.. ..... .##P  h. ..  cggp8C#h ## cggA! ### ####  ####### .......[ ....... ....>..### ......... #...#.#.####.#. .......@....... ..#####.#..##.. .....).. cgg=..###.##.. h.. ..... .##P  h. ..  #h ## cggcggucgg0cggd _There are monsters nearby!cggҧ ### ####  ####### .......[ ....... ....>..### ......... #...#.#.####.#.cgga2 .......@....... ..#####.#..##.. .....).. ..###.##.. h.. ..... .##P  h. ..  #h ## cggD{ ### ####  ####### .......[ ....... ....>..### ......... #...#.#.####.#. .......@....... ..#####.#..##..cgg3E .....).. ..###.##.. h.. ..... .##P  h. ..  #h ## cggOcggPcgg.Zcgg^d _There are monsters nearby!cgg, ### ###################.####..##....................[.........>..###.###..............#...#.#.####.#...###.###..........................#####@#..##..###....##..P......).............##PP..###.##..####..P.#h...h.. ................#.##P ####.#####.####..h. .. ...............h 4 wolves (3 wandering)##h ## .#.####.#######.gg5 W0m ...............##########.#####cgg cggF cgg XcggY cgg cgg Yh.h...hkY   yak (wandering).k   rime drakehhhh 4 wolves (2 wandering)cgg /--9cgg cgg| _A wolf comes into view. A rime drake comes into view. A yak comes into view.cggi ###############.####..# ....................[.. ....... ....>..###.### ............. #...#.#.####.#...###.## .......................cggj #####.#..##..###....#.Y...P.@....).............##PPh.###.##..####..P.h...... .............#h.#.##P.#####.#####.###..kh. ..................###. ####.#.####.###### . ..............P ##########.##### ..............cggx H  The yak bellows! The wolf howls! x2cggqz cggJ{ cgg"} cgg~ cgg~ cgg) cggH .Y..hh.h.kYcgg hhh  You block the wolf's attack. x2cggM 1===70cgg cgg ( _You hear a bellow!cggI  You hit the wolf. You burn the wolf.cggn  The wolf is moderately wounded.cggcggGcggcggcggo.Y.#h.kcgg>6--1.6 (0.9cggF cggg _The wolf misses you. You block the wolf's attack.cggӚ #.####..#.......[............>..###.###................#...#.#.####.#...###.#..................#####.#..##..###....#...Y.P..@...)...##PPh.###.##..####..P.#....hh... .#..#h##P.#####.#####.#....k .....###. ####.#.####.#. ..hhhh 4 wolves.P ##########.#####.cgg F.cgg cggؠ cggZ cgg. cgg cgg! cgg 6.YP.h.k.k   rime drakehhh 3 wolvescgg9 H--2.6 (1.0cgg~ ^ _The wolf bites the plant! The plant begins to die.cggVB 6#.####..#........[...[.............>..###.###.................#...#.#.####.#...###.###.cggZC d..................#####.#..##..###....##.....YP.h.@..)...##PPh.###.##..####..P.#.....h... ...#..#k##P.#####.#####.#..... ...cggD ..###. ####.#.####.#. ..P #.#####.#.cgg'J cggJ cggFK cggL cggM cgg5O cgg_ h.hk.cgg` .-3cggm cgg_r cgg.\ #.####..#.............[...[...............>..###.###...cgg\ ................#...#.#.####.#...###.###.#..................#####.#..##..###....##.#....YPhh..@.)...##PP.h###.##..####..P.#.....k... ....#..#.##P.#####.#####.#####.cgg)] ..... ....###. ####.#.####.#.. cggU] q..P #.#####.#..cgg-c cggc cggd cggue cggf cgg^g cggh cggtu .hhh.hhhhh 4 wolvescggu @-4cgg` cgg؅ . _The yak gores the plant!cgg[V ....................[...[.................>..###.###.....................#...#.#.####.#...###.###.##..............................#####.#..##..###....##.#....YP.hhh..).................##PP..###@##..####..P.###.....hk.....................#..#.##P.#####.#####.#####...........................###...####.#.####.######## . . ..................P ##########.#####.#k   rime drake ggV }m................... hhhh 4 wolves#.########cggY cggZ cggYj h..(catching breath) 3cggcs ****The rime drake breathes ice at you.cgg ,cgg cgg .h.k...cgg= E====5cggw cggy  cggR H_You block the icy flash freeze. The yak gores something!cggi&..........>..###.###...................#...#.#.####.#...###.###.##P...............................#####.#..##..###....##.#....YP..hhh.).................##PP.h###.##..####..P.###.......k....@...............#..#.##P.#####.#####.#####...........................###...####.#.####.######## . . ..................P ##########.#####.#k   rime drake (catching breath) ..................hhh 3 wolves#.########.###.####..#cgg'cggI(cgg+i  A nearby plant withers and dies. The wolf attacks as it pursues you!cgg_,cgg-cgg.cggc0cgg3cgg3cgg5cggQ6cgg\E.P....hh...###hY..hkY   yakk   rime drake (catching breath)hhhh 4 wolvescggF1-=---6cggQcggWF _You block the wolf's attack. The wolf bites you.cgg .....>..###.###.......................#...#.#.####.#...###.###.##P....................#####.#..##..###....##.#......P....hh).........##P...###h##..####..P.###.......Y..h.cggW #..#.##Pk#####.#####.#####......÷###...####.#.####.##...#. . .....P #.#####.#..#.#####.###.# 3###.####.#cgg(cggcggcggcggcggcggcggcgg@#...Y.khhh.h 4 wolvescgg$93/103 ---=--7cgg20cgg5 _The wolf attacks as it pursues you! The wolf misses you. The wolf bites you!cggo  You slash the wolf! You burn the wolf.  The wolf is severely wounded.cggjcgg`v. 38.4 (0.8cgg)cgg< _The wolf bites you but does no damage.cggȎ  You hit the wolf but do no damage.The wolf is severely wounded.cgg cgg cgg ..Y.k 2cggA 5-9.3 (0.9cgg' cgg" 5 _You block the wolf's attack. x2cgg ^  You barely miss the wolf.cgg l  The wolf is severely wounded.cgg cgg cgg cgg k##h.Y.hh@hhh 4 wolvescgg `4---80.2cgg cgg 2 _You block the wolf's attack.cgg.K  You slash the wolf! You burn the wolf.cgg2cggI5W  You kill the wolf!cggC .Y. 3  You block the wolf's attack. The wolf completely misses you.cggH5=1.0 (0.8cggrTcgg$Y2 _You block the wolf's attack.cgg-.Y. 2 yakscgg8.=3-8.2 (0.9cgg<cgg@p _You closely miss the wolf. You block the wolf's attack. x3cggĵ  You hit the wolf. You burn the wolf.  The wolf is moderately wounded.cggBcgg̷cggo.YhkcggB-9.1cggcgg} _The wolf closely misses you. x2; The wolf bites you but does no damage.cggS  You slice the rime drake!! You burn the rime drake.  The rime drake is almost dead.cggU cgg` _hY cgg&a 4==9 (0.8cggl cggp < _The wolf bites you but does no damage.cgg U  You hit the rime drake. You burn the rime drake.cgg ]  You kill the rime drake!cgg cgg Y.Yhhh 2 wolvescgg B47--90.7cgg cgg Q _The wolf barely misses you.cggML  You slice the wolf!! You burn the wolf!cggW  You kill the wolf!cggcgg cggեY.YY 3 yaks   wolfcgg6==1.6 (0.9cggcggy _The wolf bites you but does no damage. The wolf closely misses you.cgg  You slash the yak! You burn the yak.  The yak is moderately wounded.cgg5-2.4 (0.8cggcggo2 _You block the wolf's attack.cgg\  You hit the yak. You burn the yak.  The yak is heavily wounded.cggЊ89---3.2cggcgg _The wolf misses you. The yak completely misses you. The wolf bites you.cgg  You slash the yak! You burn the yak.  The yak is almost dead.cgg. 2 yaks=4.1 (0.9cggcgg2 cgg{__The wolf barely misses you. You block the yak's attack.cgg.Y I  You slash the yak! You burn the yak.cggU[ V  You kill the yak!cgg[ cggd TY.cggBi 88-5.0cggq cgg v n _You block the wolf's attack. The wolf barely misses you.cgg cgg .   yakcgg \6--9cggz cgg _You completely miss the yak. The wolf bites you. The yak completely misses you.cgg\cggh9 YcggMhY 2 yaksYou completely miss the yak. The wolf bites you! The yak misses you.cgg)i779--cggQi!6.8cggFrcggv2 _You block the wolf's attack.cggcggC .cgg   yakYou hit the yak but do no damage. The wolf completely misses you.cgg(7.7cggXcgg cgg2#_You block the yak's attack.cggmG   You slash the yak! You burn the yak.  The yak is moderately wounded.YY 2 yakscggYHj5---=8.6cgg9QcggjUb _The wolf bites you. You block the yak's attack. You block the wolf's attack.cggG  You hit the yak. You burn the yak.  The yak is heavily wounded.cgg!5-9.4 (0.8cggcggQ _The wolf barely misses you.cgg1 Q  You slash the yak! You burn the yak.  cgg FThe yak is severely wounded.cgg .   yakcgg 3=7000.2cggo cgg f _The wolf misses you. You block the yak's attack.cggt I  You slash the yak! You burn the yak.cgg8 V  You kill the yak!cgg! UY† cgg% 091.0cgg0 cgg5 Y _The wolf bites you but does no damage. You block the wolf's attack.cgg  You hit the wolf. You burn the wolf.  The wolf is moderately wounded..h   wolf6--8 _You block the wolf's attack.cgg  You hit the wolf. You burn the wolf.  The wolf is severely wounded.cgg~YY   yakcgg' Fh   wolfcgg !-cgg# &2.7 (0.9cggEcgg@< _The wolf closely misses you.cggwcggK  You slash the wolf! You burn the wolf.cggGcgg̦].Ycgg(3.6cggcggH _You kill the wolf!cgg8#  You slash the yak! You burn the yak.7=4.4 (0.8cggJ' cgg'P_The yak is moderately wounded.cgg^  You hit the yak. You burn the yak.  The yak is heavily wounded.cggk_ 5-5.3 (0.9cggj cggo P _The yak barely misses you.cgg$  You hit the yak. You burn the yak.  The yak is heavily wounded.cgg G-6.1 (0.8cgg cgg~   You hit the yak. You burn the yak.  The yak is heavily wounded. _The yak barely misses you.  You hit the yak. You burn the yak.  The yak is heavily wounded. _The yak barely misses you.cgg ` _The yak barely misses you.  You hit the yak. You burn the yak.  The yak is heavily wounded. cggj`_The yak barely misses you.  You hit the yak but do no damage.  The yak is heavily wounded.cgg1a567.0 (0.9cggkcggn( _The yak gores you.cggYI  You slash the yak! You burn the yak!cggfl.cggwh860==9cgg=mcggSrG _You kill the yak!cggcggfcgg cggH _No target in view!cgg4cggcgg   ....>..###.###.... ................. #...#.#.####.#...###.###.##PcggZ ............... ...#####.#..##..###....##.# .....P......)......cgg ..##P...###.##..####..P.### .cgg #..#.##P.#####.#####.##### ....cgg.cgg~ ###...####.#.####.##...cgg, . . ... .P cgg]s#.#####.#  #.#####.###.cggh ###.####. _No target in view!cggBcgg55---8.9 (1.0 cgg _cgge!cgg$p _You see here a yak corpse.cgg#   ....>..###.### ........ #...#.#.####.#...###.###.## ............ ...#####.#..##..###....##.# .....P......)...... ..##....###.##..####..P.### cgg5 † #..#.##P.#####.#####.##### ......... ###...####.#.####.# . . .. .P #.#####.#  #.#####.### ###.####.cgg cgg V7---9 cggִ _cgg cgg\ cggn N  ....>..###.### .. #...#.#.####.#...###.###. cgg .......... ...#####.#..##..###....##.# .....P......)..... ..##....###.##..####..P.### cgg& .† #..#.##P.#####.#####.#####cggP  ........ ###...####.#.####.cggt # ...  .P. cgg [#.#####.#  #.#####.cggˡ O ###.####.cggO cgg '10cgg cgg cgg,n[?25h[?0c  Search for what [Enter for "armor", or ? for help]? cggr [?25l[?1ccgg cgge 1 match: travel [toggle: !], by dist [/], hide useless & duplicates [=]  a - [Lair:1] a helmetcgg2n Level 1 of the Lair of Beasts <>>^(Press ? for help) ### ####  ###### ### ##### cggn  ###############.####..######P#########..#######.#####.#P## ....................[...[...............................P# .....................................[............P.....## ....>..###.###.........................#....##.P.#..###.#  ........................................................## #...#.#.####.#...###.###.##P...####......................# ........................................................##cggn ...#####.#..##..###....##.#...........#P.#.###.#...#..P#.#  .....P......)............................................#cggn   ..##....###.##..####..P.###...#.######.P...##....†####.#.#cggn , cgg#o ..........@.†............................................# cgg9o { #..#.##P.#####.#####.#####.............#[#...###.#...##..# cggOo P .............................÷...........................#cggco   ###...####.#.####.########...####.##.#######.P#..........# cggzo z ...   .....................................^.........##cggo .P.  ##########.#####.#........#######...###.#..#.##...#   ................................................##cggo 2 #.#####.........###.#.######P#P..#####.##..###..#cggp   ###.####..........#####..#.#####..#########.#####.# cggDp ..................................................#  #P.####.#†##...)................###........#####.#..# cggrp .............................................>......# cggxcggn1cgg,3cggi8ndeadiverson the CarverHuman of the Shining One ******Health: 77/103 =================-------Magic: 13/13 ========================AC: 20Str: 17EV: 14Int: 11SH: 16Dex: 15XL: 13 Next: 60% Place: Lair:1Time:You slash the yak! You burn the yak! _You kill the yak! _No target in view! _No target in view! _You see here a yak corpse.  Search for what [Enter for "armor", or ? for help]? helmcgg:4cgg<cggXMcggkQ; _cggWcgg\cgg`98cgg^`)=cggbcggy>  You see here a +0 rapier.cggO|cgg| _cgg^cggcggcgghV9=cggcggcggޕ,cggƜcgg/cgg,cgg8cggЪcgg=80cggcggڵcgg{cggθcgg.cggcggcggRcgghcgg(cggcgg&1cggcggcgg`,cggcggcggcggNL2=cggcggcgg,cggcggcggX ,cgg cggc cggP cgg V3=cgg cgg  cgg/ ,cgg~" cgg& cgg) cgg* cgg4, cgg2 cgg6 <4cgg@9 cgg< cgg3? cggw? cgg_A cggF cggH ,cggI cggM cggP cggP &5cggtS cggW cggZ cggVZ cgg\ cgg` cggb cgg c 66=cgg6c cggze cggg cggh ,cggi cggLk cggl ,cggn cggAq cggt 97cggu 3=cggDv cggx cgg{ ,cgg} cgg cggԄ ,cgg. cgg T ## ####### ### ## .######P#########..#######.#####. ...[............................. ................@............P... Noise: --------- 17038.9 (28.0) cgg0 R..................#....##.P.#..## a) +0 scimitar (flame) ................................. Throw: 9 darts (poison) ###.##P...####................... ................................. .##.#...........#P.#.###.#...#..Pcggr   .................................  cgg P.###...#.######.P...##....†####.  .................................cggơ E cggآ cgg cgg O _You see here a +0 helmet.cgg8cggǛ989.9 (1.0)cggIcgg% _T - a +0 helmetcggcggcRWear which item? Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn) cgg w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)T - a +0 helmet[?] describe selected cgg[!] equip|wield|wear|put on[tab] equip|unequip cgg cgg{*deadiverson the CarverHuman of the Shining One ******Health: 88/103 ====================----Magic: 13/13 ========================AC: 20Str: 17 ## ####### ### ## EV: 14Int: 11 .######P#########..#######.#####. SH: 16Dex: 15 ...[............................. XL: 13 Next: 60% Place: Lair:1 cgg+................@............P... Noise: ---------  Time: 17039.9 (0.0) ..................#....##.P.#..## a) +0 scimitar (flame) ................................. Throw: 9 darts (poison) ###.##P...####................... ................................. cggM+n.##.#...........#P.#.###.#...#..P  .................................  cgg+P.###...#.######.P...##....†####.  .................................  cgg+_No target in view! _You see here a yak corpse. _Search for what [Enter for "armor", or ? for help]? helm cgg+`_You see here a +0 rapier. _You see here a +0 helmet. cgg+_T - a +0 helmetcggl7cgg8,40.9 (1cggYHcggRcggS391.9 (2cggZcgg{ccgg[d+2.9 (3cggkcggscggt+3.9 (4cgg|cggǒ=904.9 (5 1 _You start putting on your armour. You continue putting on your +0 helmet. x4cgglcgg [ _You finish putting on your +0 helmet.cgg3cggcgg$cggf _cggcgg}91cgg(=cggcgg cggfcggcggHcgg#2cgg2=cggcggT,cggAcggݡBcgghcgg%3cggcgg cgg;cggcggO,cggcggHcggˬ%4cggcgg!,cggkcggJcggcggcggcggDK5=cggscggccggcggcggcggTU6=cggcggcggcggcggF,cggqcggzcgg%7cggcggcggcgg cgg,cggcggcgg%8cggcggRcggcggcggcggK9=cggcggcggFcgg]cggUcggcggcgg}cgg[100/103=cggcgg cggHcgg]cggX,cggxcggcgg%1cgg.cgg,cggAcgg-cggqcggcggs cgg %2cgg cggcggPcggcggcgg cggXD3=cggcgg%cggk(cgg(cgg4*cgg0cgg.4,cggU6cgg<cgg3?cgg?cgg*AcggFcggHcgggI9=cggKcggPcggQRcggRcggScggYcgg\cggS\cgg]cgg]ccggecggfcggxhcggKmcggocgg:pcggWrcgg4wcggz,cgg|cggcggƄcgg6cgg1cggcggcggcgg:cggcggcggpcggcggScggcgg;cgg)cggɝcgg^cggcggcgg#cggcggcggҥcggިcggZ,cggicggޭcgg,cggưcggcggZcggcggcgg cgg%,cggUcggocggo,cggcggcggcggcgg8cggcgg,cgglcggcgg,cggcggwcgg,cggcggcggcggcggcggcggBcggcggN,cggcggscgg,cggcggcgg+cggfcgg?,cggcggcggcggcggXcggcggcgg cggl,cggcggcggcggScgg`cggcggcgg%cggcgg{ cgg6#,cgg,$cgg&cggi(,cgg)cggb2Xcgg44cgg6cggX6cgg7cgg:cggW=cgg=cgg>cggAcggvCcggCcgg6EcggIBcggJcggZMcggPcggPPcggMQcggSScgg&UcgggUcgguVcggXcggZ,cgg \cggaXcggc,cggdcggihN _You now have 758 gold pieces (gained 10).cggRkcggkcgglcgg5ocggipcggpcggqcggvscggvBcgg&ycggpXcgg,cgg4cggcgg,cggڄcggcggcggacggcggڎXcgg'cggqcgg*cgg[Xcggcgg],cggXcggd `cggj* Jcgg/ Xcgg1 cgg|3 ,cggG4 cgg]6 cgg9 Bcgg: cgg7= ,cgg(> cggI@ cggA ,cggF ,cgguO cggQ BcggT cgg+V ,cggW cgg)Y cggWZ cggZ cgg*[ cgg] cgg#^ cggL^ cggb ,cgg cgg cggF ,cgg˧ cgg cggO ,cgg cggm cgg cggc cgg cgg cgg ,cgg cggz cgg` ,cgg cgg> cgg0 ,cgg1 cgg cgg ,cgg cgg cgg ,cgg cgg cgg cggF cgg cgg cgg> cggq cgg cgg cggY Bcgg cggH cgg cgg cgg cgg cgg cgg cgg2 cgg cggc cgg[ cgg cgg Xcgg cgg cgg cgg cgg ,cgg1 cgg> cgg@ cggA cggOB cggC cggF cgg2H ,cggH cggpK cggM cggM cggP cggQ cggT ,cggU cgg?\ cgg^ ,cgg ` cgg b cggg Bcggk cggk cggm cggr N _You now have 778 gold pieces (gained 20).cggu cggv cggux cgg| cgg cgg cgg: cgg cgg cgg cgg cgg cggԕ cgg9 cgg cgg cggF cgg cggt cgg cgg cgg cgg# M _You now have 787 gold pieces (gained 9).cgg cggc cgg\ cgg' cgg cggX cgg cgg cgge cgg cggݶ cgg cgg Xcgg cgg ,cgg cgg cgg cgg cgg cgg cgg Bcgg cgg cggn cgg cgg" cgg ,cggC cgg] cgg cgg' cgg cgg& cgg cgg" cgg cgg< cgg` Bcgg cgg ,cggE cgg cggq cgg cgg cgg0 cgg cgg7 cgg( cgg cgg cgg= cgg cgg cggv cgg  cgg* cggd cgg cgg ! cgg! cgg& cggc* ,cgg+ cgg/ cgg0 ,cgg1 cgg4 cggu5 cgg5 cggq6 cgg7 cggU9 ,cgg9 cgg; cgg= ,cgg= cgg? cgg`B ,cggB cggSD cggE ,cggF cggXH cggJ ,cggJ cggGL cggM cggM cgg?N cggU cggYW ,cggW cggY cgg[ cggS[ cgg[ cgg] cgg^ cgg_ cgg_ cgga cgg,c cggdc cggd cggh cggj ,cggk cggm cggn cggo cggo cggq cggr cggs cggs cggu cggx cgg8x cgg;y cgg| cgg+~ cggd~ cgg cgg0 cgg ,cgg ,cgg cgg׉ cggT cgg cgg ,cgg< cggd ,cgg cggŮ n _g - 4 scrolls of vulnerability (gained 1)cgg& cgg cgg7 cgg cgg cgg cgg[ cgg cgg? ,cggC cgg cggJ cgg cgg< cgg cgg ,cgg| cgg cgg& cggc) cgge/ BcggQ4 cgg,6 cgg6 cgg67 cgg> cgg? cgg@ cgg@ cggD cggE ,cggWF cgg:J cggJ cgg7K cggK cggGS cgg{T cggT cggU cgg ` .................>. .#.####....#..# .................................###P..##P.##.##.##...................... .Pcgg` ...#.##.##..###..##..###. ........................... .##.##.P#.##.##.#######.#.#.#.###...@.....[...292.9 (98.0) cgg` #^.#.P[##.#..#####.##..##P........................ ....##...........###### ...#.##cggBa d......######............. ####.#####.###.###.##.# .......###.P..##...##########.#cgga  ...... cggRb cggi cggl T _Key pressed, stopping explore.cggT Icgg cggͧ cgg : _cggѰ cgg ,cgg˳ cgg cggy ,cgg cgg cgg^ ,cgg cggb cgg ,cggC cggn cgg ,cgg cgg cgg' cggq cgg cgg cggQcggcgg[cggQ cggcggcggcgg~cggcgg1cggrcggI#cggC%cggz%cgg&cgg;+cgg0Bcgg1cgg5cgg\5cggi8cggG=cggq@cgg@cgg3BcggFcggIcgg=Jcgg Lcgg7Qcgg^ScggScggTcggWcggRYcggYcggbZcgg\cgg6^cgg^cggH_cggacggc,cggdcgggcgg5j,cggkcggmcggocggocggpcggtcggucggvcggwcggGzcgg{cgg|cgg,}cggcggBcggۆXcgg@cggcgg1cggcggjcggcgg<cggcggђcggW,cggӘcgg£cgg-cggcgg4cggcggcgg cgg . .#.###...#.#.####.#...## >.............. ......#####.#..##..###. .......P......) ###..##....#### #................† P...##..#.##P.#####.## #.....323.9 (31 #..#####...####.#.####.## #.......... #.#.P#.P.##P.##########. ##...................cgg!..... #..##.###..#####.#####... ##.#######..####.####..... #........................ ##..#.#.####P.####.#÷##...cgg[cggl,4.9 (32cggcgg; _Found a stone staircase leading down.cggEcggcggcggcggcggcggI,cgg,cggwcggcgg,cggEcggcggNcggcggcggcggcggcggcggcggFcggcggPcggcgg,cggcgg@R  There is a stone staircase leading down here.cggK _cgg&cggcgg7cggcggcgg cgg cgg cgg cggcggcgg cggcgg!,cggcggcggcggCcggcgg,cggncggcggc3cgg4,cgg5cgg7cgg(9cgg9cgg9cgg;cgg<cgg<cggx=cggj?cgg@,cggAcgg`  There is a stone staircase leading down here. _cggߊu #.####....>..###.# #................. ##.#.###...#.#.#### #.>............... ##.......#####.#..# cggc|#.........P......) #.###..##....###.# ##................† #P@..##..#.##P.####49.9 (25 cgg##................. #..#####...####.# #................. #.#.P#.P.##P.##### ##.............. #..##.###..#####.##cggȌ ##.#######..####.## #.................cggRcgg'cggE _Done exploring.cgg3cgg_cggJ....>.......###........0.0).cggj cggcgghE _Done exploring.cggecgg\fcggfcgg=cggcgg\cggbE _Done exploring.cgg cgg Inventory: 46/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar of flaming (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 9 poisoned darts (quivered)F - 6 atropa-tipped darts  cgg S - 9 curare-tipped darts Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)cggD p - a +5 ring of evasion  H - a ring of willpower Wands (go to first with /)h - a wand of roots (14) cggu [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]cgg=B Jewellery "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)  p - a +5 ring of evasion  H - a ring of willpower Wands (go to first with /)  h - a wand of roots (14)  y - a wand of digging (6)  B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (7) Scrolls (go to first with ?)  g - 4 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 4 scrolls of teleportation43%cggY cgg5 cgg: +cggt 2#.####....>..###.# deadiverson the Carver#................. Human of the Shining One ******##.#.###...#.#.#### Health: 103/103 ========================cgg #.>................ Magic: 13/13 ========================cgg ##.......#####.#..# AC: 21Str: 17cgg #.........P......) EV: 14Int: 11#.###..##....###.# SH: 16cgg Dex: 15##................† XL: 13 Next: 60% Place: Lair:1cgg1 #P@..##..#.##P.#### Noise: ---------  Time: 17349.9 (0.0)cggu ##................. a) +0 scimitar (flame)#..#####...####.#. Throw: 9 darts (poison)#.................cgg #.#.P#.P.##P.#######................. #..##.###..#####.## ##.#######..####.## #.................  _Found a stone staircase leading down. _There is a stone staircase leading down here. _There is a stone staircase leading down here. _Done exploring. _Done exploring. _Done exploring.cggl 4cgg cgg cgg6cgg><Drop what?46/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 9 poisoned darts (quivered)F - 6 atropa-tipped darts  S - 9 curare-tipped darts cgg@Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)p - a +5 ring of evasion  H - a ring of willpower Wands (select all with /) [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]cggw(1 turn)  a - a +0 scimitar of flaming (weapon)  p + a +5 ring of evasion[Enter] accept (1 chosen)cgg cgg C#.####....>..###.# deadiverson the Carver#................. Human of the Shining One ******##.#.###...#.#.#### Health: 103/103 ========================#.>................ Magic: 13/13 ========================cgge 5##.......#####.#..# AC: 21Str: 17#.........P......) EV: 14Int: 11#.###..##....###.# SH: 16Dex: 15##................† XL: 13 Next: 60% Place: Lair:1#P@..##..#.##P.#### Noise: ---------  Time: 17349.9 (0.0)##................. a) +0 scimitar (flame)cgg #..#####...####.#. Throw: 9 darts (poison)#.................#.#.P#.P.##P.#####cgg ##................. #..##.###..#####.## cgg ##.#######..####.## #.................  _Found a stone staircase leading down. cgg3 _There is a stone staircase leading down here. _There is a stone staircase leading down here. _Done exploring. _Done exploring. cggr 0_Done exploring.cggp ,50.9 (1cgg cgge _There is a stone staircase leading down here. _Done exploring. _You drop a +5 ring of evasion.cgg֩J................##.#.###...#.#.####.>................#.......#####.#..# ....P......)###..##....###.#cgg̪##................†P=..##..#.##P.######@................ #..#####...####.#..............#.P#.P.##P.#######...................##.###..#####.###.#######.. #.................##..#.#.####P.####cgg<1cggtcgg3cggq ##.#.###...#.#.####.>................#.......#####.#..# #.........P......)###..##....###.###................†#P=..##..#.##P.######................. #@.#####...####.#cggr..............#.P#.P.##P.#####.##..#.................. cgg{cgg{&2cgg6cggcggє cgg1   Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   8.2  gg 0m 1.0   0      e + Long Blades 12.9  15.0   0               f - Armour   8.0   9.0   0       g - Dodging  12.0  15.0   0       h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1           gg m                               cgg     The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetscggxcgg$cgg[##.#.###...#.#.#### deadiverson the Carver#.>................ Human of the Shining One ******##.......#####.#..# Health: 103/103 ========================#.........P......) Magic: 13/13 ========================#.###..##....###.# AC: 21Str: 17cgg##................† EV: 14Int: 11#P=..##..#.##P.#### SH: 16Dex: 15##................. XL: 13 Next: 60% Place: Lair:1#@.#####...####.#. Noise: ---------  Time: 17352.9 (0.0)#................. a) +0 scimitar (flame)#.#.P#.P.##P.##### Throw: 9 darts (poison)cgg##.................#..##.###..#####.##cgg##.#######..####.## cgg#................. ##..#.#.####P.####.cgg:o #..................  cggXJ_There is a stone staircase leading down here. cggwj_There is a stone staircase leading down here. _Done exploring. cggl_Done exploring. _Done exploring. cgg_You drop a +5 ring of evasion.cggcggcggcgg cggfcggcggcggcggcggcggE _Done exploring.cggbMcgg"h3cgg64cggYcgg,E _Done exploring.cgg+cggcggcggcggcgg[ _Done exploring.cggp cggp cggq cgg cgg cggŞ cggݠ  cgg 7_Done exploring.cggcgg\cggcggGcggKcggxOcggURE _Done exploring.cggicgggkWhere to? (Tab - Lair:1 @ (x,y), ? - help) D - DungeonT - Temple L - Lair  O - Orcish Mines  V - Vaultscggi6cggR##.#.###...#.#.#### deadiverson the Carver#.>................ Human of the Shining One ******##.......#####.#..# Health: 103/103 ========================#.........P......) Magic: 13/13 ========================#.###..##....###.# AC: 21Str: 17##................† EV: 14Int: 11#P=..##..#.##P.#### SH: 16Dex: 15##................. XL: 13 Next: 60% Place: Lair:1#@.#####...####.#. Noise: ---------  Time:cggS[37m 17352.9 (0.0)#................. a) +0 scimitar (flame)#.#.P#.P.##P.##### Throw: 9 darts (poison)##.................#..##.###..#####.####.#######..####.## #................. ##..#.#.####P.####. #..................  _You drop a +5 ring of evasion. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring.cgg1TcggFUcggjcggkcgg_pP _cgg*rcggkrcggscgg!wq _Done exploring. _ You see here a +5 ring of evasion.cggxcggy _cggzcgga|cgg~,cgg~cggZcggcggcggĂcggEcggcggcggcgg cggcgg߉cggՊcgg%  cgg4There is a stone staircase leading down here.cggcggcgg$ _cggtcgg 2cgg cgg( ,cgg cggҨ 2 cgg #. #....##.. .###.##.....#.. ............... cgga ............... ............. .....>..# #P....## #.@....# 61.6 (8.7cgg #.....#....## #.... #.....# .... ###...#cgg4 ... ..[#.. .....# ..... ..... _You climb downwards.  Found a leather armour. Found a stone staircase leading down.cggl cggX a _There is a stone staircase leading up here.cgg|cggcggcgg cggPcgg3: _cggcggmcggcgg'cggcgg!cgg("cgg#cgg'cggq+cgg+cgg%-cgg1cggN4cgg4cggx5cgg7cgg:cgg;cgg;cgg=cgg?cgg"@cggAcgg CcggF,cggFcggSJcggLcggLcggwMcggfOcgg^RcggRcgg8Scgg.UcggWcggWcggXcggZcgg ^,cgg+_cggcacgge,cggtqcgg-tcgg wcggwcggycgg7}cggcggcggcggscgg,cggcggcgg .....  #.PP .# ##.P## #.##....##. #....###.##.....#.. #.#.................#####................cggtS..............................@...........>..#P....##.###....#P....##..# #.# #....#.<....# ..# #.....#....## #..###....##.....# ##.##.....####...# S   black mamba (asleep) #.##.....# ..[#.$##.....# .....cggM##....# ....cggw077.6 (16.0)cgg,8.6 (17cgg&cggV+^ _A black mamba comes into view.cggv_$ .....  #.PP .#  ##.P##  #....###. . #.#..... ...#####....... S.............. .......@...........>..#  P....##.###....  ..# #.# #....#.<....#  ..# #.....  #..###....  ##.##....  #.# ..[#  .$#   cgg{~ .....  cgg=#.PP .#  ##.P##  #....###. . #.#..... cgga...#####....... S..............cggy cgg.......@...........>..#  cggP....##.###....  cgg ..# #.# #....#.<....#  cgg#..# #.....cgg:o #..###....cggP& cgggt##.##.... cggx cgg8#.#cgg3 ..[cgg!cgg cggO.$# cgg cgg  cggcggcggcgg b _A black mamba is nearby!cggs-$ .....  #.PP .#  ##.P##  #....###. . #.#..... ...#####....... S.............. .......@...........>..#  P....##.###....  ..# #.# #....#.<....#  ..# #.....  #..###....  ##.##....  #.# ..[#  .$#   cgg ~ .....  cggf f#.PP .#  ##.P##  #....###. cgg . #.#..... cgg j...#####....... cgg NS.............. cgg .......@...........>..#  cgg P....##.###....  cggE ..# #.# #....#.<....#  cggm ..# #..... cgg #..###.... cgg ##.##....  #.# ..[ cgg T.$#  cgg8  cgg Jcgg b _A black mamba is nearby!cgg?  .....  #.PP .#  ##.P##  #....###. . #.#..... ...#####....... S.............. .......@...........>..#  P....##.###....  ..# #.# #....#.<....#  ..# #.....  #..###....  ##.##....  cgg [#.# ..[#  .$#   cgg  .....  #.PP .#  ##.P##  #....###. . #.#..... ...#####....... S.............. .......@...........>..#  P....##.###....  ..# #.# #....#.<....#  ..# #..... #..###.... ##.##....  #.# ..[ ggӓ m.$#   cgg cgg Q  .....cgg  #.PP .# ##.P## #.##....##. #....###.##.....#.. #.#.#####cggg .S.....>..##P....##.###....#P....###..#. #.# #....#.<....#cgg H. .. ..# #.....#....##(. #..###...cggש .##.....#.# ##.##.....####...# #.##.....# ..[# .$##.....# cgg ##....# _A black mamba is nearby!cggu <  Found 2 poisoned darts.cgg cgg z..SScgg 19.0)cgg cggv 5 _The black mamba hisses angrily.cgg: ...... #.PP .#.. ##.P## #.##...... #....###.##...... #.#cgg5.#####.S.>...#P....##.###....#P.... #..#.. #.# #....#.<....cgg`.#...# ..# #.....#..... (.#. #..###....##.....cgg.###. ##.##.....####.... # #.##.....# ..[cggN .$##.....#  ##....# cggcggLcggP&B..Scgg''80cggk/cggt2cggscggF.=1cggcggU< _You block the black mamba's attack. x2cggDL ( cggL  You slash the black mamba! You burn the black mamba.  The black mamba is heavily wounded.cggqM %=cggM 2.4 (0.8cggT cgg \ C _The black mamba bites you but does no damage.cggW r  You barely miss the black mamba.The black mamba is heavily wounded.90/103 ----3.3 (0.9 _You block the black mamba's attack. The black mamba bites you!cgg  You closely miss the black mamba.The black mamba is heavily wounded.cggUcgg%-cgg" 4.2cggT cgg3X _The black mamba barely misses you.cgg8D  You slash the black mamba! You burn the black mamba.  The black mamba is almost dead.1=---=5.2 (1.0cgg=cgg\D _The black mamba closely misses you. The black mamba misses you.cggZ  You slice the black mamba!! You burn the black mamba.cggo.cgg]6 2-cggP6.0 (0.8 _You kill the black mamba!cggcggW cggt__Your Long Blades skill increases to level 13!cggԓcgg"-cggcggWcggDH _No target in view!cgg.....^.... #.PP .#.... ##.P## #.##........ #....###.##....... #.#........#####......#> .#P...@##.###....#P.. #..#..##.# #....#.<...!..#...##..# #.....#..(.#. #..###....##......###. ##..####P. #. #.##.....# S   black mamba (asleep) #S .$##.....# ..#. ##....#  #....#cggb# cggW cgg}g A black mamba comes into view.cgg+cggoKSScgg .cgg6==-7.0 (1.0cggcggf. _Found a potion of might.cgg ^.... #.PP .#.# ##.P## #.##...^...... #....###.##^...... #.#.......#####.#.............. #....>cggU  .#P....##.###....#P.. #..#@.##.# #....#.<!..#...##..# #.....# ...(.#..#..###....##...###S###..####P. #.. #.##.....# .. #.. .$##.....#  #.. ##....# ...# #....#cgg 2 #.....#cggև cgg cggI NS.cgg #9cggL `==-8cggW cggC cgg.# ##.P## #.##..^...... #....###.##.^...... #.#........#####.cgg #............. #.......... .#P....##.###....#P.. #..#..##.# #....#.<!..#.@S##..# #.....#.....(.#..#..###....##.....###.###..####cggeP. #.. #.##.....#.. #..#.$##.....#cgg #..# ##....#  ...# #....#cgg .#. #.....#cggE #.#####cggcggc101/103==cgg 9cgg6cgg< _You block the black mamba's attack. x2cgg:cgg.<+9 (0.9cggIcggL{ _You closely miss the black mamba. You block the black mamba's attack.cgg  You slash the black mamba! You burn the black mamba.  The black mamba is moderately wounded.cgg!92=90.8cggcggF _The black mamba bites you but does no damage. x2cgg   You hit the black mamba. You burn the black mamba.  The black mamba is heavily wounded.cgg!0-1.7cggr)cggR- _The black mamba misses you. The black mamba closely misses you.cgg0  You slash the black mamba! You burn the black mamba.  The black mamba is almost dead.cgg 5=2.5 (0.8cggk cgg) C _The black mamba bites you but does no damage.cgg Z  You slice the black mamba!! You burn the black mamba.cgg E†cgg k3=4-3.4 (0.9cgg cgg" O _You kill the black mamba!cggSyN-cggcggH _No target in view!cgg 9s^...... #....###.## .^......# #.#...... ........#####. #............ #......##.#P....##.###....#P#..#..#..##.# #....#.<cggK:..#!..#..†##..# #.....#......(@#..#..###....##.###.###..###P. #.. #.##.....# .. #..#.$##.....# #..# ##....# ...# #....# .#. #.....# #.#####cggX;D ...cggEcggF<-4.4 (1.0 _cggNcggwRcgg ^^...... #....###.## .^......# #.# ........##### #........... #......... ##.#P....##.###....#P #..#..#..##.# #....#..#!..#..†##..# #.....#.@.#..#..###....##.###.###.##......P.. #.. #.##.....##.....# #..#.$##.....#P...#. #..# ##....#.... ...# #....#.... cggr .#. #.....#.. .. #.#####  ...cgg&cggv'@-5cgg.cgg:cgg;k6.4 (211 darts (poison)cggAcggD` _f - 11 poisoned darts (gained 2)cgg?d   ^^...... #....###.   .^......# #.#   ........#####   #....   #........   ##.#P....##.###....#  . #..#..#..##.# #....#  .#!..#..†##..# #.....  #.#..#..###....  #.###.###.##.....  #....P..# #.. #.##.....#  #.....## #..#.$##.....#  #P...#. #..#ggg .9m ##....#  . ...# #....#  ... .#. #.....  ..... #.   ...=7.4 (1cgg C  ^^...... #....###.   .^......# #.#  cgg? Q ........#####   #.........  #........ # ##.#P....##.###....  cggd #.. #..#..#..##.# #....  cgg #....#!..#..†##..# #   #cgg .#..#..###....   #.###.###.##.....   #....P..# #.. #.##.....  cgg  ##.....## #..#.$##.....  cgg8  #P...#.# #..# ##....  cggW .# ...# #....  cggv ..... .#. #  ..cgg t #.   ...cgg cgg &8cgg" cgg cgg  ^.....# ##.P## #  ^^......# #....###  .^......# #.# ........##### cgg( #........  #............  # ##.#P....##.###  #.. #..#..#..##.# # #....#@..#..†##..# #  #...#..#..###  #.......###.###.##  #....P..# #.. #.## cgg i ##.....## #..#.$  #P...#.# #..# ##...   ........# ...# #...   ... .#. #... cgg  ......... #.## cgg,cgg}-&9cggR5cgg?cgg0-400.4 (2cggAcgg{7 _R - 2 potions of might (gained 1)cggxcggycgg\zcggf~cggMcggiBcggAcggcggȌcggcgg,cggcggcgg,cgg[cgg6cggqcgg!,cgg&cggcgg C   ..^^^.^>^..  cggvK..^.^...^.  ....^.^^.... # #.^^..^.....# ##cgg #....^^......# # cggԫ .....^......# # cgg ##...........#####  #.@...#.........5.4 (5cgg/  ##....##........ cgg\ ##...##.#P....##.#  #....#..#..#..##.# cggլ< #....#...#..†##..#  ##.........#..#..#  #.......###.###.#  #....P..# #.. #.# cgg ##.....## #..#.$cggcgg+6.4 (6cggcgg6 _Found a hole to the Spider Nest.cgghcggXicggXjcggmcggpcgg3qcgg8u,cggwcggwcggkxcggw{cgg~cgg~cggcggÂcggcgg<cgg?cggcggcggcggcggcgglcggcggpcggcgg,cggccggcgg,cgg|cggscgg<cggvcggͥcggʨcggcggAcgg-cggWcgg,cgg&cggYcggZ,cggAcgg׹cggPcggcggcggcggcggcggcgg-cggvcggcggcggcggX,cggccgg cggb,cggfcggcgg,cggcggcggY,cgghcggcggmcggcggWBcggcggcggHcggcggNcggcggcgg,cgg$cgg cggh,cggcggcggcggcggcggGcggcggcggcggcggF,cgg cgg]!cggp#cgg#cgg.$cgg%cgg(,cggc(cgg#*cgg -cggo-cgg.cgg^/cgg41,cgg1cgg2cgg4cgg4cgg`5cggd7cgg9,cgg:cggv<cgg?,cgg@cggD,cggEcggIN _You now have 804 gold pieces (gained 17).cggL3cgg2McggNcgg$QcggiQcgg`RcggZTcggV,cgg9WcggYcgg\,cgg]cgg`cggccggccggdcgggcgg jcggNjcggkcggEncgg&r,cggrcgg,ucggwcggwcgg!ycggY{cgg}cgg~cgg~cggcggqcggcggLcgggcggBcggcgg_cggݍcggcggcggfcggΕcggcggcgg5cggpcggŝ,cgg-cggcggcgg@cggӢcggcggfcggcggcggcgg6cggxcggcgg1cgg,cggcggcggcgg:cggucggycgg,cgg cggncgg,cggcggcggcggcggcggcgg9,cgglcggcggcggcggcggcggKcggcggcgg cgg cggt cgg4 x _x - 6 scrolls of teleportation (gained 2)cgg cgg cgg cgg cgg ,cgg cgg` ,cgg cgg$ R _y - a wand of digging (12) (gained 6 charges)cgg' 3cgg( cggG vcggSJ ,cggN ,cggO cggO cggQ cggT cggV cgg W cggW cggAZ cgg\ cgg\ cgg] cgg` cgge ,cggVf cggi cggm ,cggn cggr cgg2z ......... ...>..# ............. P....## .............. .<....# ..........$..S# #....## .............# #.....##..............# cgg?{ ,###...##...........<.# #.#..[#P.............#  #..............@##  #...........#...P# ##................# ##...............## ##...............# .................#S   water moccasin (asleep) .#.............#.# .#...........##### cgg{ 9#.###..#.##..#cgg 81.4 (75.0)  A water moccasin comes into view.cgg~ ,2.4 (76cgg cggD ; _Found an escape hatch in the ceiling.cgg )>..# ...............  ............... .<....# ..........$..S#  .............# .............# ..........<.# [#P.............#  cgg7! .......@##  ....#...P#.........#........##..........# .................# .......#.#....#####cggk >..# ...............  ............... <....# ..........$..S#  .............# .............# ..........<.# cgg y[#P.............#  .......@##  ....#...P#.........#........##cgg3 ..........# .................# .cgg B......#.#....#####cgg cgg cgg cgg e _A water moccasin is nearby!cgg )>..# ...............  ............... .<....# ..........$..S#  .............# .............# ..........<.# [#P.............#  .......@##  ....#...P#.........#........##..........# .................# .......#.#....#####cgg&]>..# ...............  ............... <....# ..........$..S#  .............# .............# ..........<.# [#P.............#  .......@##  ....#...P#.........#cgg]........##..........# .................# .......#.#....#####cgggcggxhcggvocggqe _A water moccasin is nearby!cgg 3 ..... ...$P....~~ ..>..# . ....## ...... <....# .$..S ....## # .....##..#...##.<.# .#..[#P...# #....#####...#...P# ........#........## #...............# ........# #....#.#..........#####cgg3cgg5cgge7cgg%>g.SScgg>13.4 (1.0)cggGcgg5K* _Found 9 gold pieces.cgg]}  ....[..~~~~P..... ...$P....~~>..# . ...## ...... .$## .# ....##.S #...##.cgg}<.# [#P...# ....##### ..#...P# ...cggt~# ..#..# ...# ..#.#cggۃcggM.Scgg&4cggݔcgg+ _Found a plate armour.cggM  You slash the water moccasin! You burn the water moccasin.  The water moccasin is heavily wounded.cgg/==5cgg cgg{ _The water moccasin misses you. You block the water moccasin's attack.cggEZ  You slash the water moccasin! You burn the water moccasin.  The water moccasin is almost dead.cgg&[ &6cggjc cggYh < _You block the water moccasin's attack.cgg  You closely miss the water moccasin.The water moccasin is almost dead.cgg 5-7.2 (0.8cgg^ cggE < _You block the water moccasin's attack.cggJ _You block's attack.  You closely miss the water moccasin.  The water moccasin is almost dead. _You block the water moccasin's attack.  You closely miss the water moccasin.  The water moccasin is almost dead.cggKG-8.1 (0.9cggScggX  You closely miss the water moccasin.  The water moccasin is almost dead. _You block the water moccasin's attack.  You closely miss the water moccasin.  The water moccasin is almost dead. _You block the water moccasin's attack.cggThe water moccasin is almost dead. _You block the water moccasin's attack.  You closely miss the water moccasin.  The water moccasin is almost dead. _You block the water moccasin's attack.  You slash! You burn the water moccasin.cggfC<cgg059.0cggycgg R _You kill the water moccasin!cggŤcgg5cggcggOcggcggcggųcggشcggR,cggcggӽcggP,cggscgg,cgg cggHN _You now have 820 gold pieces (gained 16).cgg3cgg{cggcggV,cggAcggzcgg,cgg,cgg_ ........PS~~ .P......~≈≈≈.... #P~≈≈≈≈P..P # ~≈≈~≈~~~... cgg7##....##~~≈≈~.≈~.P... ##.....#~.≈~.....P....~~.~~.... ........~~~~P....cggd- ......$P....~~......>..# ............# #P....## ................... #.<....# ......cgg@.........#.# .#....## ..............##S   electric eel (asleep) cgg ##.....##..............# ####...##...........<.## cgg3 S##.#..[#P.............#cgg_.96.0 (7.0cggE-7.0 (8cgg\"cgg`7 _An electric eel comes into view. _You see here a +0 plate armour.cgg  ........PS~~...  .P......~≈≈≈....  #......P~≈≈≈≈P..P # .......~≈≈~≈~~~... ......~~≈≈~.≈~.P... .......~.≈~.....P.. ..........~~.~~.... .......@..~~~~P.... .....$P....~~...... >..# ..................#  ................... <....# ...............#.#  ..............## ..............# ...........<.## [ cggB  ........PS~~...  .P......~≈≈≈....  #......P~≈≈≈≈P..P  .......~≈≈~≈~~~... ......~~≈≈~.≈~.P... .......~.≈~.....P.. ..........~~.~~.... .......@..~~~~P.... .....$P....~~...... >..# ..................#  ...............<....# ............cgg (... ..............## ..............#...........<.##[cgg cgg d _An electric eel is nearby!cggr  ((((((Spoisoned)  You throw a poisoned dart.  The poisoned dart hits the electric eel.  The electric eel is poisoned.cggQB S≈~≈≈~.You hear a splash.cggK *******The electric eel shoots out a bolt of lightning at you!cgg[≈≈≈≈..@cgg 90/103 ----===8.1 (1.10cggcggb7 _The bolt of electricity hits you!cggX (((((((You throw a poisoned dart.  The poisoned dart barely misses the electric eel.cgg S≈~≈≈~.You hear a splash.cggS *******The electric eel shoots out a bolt of lightning at you!cggL≈≈≈≈..@cggO85-----9.3 (1.29 darts (poison) cggUXcggb7 _The bolt of electricity hits you.cgg (((((((You throw a poisoned dart.  The poisoned dart barely misses the electric eel.cgg7cgg8cggI lS~≈≈~.l   basilisk (wandering)S   electric eel (poisoned)  You hear a splash.cggJi---500.4 (1.18cgg-WcggX[[ _A basilisk comes into view.cggۏ[(((((very poisoned)  You hear a splash. _A basilisk comes into view.  The poisoned dart hits the electric eel.  The electric eel looks even sicker.  The electric eel is lightly wounded.cgg( l≈≈≈..lYou hear a splash.cgg* 77------7The electric eel shoots out a bolt of lightning at you!cgg</  --more--cgg> cgg? cggM?*cgg?*cgg?*cgg?*cgg)@*cggc@*cgg@*cgg@>The bolt of electricity hits you!cggA$bolt of electricity hits the fungus!cggGcgg[(l~≈≈cggc~.@Pcgg'===cggR 1.5cggcggD' _The fungus begins to die.cggO(((((((You throw a poisoned dart.  The poisoned dart closely misses the electric eel.cgg(S≈≈≈..You hear a splash.cgg *******The electric eel shoots out a bolt of lightning at you!The bolt of electricity hits you.cgg& cggo~≈≈~.@cggFP  The bolt of electricity hits the fungus.cgge71---6cggcgg/  --more--cgg3 ******* but does no damage.cgg[ ~≈≈~.@P  The bolt of electricity hits the fungus!cgg\ (2.6cggi cggn % _You hear an angry hiss.cgg/........P((~....PlS≈≈.#......P~≈≈≈≈P..P.......~≈≈~≈~~~... #....##.......~~≈≈~.≈~.P.....#..≈~.....P.. ..........~~.~~.... [..~~~~P.... $P...... >..# cggo............# P....## .. .<....# .....#.#...## ...## #....# #...##.<.## .#..[#P...#  #.......#####cggcggB~lcgg[*******The electric eel shoots out a bolt of lightning at you!cgg≈≈≈...@cgg[o64---30cggGcgg\/ _The bolt of electricity hits you!cgg.P~S≈≈.#......Pl≈≈≈≈P..P.......~≈≈~≈~~~... ....##.......~~≈≈~.≈~.P .....#..≈~.....P.. .........~~.~~.... [..~~~~P.... $P....~~...... >..# cggG...@........# .## . <....# .#.# ...## .## ..##...##.<.## .#..[#P..#......##### #.#...Pcgg!#cggcgg1cgg|≈SlS   electric eel (very poisoned)cggq5=----4cggϵcggKcgg #......PS≈≈≈≈P..P.......l≈≈~≈~~~... ...##.......~~≈≈~.≈~.P..≈~.....P.. ...~~.~~.... cggH [..~~~~P.... $P....~~...... >..# ............# .## .  .#.# ...## .cgg /## .# #...##.<.##..[#P..# ......##### .#...P# .....#cggcggscggR!M~S.cgg!bS   electric eel (poisoned)cgg&B---5cgg41cgg6 cggi61_A nearby fungus withers and dies.cgg+  .l≈S~≈~~~... ...##.~~≈≈~.≈~.P.....~.≈~.....P.cggm, ...~~.~~..[..~~~~P$.....~~..>..# ..................# ...#..#.# ### .## ...... cgg, @...............##cgg/ cgg(2 cgg= 4~≈≈l≈≈Sl   basiliskS   electric eel (poisoned)cgg-> &6cggH cgg\M cgg/ V..##.......~l≈≈S.≈~.P..≈~.....P.. ...~~.~~.... [..~~~~P.... $.....~~...... >..# ............# .## .  .#.# ## .## .# ##.<.## ..[#P..# ......######...P#....#.###cggR j6=7cgg cgg cgg,  ..~.≈~.....P....~~.~~..[..~~~~P$.....~~.. >..# ..................# ..#...cgg W#.# ### .## <.#[#P..# .cgg [... ..............#cgg cgg% &8cgg&cggOcgg ....~~.~~..[..~~~~P$.....~~.. >..# ..................# ..#...cggN#.# ### .## ##[#Pcggkr..# ...####cgg.cgg..cgg.. ............#.#cggcggcggF#7cgg|9cggcggy _There is an escape hatch in the ceiling, spattered with blood here.cgg 4cggi cgg cgg ll   basiliskcgg .10 _cgg cgg/ .........#  ###........#####.#..#  .......>......#  ....#..#................#  ...............#  #P.##.##.#........#####.#  ......................#  #.##..###..##..###.###..## 1.........# #.#######.#.#.#.####.#..## ......[......†.#  ####.##..##P..####.##.#<#  ............#  cgg/ ..######.###.#  ...##########.#  cgg.0 ? ...............#    .#####.###.###.##.#P##..#   cgg1 cgg: cgg 1.4 (1.8 _A mysterious force pulls you upwards. The hatch slams shut behind you.cggcggfcggcggcgg{8cgg cggPcggcggcggcggS9=cggcggcggIcggcggcggcgg]cggcggL70=cggcgg$,cggcgg(cgg91cggcgg5 ,cgg cgg ,cggcggcgg92cggcgg,cggcggm,cggcggcgg_S3=cggcggJ!,cgg#cggU%cgg%X74=cgg%'cgg(cgg)cgg=*cggf,cgg,cgg.cgg\2;5cgg6Bcggk7cgg{9,cgg:cgg<cgg8=%6cggp>cggA,cggyBcgg=E;7cggDFcggHcggIcggJcggM,cggNcggQcggQD8=cggScggUcggUcgg~Wcgg Z,cggf[cgg]k9=cgg^_cggb,cggdcggf,cgggcggicggNj&80cggkcgg^q,cggrcggucggu%1cggwcggzcgg8{cggj}cggcggǀcggxcggcggcggD2=cggcggcggcggcggcggcgg֑cggcggU3=cgg~BcggcggМcgg%4cggӞcggcggcgg=cgg cgg4cggTcgghcgg%5cggcggتcggcggcggZcggcggcgga6=cgggcggܺ,cggcggcgg%U7=cggcggz,cggcggcggAcgg]cggcgg%8cggcggcgg cggcggcgg&cggcggcgg%9cggcggq,cggcgg,cggdcggcggX&90cggcgg`,cggcggcggD1=cgg!cgg,cggcgg,cggcggAcggU2=cggcgg7,cggcgg,cggcggcgg%3cggqcggcgg5cggcggcgg6%4cggpcgg,cgg cgg. ,cgg cggcggXK5=cggcgg,cgg{cgg,cgg cgg5cggU6=cggScggd,cggcgg!;7cggp"cgg$,cgg%cgg',cgg)cgg+;8cgg,cggT.,cgg/cgg@2,cgg3cgg7cgg8K9=cgg9cggA<,cgg,>cggA,cggCcggEcgg,F[100/103=cggGcggJ,cggLcggO;1cggPcggjRcggRcgg-TcggDVcggVcggWcggyZcggZ%2cggI\cgg^cgg^cgg_cggbcggxbcggccggn_ _You start resting.cgg#u1606.4 (95.0)cgguZ3=7.4 (96cgg|cggQ" _HP restored.cgg cgg Where to? (Tab - Lair:2, ? - help) D - DungeonT - Temple L - Lair  N - Spider Nest  cgg $O - Orcish Mines V - VaultscggI? cgg` ........................#   deadiverson the Carver ....###........#####.#..#   Human of the Shining One ****** .................>......#   Health: 103/103 ======================== ....#..#................#   Magic: 13/13 ======================== ........................#   AC: 21Str: 17 #P.##.##.#........#####.#   EV: 14Int: 11 ........................#   SH: 16Dex: 15 #.##..###..##..###.###..##  XL: 13 Next: 65% Place: Lair:1 .............cgga ...@........#  Noise: ---------  Time: 17607.4 (0.0) #.#######.#.#.#.####.#..##  a) +0 scimitar (flame) ...............[......†.#   Throw: 6 darts (poison) ####.##..##P..####.##.#<#  ........................#  .............######.###.#    .............##########.#    ........................#    .#####.###.###.##.#P##..#    _The bolt of electricity hits you! _A nearby fungus withers and dies. _There is an escape hatch in the ceiling, spattered with blood here. _A mysterious force pulls you upwards. The hatch slams shut behind you. cgg>b F_You start resting. _HP restored.cggb cggd cggy Jcgg cgg Y  There is a stone staircase leading down here.cggP cgg cgg $ _cgg cgg 2cgg cgg 9  You climb downwards.cgg# cgg a  The iguana hisses angrily. The komodo dragon hisses angrily.cggQ cgg] cgg1 o _You hear an angry hiss.  There is a stone staircase leading up here.cggN_cggk #  .#  ~l  ##l  ##≈≈ ###≈≈ ##...# #...@#16.2 (8.8 .........# ....P...## ......... ......... .#........l   komodo dragon ..........l   iguana ........... ........P((~...cgglcggyz _There are monsters nearby!cgg' #  .#  ~l  ##l  ##≈≈ ###≈≈ ##...# #...@# .........# ....P...## ......... ......... .#........ .......... ...........   cgg" #  .#  ~l  ##l  ##≈≈ ###≈≈ ##...# #...@# .........# ....P...## ......... ......... .#........ .......... ........... cggcggRcggcggd _There are monsters nearby!cggX ((((((You throw a poisoned dart.cggcggmcgg~.≈≈≈.cgg,q]7.3 (1.15cggxcgg{l _The poisoned dart completely misses the komodo dragon.cgg 4cgg= cgg~ H _No target in view!cgg| cgg} cgg cggZ H _No target in view!cggcggcggYcggH _No target in view!cggYcggpcgg!cgg}cggllll   komodo dragonl   basilisk (wandering)l   iguanacgg,80cggKcgg@ [ _A basilisk comes into view.cgg ((poisoned)You throw a poisoned dart.  The poisoned dart hits the komodo dragon.  The komodo dragon is poisoned.cggɦBcggcgg  You hear a splash. The basilisk hisses angrily. You hear an angry hiss.cgg&cgg^ll≈ll.ll   frilled lizard (wandering)cggf==9.4 (1.14cgg2cggH _An iguana comes into view. _A frilled lizard comes into view.cggcgg cggcgg5cgg`cggrcgg lll 2 basiliskslYou block the komodo dragon's attack.cgg-i  The basilisk gazes at you.cggcgg5-200cggvcgg ##.#######.P#..........#  .............^.........## #######...###.#..#.##...# .......................## ###P#P..#####.##..###..#  #####..#########.#####.#  .......................#  ...###........#####.#..#  1 ................@l.....#  ...#..#.......#  .......................#  P.##.##.######.#  ..............#  .##..###..##..###.###..## ........................#  .#######.#.#.#.####.#..##  ..............[......÷.#  _You resist with almost no effort.-cgg[37mcggE5-1.9 (2.5cggTNcggR} _You climb upwards. _There is a stone staircase leading down here.cggsp  You hit the komodo dragon but do no damage.cgglt5=2.8 (0.9cgg|cggZ _The komodo dragon barely misses you.cgg  You hit the komodo dragon but do no damage.The komodo dragon hisses menacingly.cgg -3.6 (0.8cgg^ cgg ; _You block the komodo dragon's attack.cggn9  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is moderately wounded.cggA: <96/103 --cggx: .=4.5 (0.9cggxC cggF 2 _The komodo dragon bites you!cggD$  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is severely wounded.cgg'%D83-----cggR%!5.4cgg,cgg12 _The komodo dragon bites you!cggXY _The komodo dragon bites you!  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is severely wounded. _The komodo dragon bites you!  You hit the komodo dragon but do no damage. cggXg The komodo dragon is severely wounded.cggY`4----6.3cggacggea _The komodo dragon looks more healthy. You block the komodo dragon's attack.cgg  You hit the komodo dragon but do no damage.The komodo dragon is severely wounded.cggG-7.3 (1.0cggcgg; _You block the komodo dragon's attack.cgg]  You slash the komodo dragon! You burn the komodo dragon.cggq†cgg:=7=8.1 (0.8cgg cggcQ _You kill the komodo dragon!cgg> 4cgg} cgg H _No target in view!cgg# cgg cggl cggs H _No target in view!cgg cgg, cgg> cgg+ cgg g5cgg\ cgg cgg K6=cgg cggB cgg cgg> cggP cgg cgg> cggE cgg cgg N7=cgg cgg ,cgg cgg cgg cgg cggY cgg %8cgg cgg' cggY cgg cgg ;9cgg cgg ,cgg cgg cgg cgg cgg cgg &90cgg cgg,cggcggcggcggcgg cgg #1cggA (=cgg] cggF cgg~ cggWcggcggRcggcggcggcgg&N2=cggcgg~BcggBcggq%3cggcggcggcggcgg} cgg cgg!cgg#cggL$%4cggd%cgg&cgg'cgg(cgg+cgg3+cgg,cgg-cggK.cggp.D5=cgg/cgg1cgg2cgg2cgg4cgg4U6=cgg(6cgg9cggk9cgg:cgg>,cggw>cgg\B;7cggBcggCcgg4DcggEcggTL8cggN_cggOZ9=cggQcgg-RcggRcggScggTcggTcgg~Wq100/103=cggWcggtY,cggYcgg\,cgg\cgg_Q1cggFacggacgg/bcggc,cggIdcggPfcggf%2cggNgcgghcgghcggBicggqi -- _You start resting.cggw076.1 (48.0)cggxm3=--7.1 (49cgg}cgg" _HP restored.cggcggcggcggG8.1 (1.0)cggcgg #  l#  ~.  cgg##≈  ##≈≈ ###≈≈ ##...#2 #...@# cggl.# ....P...## .  .#........cgg*l   basilisk ........l.cggPl   iguana ...........cggwl   frilled lizard (wandering) ........P((~...cggz:=cggcggcggcgg cgg!cggG.2(lllll 2 basilisks.l 2 iguanaslcggֲ-9.6 (2.5cggcgg } _You climb downwards. _There is a stone staircase leading up here.cggD cgg cgg cgg: F _Unknown command.cggcggv≈lll..cgg6=80.6 (1.0cggcgg ##.#######.P#..........#  .............^.........## #######...###.#..#.##...# .......................## ###P#P..#####.##..###..#  #####..#########.#####.#  .......................#  cggf...###........#####.#..#  1 ................@†.....#  ...#..#.......#  .......................#  P.##.##.#cgg<.#####.#  ..............#  cgg.##..###..##..###.###..##  l   iguana ........................#  .#######.#.#.#.####.#..## ..............[......÷.#  _You block the iguana's attack.cggcggxcggڇ5-2.1 (2.5cgg cgg' _You climb upwards. _There is a stone staircase leading down, spattered with blood here.cgg\RO  You slash the iguana! You burn the iguana.cgg#Y^†cgg;]4==9 (0.8cgg3bcggWeJ _You kill the iguana!cggicggZcgg߲cggH _No target in view!cggC cgg4 cgg cggI H _No target in view!cgg64cggcggcggf=--3.9 (1.0 _cggƴcggA #  (#  ~.  ##≈  ##≈≈ ###≈≈ ##..l#cgg 2 #...@# l..# ....P.l.## .  .#........ll 2 basilisks .......l..cggRl   iguana ...........l   frilled lizard ........P((~...cgg9--cggEcgg;`  You climb downwards. You block the frilled lizard's attack.cgg0cgg l.l.You block the iguana's attack. You block the frilled lizard's attack.cggT5=5.4 (2.5cgg[]cggRe _The iguana bites you but does no damage. _There is a stone staircase leading up here.cggncggcgg cgg F _Unknown command.cggF cggG cggV cgg` cggJh i  The basilisk gazes at you.cgg cggU  l.You resist with almost no effort. You block the frilled lizard's attack.  The iguana hisses menacingly.cggI -6.4 (1.0cgg cgg*  ##.#######.P#..........#  .............^.........## #######...###.#..#.##...# .......................## ###P#P..#####.##..###..#  #####..#########.#####.#  .......................#  ...###........#####.#..#  1 cgg+ l................@†.....#  ...#..#..ll.....#  .......................#  P.##.##.#.#####.#  ..............#  .##..###..##..###.###..##  l   basilisk ........................# .#######.#.#.#.####.#..## ..............[......÷.#  _You block the iguana's attack.cgg, cgg5 cgg 5-7.9 (2.5cggi cgg _You climb upwards. _There is a stone staircase leading down, spattered with blood here.cggwcggx8-cggecggqF _Unknown command.cggAcggB5=8.7 (0.8cgg IcggOLt _You barely miss the basilisk. You block the basilisk's attack.cgg   You slice the basilisk!! You burn the basilisk.  The basilisk is severely wounded.You block the frilled lizard's attack. You block the iguana's attack.cggJ 1==9.5cggc cgg Y _The basilisk completely misses you.cggi   You hit the basilisk. You burn the basilisk.  The basilisk is severely wounded.The frilled lizard closely misses you. You block the iguana's attack.cggN 7--90.4 (0.9cgg cgg# 6 _You block the basilisk's attack.cgg,S  You slash the basilisk! You burn the basilisk.cggF7 .l   iguanal   frilled lizard  You kill the basilisk!You block the frilled lizard's attack.cgg:Y8=-1.3cgg?cgg>C> _The iguana bites you but does no damage.cgg0............^## ######...###.#..#.##...# ......................## ##P#P..#####.##..###..#  cgg+1#..#########.#####.#  ......................#  ###.#####.#..#  ....>†.....#  #..#ll@.....#  ...........#  .##.##.######.#  ...............#  ##..###..##..###.###..## .......................# #######.#.#.#.####.#..## .............[......÷.#  ##.##..##P..####.##.#<#  cgg45cgg> .lThe frilled lizard bites you but does no damage.cggw?5-2.3 (1.0cggIcgg@KZ _The iguana attacks as it pursues you! You block the iguana's attack.cggO  You slash the iguana! You burn the iguana!cgg  .l   frilled lizard  You kill the iguana!cgg6==3.1 (0.8cgg`cgg!< _You block the frilled lizard's attack.cgge`  You slice the frilled lizard!! You burn the frilled lizard.cggg†cgg6--4.0 (0.9cggcggR _You kill the frilled lizard!cggK cgg2 9--cgg cgg H _No target in view!cgg~ cggM cgg cggt" H _No target in view!cgg ##.#######.P#.# .............^.........## #######...###.#..#.##...# .......................##P#P..#####.##..###..# #####..#########.#####.# ..............# ########.#..# .....@†.....# #..#†......# ..............# P.##.##.#.#####.# ..........#  .##..###..##..###.###..##..............# .#######.#.#.#.####.#..## ..............[......÷.#   cggQ"h-5.0 (1.0 _cgg$y _There is a stone staircase leading down, spattered with blood here.cggV3N-cgg\7cgg=cggaA-6 _cggqCcgg+ #  (#  ~.  ##≈  ##≈≈ ###≈≈ ##...#2 #...@# ..# ....P...## . l .#........l   basilisk .......... ........... ........P((~...cgg cggV#cggc%cggy+cgg+ll.l   frilled lizardcgg-7.5 (2.5cgg)cggv} _You climb downwards. _There is a stone staircase leading up here.cgg!c cggc cggm cgg/r F _Unknown command.cggo2 cgg2 cgg9 ≈ll.8.5 (1.0 _cgg2@ cgg^B cggMcggMcggzUcggWcggM^Ql.cgg b.=9cggccggC  ##.#######.P#..........#  .............^.........## #######...###.#..#.##...# .......................## ###P#P..#####.##..###..#  #####..#########.#####.#  .......................#  ...###........#####.#..#  1 cgggC ................@†.....#  ...#..#..l......#  .......................#  P.##.##.######.#  .........cgg D c.....#  .##..###..##..###.###..##  l   frilled lizard ........................# .#######.#.#.#.####.#..## ..............[......÷.#  _The frilled lizard barely misses you.cgg*E cggO cgg 7-701.0 (2.5cggi cgg _You climb upwards. _There is a stone staircase leading down, spattered with blood here.cgg _  You slash the frilled lizard! You burn the frilled lizard.cgg h†cgg 3=8 (0.8cgg cgg  R _You kill the frilled lizard!cggu!cgg!cgg&cggy(H _No target in view!cgg4cggcggm cgg <-2.8 (1.0 _cggcggb #  (#  ~.  cgg4##≈  ##≈≈ ###≈≈ ##...#2 cgg#...@# ..#cgg ....P...##cggB .cgg+  cggG.#......l.cgg`l   basilisk cggy.......... ...........cgg> ........P((~...cggq8-cgg.cggcgg7'Sl.cgg-4.3 (2.5cggwcggD} _You climb downwards. _There is a stone staircase leading up here.cgg^b#(#~. ##≈ ##≈≈ ###≈≈ ##...#..P#...<##cggb=.......@.#P...#...l. ....#cggb;........cggcS   electric eel (wandering)P(S~...cgg#c1P~≈≈≈....cggicgg0jcgg.ul.(cggu45.3 (1.0 _cgg~cggcggQ  You hit the basilisk. You burn the basilisk.cggf5=6.2 (0.9cgg=cggY6 _The basilisk is lightly wounded.cggj  You slash the basilisk! You burn the basilisk.  The basilisk is heavily wounded.cgg5=7.2 (1.0cggcggN _The basilisk misses you.cgg?G  You hit the basilisk. You burn the basilisk.  The basilisk is heavily wounded.cggNi  The basilisk gazes at you.cggpcgg5-8.1 (0.9cggcgg7 _You resist with almost no effort.cgg~ S  You slash the basilisk! You burn the basilisk.cgg" F†cgg͐ 99==9.0cgg cgg0 L _You kill the basilisk!cgg  (~. ##≈ ##≈≈ ###≈≈ . ##...#..P#...<##.......P..@##........#................cggQ .P......~≈≈≈...#......P~≈≈≈≈P..Pcgg cgg 8---10.0 (1.0cgg* cgg  cgg o_You see here a basilisk corpse.cggػcggcggؾcggcgg|cggR: _cggcggRcggucggcggcgg cggHu cgg ##≈ ##≈≈ ###≈≈ ... ##...# $...P#...<## ............### ....cgg A....P..†##.#...........#.............@.......---2.0 (2.#.....cgg ......P((~.P~≈≈≈S   electric eel (wandering)cggg #......P~≈≈≈≈P..P.......~≈≈~≈~S~ ....##.......~l≈≈S.≈~.P...cggT cggg d _An electric eel is nearby!cgg  ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  ....P..†##.#.....  cgg #............#....  .........@.......  .#...............  .................  .................  ........P((~.....  .P......~≈≈≈.....  cggM #......P~≈≈≈≈P..P  .......~≈≈~≈~S~...  cgg* ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  ....P..†##.#.....  ............#....  .........@.......  .#...............  .................  ................. ........P((~..... .P......~≈≈≈.....  #......P~≈≈≈≈P..ggo,40mP .......~≈≈~≈~S~..cgg2cgg2cggw<cggAd _An electric eel is nearby!cgg ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  ....P..†##.#.....  ............#....  .........@.......  .#...............  .................  .................  ........P((~.....  .P......~≈≈≈.....  #......P~≈≈≈≈P..P  .......~≈≈~≈~S~...  cggdY ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  ....P..†##.#.....  ............#....  .........@.......  .#...............  .................  ................. ........P((~..... .P......~≈≈≈.....  #......P~≈≈≈≈P..gg Z40mP .......~≈≈~≈~S~..cggD[cgg\dcgg%id _An electric eel is nearby!cgg ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  ....P..†##.#.....  ............#....  .........@.......  .#...............  .................  .................  ........P((~.....  .P......~≈≈≈.....  #......P~≈≈≈≈P..P  .......~≈≈~≈~S~...  cgg X ##≈ cgg ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### ....  cgg# &....P..†##.#.....  ............#....  .........@.......  cgg .#...............  .................  ................. ........P((~..... .P......~≈≈≈.....  cgg #......P~≈≈≈≈P..P .......~≈≈~≈~S~..cgg cgg cgg; cgg d _An electric eel is nearby!cggMf (((((S( _An electric eel is nearby! _An electric eel is nearby!  You throw a poisoned dart.  The poisoned dart hits the electric eel.cggO ...~.≈SYou hear a splash.cggZ *****cggf**The electric eel shoots out a bolt of lightning at you!cgg@...~.≈cggȍg===3.1 (1.13cggucgg5J _The bolt of electricity hits you but does no damage.cgg$ (((((((You throw a poisoned dart.  The poisoned dart closely misses the electric eel.cgg ...~.≈SYou hear a splash.cgg *******The electric eel shoots out a bolt of lightning at you!cggQ;@...~.≈94/103 ---4.22cggWcgg\7 _The bolt of electricity hits you!cgg3((((((poisoned)(The electric eel shoots out a bolt of lightning at you! _The bolt of electricity hits you!  You throw a poisoned dart.  The poisoned dart hits the electric eel.  The electric eel is poisoned.cgg ...~.≈You hear a splash.cgg *******The electric eel shoots out a bolt of lightning at you!cgg` @...~.≈The bolt of electricity misses you.cgga5=--dart (poison) cgg"n/  --more--cgg *******The electric eel shoots out a bolt of lightning at you!cggę@...~.≈cgg-5.4 (1.2cggcggQ _The bolt of electricity misses you.cggBS(((((((cggYou throw a poisoned dart.  The poisoned dart barely misses the electric eel.cgg}cgg~.cggW~.cgg~.cgg~~cggC.cgg≈cggScggYou hear a splash.*******The electric eel shoots out a bolt of lightning at you!cgg!z@...~.cgg~!3≈cgg6"#1cggU"8-6.5 (1.1cggq"8Nothing quiveredcgg .cgg2 cgg2)_The bolt of electricity hits you.cggcggcggɘcggG _Nothing quivered!cgg4cggcggG _Nothing quivered!cggn cgg cgg cgg  G _Nothing quivered!cggcggcgghcggcggcggHcgg/cggF _Unknown command.cgga cgg cgg# cgg'( F _Unknown command.cgg cggZ Evoke which item? Wands  h - a wand of roots (14)y - a wand of digging (12)  cggŲ B - a wand of mindburst (38)  M - a wand of flame (12)  N - a wand of charming (7) Miscellaneous  I - a Gell's gravitambourine (2/2) cgg= [!] read|quaff|evoke[?] describe selectedcggcggGcggW##≈deadiverson the Carver##≈≈Human of the Shining One ******###≈≈.Health: 91/103 =====================---.. ##...#$.Magic: 13/13 ========================..P#...<## ...AC: 21Str: 17.........### ....EV: 14Int: 11cgg0....P..†##.#.....SH: 16Dex: 15............#....XL: 13 Next: 69% Place: Lair:2.........@.......Noise: ===------  Time: 17716.5 (0.0).#...............a) +0 scimitar (flame).................Nothing quiveredcggu.........................P((~......P......~≈≈≈.....S   electric eel (poisoned)cggj#......P~≈≈≈≈P..P.......~≈≈~≈~S~... cgg?....##.......~l≈≈S.≈~.P... _The bolt of electricity hits you. _Nothing quivered! cggap_Nothing quivered! _Nothing quivered! cggH_Unknown command. _Unknown command.cgg ##≈ deadiverson the Carver ##≈≈ Human of the Shining One ****** ###≈≈ .  Health: 91/103 =====================--- .. ##...# $.  Magic: 13/13 ======================== ..P#...<## ...  AC: 21Str: 17 .........### ....  EV: 14Int: 11 ....P..†##.#.....  SH: 16Dex: 15 ............#....  XL: 13 Next: 69% Place: Lair:2 .........@gg#;1m.......  Noise: ===------  Time: 17716.5 (0.0) .#........*......  a) +0 scimitar (flame) ..........*......  Nothing quivered ...........*.....  cgga........P((*.....  .P......~≈≈≈*....  S   electric eel (poisoned) cgg#......P~≈≈≈*P..P  cgg .......~≈≈~≈~S~... ....##.......~l≈≈S.≈~.P... _Nothing quivered! cgg9_Unknown command. _Unknown command.cggAiming: MindburstPress: ? - help, Shift-Dir - straight line, f/p - electric eelAim: an electric eel (lightly wounded, poisoned, haloed, chance to affect: 72%)cggD: ##≈deadiverson the Carver##≈≈Human of the Shining One ******###≈≈.Health: 91/103 =====================---.. ##...#$.cgg: .Magic: 13/13 ========================..P#...<## ...AC: 21Str: 17.........### ....EV: 14Int: 11....P..†##.#.....cgg: bSH: 16Dex: 15cgg: ............#....XL: 13 Next: 69% Place: Lair:2cgg ; \.........@.......cgg$; Noise: ===------  Time: 17716.5 (0.0).#...............cgg=; Ha) +0 scimitar (flame)cggd; .................Nothing quivered.................cgg; r........P((~.....cgg; .P......~≈≈≈.....S   electric eel (poisoned)cgg; #......P~≈≈≈≈P..Pcgg; .......~≈≈~≈~*~... ....##.......~l≈≈S.≈~.P... cgg< g_Nothing quivered! _Unknown command. _Unknown command.cgg4< >Aiming: MindburstcggL< Press: ? - help, Shift-Dir - straight line, f/p - electric eelAim: an electric eel (lightly wounded, poisoned, haloed, chance to affect: 72%)cgg pUnknown command.  Aiming: MindburstPress: ? - help, Shift-Dir - straight line, f/p - electric eelAim: an electric eel (lightly wounded, poisoned, haloed, chance to affect: 72%)The electric eel's mind is blasted!cgg )cgg 9(cgg˭ h2====7.5 (1cgg cgg S _You blow up the electric eel!cgg cgg cgg cgg cgg cgg" cgg  ,cgg cgg! cggG" %3cgg# cgg) ,cgg+ cgg#3 ,cgg8 cggq; cgg@ cgg@ %4cggC cggG cgg cgg †.----23.5 (6l   basilisk (wandering)lcggc ;----cggA u _A basilisk is nearby!cgg cgg+t##≈ ##≈≈ ###≈≈ .  .. ##...# $. cggO* ..P#...<## ...  cggrL.........### ....  ....P..†##.#.....  cgg%............#....  cggţ.........@.......  .#...............  ................. cgg+ .................  cgg M........P((~.....  .P......~≈≈≈..... cgg2 cggp#......P~≈≈≈≈P..P  .......~≈≈~≈~l~...  cgghB ##≈ ##≈≈ ###≈≈ .  .. ##...# $.  ..P#...<## ...  .........### .... cggB_ ....P..†##.#.....  ............#....  .........@.......  .#...............  cggC.................  ................. ........P((~..... .P......~≈≈≈.....  #......P~≈≈≈≈P..P .......~≈≈~≈~l~..cggC+cggQ4cgg']cggb_ _A basilisk is nearby!cgg`` ~. ##≈ ##≈≈  ###≈≈ . .. ##...# $. ..P#...<## ... .........### .... ....P..†##. #.... .. .#. . .......... ..P((~..... .P......~≈≈≈..... #......P~≈≈≈≈P..P .......~≈≈~≈~l~cggbcgg!)4.5 (1 cggQ _cgg9cggecgg&  (# ~. ##≈ ##≈≈ cggk  ###≈≈ . .. ##...# $. ..P#...<## ... .........### .... ....P..@##.#..... cggח #.... .. .#.. .. .......... ..P((~.. .P......~≈≈≈..... #......P~≈≈≈≈P..Pcgg cggK #5cggb 1=5cgg cgg u _You see here a basilisk corpse.cgg= M  (# ~. ##≈ ##≈≈cgg>   ###≈≈ .. ##...# $P#...<## ...@.### cgg/> P..†##.#....#...................cgg^> '..........cgg> 2.P......~≈≈≈...cgg J cggJ $6 cggJ _cggR cggV cgg+M # (# ~. ##≈ ##≈≈  ###≈≈ .. ##...# $..P#...@## .....### P..†##.#.............#..................P((~..cggcgg&7cggcgga _There is a stone staircase leading up here.cggWM  (# ~.## ##≈..# ##≈≈≈..## cgg g ###≈≈≈≈....  ##..@# $..P#...<## .....### ....P..†##.#..................cggcggpcgg88=cgg&8 _cggcgg=cgghcgg#icggncggrT _Why would you want to do that?cgg$_  #(~.####≈..#cgg_ ##≈≈≈..#####≈≈≈≈.... ... ##...# $P#...@## ...........### .P..†##.#......................P((~.....cggrj cgg6k cggLk &9 _cgg7r cggw a _There is a stone staircase leading up here.cggcggcggcgglcggcggcggcgg}#9cgg(=cgg|cggKcggcggCcggcgg;cggEcggycgg[100/103=cggcggucggcgg`cgg cgg %1cgg cggcggcggcggm cgg cgg!cgg%cggB&%2cggt'cggC-cgg-cgg.cgg5Bcgg&>_ _You start resting.cggA0412.0)cggL ll   iguana (wandering)  HP restored.cggRLZ3=2.5 (13cggScggWZ _An iguana comes into view.cgg) #l#~.####≈..##≈≈≈..#####≈≈≈≈.... ... ##...# $..P#...<## .........@.### .P..†##.#.........#....#..............P((~...P......~≈≈≈.....cgg0cgg/3.0) cgg cgg?cgg3cgg_cggcgg,cggcggcgg:cggcggcgg.9=cgg!cgg)l   basilisk (wandering)lcggN  #  l#  ~.##  ##≈..#  ##  ### .  .. ##...# $.  ..P#...<## ...  .......@.### .... 6.5 (3 ....P..†##  .........  ..........cgg  .#.........  .................  ............l....  ........P((~.....   _You start waiting.cgg|  #  l#  ~.##  ##≈..#  ##  ### .  .. ##...# $.  ..P#...<## ...  .......@.### ....  ....P..†##  .........  .......... cgg.#......... .................  ............ ........P((~.. cggcggQcgg:_ _A basilisk is nearby!cgg cggD cgg cgg cgg%l~.####≈..##≈≈≈..#####≈≈≈≈.... ... ##...# $..P#...<## .........### .P..@##.#.........#cggM&......#..........l..P((~...P~≈≈≈...#......P~≈≈≈≈P..Pcgg)cgg5Ml.cgg6)7.5 (1 cgg6 _cgg@cggFu _You see here a basilisk corpse.cgg!A~.###≈..# ##≈≈≈..####≈≈≈≈.... ... ##...# $. ..P#...<## ... cgg^.........### .... ....P..†##.#..... ........@...#.... ..... .# .....l.cgg.P((~..... .Pcggi~≈≈≈.....cggA#......P~≈≈≈≈P..P.......~≈≈~≈~l~...cggcggq"l.lcggA#-8 _cgg-cgg1cgg##≈..# ##≈≈≈..####≈≈≈≈.... ... ##...# $. ..P#...<## ... .........### .... cgg....P..†##.#..... ........... ..... .# ...l cggCM..cggeY.P((~cggf.P~≈≈≈..... cgg”#......P~≈≈≈≈P..Pcgg.......~≈≈~≈~(~... ....##.......~l≈≈S.≈~.PcggKcggNl.cgg,&9cgg1cggcggA  You slash the basilisk! You burn the basilisk.  The basilisk is heavily wounded.cggH i  The basilisk gazes at you.cgg cgg 6==50.4 (0.9 cgg9 cggT 7 _You resist with almost no effort.cggi  You closely miss the basilisk.The basilisk is heavily wounded.cggΞ i  The basilisk gazes at you.cgg, J-1.2 (0.8 cgg8 cgg1< 7 _You resist with almost no effort.cgg;DS  You slash the basilisk! You burn the basilisk.cggR l l   iguana (wandering)  The basilisk is almost dead.cggRb2-=2.1 (0.9 cggR]cggb- _The basilisk bites you.cggu#S  You slash the basilisk! You burn the basilisk.cgg &cggX1j.†cggS6T3=70cgg6-9 (0.8 cgg@cggCL _You kill the basilisk!cggcgg8-cggmcggH _No target in view!cgg 3cgg cgg cgg+  ##≈≈≈..#####≈≈≈≈........ ##...# .$P#...l## l..cgg Y.......####...P..†##.#.........#.......#..l   iguanal   frilled lizard (wandering) cgg ....##.......~~≈≈~.≈~.P....cgg/ +.~.≈~.....Pcgg &0cgg$ cggt' <## .l.####lcgg+ 3-3.9 (1cgg3 cgg4? _An iguana and a frilled lizard come into view. _You see here a basilisk corpse.cggB   ###..  .. ##...# .$.  ..P#...<## ....  .......l.####l...  ....P..†##.#.....  ............#....  .................  .#.......@.......  .................  .................  ........P((~.....  .P......~≈≈≈.....  #......P~≈≈≈≈P..P  .......~≈≈~≈~(~... ....~~≈≈~.≈~.P...  cgg+    ###..  .. ##...# .$.  ..P#...<## ....  .......l.####l...  ....P..†##.#.....  ............#....  .................  .#.......@.......  .................  .................  ........P((~..... .P......~≈≈≈..... #......P~≈≈≈≈P..P  .......~≈≈~≈cgg F~(~... ....~~≈≈~.≈~.P.cggL cgg cgg 1-cggcggyd _There are monsters nearby!cgg[=   ###..  .. ##...# .$.  ..P#...<## ....  cgg=.......l.####l...  ....P..†##.#.....  ............#....  ................. cgg=: .#.......@....... cgg=+ .................  cgg>G.................  ........P((~..... cgg6>1 .P......~≈≈≈.....  cgg[>.#......P~≈≈≈≈P..P  cgg>r.......~≈≈~≈~(~... ....~~≈≈~.≈~.P...  cggYI   ###..  .. ##...# .$.  cggX..P#...<## ....  .......l.####l...  ....P..†##.#..... cgg2 ............#....  cgg^.................  cgg.#.......@.......  .................  cggZ.................  cgg........P((~..... cgg.P......~≈≈≈..... cgg#......P~≈≈≈≈P..P  cggP.......~≈≈~≈~(~... ....~~≈≈~.≈~.P.cggw cggTcggcggcggRd _There are monsters nearby!cggt ##≈..#  ##≈≈≈..##### ###≈≈≈≈........ ##...# .$..P#...<## ....#.......l.####l...#....P..†##.#.....P.cggQ..#....#....#†#..........P........P((~.....$.P~≈≈≈......#P~≈≈≈≈P..P ≈≈~≈~(~...cgge##.~~≈≈~.≈~.P...cggcggR.lcggy&4cggcgg + _Found 16 gold pieces.cgg< ~.##  ##≈..#  ##≈≈≈..###### ###≈≈≈≈........ ##...# .$..P#...<## ....# .......l.####....##....P..†##.#l....P.#....# .....#cgg-=Y†##.#.........P.........P((~.....$.P~≈≈≈......#P~≈≈≈≈P..P ≈≈~≈~(~...cggKcggL.=5cgg%VcggW> _The iguana bites you but does no damage.cgg  You slash the iguana! You burn the iguana.  The iguana is almost dead.cgg P==6.8 (0.9 cgg cgg S _The iguana barely misses you.cggf  You hit the iguana but do no damage.The iguana is almost dead.cggjg 4-7.6 (0.8 cggm cggsq 4 _You block the iguana's attack.cggO  You slash the iguana! You burn the iguana.cggE.cggF-8.5 (0.9 cggTcggJ _You kill the iguana!cggcgg4cggcggH _No target in view!cggcgg,cggcgg cggrcggP _cgg5,cggcggcgg%,cggcggQcggT cgg cgg7 cgg cggcggcggcggcggcggcgg0N _You now have 837 gold pieces (gained 17).cggcgg cggcggcggGcggcggn cgg"cgg%,cgge&cgg (cgg1*cggj*cgg*cgg,cgg-,cgg.cgg0cgg3cggO4cgg95cgg:1cggD;cgg?L _f - a poisoned dartcgg@cggCcggCcgg4Ecgg8Hcgg3LcggeLcgg[Mcgg'PcggScggIScggATcgg:WcggvZ,cgg[cgg]cggc,cgg7dcgg=fcgg icggIicgg:jcggncggrcggscgg0tcggvcgg}{cgg{cgg>}cggUcgg!,cgg݅cggcggcggcggpcgglcggqcggcggcggycggݩH###≈≈≈≈........ cgg). ##...##≈≈#.....# .P#...<##≈##....## ......l.####....## cggPO...P..†##.#.....P# ...........#....## cggum.................# cgg#.......†.......## ..... - .....cggʪP..# .......P((~.....$..... cggThrow: dart (poison) P......~≈≈≈#YP cgg......P~≈≈≈≈P..P....## cggE......~≈≈~≈~(~.....## Y   yak (asleep) cggpu.....~~≈≈~.≈~.P....# ......~.≈~.....P.... .........~~.~~.cgg$...cgg׶x 82.5 (24.0)  A yak comes into view.cggY.Ycgg5==3.5 (25cggcgg$^ _The yak bellows! You hear a bellow! You hear a shout! You hear a bellow!cggzp ......# . #.....##<##≈##....####....##†##.#.....P#..#....##........#†.......##.......@#.......P..# (~.....$....Y ..........#.P cggP..P....## ~≈~(~.....## ~.≈~.P....# ~.....P.... cggv:  ......# #.....##<##≈##....####....##cgg*;†##.#.....P#..#....##........#†.......##.......@#.......P..# (~.....$....Y ..........#.PcggY;P..P....##~≈~(~.....## cgg;~.≈~.P....#cgg<}~.....P....cggaIcggIcggjVcgg<\Z _A yak is nearby!cggj  ......# . #.....##<##≈##....####....##†##.#.....P#..#....##........#†.......##.......@#.......P..# (~.....$....Y ..........#.P P..P....## ~≈~(~.....## ~.≈~.P....# cggnk B~.....P.... cggF  ......# #.....##<##≈##....##cgg ##....##†##.#.....P#..#....##........#†.......##.......@#cgg .......P..# (~.....$....Y cgg0 ..........#.PP..P....##~≈~(~.....## ~.≈~.P....#~.....P....cggW cgg cggn cgg cggx Z _A yak is nearby!cggf*##...##≈≈#.....## P#...<##≈##....## ....l.####....## P..†##.#.....P# .......#....## ......# †## ...###P@.#P((~.....$....Y.YY~≈≈≈..........#.P. .....P~≈≈≈≈P..P....## .cgg_g~≈≈~≈~(~~~≈≈~.≈~.P....# YY 3 yaks (2 wandering).≈~......~~.~~.....#[.l~~~~P....cggte  2 yaks come into view.cggucggMx5  The yak bellows!cggycggy Y..Y. 2 yaks (1A yak comes into view.cggN14.5 (1.0)cggI _The yak moves out of view. x2cgg##...##≈≈#.....## #...<##≈##....## l.####....## P..†##.#.....P# #....## ..# †.## ### P.@# cggJP((~.....$...Y..Y.F~≈≈≈.#.P.#P~≈≈≈≈P..P....## . ~~≈≈~.≈~.P....# ~.≈~.....P.... F   bullfrog (wandering)~~ cggj  A bullfrog comes into view.cgg  cggJV The yak bellows! The bullfrog gives a loud, deep croak!cggcggcggcggY..YYF~YY 3 yaksFcgg.=5cggScggM _The bullfrog hits the fungus! The fungus begins to die.cgg  You slash the yak! You burn the yak.  The yak is moderately wounded.cgg!cgg#cgg1YY.YY 4 yakscgg2k93/103 ----6.3 (0.8cgg#AcggEF _The bullfrog hits the fungus! The yak gores you!cggdoI  You slash the yak! You burn the yak.cggNF.cggl!-cgg!7.1cgg̏cggW[ _The yak is heavily wounded.cgg  You hit the yak but do no damage.The yak is heavily wounded.cggcggbcggB  The bullfrog hits the fungus.cggcggBY.YYY.Y 5 yakscggEe4----8.1 (1.0cggcgg V _A yak comes into view.cgg G  You hit the yak. You burn the yak.cgg cggH cggQ cggG Y.The yak is severely wounded.cggѥ E-9 (0.8cgg cgg 1 _You block the yak's attack.cgg  You hit the yak. You burn the yak.  The yak is almost dead.cggy cgg: cggI cgg FYF   bullfrogcggw 539.8 (0.9cgg& cggG D _The yak gores you. You block the yak's attack.cgg-A  You hit the yak. You burn the yak.  The yak is almost dead.cgguCcggE  A nearby fungus withers and dies. The yak closely misses you.cgguHcggXWF.Y.Y#..cggX6490.6 (0.8cggogcggm1 _You block the yak's attack.cggG  You hit the yak. You burn the yak.cgg'cggcggxcgg:cggYYY..Y. 4 yakscggo011.4cggcgg\G _You kill the yak!cggTI  You slash the yak! You burn the yak.cggr`NF.cgg`0=2.2cggkcggEn^ _The yak is moderately wounded.cgg  You hit the yak but do no damage.The yak is moderately wounded.cgg' t5=-3.0cgg cgg2 e _You block the yak's attack. The yak misses you.cggF  ##...##≈≈#.....## P#...<##≈##....##.l.####....## ..P..†##.#.....P#.#....##...#.†.##.###.P@.#.P((~.....$YYYF....~.~≈≈≈.Y.#...#.P~≈≈≈≈P..P....## .. .....~≈≈~≈~(~.....##cggF .~~≈≈~.≈~.P....#.~.≈~.....P.....~~.~~.....# .....[.l~~~~P....cggL cggFO cggX[ `.YFcgg[ G-4.0 (1.0cggi cgg}m W _The yak gores you but does no damage. You block the yak's attack.cggTi  You slash the fungus! The fungus begins to die. You burn the fungus.cgg/C  The fungus is lightly damaged.cgg6cggcggY.YF.cgga4-=9 (0.9cgg{cgg( _The yak gores you.cggB ###≈≈≈≈........# . ##...##≈≈#.....## .P#...<##≈##....##....l.####....##P..†##.#.....P##....##.cgg+..# #† .@###..........P.Y# cgg.P((~.....$YY......~ P......~≈≈≈......YF..#...#cgg.P~≈≈≈≈P..P....## ..cgg..~≈≈~≈~(~.....##~≈≈~.≈~#cgg~.≈~.....P........~~.~~.....#cggcggcggkcgg*cggcggmYYY†F..cgg~d5=--5.9 (1.0cggIcggLcgg(cgg{  You completely miss the yak. The yak gores the fungus!cggW cgg9NF.cgg":6==6.7 (0.8cgg[GcggK/ _The yak gores the fungus.cgg j  You hit the yak. You burn the yak.  The yak is lightly wounded.cgg cgg cgg cgg cggS XYYF†cggM 5-7.6 (0.9cggG cgg 7 _A nearby fungus withers and dies.cgg6 G  You hit the yak. You burn the yak.cgg7 cgg.9 j  The yak is heavily wounded.cggB SYY.cggB 6=-8.4 (0.8cggWO f _The yak barely misses you.cggWG  You hit the yak. You burn the yak.cgg&cgga  The yak is severely wounded.You block the yak's attack. The yak gores you but does no damage.cgg+-9.3 (0.9cggcgg1 _You block the yak's attack.cgg]  You hit the yak. You burn the yak.cgglYYY.$Fcggi/800.1 (0.8cggcggb\ _The yak is severely wounded.cgg'I  You slash the yak! You burn the yak.cgg*V  You kill the yak!cgg?9.F. 3 yakscgg>E72=1.0 (0.9cgg>McggRi _You block the yak's attack. x2; The yak misses you.cggw  You slash the yak! You burn the yak.  The yak is heavily wounded.You block the yak's attack. The yak gores you but does no damage.cgg?&9cggcgg1 _You block the yak's attack.cgg  ##≈≈≈..#######  ###≈≈≈≈........# .. ##...##≈≈#.....##P#...<##≈##....##....l.####....##P..†##.#.....P##....## cggJ ....##† ...###.........YYY.# ..P((~.....F.†......~ .cgg P......~≈≈≈..........#...# #......P~≈≈≈≈P..P....## ....~≈≈~≈~(~.....##~≈≈~.≈~#~.≈~.....P....cgg cgg cggv cgg` m  The yak attacks as it pursues you! The yak gores you but does no damage.cgg %  cgg VThe yak attacks as it pursues you! The yak misses you.cgg kYYYF..$cgg! 5-2.9 (1.0cgg{, cgg/ T _The yak attacks as it pursues you! You block the yak's attack.cgg%#≈..#  ##≈≈≈..#######  ###≈≈≈≈........#  ##...##≈≈#.....# .P#...<##≈##....## ..l.####....## P..†##.#.....P# #....## .. #†.## YYY### .......F...#......P((~.....$.†......~ P~≈≈≈..........#...#  2 yaksP~≈≈≈≈P..P....## ..≈≈~≈~(~.....##~~≈≈~.≈~.P....#cgg *cgg .cgg/cgg/cggu;cY..cgg,<88--cggY<3cgg cggKcgg,cggԜcggW=7=4.7 (0.8cggcgglj _You hit the yak but do no damage. The yak gores you.cgg+cggcggcgg1 jFF   bullfrogcgg (5.5cgg*cggiW _You hit the yak but do no damage.cggyfI  You slash the yak! You burn the yak.cggqF.cggr-8=cggr6.4 (0.9cgg{cgg cgg;_The yak is almost dead.cggcggI  You slash the yak! You burn the yak.cgg"cggcgg.F   yakF   bullfrogcgg=3-7.2 (0.8cgg cgg2  cgg_ 9_You kill the yak!cgg_ G  You hit the yak. You burn the yak.cggSd @  The yak is lightly wounded.cggn SF.cggjo G-8.1 (0.9cggVu cggy Q _The yak closely misses you.cgg f  You hit the yak but do no damage.cggi cgg F.Y.Y 2 yaksThe yak is lightly wounded.cgg +9 (0.8cgg cgg\ ; _The yak gores you but does no damage.cggL  You slash the yak! You burn the yak.  The yak is moderately wounded.cggU.   yakcggVV9=9.7cgg:_cgg>cu _You block the bullfrog's attack. The yak completely misses you.cggʑ  You hit the yak. You burn the yak.  The yak is heavily wounded.cgg] YY 2 yaksYou block the bullfrog's attack. You block the yak's attack.cgg9.10.6 (0.9cggѸcgg]6 _You block the bullfrog's attack.cgg  You hit the yak. You burn the yak.  The yak is severely wounded.cgg6 .   yakThe bullfrog hits you but does no damage.cgg7(1.5cgg@cgg"E1 _You block the yak's attack.cgg<  You hit the yak but do no damage.The yak is severely wounded.cggCk100/103=2.3 (0.8cgg$cggm6 _You block the bullfrog's attack.cgg;  You hit the yak. You burn the yak.  The yak is almost dead.cggG tYY 2 yakscgg~H (3.1cggWS cggW R _You block the bullfrog's attack. You block the yak's attack.cgg\  You hit the yak. You burn the yak.  The yak is almost dead.cgg .   yakYou block the bullfrog's attack. You block the yak's attack.cggg &9cgg cgg 6 _You block the bullfrog's attack.cggOJ  You slice the yak!! You burn the yak.cgg*V  You kill the yak!cggM9 cggz8144.7cggcggl6 _You block the bullfrog's attack.cgg`bj  You hit the yak. You burn the yak.  The yak is lightly wounded.cgg@c(5.5cggkcggoR _You block the bullfrog's attack. You block the yak's attack.cgg  You slash the yak! You burn the yak.  The yak is heavily wounded.cgg0=6.3cggcgg6 _You block the bullfrog's attack.cggn  You hit the yak. You burn the yak.  The yak is severely wounded.cgg3p]92/103 --7.1cggkycgg}I _You block the bullfrog's attack. The yak gores you!cgg G  You hit the yak. You burn the yak.  The yak is almost dead.The bullfrog hits you but does no damage.3---9cgg6 cggy R _You block the yak's attack. You block the bullfrog's attack.cgg  You hit the yak but do no damage.The yak is almost dead.cgg G-8.8 (0.9cggE cgg \ _You block the bullfrog's attack. The yak gores you but does no damage.cgg I  You slash the yak! You burn the yak.cggb .F   bullfrog  You kill the yak!cgg059.7cgg_(cgg+6 _You block the bullfrog's attack.cgg"  You slash the bullfrog! You burn the bullfrog.  The bullfrog is heavily wounded.cgg6420.5 (0.8cgg|cgg6 _You block the bullfrog's attack.cgg _  You slash the bullfrog! You burn the bullfrog.  The bullfrog is severely wounded.cgg_-1.4 (0.9cggicgg9kv _The bullfrog barely misses you. You block the bullfrog's attack.cgg  You barely miss the bullfrog.The bullfrog is severely wounded.cgg -2.2 (0.8cgg< cgga 6 _You block the bullfrog's attack.cggg  You barely miss the bullfrog.The bullfrog is severely wounded.cggh [5=3.1 (0.9cggo cggq Y _The bullfrog completely misses you.cgg  You hit the bullfrog but do no damage.The bullfrog is severely wounded.cgg(4.0cggY cgg,$w _The bullfrog closely misses you. You block the bullfrog's attack.cgg  You closely miss the bullfrog.The bullfrog is severely wounded.cgg+8 (0.8cggBcgg6 _You block the bullfrog's attack.cgg_S  You slash the bullfrog! You burn the bullfrog.cgggE.cggue6=5.7 (0.9cgg}cgg݀L _You kill the bullfrog!cgg cgg cggcggH _No target in view!cggFcggGcggIcggNcggN$ _cgg"RcggTcggTcggUcggZcggZ%7cgg[cgg`,cggAacggccggd%8cgggecggj,cggkcggocggocgg*qcgg tcgg[tK9=cggucggx,cggzcgg`,cggncgg cgg][100/103=cgg߃cggcggȅcggdcgg>,cggg1cggncggҗl-l   frilled lizard (wandering)cgg039.7 (14.0)cggG-40.7 (15cggcggha _A frilled lizard comes into view.cggi   .#######  .......# . #.....##<##≈##....####....##†##.#.....P#..#....##.......@#†.......##........### ..........# (~.....$.† ..... cggn hP..P .. ~≈~(~.....##  cgg[   .#######  .......# #.....##<##≈##....####....##†##.#.....P#..#....##cggA .......@#†.......##........### .......(~.....$.†..... P..P ~≈~(~..cgg cgg cggv cgg e _A frilled lizard is nearby!cgg 7  cggb .#######  .......# . #.....##<##≈##....####....##†##.#.....P#..#....##.......@#†.......##........### ..........# (~.....$.† ..... P..P .. cgg L~≈~(~.....##  cgg;  cggG.#######  .......# #.....##<##≈##....####....##†##.#.....P#..#....##.......@#†.......##cggo........### .......cgg(~.....$.†..... cgg P..P ~≈~(~..cggtcggcgg cgg&%e _A frilled lizard is nearby!cggM# #~.## ###≈..#  ##≈≈≈l.#######  ###≈≈≈≈........# .. ##...##≈≈#.....##P#...<##≈##....##....l.####....##P..†##.#.....P#...#...@## ....##†.## ..###.............# ..P((~.....$.†......~ .P......~≈≈≈..........#...# #......P~≈≈≈≈P..P....## ..cgg$4..~≈≈~≈~(~.....##cgg)cgg3D.cgg4+21cgg35.0) _cgg<cgg?cgg cggcggcgg!H _No target in view!cgg8cgg9cgg6BcggFH _No target in view!cgg)cgg&cggcgg5cgg$ _cggcgg}cggacggcggcgg K3=cggOcgg1 _HP restored.cgg3cgg cgg cgg cggC cgg cgg cgg cgg< cgg cgg cgg cgg} 9=cgg cgg # cgg5. ,cggq2 cgg8 cgg/E  .P#...<##≈##....## ......l.####....## ...P..†##.#.....P# ...........#....## ...............# #.......†.......## ..........###...............###.#cggBG P((~.....@.†......~ P~≈≈≈...#.m.# ......P~≈≈≈≈P..P....## ..~≈≈~≈~(~.....##~~≈≈~.≈~.P....#~.≈~.....P.... m   water nymph (wandering)..~~.~~.....## ......[.l~~~~P.....#$.....~~......  You now have 853 gold pieces (gained 16).cggR E~9.7 (8cggS ,50.7 (9cgg#] cggb ^ _A water nymph comes into view.cgg2 P#...<##≈##....## l.####....## P..†##.#.....P# #....## .# .†.## ### ..###.#~P((~.†...~.~~ ......~≈≈≈.#.m~# P~≈≈≈≈P..P....## .. ~≈≈~~~≈≈~~.≈~.....P.... cgg3 ~~.~~.....##[.l~ cgg: cggtG ~m~~mcggKH 4==1.7 (1cggR cggV - _The water nymph shouts!cggW u#...<##≈##....## l.####....## P..†##.#.....P# #....## .# †.## ### ###.#~P((~...~m~~~ ~≈≈≈.#.~~# cggX P~≈≈≈≈P..P....## .. ~~≈≈~.~.≈~.....P.... ~~[.l~~ cgg$] cggj t~~m~~#~cggk /--2cggIv cgg } p _You see here a yak corpse.cggM...<##≈##....## l.####....## P..†##.#.....P# #....## ..# †.## ### ###~#~P((~.†@~m~~≈≈≈.~#~~~#P~≈≈≈≈P..P....## ~.#~≈≈~≈~(~.....## .~~≈≈~.≈~.P....#~.≈~.....P.... cggz ~~.~~.....##[.l~~~~P.....# cggpcggc :m~cgg  Splash!  You fall into the shallow water.  Moving in this stuff is going to be slow.cgg~=====3Water cgg&cgg.+- _You hear an angry hiss.cgg+2 .Your unstable footing causes you to fumble your attack.cgg2c=----4.5 (0.8cggQ>cggBY _The water nymph closely misses you.cggY  You slash the water nymph! You burn the water nymph!cggn l l   frilled lizardThe water nymph is heavily wounded.cgg4X=---5.4 (0.9cggcggS9 _You block the water nymph's attack.cgg cgg .l.Your unstable footing causes you to fumble your attack.cggO 0-6.3cgg cggB 9 _You block the water nymph's attack.cgg :.cggt Q--7.2cgg cgg M _Your unstable footing causes you to fumble your attack.cggR\  Your unstable footing causes you to fumble your attack.cggFgS.l.cgggH~~#~..cgg=hcggicgghj=cggj8.0 (0.8cgg{cggӈ cggcggx+_You block the water nymph's attack.cggɲ ~l   frilled lizard  You slice the water nymph!! You burn the water nymph.cggcggcgg ..l..†@......#.cggk7====8cgg/cggO _You kill the water nymph!cggK#...<##≈##....##.l.####....## .P..†##.#.....P#.#....##...#.†.##.###.###.#.~~cggR.P((~....l...~.~≈≈≈.#...##.P~≈≈≈≈P..P....## ..#.~≈≈~≈~(~.....## ..~~≈≈~.≈~.P....#.~.≈~.....P.....~~.~~.....##.[.l~~~~P.....# ..$.....~~......cggcggD.lcggL----9.8 (1.0cggcggp _You see here a yak corpse.cggA <#....##†##.#.....P##....##......#†.......##......###........###.#.~~ .....l.@.......~ ..........#...## P..P....## ..# ~(~.....## . ~.P....#....P.....~~.....##[.l~~~~P.....#$cgg "cggr n<#....##†##.#.....P##....##......#†.......##......###cggs O........###.#.~~ .....l.@.......~ ..........#...## P..P....## ..# ~(~.....## ~.P....#....P.....~~.....#[.l~~~~P.....#$cgg"z cggz ;----cggӁ cgg9 e _A frilled lizard is nearby!cggddP#...<##≈##....##.l.####....## ..P..†##.#.....P#.#....##..#.†cgg5e.##.###.###.#.~~.P((~.....l@†.~.~≈≈≈.#...##cggme!.P~≈≈≈≈P..P....## ..# .....~≈≈~≈~(~.....## .cgge.~~≈≈~.≈~.P....#.~.≈~.....P....cgge.~~.~~.....##.[.l~cgghf~~~P.....# ...$.....~~......cggVvcggw%=cgg}w 60cggcggT _The frilled lizard misses you.cgg<1cgghcgg _You closely miss the frilled lizard. You block the frilled lizard's attack.cggB_  You slash the frilled lizard! You burn the frilled lizard.cggE.cgg-2.6 (0.8cggcggкR _You kill the frilled lizard!cggX cgg;!cgg*cgg.H _No target in view!cgg+0 cgg1 cgg2 cgg7 cgg= cggB : _cggkE cgglJ cggJ cgg M cggP cggV cgg*W cgg(Y cgg^ cggc cggd cggf cggVk cggs A  You enter the shallow water.cggEt cggt 8Water cggw cggր l _Moving in this stuff is going to be slow.cgg cgg֌ n _f - 5 poisoned darts (gained 4)cggD cgg &cgg cggj cggפ cgg_ cgg cggϭ cgg, E ..P#...<##≈##....##  .....l...####....##  ....P..†##.#.....P#  ......#....##  .......#  .#.......†.......##  cgg ......###  ......###.#.~~  ........P((~@......†.......~-  .P......~≈≈≈..........#...##  #......P~≈≈≈≈P..P....## ..#5 darts (poison)  .......~≈≈~≈~~~.....## . .##.......~~≈≈~.≈~.P....##........~.≈~.....P....#l   frilled lizard (wandering)cgg w......~~.~~.....##......[..~~~~P.....#......$.....~~........#cgg .71.2 (8.6cgg .-2.2 (9cgg[ cggZ cgg 3cgg= cgg cgg  .. ##...##≈≈#.....## ..P#...<##≈##....## ....l....####....##cgg  ....P..†##.P# #....## ....# .#†cgg   ###  .......###.#.~~ .cgg4 ,.P((~.......†.......~ .P......~≈≈≈..........#...##cggo ^ #......P~≈≈≈≈P..P....## ..# .......~≈≈~≈~~~.....## .#~≈≈~.≈~cgg l   frilled lizard (wandering)#~.≈~.....P....#....~~.~~.##...[..~~~~Pcgg= (0.0cgg B.cgg +3.2 (1cgg* cgg, cggcgg+cggcggtcgge  ..P#...<##≈## .........####....## ...lP..†##.#.....P# ............#....##cgg .......# .#†# ....### .........###.#.~ cgg:LP(@~†.......cgg_ .P......~≈≈≈....#...# #cggTP~≈≈≈≈P..P....## .. .~≈≈~≈~~~.# ...##~≈≈~.≈~.P....#..#..~.≈~.....P....#cggLl   frilled lizard (wandering).....~~.~~.##[..~~~~P.....$.....~~.cggzI.......#You enter the shallow water.cgg!W 0  Moving in this stuff is going to be slow.cggr o.llcgg c4.2 (1Water cgg`cgg} _The frilled lizard hisses angrily. _You see here a poisoned dart.cgg <  .........####....##  ....P..†##.#.....P#  ....l.......#....##  ..................#  .#.......†.......##  ..................###  .................. ........P(@~.......† .P......~≈≈≈...... #......P~≈≈≈≈P..P....##  .......~≈≈~≈~~~.....## ...~~≈≈~.≈~.P....# ....~.≈~.....P....# .......~~.~~.....## ....[..~~~~P.....# $ cgg <  .........####....##  ....P..†##.#.....P#  ....l.......#....## cggD{ ..................#  .#.......†.......##  ..................###  cgg{1.................. ........P(@~.......† cgg.P......~≈≈≈...... cgg#......P~≈≈≈≈P..P....##  cgg.......~≈≈~≈~~~.....## ...~~≈≈~.≈~.P..cgg ....~.≈~.....P....# cgg2.......~~.~~...cggT....[..~~~~P...$cgg-cgg-cgg:cgg>e _A frilled lizard is nearby!cgg© <  .........####....##  ....P..†##.#.....P#  ....l.......#....##  ..................#  .#.......†.......##  ..................###  .................. ........P(@~.......† .P......~≈≈≈...... #......P~≈≈≈≈P..P....##  cgg%.......~≈≈~≈~~~.....## ...~~≈≈~.≈~.P....# ....~.≈~.....P....# .......~~.~~.....## ....[..~~~~P.....# $ cggaL <  .........####....##  ....P..†##.#.....P#  ....l.......#....##  ..................#  .#.......†.......##  ..................###  .................. ........P(@~.......† .P......~≈≈≈...... #......P~≈≈≈≈P..P....##  .......~≈≈~≈~~~.....## ...~~≈≈~.cggL≈~.P......~.≈~.....P....# .......~~.~~.......[..~~~~P...$cggZcggZcggAkcggoe _A frilled lizard is nearby!cgg-/ cgg4 L.lcggc5 Y56cgg8A cgg)F _ _f - 6 poisoned darts (gained 1)cgg ! ..P#...<##≈##....## ..####....## ....P..†##.#.....P# .....l......#....## .# .#.†.## .### ..###.#. .P@~~.† .P......~≈≈≈.#... #......P~≈≈≈≈P..P....##  .~≈≈~≈~~~.....##cgg .##.~~≈≈~.≈~.P...#.#.~.≈~.....P....#.~~.~~...##.[..~~~~P...# .$.....~~.#cggcgg`cggP.lcggz -6.8 (1.6cggt-cggz5T _You see here 3 poisoned darts.cggcggP.lcggA_709cggcgg_ _f - 9 poisoned darts (gained 3)cgg .. ##...##≈≈#.....## ..P#...<##≈##....## .........####....## ....P..†##.#.....P# cggz#....## ....# .#.......†  l###  .@....###.# ..P~~~†.. .P......~≈≈≈..........#.cggN #......P~≈≈≈≈P..P....## .......~≈≈~≈~~~cgg.## #....##~≈≈~.≈~ cgg)#.....#~.≈~.....P...cggT.#....~~.~~.##...[..~~~~Pcggxcggcgg5=9.4 (1.6cggcggcggX? _You block the frilled lizard's attack. x2cgg$b_  You slash the frilled lizard! You burn the frilled lizard.cggnE†cggNt.80.2 (0.8cggp~cgg>R _You kill the frilled lizard!cgg cgg% cgg cgg[ H _No target in view!cggZ cgg cgg cgg5 H _No target in view!cggcggcggJcggcggٓcgg: _cgg̝cggcgg0cggƥcgg(cggcggYcggcggɶcggcggMcggjcggcggFcggcggcgg)cggcggcggcggcggcggDcggcggcgg9cggvcggzcggVcggcggUcggcgg5,cggcggM _You now have 862 gold pieces (gained 9).cggcggcgg6cgg cggcggcgg}cggcggzcggcgg"cgg$cggG(cgg(cgg*cgg/cgg4cggf4cggs6cgg8cgg/;,cgg|<cgg<cggcgg!cggYcgg cgg,cggcggcggcggcggcggcgg!cgg"cggj#cgg&cgg)cgg)cgg+cgg@2cgg2cggI3cgg4cgg;cgg>cgg?cgg@cggZCcggGcgg\GcggeHcgg_Kcgg>NcggNcggOcgg:RcggUcggVcgg cggA 4  The wolf howls!cggE cggG cgg^H cggI cggV .Fhhhhhh 3 wolves (1 wandering)F   bullfrog (wandering)cggW :==9.2 (1.0)cgg ` cgge _A bullfrog comes into view. A wolf comes into view.cgg\ $ ........#  ##...#..Fhh..#### ###≈^.......# .. ##...h......# ..P#...< ..[..#......... ###............P..†#.......@# .#. ..#..#####.#... ^.....##PP.....#...... .^..†........... .^ cggg` ..........P..............#.....####P #.PP###.cgga cgga cggb cggc cggd cggd cggm }F.h.hcggsn 0--10cggv cggz - _Found a leather armour.cgg   The bullfrog croaks.  You slash the wolf! You burn the wolf.cggD l  The wolf is severely wounded.cgg cggg...FhhcggP?Fcgg6==1.0 (0.8cgg cgg$R _The wolf closely misses you.dggL  You slice the wolf!! You burn the wolf.dggmdggdggdgg .F 2  You kill the wolf!dgg389 (0.9dggdgg32 _You block the wolf's attack.dgg dgg9dgg[R.FhdggAc2--2.7 (0.8dgg$dgg _You closely miss the wolf. You block the wolf's attack. The wolf bites you.dggMy  You slash the wolf! You burn the wolf!  The wolf is almost dead.dgg\ .FThe wolf bites you but does no damage. You block the wolf's attack. x2dggF 5=3.7 (1.0dgg dgg 6 _You block the bullfrog's attack.dgg[;  You hit the wolf but do no damage.The wolf is almost dead.You block the wolf's attack. x2; You block the bullfrog's attack.dggS< c3=-4.6 (0.9dggLG dggJ _The wolf closely misses you. The wolf barely misses you.dgg  You barely miss the wolf.The wolf is almost dead.You block the wolf's attack. The bullfrog barely misses you.dggkB-5.5dggdggU _The wolf closely misses you. x2dggK  You slash the wolf! You burn the wolf.dgg\ .   wolf  You kill the wolf!dggp-6.3 (0.8dggdggA] _You block the bullfrog's attack. The wolf bites you but does no damage.dgg(  You slash the bullfrog! You burn the bullfrog.  The bullfrog is almost dead.You block the bullfrog's attack. You block the wolf's attack.dggU0=7.1dgg~dggx6 _You block the bullfrog's attack.dgg;S  You slash the bullfrog! You burn the bullfrog.dggE .  You kill the bullfrog!dggIY=9-8.0 (0.9dggSdggW dggMWY_You block the wolf's attack. The wolf misses you.dgg1 L  You slice the wolf!! You burn the wolf!dggl k†dgg@ 4==8 (0.8dggT dgg H _You kill the wolf!dgg8K dggK dggP dgg+T H _No target in view!dggdggdggpdggH _No target in view!dgg8dggdggdgg9dgg7M ..#.....: . .. ##...##### ###≈^ ##......# ..P#...< ...[..#......... ###†...........P..†dggu0#...####.#. ....#..#####.#... ^^.# ........##PP.....#.......... ..........#...dgg dgg5---9.8 (1dggydggcO _Found a book of Movement.dgg3dggdggKdggBdgg)dggtdggdggDdgg]dggHdggdggGdggdggdggYdggHdggadggdgg5dggdggdgg?dggdggdgg dgg},dggPdgg#Bdggdgg"dggF&dgg&dgg'dgg)dgg,,dgg@.dgg1dggA4,dgg5dgg88dggA` ### #.P#  ...# . #...#  ...# ##P...#  ..##.....#  ##.#...#  dggBu#...@..# ---30.8 (11.0) .:...##...##  ).. ###....##  ..###.......# #..........# dggCj....#.....:.#  ............#  #...........# # #...#.......#### ###dggIdggJ,1.8 (12dggVdggVXd _Found a book of Wicked Creation and an orcbow.dggUdgg]Vdgg)Ydgg^dggadgg5fBdgg@idggidggjdggldgg$pdggqpdggqdggwdggxdggydggydgg{dggXdggdgg҅dggՆdggۈdgg*dgggdggNdggjdggΒdgg dggdggdggdgg3dggdgg[dggdggɚdgg2dggdggE,dggdggdggDdggdggjdggdgg,dggdggŭdggadggdggNdggƲdgg,dggҶdgg<dggdggdggdgg}dggdgg dggdgg|dggt,dgg?dggdgg,dggdggdgg7,dgg<dggdggdggdggdggSdgg,dggpdggdggM,dggdggdggdgg>dggcdgg1 dggmdggdggdggdgg"dggldggFdgga!dgg%dgg@&dgg2(dgg+dgg8/dgg/dgg1dgg%4dgg8dgg8dgg]:dgg?dggGI ..##.. #......  .F....#..# ......  ....P...## ##....# ##  .......P####.....# #.  dgg*J...P............## ##  ....##.............# ##  .......#...####P   #........#.....##..  ...#@..P..#....##.#..   #..####.....#.....   #..# #...:...##..   ##.# #..)..####..   ### ##...###....   ..##....... F   bullfrog (wandering)   ##.....#....   ##.........  dggJW#........dggO-60.8 (29dggPZS.Fdgg[,1.8 (30dggddgg1h[ _A bullfrog comes into view.dggu    ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#.. #..####.... #..# #...: dgg']##.#  ###   dgg@     ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#..#..####....dggA E#..# #...:##.# ### dggJ dggJ dgg`R dgg&W _ _A bullfrog is nearby!dgg$     ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#.. #..####.... #..# #...: ##.#  dgg J###   dgg&     ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#...dgg { #........#.....##.. ...#@..P..#....##.#..#..####....#..# #...:##.# ### dgg dgg dgg dgg _ _A bullfrog is nearby!dgg][?25h[?0c dgg{]\ Search for what [Enter for "helm", or ? for help]? dgg [?25l[?1cdgg9dgg:93 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+Results elsewhere ([,] to cycle) dggA; b - [D:7] the +1 robe "Rucaif Ixti" {+Inv rF- rCorr Dex+5}  c - [D:13] the +8 Vampire's Tooth {megavamp}dgg?AdggLdggW ..##.. #......deadiverson the Carver  dggWD......#..# ......Human of the Shining One ******  F....P...## ##....# ## Health: 103/103 ========================  dggW6.........P####.....# #. Magic: 13/13 ========================  ......P............## ## AC: 21dggW4Str: 17  ....##.............# ## EV: 14Int: 11 dggX  ....#........#...####P SH: 16Dex: 15  dggX#........#.....##.. XL: 13 Next: 79% Place: Lair:2  ...#@..P..#....##.#.. Noise: ---------  Time: 17961.8 (0.0)  #..####.....#..... a) +0 scimitar (flame)  #..# #...:...##.. Throw: 9 darts (poison)  ##.# #..)..####..  dggX### ##...###....  ..##....... F   bullfrog (wandering)  dggYD##.....#....  ##.........  #........ dgg:Y_Found a book of Movement. _Found a book of Wicked Creation and an orcbow. _A bullfrog comes into view. dggQY_A bullfrog is nearby! _A bullfrog is nearby!dgghYcSearch for what [Enter for "helm", or ? for help]? artifactdggUbdggbdggjdgg0n. _dggAdggBdgg}JdggoOF _Unknown command.dgg}     ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#...dgg~ #........#.....##.. ...#@..P..#....##.#.. #..####.... #..# #...: ##.#  ###   dgg     ......#..#   F....P...##   .........P####.....# #. ......P........dggW   ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#..#..####....#..# #...:dggV ##.# ### dgg! dggJ" dgg* dgg. _ _A bullfrog is nearby!dggru     ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#.. #..####.... #..# #...: ##.#  ###   dggv dgg ^    ......#..#   F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#..#..####....#..# #...:##.# ### dggi dgg! dgg* dggS. _ _A bullfrog is nearby!dggR X    ......#..#  dgg1T  F....P...##   .........P####.....# #. ......P........  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#.. #..####.... #..# #...: ##.#  ###   dgg    ......#..#   F....P...##   .........P####.....# #. ......P........dgg  ....##........  ....#........#... #........#.....##.. ...#@..P..#....##.#..#..####..dggn..#..# #...:##.# dggT### dgg dggldggbdggdgg _ _A bullfrog is nearby!dggs  .  ...##... #......  .......#..# ......  F....P...## ##....# #  ....P####.....#  .......Pdggkt#  ......##......# #  .......#........#...####   #@.......#.....##.  .......#...P..#....##.#  ......##..####.....#..  ...... #..# #...:...##  dggu..... ##.# #..)..####  P#P.P ### ##...###  ### ..##..  #  #dggzdgg(|dggSn.dggɅ22.8 (1 _dggdgg"dggdggdggdgg@H _No target in view!dggdggdggdggƽH _No target in view!dgggV    ... dggV . ...##... #...... ...#..# ......  ..P...## ##....#  F..........P####.....#  dgg0W ..P......#  #.............# dggLW i .......@#........#...###dggqW C .....#.....##dggW  dggW (.......#...P..#....##.# dggW w.##..####.....#.. dggW .. #..# #...:...## dgg X ....... ##.# #..)..#### F   bullfrog (wandering) dgg%X #P#P.P# ### ##...###..dggvX  ###### ..##..... #..dgg;\ dggg Q.Fdggg &3dggar dggu A bullfrog is nearby! __No target in view! _Found 5 stones.dggY  .# .#.#  .k .... . .##...# #...... ..#..# ...... dgg:Z.P...## ##....#  ......P####..... F.......P.....# #...... ..#........#  ..#........#.... (.......#...P..#....## dggZ.##..####.....#.. .##..# #...:...# k   wyvern (asleep)  ........###.# #..)..### F   bullfrog (wandering) P#P.P## ### ##...### ###### ..##..dgg`dgg/cdggtlR.Fdgg:m&4dggtdggexY _A wyvern comes into view.dgg  # .#.# k .... .##...# #.#..# ......P...## ##...P#### .P.....#.##.............F.#........#...#.#........#.....#(.#...P..#....##..####.....#.....:...........###.# #..)..#####P#P.P## ### ##...###dgg dggi dgg dgg&.k.FkFdgg"/==5dgg%dgg%E _The bullfrog croaks. The wyvern hisses angrily.dgg=  .# .#.# . .... ..##...# #k.#..# ......P...## ##...P#### .Pdgg#......##.......F......#........#...#.#........#.....#(.#...P..#....##.####.....#....# #...:...........###.# #..)..###dggdgg\dggtdgg~.kF.dgg/--6dggdggdggs  You hit the wyvern. You burn the wyvern.  The wyvern is lightly wounded.dggUF.dggUV=-7.6 (0.8dggdggg4 _You block the wyvern's attack.dgg>  You hit the wyvern. You burn the wyvern.  The wyvern is moderately wounded.dgg YF. dggi dgg (8.4dgg dgg^ k _The wyvern misses you. You block the wyvern's attack.dggǬ >  You hit the wyvern. You burn the wyvern.  The wyvern is severely wounded.The bullfrog snags a nearby mosquito with its tongue.9.2dggH dggg U _You block the bullfrog's attack. You block the wyvern's attack.dggK  You hit the wyvern. You burn the wyvern.  The wyvern is almost dead.dgg^L)70.0dggRdggVUU _You block the bullfrog's attack. You block the wyvern's attack.dgg+O  You slash the wyvern! You burn the wyvern.dgg<d .F   bullfrog  You kill the wyvern!You block the bullfrog's attack.  The bullfrog releases a deep croak.dggA/808dggeKdggOV _The bullfrog closely misses you.dggdgg-1.7 (0.9dgg2dggsu _You closely miss the bullfrog. You block the bullfrog's attack.dgg`  You slash the bullfrog! You burn the bullfrog.  The bullfrog is severely wounded.dggxa 6==2.7 (1.0dggxj dggn 9 _You block the bullfrog's attack. x2dgg S  You slash the bullfrog! You burn the bullfrog.dgg o.dgg 6--3.5 (0.8dgg dgg L _You kill the bullfrog!dggO--dggdggH _No target in view! dggz dgg dgg dgg dgg dggB: _ dgg dgg  dgg  dggV dggl dggg dgg dgg dgg dgg dggj dggo dgg" dgg[& dgg& dgg' dgg1, dgg>/ dgg/ dgg0 dggx2 dgg4 dgg5 dgg5 dgg8 dgg9, dgg]; dgg= dggA dggDA dggA dggtC dggE, dggE dggG dggH, dgg/I dggK dggN, dggSP dggR dgguT, dggU dgg8X dgg*[ dggr[ dgg.\ dgg^ dgg:a dggza dggGb dggUd dggEf dggf dgglg dggi dggk dggk dgg]l dgg,n dggo dgg&p dggp dgg;r dggs dgg9t dggt dggHv dgg x dggMx dggx dgg z dgg|{ dgg{ dgg%| dgg} dggA dgg dgg dgg< dgg dgg dggW dgg݅ dggk dgg dgg4 dggމ dgg dggӋ dggf dggG dggZ dgg dgg dgg dgg dgg& dgg dgg dgg dggř dggo dggW dgg dgg dgg[ dgg dggB dgg dgg5 dgg dgg dgg dgg dggV dggx dgg¯ dggj dgg dggô dgg  dggϵ dggз dggȹ dgg dgg dgg dgg , dgg! dggO dgg, dgg dgg dgg  dggF dggE dggj dgg dgg dgg7 dgg dgg, dggR dgg  dggI, dgg dgg dgg' dggf dgg dgg dggr, dgg dgg dgg dgg dgg{ dgg dgg, dgg dgg dgg9, dgg dgg dgg dgg dgg  dggP  dgg dgg dggJ dgg dgg dggO dggP dgg dgg dgg dgg! dgg$ dgg(, dgg) dgg- dgg0, dggr2 dggB6 dgg9, dgg < dgg? dggB dggC dggD dggH dggL, dgg!N dggP dggS, dggW dgg[ dgg-_, dggIa dggc dgg...S. dggn......# .....##....## ... ..#...P.# .. ..#...#.###.....(. ..#..... ..##...#.##. .. dgg o.#..#### .. ..P...## ##....## ......P####... ...P.....## ##...# S   water moccasin (asleep) ........##.....# .........#. dgg^o}#...## ..... dggMuq 0.0)  A water moccasin comes into view. dggu;Found a stone staircase leading down. dgg}w dggp~tS..S dgg+7.5 (1 dgg6 dgg8 _The water moccasin hisses angrily. dgg? .......  #....... ..>.S..  .......  .......  ....... ...#.###.....(. #......@....... #...#.##.......  dgg#..#### .......  ##....##  ....#  ....##  ....#  ...##   dgg/ .......  #....... ..>.S..  .......  .......  ....... ...#.###.....(. #......@....... #...#.##....... #..#### .......  ##....## ....# ....##  ....# ...## dggp dgg dgg dgge _A water moccasin is nearby! dgg ? .......  dggY  #....... ..>.S..  .......  .......  ....... ...#.###.....(. #......@....... #...#.##.......  dgg 0#..#### .......  ##....##  dggƩ A ....#  ....##  ....#  dgg < ...##   dggJ / .......  #....... ..>.S..  .......  .......  ....... ...#.###.....(. #......@....... #...#.##....... #..#### .......  ##....## ....# ....##  ....# ...## dggM  dggM  dgg&T  dggnV   dggV __A water moccasin is nearby! dgg/ ## # #.#### #.#.P#.## #......#....>.S......##.$##....###. dgg #...P.# #.......#...#.###@....(........##...#.##.#..#####........P...## ##....#########..P####.....# #.#.P# P.....####......# ...#####P...# dgg  dgg\& R.S dgg& &8 dgg,  dgg/ + _Found 21 gold pieces. dgg#.##### ## #.# #.#### #.#.P#.####....#....>............##...S...$###....###.# dggO#...P.# #.@......##...#.###.....(........##...#.##.##..#####........P...## ##....######### ..P####.....# #.#.P#P......###.....# ...# dgg  dggS#w.S9 dggJ( dgg+ dggi  You hit the water moccasin. You burn the water moccasin.  The water moccasin is lightly wounded.  The water moccasin closely misses you. dggUj6=40.4 (0.9 dggo dggOrF _The water moccasin bites you but does no damage. dgg  You slash the water moccasin! You burn the water moccasin.  The water moccasin is moderately wounded. dggo(1.3 dgg dggg< _You block the water moccasin's attack. dggwI  You barely miss the water moccasin.The water moccasin is moderately wounded. dggcJ-2.1 (0.8 dggP dggS\ _The water moccasin closely misses you. dgg  You barely miss the water moccasin.The water moccasin is moderately wounded. dgg) &9 dgg  dggd < _You block the water moccasin's attack. dggs  You slash the water moccasin! You burn the water moccasin.  The water moccasin is severely wounded. dggt 0=3.7 dggz  dgg| \ _The water moccasin closely misses you. dgg=3  You barely miss the water moccasin.The water moccasin is severely wounded.-4.6 (0.9 dgg`9 dgg=F _The water moccasin bites you but does no damage. dgg>_  You slash the water moccasin! You burn the water moccasin. dggE. dggX1-5.5 dggݻ dggzR _You kill the water moccasin! dggdb dggc dgg;k dggnH _No target in view! dgg{ j.....#......... #.##### #.#.P#.####......#....># dgg" n#.......$# ##....###.# #...P.# #.##...#.###..@..(..............###...#.####..#### dggq P...## ##....#########...P####.....# #.#.P#P............## ##...# dgg g##.........#...####P dgg $...# dgg  dgg <-6.5 (1.0 _ dgg  dgg  dgg #.##### #.#.P#.####......#....># #.......$#  dgg##....###.# #...P.# #.##...#.###.....(...# .......@.....# ##...#.#### ..#####.#  dggP...## ##....#########...P####.....# #.#.P# dggP............## ##...###........ dggK........#...####P...##..#.....##.....# dgg dgg3@-7 dgg dgg) dgg[ ## #. # #. dgg[ I#### #.#.P#.####.....#....>............##.$# ##....###.# #...P.# #........##  dgg[ #...#.###....@(...# ........  dgg[ m##...#.##.# dgg\ #..#####........P...## ##....######## dgg5\ #..P####.....# #.#.P#P.# dgg\ ##.....# ...#####P...# dggf  dgg:g &8 dggk  dggn  dgg q[?25h[?0c  Search for what [Enter for "artifact", or ? for help]?  dgg [?25l[?1c dggj  dgg X9 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  dgg U a - [carried] F - 6 atropa-tipped darts  b - [carried] S - 9 curare-tipped darts  c - [carried] b - 3 throwing nets  d - [carried] f - 9 poisoned darts (quivered) Results elsewhere ([,] to cycle)  e - [Lair:2] 4 javelinsf - [Lair:2] 5 stones (111 further duplicates in 24 piles)  g - [D:10] 4 darts of dispersal  h - [D:12] 3 boomerangs (6 further duplicates in 2 piles)  i - [D:14] a poisoned dart (5 further duplicates)dgg;oLevel 12 of the Dungeon <<<<>>>>>^∩∩_∩(Press ? for help) ##...##   ##### #######.....##   #...# #...##.......##   #.ß.# #)ß.###..#....###  dgg  #...## ##)).# ##### ##..........####   ##)#'###)######## ###...# #.##......###..###   #.##...## #..####.....####................#   #.##)>.# #...#.......##.................##   #)##)..## ##..........###.....>...........#   ##.#'###'####....[..........................#   #..)## ##...#)..............................##  #.ß.# #.ß.).............................#..###  dgg@#...# #...#)............................#....#  ##.##########.###..........#............#(.....#  #..........#..####........................##..##  dgg ########.......##..................##......#...#  #.......##.......>..................#..####  #......................................##.#  ##.....................!.<..........##....#####  ##...................[................##..##.ß!##  #.........<..........................###..#Vc.$.#  ##................#...................#...+Q$$.ß# ###  dgg3###..............#..................##...+WoI$∩###.#dggN deadiverson the CarverHuman of the Shining One ******Health: 103/103 ========================Magic: 13/13 ========================AC: 21Str: 17EV: 14Int: 11SH: 16Dex: 15XL: 13 Next: 81% Place: Lair:2Time:The water moccasin is severely wounded. _The water moccasin bites you but does no damage.  You slash the water moccasin! You burn the water moccasin. _You kill the water moccasin! _No target in view!  Search for what [Enter for "artifact", or ? for help]? throwdgg dgg Q _dgg BdggP dgg dgg dgg/ dgg dgg dgg dgg dgg dggg$ dgg' dgg' dggp) dgg/ dgg5 ,dgg9 dggC> dggaB dggB dggD dggZI dggK dggGL dggfM dggS dggU dggVV dggW dgg\ dgg1_ ,dggs` dggFe dgg h ,dggi dggPn dggq ,dggs dggy dgg| dggo| dgg} dgg dggm dgg dggS dgg dgg dgg dgg dgg՘ dgg ,dgg dgg- dgg dggԥ dgg dggC dgg2 ,dgg dgg dgg dgg dgg dgg3 dgg= dgg dggS dggR dgg dggi dgg[ dgg dgg dgg dgg dggc dgg ,dgg? dgg dgg ,dgg, dgg dggW dgg dgg dgg dgg[ dgg dgg dggH dggL dgg dgg! dggn& dgg* dggI* dgg+ dgg. dggK2 dgg2 dgg3 dgg7 dgg: dgg: dggO< dgg> dggA dgg6B dggC dggF dgg K ,dggL dggZO X  There is a stone staircase leading up here.dggP dggS dggeT % _dggU dgg1dggdgg/dggdggAdgg _You climb upwards.  There is a stone staircase leading down, spattered with blood here.dggdgg\ _dggdgga&  dggThings that are here:  a frilled lizard skeleton; a frilled lizard skeleton; an iguana skeletondggodggб _dggdggdgg,dgg[dggdgg,dggdggdgg#dggdggBdgg-Bdggdggdggdggl  You see here a water moccasin skeleton.dggdgg _dggdgg  There is a staircase back to the Dungeon here.  Things that are here:  an amulet of reflection; a ring of icedgg&dggdgg% _dggdgg&Dungeon:9dggdggUdggdggdgg _You climb upwards. Welcome back to the Dungeon!  There is a staircase to the Lair here.dggdggc _dggdggdgg6,dggdggdggdggdggEdgge dgg dgg dgg dggdggBdgg8dgg :dgg>,dgg?dggiCdgg.F,dggHdggKdggHNdggNdggPdggSdggV,dggXdgg>[dgg],dggl_dggbdgg`e,dgg}gdggjdggm,dggodggsdggxBdgg}dgg,dgggdggɇdggt,dggDdgg-dgg,dggdgg!dgg,dggVdggdgg{dggΟdggrdggdgg,dggdgg!Z  There is a stone staircase leading down here.dggƬdgg}dggv% _dggdggtb10dggMcdggddgge,dgg{l _You climb downwards.  There is a stone staircase leading up here.dgg }dgg} _dgg~dggIdgg,dgg˨dgg_dgg,dggЬdggk@  There is an open door here.dggdggr _dggdggdgg,dggdggdgg,dggdggdgg,dggKdggdggd,dggdggdgg,dggdgg@  There is an open door here.dggdgg _dggdggdgg,dggJdgg/dgg,dggdggdgg,dggdgg dgg,dggdggdgg7  There is an open door here. _dgg:,dgg,?,dggA,dggBdgg-GdggJ,dgg[LdggUPdgg;S,dggTdggFWdggZdggUZdggL[dggE^dgg`dgg%adgg bdggedgghdggThdgg1jdggldggsBdggtdggw,dggxydggE|dggMdggdggdggփdgg,dggdggdgg2,dgg9dggdgg$,dgg"  There is a stone staircase leading down here. _dgg1dggdggdggdggdggl _You climb downwards.  There is a stone staircase leading up here.dggdgg _dggdggdgg ,dggbdggdgg,dggdggdgg,dggkdggdgg,dggdgg#dgg,dggdggvdgg',dggdgg Z  There is a stone staircase leading down here.dgg dggzdgg% _dggdggPXI 2  You climb downwards.dggYdggfBdgg4s  Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHuThere is a stone staircase leading up here.dggydggy _dgg|dggdggBdggdggLdggdggӕdggzdggס,dggwdgg dggu,dggDzdgg4dgg%,dggdgg?dggdggdggdggxdgg',dgg dgg  Items here: ))) [[[ ÷÷÷.dggdgg _dggdggd   #.ß.# #)ß.##...## ##)).###### #dgg ,##)#'###)######## ###...# ##.##...## #..####.....#####.##[>.# #...#.......##..#)##)..## ##..........###..##.#'###'####....[...........dggD #..)## ##...#)...............#.ß.# #.ß.@................ Noise: --------- 18180.0 (131.5)dggv #...# #...#[............... a) +0 scimitar (flame)dgg c##.##########.###..........#. Throw: 9 darts (poison)#..........#..####..........dgg D########.......##...........#.......##.......>... #.................... ##.................... ##...................[.dgg] } There is an open door, spattered with blood here.dgg dgggdggro _Items here: ( )))) [[ ÷.dgg dgg DPick up what? 45/52 slots (_ for help) Hand Weapons (select all with ))a - a +0 dagger  b - a +0 dagger  c - a +0 whip  d - a +0 whip dgg eMissiles (select all with ()e - 3 boomerangs Armour (select all with [)f - a +0 leather armour  g - a +0 robe Carrion an orc skeleton dgg [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]dgg  e + 3 boomerangs[Enter] accept (1 chosen)dgg dgg dgg!)  #.ß.# #)ß.#deadiverson the Carver#...## ##)).###### # Human of the Shining One ******##)#'###)######## ###...# # Health: 103/103 ========================#.##...## #..####.....#### Magic: 13/13 ========================#.##[>.# #...#.......##.. AC: 21Str: 17dgg) #)##)..## ##..........###.. EV: 14Int: 11##.#'###'####....[........... SH: 16Dex: 15#..)## ##...#)............... XL: 13 Next: 81% Place: Dungeon:12#.ß.# #.ß.@................ Noise: ---------  Time: 18180.0 (0.0)#...# #...#[............... a) +0 scimitar (flame)dgg) I##.##########.###..........#. Throw: 9 darts (poison)#..........#..####..........########.......##...........#.......##.......>... dgg* |#.................... ##.................... ##...................[. Level annotation: 3 runed translucent doors, exclusion: obsidian statue, Ravn's_ghost, legendary CoHu _There is a stone staircase leading up here. _Items here: ))) [[[ ÷÷÷.  There is an open door, spattered with blood here. _Items here: ( )))) [[ ÷.dgg8 dgg# +1.0 (1dgg, dgg+ & _p - 3 boomerangsdgg dggj dgg dgg ,dgg dgg dgg dgg dggM dgg dgg dgg; dgg dgg @  There is an open door here.dgg dgg  _dgg dgg dgg dggi dgg8 dgg dggY% ,dggB) dgg7 X  Items here: ))) ÷.dggt? dgg@  _dggC dggP @  There is an open door here.dggU dgg=V  _dggY dgg@n ]  p - 6 boomerangs (gained 3)dggr dgg i   #...# #...#  #.ß.# #[ß.#   #...## ##)).#   ##)#'###)########   #.##...## #..####  #.##[>.# #...  #)##)..## ##  ##.#'###'####....[  #..@## ##...#)90.0)  #.ß.# #.ß.) dgg  #...# #...#[.....  ##.##########.###  #..........#..####  ######### ### #  ##. _Items here: )))))))) [[[[[ ÷÷÷÷÷÷.dgg0 dggf ^ _Partly explored, can't reach some items.dgg] 3dgg_ dggO ..'###'...0.0)dggy dgg dgg> ^ _Partly explored, can't reach some items.dggudgg1dggdgg:4dggHt _Partly explored, can't reach some items.dgg@dggAdggEdggdggdggdgge dggX_Partly explored, can't reach some items.dgg [?25h[?0c dggs ] Search for what [Enter for "throw", or ? for help]? dggFa [?25l[?1cdgg dgg 10 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] F - 6 atropa-tipped darts  b - [carried] S - 9 curare-tipped darts  c - [carried] b - 3 throwing nets  d - [carried] f - 9 poisoned darts (quivered)  e - [carried] p - 6 boomerangs Results elsewhere ([,] to cycle) dgg}  f - [D:12] 3 stones (113 further duplicates in 24 piles)g - [D:10] 4 darts of dispersal  h - [D:14] a poisoned dart (5 further duplicates)  i - [Lair:2] 4 javelins  j - [D:5] 3 boomerangsdgg Level 5 of the Dungeon <<<>>>>(Press ? for help) #.# #.#.##.##.....###.#.......................# #.# #.#.##.#####.....................<#.#.#.#.# #.# #.#.##.######.###.....##..#.........#.#÷#.# #.# #.#.##.................#....####.#....#.#.# ### #############.#######.##.##.####.######.#)###################  #.#######.........#............(................#  #.......#..#.##...#########.#.###############.### dgg  ###### ##### ######.##..#.#..#.........).).................#  ##..#.## ###..)# #.##..#.#.##...#######.###########.#######  #......####.)...# #########.##..#.#.##.........#....# #...# #.......#..##...# #.............#.#....#.......#.##.# #.#.# #.#.#..#.######## #########.##.##....###.......[.##.######.#.##..########.........##.####...####.......##....[)..#.###.#############.# #.⌠.# ##.......###########.##.#####...(.......####...###....................##....###.########.#.........#.#.....###############...#dgg Y#.####.⌠..>..⌠...#.....##...##.##.........#######.#######...##.#####...#### #......##...##.##.⌠.# ########......# ########## ###.##.##...###......#......# #....#...# ###.##.####..........#......#####.##.#.#.#dgg'  #.).##.#####.......'>).............#.#.# dgg$dggdggndeadiverson the CarverHuman of the Shining One ******Health: 103/103 ========================Magic: 13/13 ========================AC: 21Str: 17EV: 14Int: 11SH: 16Dex: 15XL: 13 Next: 81% Place: Dungeon:12Time: _Items here: )))))))) [[[[[ ÷÷÷÷÷÷. _Partly explored, can't reach some items. _Partly explored, can't reach some items. _Partly explored, can't reach some items. _Partly explored, can't reach some items.  Search for what [Enter for "throw", or ? for help]? dggdgg'dggdggdggdgg % _dgg dggjdggdggzdggdgg"dgg',dgg)dgg.dggZ2dgg2dggl4dggb9dgg<dgg~<dgg>dggBdggGdggGdgggIdgg&Qdgg4YBdgg ^dggbdggAcdggpjdgg{odggtdggxtdgg`wdgg{dggr,dggdggdggdgg8dggdggFdgg,dgg&dggadggdggSdggܡdggdggdgg<dggdggydgg[  There is a stone staircase leading up here. _dggdgg+nR1dggo,dgg}l _You climb upwards.  There is a stone staircase leading down here.dggdggN _dgg1dggdgg],dgghdgg dggH,dggSdgg"dgg4dggjdgg{dggdggdgg6dggdgg#dgg'dggedggddggdggעdgg6dggFdgg X  There is a stone staircase leading up here.dggdggdgg% _dggdgg\m<0dgg s,dggftdggl _You climb upwards.  There is a stone staircase leading down here.dggodgg  _dggdggpdgg,dgg>dggάdgg],dggdggUdgg,dggKdgg~dggQ,dggdggdggI,dggdggdgg^,dgg"dggdgg,dggdgg\dgg,dggdggdgg@,dggndggdgg ,dgg( dgg dgg,dggdggZdgg,dgg)dggdgg ,dgg dgg$dgg='dggXdgghZdgg~^dggbdggbdggcdgghYou climb upwards. _There is a stone staircase leading down here.up _You climb upwards. _There is a stone staircase leading down here.  n open doordggkdggl _dggmdggqdggt,dgg4udggwdggg{dgg{dgg|dggdggdgg dgg dggdgg|,dggәdgg$dgg̠dgg(dggdgg<@  There is an open door here.dggdgg _dggdggpdgg,dggdggdgg,dgg_dggdggk,dggdggdgg,dggXdggdgg dggP: There is an open door here.dggdgg _dggdgg)dggBdggFdggdggBdggdggw,dggdggodgg,dgg[dggn  There is a stone staircase leading up here.dggp; _dggdggh!9dgg0jdggl,dgg!odgg@l _You climb upwards.  There is a stone staircase leading down here.dggdgg| _dggVdggdgge,dgg=dggbdgg,dggJdggdggdggdggdggdggD,dgg*dgg`dgg ,dggdggdgg,dggbdggdggf,dggdggdgg8dggtdgg dggdggL,dggdggdgg,dggdggdgg,dggdgg dgg# ,dgg dggx dggY ,dgg dgg, dgg ,dgg dggE dgg ,dgg= dgg1 dgg! dggF" dgg# dgg' dgg* ,dgg, dgg/ dggz2 dgg2 dgg6 dgg: dgg> ,dgg@ dggD dggM ndggoN dggO dggHR dggT ,dggV dggY n  There is a stone staircase leading up, spattered with blood here.dgg [ dgg_ dggf` % _dggc dgg6 8dgg$ dggp dgg' dggp dgg l _You climb upwards.  There is a stone staircase leading down here.dgg 6 _dgg dggS dggn dgg dgg, dgg X  There is a stone staircase leading up here.dgg` dgg dggA % _dgg͛ dgg3 h7dgg, dgg l _You climb upwards.  There is a stone staircase leading down here.dgg dgg= _dgg dgg dggq ,dggo dgg dgg ,dgg! dgg dggP ,dgg^ dgg dgg ,dgg' dgg dggN ,dggG dgg dgg  dggk dgg dggG dgg ,dgg dgg~ dggT dgg dgg dgg] dgg1 ,dgg dgg dgg dggH dgg dgg\ dgg$ ,dgg$ dggH' dggW* ,dggr+ dgg. X  There is a stone staircase leading up here.dgg#/ dggUZ Q _dggMY <6dgg Z ,dgg[ dgghi There is a stone staircase leading up here. _You climb upwards.down here. _There is a stone staircase leading up here. _You climb upwards.  down here.dggl dggTm _dggt Xdggv dggx dgg0| ,dgg-} dgg dggc dgg dgg dgg^ dgg ,dgg dgg dgg ,dgg dgg dggǙ dgg0 dggݛ dggk dgg ,dgg_ dggz dggΧ ,dggE dgg dgg$ dgg dgg dgg dgg ,dggz dggq dgg dgg dgg dgg dgg~ ,dgg_ dgg% dgg ,dgg dggH You climb upwards. _There is a stone staircase leading down here.up _You climb upwards. _There is a stone staircase leading down here.  updgg dgg dggl % _dgg dggi5dggedgg3 ,dgg dgg*There is a stone staircase leading up here. _You climb upwards.down here. _There is a stone staircase leading up here. _You climb upwards.  down here.dggL _dggdggd",dgg($dgg (dgg'2dgg2dgg4dgg9dggB=,dggdggYdgg,dgg dggodggR,dggsdggdgg,dggdgge@dggldown here. _There is a stone staircase leading up here. _You climb upwards.down here.  p - 9 boomerangs (gained 3)  Things that are here:.#....####.#....#.#.# ##.##.####.######.#)############# ........#............(........... .#.##...#########.#.############# .#.#..#.........).).............. .#.#.##...#######.###########.### .#.#.##.........#....# #...# .#.#....#.......#.##.# #.#.# ##....###.......@.##.######.#.#Noise: --------- 18332.5 (141.5) ####...####.......##....[)..#.#a) +0 scimitar (flame) # #.⌠.# ##.......###########.#Throw: 9 darts (poison) ####...###..................dggm..# #.........#.#.....############# #.⌠..>..⌠...#.....# #.........#######.###### ####...#### #......##.⌠.# ########......# ######  _a +0 leather armour; a +0 war axe; an orc skeletondggm) .#....####.#....#.#.# .##.##.####.######.#).#.....(.#.##...#.#. ..#.#..#...).).#.#.##...#######.####. ..#.#.##.#....# #...# ..#.#....#.#.##.# #.#.# .##....###[.##.######.#.# .####...####.......##....[)..#.# .# #.⌠.# ##.......##.# .####...###...........# .#.#.#.....#### ##.⌠..>..⌠...#.....#  #dgg* .#######.######  ####...#### #......# #.⌠.# #......# dgg8 dgg 13.5 (1.0)dggQ dgg dgg#....####.#....#.#.# ##.##.####.######.#)##.....(. .#.##...#.#.# .#.#..#...).). .#.#.##...#######.####.# .#.#.##.#....# #...# #.#....#.#.##.# #.#.# ##....###.dgg.##.######.#.# ####...####.##....[)..#.# # #.⌠.# ##.##.# ####...###.. #.#.#.....###.⌠..>..⌠...#.....# #.#######.###### dgg) ####...#### #......# #.⌠.# #......# #dggdgg&4dgg;*  Things that are here: _a +0 leather armour; a +0 war axe; an orc skeletondgg3.n[?25h[?0c  Search for what [Enter for "throw", or ? for help]? dgg̜ [?25l[?1cdggYdgg<9 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [carried] F - 6 atropa-tipped darts  b - [carried] S - 9 curare-tipped darts  c - [carried] b - 3 throwing nets  d - [carried] f - 9 poisoned darts (quivered) dggy e - [carried] p - 9 boomerangs Results elsewhere ([,] to cycle)  f - [D:5] 7 stones (109 further duplicates in 24 piles)g - [D:10] 4 darts of dispersal  h - [Lair:2] 4 javelins  i - [D:14] a poisoned dart (5 further duplicates)"dgg[Level 2 of the Lair of Beasts <<<>>>^(Press ? for help) ###  ##.####  #.###.#####    #.........## #.........  #..........# #............   ##.........##### #............  #.........#.P#.####........... "dgg{ #...............#....>......#   #................##.......$#  #.........##....###........# ##........#...P.# #........###........#...#.###.....(...##.........#................##........##...#.##........###.........#..#####........##........P...## ##....##########............P####.....# #.#.P##.........P............## ##...##........##.............# ##...# "dggw ##.........#........#...####P...##.. ##.........#........#.....##.....# #.~## #.#.(.......#...P..#....##.#...### ~~≈~~ ###........##..####.....#......# ~≈≈##"dggb "dggi deadiverson the CarverHuman of the Shining One ******Health: 103/103 ========================Magic: 13/13 ========================AC: 21Str: 17"dggIj EV: 14Int: 11SH: 16Dex: 15XL: 13 Next: 81% Place: Dungeon:5Time:p - 9 boomerangs (gained 3)  Things that are here: _a +0 leather armour; a +0 war axe; an orc skeletonThings that are here: "dggj _a +0 leather armour; a +0 war axe; an orc skeletonSearch for what [Enter for "throw", or ? for help]? "dggGl "dggl "dgg&n "dggM} "dgg "dggx ; _"dgg1 "dgg{ "dggȋ "dgg "dgg‘ "dgg B"dggҙ "dggۛ "dgg% "dgg( "dgg "dgg "dggܣ "dggɥ "dgg "dgg "dgg "dgg "dgg "dgg& "dggs "dgg "dgg "dgg ,"dgg "dgg "dgg6 "dgg} "dgg "dgg "dgg3 "dgg "dgg "dgg "dggs "dgg "dgg "dgg Z  There is a stone staircase leading down here."dgg "dgg "dgg+ % _"dgg "dgg 6"dgg "dgg "dggn "dgg "dgg l _You climb downwards.  There is a stone staircase leading up here."dgg] "dgg _"dggv "dgg_ "dgg "dgg# "dgg "dgg "dgg "dgg "dggR "dgg "dgg "dggd "dgg "dgg@ "dgg ,"dggj "dgg  "dggW ,"dgg "dgg- "dgg ,"dggn "dgg "dgg: "dggz "dgg "dggh "dgg( "dgga "dgg "dgg< "dgg "dgg "dgg "dgg "dgg  ,"dgg "dggg "dgg ,"dggy "dgg "dggQ! ,"dgg)" "dgg# "dgg% ,"dggz& "dgg( Z  There is a stone staircase leading down here."dgg) "dggl+ "dgg+ % _"dgg, "dgg l7"dggl"dggsq"dggq"dggs"dgg<l _You climb downwards.  There is a stone staircase leading up here."dgg"dgg֍ _"dggu"dgg"dggm,"dgg;"dgg:"dggћ,"dgg"dgg0"dgg,"dggq"dgg4"dgg=X"dggȭ,"dgg"dgg"dgg ,"dgg]"dgg"dgg,"dgg"dgg"dgg,"dgg"dggk"dgg,"dgg"dgg8"dgga,"dgg"dggt"dgg0,"dggY"dgg"dgg,"dgg"dggYou climb downwards. _There is a stone staircase leading up here.down here. _You climb downwards. _There is a stone staircase leading up here.  do"dggDwn here."dgg6 "dgg' "dgg % _"dgg #dgg18#dgg#dggD,#dgg#dgg>There is a stone staircase leading down here. _You climb downwards.up _There is a stone staircase leading down here. _You climb downwards.  up#dgg#dggE _#dgg#dgg#dgg#dggN#dgg#dgg9You climb downwards. _There is a stone staircase leading up here.down here. _You climb downwards. _There is a stone st#dgg9aircase leading up here.  down here.#dgg#dgg#dggS% _#dgg#dgg9#dgg#dgg,#dgg#dggThere is a stone staircase leading down here. _You climb downwards.up _There is a stone staircase leading down here. _You climb downwards.  up, spattered with blood here.#dggJ6 _#dgg#dgg#dgg,#dgg7#dgg!#dgg#,#dgg&#dgg4#dgg7#dgg88#dgg9#dgg%=#dgg?#dggQ@#dgg}E#dgg=F#dggI,#dggL#dggO#dggR,#dggPS#dggV#dggX#dggY#dggY#dgg\#dgg _,#dggf`#dgg c#dgge,#dggf#dggDi#dgg]k#dggk#dggl#dggo#dggfq#dggq#dggr#dgg!u#dgg=w#dggvw#dggnx#dggz#dggJ},#dggR~#dgg#dgg#dgg‚#dgg+#dgg,#dgg#dggݍ#dggc#dgg͑,#dgg{#dgg3#dggB#dgg'#dgg~B#dggB#dgg#dggƟ#dggt,#dgg#dggǣ#dgg'#dgg]#dgg#dgg| #dggM There is a staircase to the Lair here.#dggC#dgg #dgg% _#dggQ#dggDLair:1#dgg#dgg<,#dgg!=There is a stone staircase leading up, spattered with blood here.aircase to the Lair _You climb downwards. Welcome back to the Lair of Beasts!  There is a staircase back to the Dungeon here.  Things that are here:  an amulet of reflection; a ring of ice#dgg#dggZ _#dggj#dggl  You see here a water moccasin skeleton.#dgg#dgg _#dgg#dgg[#dgg,#dgg#dgg#dgg',#dgg#dgg#dgg#dggk#dgg{#dgg&#dgg,#dggH#dgg#dggd#dgg(#dgg#dgg#dgg#dggm#dgg+#dgg#dgg #dgg #dgg #dgg  Things that are here:  a frilled lizard skeleton; a frilled lizard skeleton; an iguana skeleton#dgg#dggb _#dgg#dgg}p  There is a stone staircase leading down, spattered with blood here.#dgg#dgg #dggJ% _#dgg#dgg12#dgg#dggj#dgg#dgg#dgg$l _You climb downwards.  There is a stone staircase leading up here.#dgg^(#dgg) _#dgg*#dggO1#dggB4#dgg4#dgg5#dgg;#dggH?,#dgg4@#dggPC#dggZE#dggE#dggxG#dggJ#dggN#dggO#dggcP#dggS#dggV#dgg7W#dggX#dgg#_#dgga,#dggc#dggg#dgg......# .........##.......$# ..##....###........# ..#...P.# #........## ..#...#.###.....@...#Noise: --------- #dggd18453.5 (119.0) ...#................#a) +0 scimitar (flame) ..##...#.##........##Throw: 9 darts (poison) ...#..#####........# ..P...## ##....######### ......P####.....# #.#.P# ...P............## ##...# ..##.............# ##...# #dggbdK...#........#...####P...##dggUe#dggl#dggVpN _You see here 4 javelins.#dgg#dgg14.0)#dgg!#dgg?$ _U - 4 javelins$dgg$dgg$dggx$dggN _There are no items here.$dgg$dggb  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1  $dgg     l - Evocations   0.0   1.0   0   d - Short Blades   8.7   1.0   0      e + Long Blades 13.7  16.5   0               f - Armour   8.0   9.0   0       g - Dodging  12.0  15.0   0       h - Shields  10.0  12.0   0       i - Stealth [39$dggq;49m  0.0   0.8  +1                                          $dgg%    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets%dgg%dgg%dgg..###.........deadiverson the Carver ...##............Human of the Shining One ****** ...##### #............Health: 103/103 ======================== ..#.P#.####...........Magic: 13/13 ======================== ........#....>......#AC: 21Str: 17 .........##.......$#EV: 14Int: 11 ..##....###........#SH: 16Dex: 15 ..#...P.# #........##XL: 13 Next: 81% Place: Lair:2 ..#...#.###.....@...#Noise: ---------  Time: 18454.5 (0.0) ...#................#a) +0 scimitar (flame) ..##...#.##........##Throw: 9 darts (poison) ...#..#####[0;10%dgg;1m........# ..P...## ##....######### ......P####.....# #.#.P# ...P............## ##...# ..##.............# ##...# ...#........#...####P...# _There is a stone staircase leading down, spattered with blood here. _You climb downwards. _There is a stone staircase leading up here. _You see here 4 javelins. _U - 4 javelins _There are no items here.%dgg%dggJ%dgg@ I%dggD %dggH %dggL : _%dggxN %dggQ %dggkR %dggS %dgg5V %dggY %dggY %dgg[ %dgg` %dgg4a %dgg>b %dgg4f N _You now have 883 gold pieces (gained 21).%dggh %dggi %dggi %dgg\l %dggio %dggo %dggp %dggs %dggv %dggv %dggw %dgg+z %dgg%} %dgg} %dgg~ %dgg %dgg %dgg~ %dggF %dggЊ %dggu  ## ##  %dgg ####.########.# .  #.........##..####..  #..........< ## #...........%dggN ####...........@......h#....>......##.........##........##..#......%dgg ###........###.####P.. P.# #........###.# .. %dgg #.###.........##.. . h   black bear (asleep)...........##..#.##........###.. #####...#%dgg_ { 63.5 (9  A black bear comes into view.%dggm ,4.5 (10.0)%dggb %dgg 9 _Found a stone staircase leading up.%dggd  ## ##  ####.########.# .  #.........##..####..  #..................<  #................... .......@......h >......##........ ....##..#...... ....###.####P..  ..###.# .. ....##.. . #..#..%dggU-%dgg 6 ## ##  ####.########.# .  #.........##..####..  #..................<  #................... .......@......h %dgg>......##........ ....##..#...... ....###.####P.. ..###.# ......##.. . #..#..%dgg%dggc%dgg%dgg@ %dgg3a _A black bear is nearby!&dgg ## ##  ####.########.# .  #.........##..####..  #..................<  #................... .......@......h >......##........ ....##..#...... ....###.####P..  ..###.# .. &dgg#a....##.. . #..#..&dggl ## ##  ####.########.# .  #.........##..####..  #..................<  #................... &dggmM.......@......h >......##........ ....##..#...... ....###.####P.. ..###.# ......##.. . #..#..&dgg{v&dggGw&dggq~&dgga _A black bear is nearby!&dgg ((((((h  You throw a poisoned dart. The poisoned dart hits the black bear.&dgg) &dgg; .....h(==5.7 (1.2)8&dggaB &dggsF 4 _The black bear growls angrily.&dgg ((((((poisoned)  You throw a poisoned dart. The poisoned dart hits the black bear.&dggZ &dggX &dgg֧ w...h.(&dggz f--6.8 (1.17&dgg &dgg 1 _The black bear is poisoned.'dgg{<((('dgg'dgg ..h(--7.96'dgg'dggW _You throw a poisoned dart. The poisoned dart hits the black bear.'dggw* ((very poisoned)  You throw a poisoned dart. The poisoned dart hits the black bear.  The black bear looks even sicker.'dggt'dggb.h.'dggkX9.05'dgg9'dgg8 _The black bear is lightly wounded.'dgg^ (You throw a poisoned dart. The poisoned dart hits the black bear.'dggV_'dggjUh('dggkY70.14'dggt'dggw8 _The black bear is lightly wounded.'dgg  You slice the black bear!! You burn the black bear.  The black bear is almost dead.'dggE†'dgg=2===9 (0.8'dgg3'dggVN _You kill the black bear!'dgg 'dgg 'dgg 'dgg H _No target in view!'dggG3'dggh'dgg 'dgg'dgg: _'dgg()  You see here a black bear corpse. _'dggj,,'dgg-'dgg0n _f - 5 poisoned darts (gained 1)'dgg3'dgg3'dggG5'dgg8'dgg:,'dgg7<'dgg@,'dgg4B'dgggGn _f - 6 poisoned darts (gained 1)'dggJ'dggK'dgg-N'dggN'dggQ'dgg R'dgg S'dggZB'dgg_]n _f - 7 poisoned darts (gained 1)'dgg`'dgga'dggcb'dggh'dgg i'dggj'dggnn _f - 8 poisoned darts (gained 1)'dggq3'dggs'dggw'dggdz'dgg{,'dgg~'dgg'dgg'dgg'dgg`'dggي'dggA'dggB'dgg'dgg,'dgg,'dggb'dgg'dgg'dgg'dggj'dggo,'dgg)'dgg$'dgg'dggY'dgg'dgg'dgg@,'dgg'dgg'dggM'dgg'dgg5'dgg'dggR,'dggl'dgg)'dgg,'dggc'dgg'dgg,'dgg:'dggC'dggL'dgg'dgg,'dgg'dgg,'dgg,'dgg{,'dgg'dggf  You see here a black bear corpse.'dgg'dggz _'dgg'dgg'dgg'dgg'dgg'dgg'dgg'dgg'dggi'dgg'dgg'dgg,'dgg'dgg,'dgg7'dgg'dggWX'dgg,'dgg'dgg+'dgg7,'dggG'dgg* 'dggv 'dgg ,'dgg 'dggn'dgg2,'dgg'dgg'dgg6'dggt'dggX'dgg,'dgg'dggL'dgg'dgg% 'dgg"'dgg$'dgg:','dgg''dgg5*'dgg,,'dgg-'dgg1'dgg:3'dgg3'dgg3'dgg5'dgg7'dggv7'dgg7'dgg:'dgg8<'dgg<'dggq='dgg?'dggB,(dgg(dgg7(dgg(dgg,(dggs (dgg (dgg (dgg (dgg(dggu(dgg(dgg(dgg-(dgg0(dgg(dggw(dgg(dgg,(dgg(dgg!(dgg$,(dggT%(dgg')(dggN,,(dgg-(dgg/(dgg1,(dggE2(dgg4(dgg6(dgg7(dgg7(dggM9(dggA########.# ##.######. ....##..####...........# .............<.~~~~~.>.. ...............~#≈≈~.... .......†.......~≈# ~..## ....##.........~≈#≈~...# ...##..#.......~≈#≈~...# (dggGBm...###.####P...~~~≈~..##..###.## #.....@......P---526.9 (56.0)..##..####.....##............8.###................ ...# ##.#.##..........####################### # #.#.P# ## ##...# .# ##...#(dggK(dgg#LH---7.9 (57(dgg!Q(dgg3T; _Found a stone staircase leading down.(dgg(dgg(dgg (dgg(dgg(dggB(dggK,(dggd(dgg٪(dgg,(dgg(dgg(dggp,(dgg(dgg(dgg,(dgg׻(dggϽ(dggE,(dggx(dgg(dgg,(dggv(dgg(dgg(dggf(dgg?(dgg(dgg,(dgg(dgg(dgg(dggU(dgg(dggH(dgg(,(dgg(dggx(dgg,(dgg(dgg(dgg,(dgg(dgg(dgg #######.##........#### ~~~~~.>.....####### .~#≈≈~......#.#..#.###.F~≈#≈~..##..............~≈#≈~...#............!.~≈#≈~...#.......~~~≈~..##.............P..#P.##....##(dgg.............#....P............#. ................#.......F   skyshark (asleep) .............P.##....#..############## #####.. (dgg-40.9 (13(dggUq.FF(dgg,1.9 (14(dgg(dgg [ _A skyshark comes into view.(dggJ #####>.....####### . ...#.#..#.###.. #............F. #............!. #......@....... #.............. .P..#P.##....##. .............#....P.. ......#........ .......#....... ....P.##....#.. ####### #####.. (dggK(dggo####>.....####### . ...#.#..#.###.. #............F. #............!. #......@....... #.............. .P..#P.##....##. .............#....P........#...............#....... (dggh....P.##....#..####### #####.. (dggi(dgg#(dgg(dgg_ _A skyshark is nearby!(dgg.0 #####>.....####### . ...#.#..#.###.. #............F. #............!. #......@....... #.............. .P..#P.##....##. .............#....P.. ......#........ .......#....... ....P.##....#.. ####### #####.. (dgg ####>.....####### . ...#.#..#.###.. #............F. #............!. #......@....... #.............. .P..#P.##....##. .............#....P..(dggN......#...............#....... ....P.##....#..####### #####.. (dgg(dgg_(dgg^u _A skyshark is nearby!(dggh (((((((You throw a poisoned dart.(dggV (dggf (dgg. Y......F(dggK a3.0 (1.1)7(dggV (dgg c _The poisoned dart barely misses the skyshark.(dggA" ((((poisoned)You throw a poisoned dart. The poisoned dart hits the skyshark.(dgg{(dggI(dggr.(.F(dggBX4.16(dgg(dggN/ _The skyshark is poisoned.)dggq (very poisoned)You throw a poisoned dart. The poisoned dart hits the skyshark.  The skyshark looks even sicker.)dgg)dggCF()dggX5.25)dgg)dgg 6 _The skyshark is lightly wounded.)dggQd  You throw a poisoned dart. The poisoned dart hits the skyshark.)dggАv  The skyshark looks even sicker.  The skyshark bites you but does no damage.)dgg(`=6.34)dgg̛)dgg9 _You block the skyshark's attack. x2)dgg strong, very poisoned)You barely miss the skyshark. The skyshark bites you.  The skyshark tastes blood and grows stronger!)dggb98/103 --7.2 (0.9)dggB)dgg9 _You block the skyshark's attack. x2)dgg {  You slash the skyshark! You burn the skyshark.  The skyshark is lightly wounded.)dggN (8.1)dgg )dgg1 9 _You block the skyshark's attack. x3)dgg h  You slash the skyshark! You burn the skyshark.  The skyshark is moderately wounded.)dgg.....####### .# ~#≈≈~......#.#..#.###.(# ~≈#≈~..##. ~≈#≈~...#.(.!. ~≈#≈~...#.(. ~~~≈~..##.............P..#P.##....##. ,dgg...............#....P.............#...........#...P.##....#############.,dgg",dgg $p74=-8.9 (1.0,dgg+,dgg9  f - 5 poisoned darts (gained 1)-9.9 (25,dgg0>,dggBU _You see here a skyshark corpse.,dgg,dgg,dgg,dggA,dgg;5,dgg,dgg-,dgg2X,dggy;6,dgg ,dgg4,,dgg,dgg,dgg%7,dggH,dgg,dgg ,dgg;,dggW,,dggY,dgg,dgg K8=,dgg,dggg,,dgg3 ,dgg ,,dgg ,dgg,dggU9=,dgg,dgg,,dgg_,dgg,dgg0&80,dgg,dgg,,dgg,dgg,,dgg,dgg'%1,dggq',,dggi(,dgg:*,dgg*K2=,dgg+,dgg/,,dgg0,dgg2,,dgg3,dgg6,dggT7U3=,dgg99,dgg;,dgg[<,dgg>,dggA,dgg_B%4,dggC,dggmG,dggG,dggI,dggN,dggO,dggP,dggMT;5,dggU,dgg[Y,dggY,dgg\,dgg`,,dgg b,dggg,dgggK6=,dgg[i,dggm,,dggo,dgg+u,dgguU7=,dgg9x,dgg|,,dgg~,dgg,,dgg,dgg5,dgg%8,dggk,dgg,,dgg,dgg,dgg[,dgg,dggo;9,dgg ,dgg,,dgg,dgg^,dggs<90,dgg,dgg\,,dggg,dggD,,dgg$,dgg޺,dggD1=,dggs,dgg{,,dggy,dgg,,dgg',dgg ,dggdU2=,dgg,dgg ,,dgg,dgg,dgg,dgg,dgg,dgg%3,dgg,dggr,,dgg=,dgg,dgg%4,dgg{,dgg,,dggJ,dgg,dggq,dgg,dgg,dggK5=,dgg,dggU,,dgg,dgg,,dgg,dgg~,dggU6=,dgg,dgg(,,dgg,dgg,dggL%7,dggA,dgg9,,dggg,dgg,,dgg,dgg,dgg%8,dgg9,dgg,,dgg ,dgg ,,dgg_,dgg,dgg!K9=,dgg?,dgg,,dgg,dgg,dgg5[100/103=,dgg,dgg",dggI#,dgg$,dgg]),,dgg*,dgg/,dgg0%1,dgg1,dgg6,dgg6,dgg8,dgge?,,dgg@,dggD,dggE%2,dggF,dgg_L,,dggN,dgg\Q,,dggS,dgg\_ _You start resting.,dgga1635.9 (76.0),dggbZ3=6.9 (77,dgg8i,dggl" _HP restored.,dgg ,dgg~ ,dgg ,dgg ,dggM ,dgg ,,dgg ,,dgg ,dgg/ n _f - 6 poisoned darts (gained 1),dggA ,dgg ,dgg* ,dgg2 ,dgg ,dgg 9=,dgg  ,dgg  ,dgg ,dggQ ,dgg n _f - 7 poisoned darts (gained 1),dgg" ,dggU# ,dgg% ,dgg}' ,dgg\* ,dgg* ,dgg+ ,dgg1 ,dggH2 ,dgg2 ,dgg]6 K _E - 2 potions of brilliance (gained 1),dgg8 3,dgg9 ,dgg; ,dgg= ,,dggx> ,dggrB ,dggoC ,dggC ,dggH n _f - 8 poisoned darts (gained 1),dgg&K ,dggK ,dgg.L ,dggN ,dggnQ ,,dgg~R ,dggNU ,dggvV ,,dggV ,dggX ,dggB[ ,,dgg\ ,dggb ,dggrf ,dggf ,dggk ,,dggxn ,dggn ,dggp ,dgg1s ,dggv ,dgg^v ,dggVw ,dgg{ ,dgg~ ,dgg~ ,dgg ,dgg ,dggH ,dgg ,dgg& ,dggI ,dgg ,,dgg| ,dgg ,dggX ,dgg` ,,dggy ,dgg ,dggݒ ,dgg" ,dgg ,dgg ,dgg ,dgg ,dgg ,dgg ,,dgg? ,dgg ,dgg ,,dgg ,dgg ,dgg2 P.##....##....##.# ...#....P........# ..#..............#,dgg l #.............#  P.##....#........#  #########........#   .#   .#   ,dggЩ #.^#  62.9 (26 #   ........#  8 ........#   .........   ........#    ........#    ......>.#     ,dgg ,dgg ,3.9 (27,dgg ,dgg 9 _Found an escape hatch in the floor.,dgg,dgg,dgg|,dgg,dgg,dggwB,dgg,,dggP,dgg,dgg\,,dggO,,dgg,,dgg8,dgg,dgg ,dgg,dgg,dgg,dgg,dgg,dgg,dgg,dggm,,dgg,dggT,dgg ,,dggc,dgg,,dggK,dggEM _You now have 891 gold pieces (gained 8).,dgg,dgg,dgg ,dgg#,dgg&,dggG',dgg (,dgg*,dgg-,,dgg.,dgg1,dggc3,,dgg@4,dgg?6,dgg8,dggF9,dgg9,dggi=-dgg|≈~≈≈≈ #........#  #~≈# #......>.#  #≈.# #........#  #~.## #........# ##≈..# #........# -dgg ≈≈≈..####### #........P# ≈≈≈........####.........# ##≈≈#.....###............# ##≈##....## #...@......... 77.9 (14 .####....## ##....#....... ##.#.....P# ####........ ....#....## ...##.# ..........# ..#~# -dgg..÷.......## .#~#~~ ..........### .##~... ............###.#.~~~~>. P~~~.......†.......~-dgg$ -dgg'-dgg(,8.9 (15-dgg-dgg6 _Found a staircase to the Shoals.-dgg-dgg-dgg+-dgg9-dgg,-dgg,-dgg,-dgg-dgg-dgg-dggk-dggS-dggp-dgg,-dgg-dgg-dgg,-dggU-dgg-dgg!,-dgg-dgg -dgg< -dgg -dggL -dgg-dgg -dgg-dgg|-dgg-dgg,-dgg-dgg-dgg%X-dggL&-dgg&-dgg)'-dgg(-dggw+,-dgg,-dgg)/-dggB1,-dgg1-dgg4-dgg7,-dggb8-dggY:-dgg/=-dgg=-dgg:>-dgg:@-dggUC-dggC-dggED-dggF-dggH-dggI-dggI-dggM-dggxP,-dggDQ-dggRS-dggU,-dggV-dggX-dgg6\,-dgg]-dgg:_-dggsa-dggb-dggb-dgge-dggh,-dgg*j-dggl-dggo-dggOp-dgg)q-dggs-dggu-dgg-dgg-dgg-dgg-dggP-dgg-dggt-dggv,-dgg-dggbN _You now have 907 gold pieces (gained 16).-dgg-dgg-dgg'-dggK-dggB-dggK-dgg:-dgg-dggo-dgg-dggհB-dgg{-dggش-dgg`-dgg-dggY-dgg3-dgg-dgg\-dgg -dgg-dggP-dgg-dgg-dggM-dgg-dggq-dgg-dgg,-dgg[-dgg7-dgg-dgg_-dggG-dggR-dggH,-dgg-dgg-dgg-dgg-dgg-dggG-dgg,-dgg-dgg-dgg^,-dgg-dgg"-dgg-dgg-dgg<-dgg-dgg -dgg-dggL-dgg-dgg,-dgg-dgg-dggj,-dggh-dgg-dgg-dgg) -dgg -dgg -dgg,-dgg-dggC-dgg,-dgg-dgg@-dgg,-dgg-dgg-dggj,-dgg-dgg -dgg",-dgg1#-dgg$-dgg',-dgg|(-dgg,-dgg.,-dgg.-dgg0-dgg2-dggT3-dggS4-dgg"8-dgg<B-dggAX-dggDB-dgg9E-dggH-dggKB-dgg~L-dggM,-dggM-dggN-dgg*P,-dggP-dggQ-dgg1R,-dggR-dgg?S-dggT,-dggT-dggU-dggj]~.....P....# ###.#...#.##.P#  ~~.~~.....## #############  ~~~~P.....##  .~~........#  ........#..#  ..........## .....#.#...########  ....####..........#  ....# ###.#####@##  .<.## ### #.#  ...# #.#  #### #.#  #..#  #..#   l   komodo dragon (asleep) ##.#  [-dgg]39;49m #l.    -dggf.742.9 (64-dggHg,3.9 (65-dgg9m-dggq` _A komodo dragon comes into view.-dggdy..#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.#  #.# #..# #..# ##.#  #l.  -dgg<..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# -dgg1~..# ..# #.#  #l. -dgg-dgg-dggl%-dgg)d _A komodo dragon is nearby!-dggqG..#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.#  #.# #..# #..# ##.#  #l.  -dgg..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# ..# ..# #.#  #l. -dgg-dgg-dgg-dggd _A komodo dragon is nearby!-dgg* ..#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.#  #.# #..# #..# #-dgg, y#.#  #l.  -dgg$ ..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# ..# -dgg ,..# #.#  #l. -dgg -dgg -dgg{ -dgg d _A komodo dragon is nearby!-dggɴ ...#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.# -dgg #.# #..# #..# ##.#  #l.  -dggO..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# ..# ..# #.#  #l. -dggU-dggV-dgg\-dgg`d _A komodo dragon is nearby!-dgg..#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.#  #.# #..# #..# ##.#  -dggv]#l.  .dgg@`..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# ..# ..# .dgg(a#.#  #l. .dggg.dggh.dgggl.dggod _A komodo dragon is nearby!5dggoM..#  .##  .##..#..#.##..######## .........#  #@## .<.## ### #.#  #.#  #.# #..# #..# ##.# 5dggNb #l.  5dgg..#  .##  .##..#..#.##..######## .........#  #@## <.## ### #.#  #.#  #.# ..# ..# 5dgg2#.#  #l. 5dggE5dgg5dggC5dggW _is nearby!5dggi(((((lpoison5dgged)(  You throw a poisoned dart.  The poisoned dart hits the komodo dragon.  The komodo dragon is poisoned.6dggH6dgg?R.....l(6dggeSa5.0 (1.1)76dggC[6dgg5_7 _The komodo dragon hisses angrily.6dgg'd ((((((You throw a poisoned dart.6dgg6dggr....l.6dggX6.166dggv6dggh _The poisoned dart barely misses the komodo dragon.6dgg ((((((You throw a poisoned dart.6dgg\6dgger...l..6dggfX7.256dggm6dggSqh _The poisoned dart barely misses the komodo dragon.6dgg{C(((very poisoned)You throw a poisoned dart. _The poisoned dart barely misses the komodo dragon.  The poisoned dart hits the komodo dragon.6dggv6dggl..l(6dggX8.346dggf6dgg: _The komodo dragon looks even sicker.6dgg ((You throw a poisoned dart.  The poisoned dart hits the komodo dragon.6dgg+ 6dgg- 6dggH5 el.(6dggV6 B9.436dgg6 6dggC 6dggF ; _The komodo dragon is lightly wounded.6dgg=  You slash the komodo dragon! You burn the komodo dragon.6dggc> 7==50.3 (0.96dggE 6dggH h _The komodo dragon is moderately wounded.6dgg  You barely miss the komodo dragon.The komodo dragon is moderately wounded.-6dgg  1.26dgg6dggd; _You block the komodo dragon's attack.7dgg&  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is severely wounded.7dggH(5=2.0 (0.87dgg.7dgg42; _You block the komodo dragon's attack.7dgg  You slash the komodo dragon! You burn the komodo dragon..7dggq.787dggђ7dggՕQ _You kill the komodo dragon!7dgg7dggp7dgg7dgg H _No target in view!7dgg7dggo7dgg7dgg7dgg7dggVP _7dgg,7dgg+7dgg7dgg7dgg7dgg7dgg7dgg7dggP7dggn _f - 4 poisoned darts (gained 1)7dgg7dgg7dggC7dgg,7dgg7dggn _f - 5 poisoned darts (gained 1)7dgg7dggI7dgg7dgg7dgg ,7dggS 7dgg 7dgg 7dgg67dgg7dgg&7dgg1,7dgg$n _f - 8 poisoned darts (gained 3)7dgg'7dgg.(7dgg(7dgg17dgg47dgg4,7dgg<7dggY>7dgg>7dgg/?7dgg3F7dggH7dggI,7dggYN7dggO7dggzP7dggP7dggW7dggsY7dggY,7dgg`7dggb7dgg d,7dgg\j7dggl7dggGm7dggm7dgg..##..................#..# .#P....###....................## #.<....##...............#.#...###....##...............####.....##.....##..............# ###.## .####...##...........<.## ### ##.#..[#P.............# # #............@..##### --# #...........#...P# ###.....F..........# 8 ..##...............#####...............# ...........gg; +40m........# F   skyshark (wandering)#.#.............#.# ##.#...........#####  ##.###..#.##..#7dgg> 088.8 (36.0)7dggI F.F7dggJ G--9.8 (377dggwS 7dggW [ _A skyshark comes into view.7dgg>  >..##.............. #....................## <....##...............#.#....................#..............# #...........<.## ### [#P.............#  .......@..#####  .F....#...P# 7dggy ...........# ..........## ..........# ..........# ........#.# .....#####  7dggj m >..##.............. #....................## <....##...............#.#....................#..............# 7dggl z#...........<.## ### [#P.............#  .......@..#####  .F....#...P# ...........# ..........##..........#..........# ........#.#.....#####  7dggv 7dggw 7dgg 7dgg _ _A skyshark is nearby!7dggs  >..##.............. #....................## <....##...............#.#....................#..............# #...........<.## ### [#P.............#  7dggJ o.......@..#####  .F....#...P# ...........# ..........## ..........# ..........# ........#.# .....#####  8dgg >..##.............. #....................## <....##...............#.#....................#..............# #...........<.## ### [#P.............#  .......@..#####  .F....#...P# ...........# ..........##..........#..........# ........#.#.....#####  gg{1;76H8dgg8dggG _ _A skyshark is nearby!8dgg*wH((((((((8dgg8dgg38dgg qF...(.....8dgg b90.9 (1.1)78dgg@8dgg1U _You throw a poisoned dart. The poisoned dart hits the skyshark.8dgg ((((poisoned)You throw a poisoned dart. The poisoned dart hits the skyshark.8dgg?u8dggO(F..8dgg:X2.068dgg8dggX/ _The skyshark is poisoned.8dggW 6((8dgg 8dggG 8dgg T(.F8dgg B3.158dgg 8dggǨ 8dgg7 U _You throw a poisoned dart. The poisoned dart hits the skyshark.8dgg d  You throw a poisoned dart. The poisoned dart hits the skyshark.8dgg<  The skyshark is lightly wounded.  You block the skyshark's attack. The skyshark barely misses you.8dggK `=4.248dgg( 8dggH, 6 _You block the skyshark's attack.9dggk >..##.............. #....................## <....##...............#.#....................#..............# #...........<.## ### 9dggl[#P.............#  ...((.F@..#####  .(....#...P# ...........# ..........## ..........# ..........# ........#.# .....#####  9dggo >..##.............. #....................## <....##...............#.#....................#..............# #...........<.## ### [#P.............# 9dgg{T ...((.F@..#####  .(....#...P# ...........# ..........##..........#..........# ........#.#.....#####  9dgg9dgg9dgg9dggc_ _A skyshark is nearby!9dggGs block the skyshark's attack. _A skyshark is nearby!  You slash the skyshark! You burn the skyshark.  The skyshark is moderately wounded.   The skyshark tail-slaps you but does no damage.9dggL5=5.0 (0.89dgg 9dgg"6 _You block the skyshark's attack.9dgg  You hit the skyshark but do no damage.The skyshark is moderately wounded.-9dggd 9 (0.99dgg 9dgg { _You block the skyshark's attack. x2; The skyshark closely misses you.9dgg9+  You slash the skyshark! You burn the skyshark.  The skyshark is heavily wounded.The skyshark bites you but does no damage.9dgg2, 5=6.7 (0.89dggw6 9dggi9 9 _You block the skyshark's attack. x29dggb  You barely miss the skyshark.9dgg0-7.59dgg9dggO` _The skyshark is heavily wounded.:dgg(  You hit the skyshark. You burn the skyshark.  The skyshark is severely wounded.The skyshark looks more healthy. The skyshark misses you.-8.3:dgg.:dgg19 _You block the skyshark's attack. x2:dggs  You hit the skyshark but do no damage.The skyshark is severely wounded.9.1:dgg+v9 _You block the skyshark's attack. x3:dgg(> _You block the skyshark's attack. x3  You slash! You burn the skyshark.  The skyshark is almost dead.  You block the skyshark's attack.  The skyshark tail-slaps you but does no damage.:dgg/==9:dgg:dggV _The skyshark closely misses you.:dggK S  You slash the skyshark! You burn the skyshark.:dggV E.:dggY 90--800.7 _The skyshark closely misses you.  You slash the skyshark! You burn the skyshark. _You kill the skyshark!raining target 14.0 for Long Blades reached!  Your Long Blades skill increases to level 14!need to enable at least one skill for training.:dggc /  --more--;dgg#;dggM  Skill  Level Cost  Apt Skill  Level Cost  Apt  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1      ;dgg!     b - Unarmed Combat   0.0   1.0   0       c - Throwing   0.0   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   9.0   1.0   0       e - Long Blades  14.0  18.0   0               f - Armour   8.0   9.0  ggٗT;49m 0       g - Dodging  12.0  15.0   0       h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1                  ;dggl                            You need to enable at least one skill.[?] Help[=] set a skill target  ;dgg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets=dgg= c + Throwing 0.0=dgg TargetTarget--  --  --  --  --  --  --  --  =dgg c--  --  --  7.0  a-z] set[-] clear selected targetcost|targets>dggaL<[?25h[?0c0 ?dgg%E" ?dggfV [?25l[?1c?dggLWQ10.0   0  The current training targets, if any.  Skills enhanced by cross-training are in green.=] set aall targets?dgg"a-z] setselected target@dggk<[?25h[?0c0 Adggq" Adgg [?25l[?1cAdggJo15.0 =] set aall targetsBdgg Bdggf Bdgg" .....................~~........# deadiverson the Carver .....>..##..................#..# Human of the Shining One ****** .#P....###....................## Health: 103/103 ======================== .#.<....##...............#.#...## Magic: 13/13 ======================== ..#....##...............####..... AC: 21Str: 17 .##.....##..............# ###.## EV: 14Int: 11 .####...##...........<.## ### SH: 16Dex: 15 .##.#..[#P.............#XL: 13 Next: 90% Place: Lair:2 .# #........dggm jm((..@..#####Noise: =--------  Time: 18800.7 (0.8) .# #......(....#...P#a) +0 scimitar (flame) .###................#Throw: 4 darts (poison) ..##...............## ####...............# ...................# ##.#.............#.# ##.#...........#######.###..#.##..# _The skyshark closely misses you.You slash the skyshark! You burn the skyshark. _You kill the skyshark!Training target 14.0 for Long Blades reached!  Your Long Blades skill increases to level 14!You need to enable at least one skill for training.Bdggf Bdgg Bdgg] . _CdggCdggkCdgg&CdggCdgg2Cdgg: _CdggCdggCdggCdggCdggTCdggCdggCdgg2CdggCdgg\CdggCdggXn _f - 5 poisoned darts (gained 1)CdggCdggCdgg2Cdgg,CdggCdggVn _f - 6 poisoned darts (gained 1)Cdgg3CdggCdggCdgg,CdggXCdggH ,Cdgg=Cdgg#n _f - 7 poisoned darts (gained 1)CdggbCdggCdggyCdggXCdgg!Cdggc"Cdgg%CdggF'CdggK*,Cdgg+Cdgg.Cdggo5BCdggS7Cdgg9CdggW:Cdgg;Cdgg=Cdgg@,CdggBCdgghDCdggIBCdggUCdgg"XCdggXCdggYCdgg _Cdgg~_Cdgg`CdggaCdggkeCdgg\hCdgghCdggiCdggmCdgg]pCdggpCdggNqCdgg+sCdggtCdggVuCdgguCdggxCdggzCdgg){Cdgg{Cdgg}CdggCdgg/CdggCdggCdggCdggCdggCdggCdggCdgg CdggCdggCdggK,Cdgg CdgggCdgg&CdggCdggCdgg5CdggCdggՓCdgg/Cdgg]CdggCdggۖCdgg%CdggqCdggCdggCdggԛCdggCdgg,Cdgg CdggSCdggCdggCdgg-CdggCdgg2,CdggCdggCdggʬ,Cdgg:CdggҲCdgg,CdggVCdggCdggCdggPCdggCdggCdggCdggnCdggлCdggۼCdgg,Cdgg(CdggXCdggCdggCdggiCdggCdggV,CdggCdgg Cdggb,CdggCdggCdggCdggCdggCdggCdgg,Cdgg)CdggpCdgg,CdggcCdgg.Cdgg###.# #..)..####....## #P.P## ### ##...###...l...# ##### ..##..#  ##.....#.....:.#  ##.....#  Cdgg?k#.....#  ##...#.......###### #.^.............##. #@.............##.- ####...........[..#.. # ###### #P.#........÷........7 ######..#.###...........####.#... ...^.^....##.........#..#####.#..Cdggn^.^^.###...........##PP..... l   basilisk (wandering) .^..^^..^.# #.................... ..^..^....# #.................... ^^......^.# #....................CdggJ044.7 (44.0)CdggS.lCdggF-5.7 (45CdgghCdgg7[ _A basilisk comes into view.Cdgg Cdgg C  Skill  Level Cost  Apt Skill  Level Cost  Apt Cdgg  a - Fighting  10.0  12.0   0   j - Spellcasting   0.0   1.2  -1      Cdgg0      b - Unarmed Combat   0.0   1.0   0      c + ThrowingCdgg 0.7   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   9.0   1.0   0  Cdgg      e - Long Blades  14.0  18.0   0      Cdgg]          f - Armour   8.0   9.0   0       g - Dodging  12.0  15.0   0  Cdgg      h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1                  Cdgg 3                        Cdgg a    The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] HelpCdgg^ [=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  Cdgg [!] training|cost|targetsDdgg]+  c * Throwing   0.7DdggpK o c - Throwing   0.7Ddggȶ= a + Fighting 10.0EdggjEdggEdgg4.....###.# #..)..####....##deadiverson the Carver #P.P## ### ##...###.......#Human of the Shining One ****** #####..##.....l....#Health: 103/103 ========================##.....#.....:.#Magic: 13/13 ========================##............#AC: 21Str: 17#...........#EV: 14Int: 11##...#.......###### SH: 16Dex: 15Edggc #.^.............##. XL: 13 Next: 90% Place: Lair:2#@.............##. Noise: ---------  Time: 18845.7 (0.0)####...........[..#.. a) +0 scimitar (flame) # ###### #P.#........÷........ Throw: 7 darts (poison) ######..#.###...........####.#... ...^.^....##.........#..#####.#.. .....^.^^.###...........##PP..... l   basilisk (wandering) .^..^^..^.# #.................... ..^..^....# #.................... ^^......Edgg %[40m^.# #....................Your Long Blades skill increases to level 14! _You need to enable at least one skill for training. _f - 5 poisoned darts (gained 1) _f - 6 poisoned darts (gained 1) _f - 7 poisoned darts (gained 1) _A basilisk comes into view.EdggEdggEdggEdggEdggn##..# #...:...##...## ....###.# #..)..####....## P.P## ### ##...###.......# ####..##.....l....# ##.....#.....:.# ##..Edgg&....# ...........# ##...#########.^##. ##....# ####....[..#  ###### #P.#.÷...... #####..#.###.....####.#..^.^....##...#..#####.# ....^.^^.###..##PP.....# ^..^^..^.# #.. .^..^....# #...Edgg(EdggTz.llEdgg+6.7 (1Edgg$EdggEdgg% ##..####.....#......# ##..# #...:...##...## Edgg ...###.# #..)..####....## .P## ### ##...#### ####..##..........# ##.....#.l...:.# ##............# .....# ##..@#.......#########.^##..# ##...##..P ####...[..#  ###### #P.#÷...... ####..#.#..####.#.. .^.^....##...#..#####.#.... ...^.^^.###.##PP.....# ..^^..^.#dgg >m #.Edgg Edgg R.lEdgg &7Edgg! Edgg$ Edggq` ...P..#....##.#...#####..####.....#......# ##..# #...:...##...## .###.# #..)..####....## P## ### ##...#### ###..##..........# ##.....#.....:.# ##.....l# #...@.......# ##...######### #.^...##..## ##......##..P# ####...........[..#  ###### #P.#........÷..Edggca .... ###..#.#.....####.#.. ^.^....##.........#..#####.#.....^^.###.##PP.....#Edggm Edggm .=8Edgg3x Edgg{ @ _The basilisk bites you but does no damage.Edggf  You slice the basilisk!! You burn the basilisk!  The basilisk is severely wounded.Edgg< 6==9.5 (0.8Edggl Edgg Y _The basilisk completely misses you.FdggS  You slash the basilisk! You burn the basilisk.Fdggo.Fdgg91-50.3FdggFdggeL _You kill the basilisk!FdggFdgg8-Fdgg+FdggH _No target in view!FdggSFdgg2UFdggVFdgg]Fdgg`FdggPe: _Fdgg uFdggwFdggHxFdggyFdgg}FdggFdggiFdggvFdggFdggFdggFdggFFdgg;  There is a shaft here.FdggFdgg2 _FdggMFdggdFdggBFdggFdgg FdggFdgg5FdggFdggݫ,FdggFdggiFdgg,FdggFdgg5FdggFdggFdggFdggFdggFdggFdggYFdggFdgg[FdggFdggFdggFdgg ,FdggFdggaFdggFdgg$FdggFdggFdggFdggFdggFdggFdgg@FdggFdggpFdgg FdggFdggFdggDFdggFdggq,FdggFdggFdggFdggFdggFdggJFdgg,FdggSFdggXFdggp,FdggYFdggFdgg Fdgg Fdgg Fdgg FdggcFdggFdggFFdggFdgg,FdggFdgg FdggFdggaFdggFdgg Fdgg#FdggFdggrFdgg+!Fdgg#Fdgg#Fdgg$Fdgg'Fdgg(Fdgg)Fdgg*Fdgg,FdggV/Fdgg/Fdgg0Fdgg3Fdgg5FdggO6FdggX7Fdgg9Fdgg;Fdgg<Fdgg+=FdggDXFdggEFdggHFdggHFdggIFdgg_MFdggPFdgg-QFdggLRFdggTFdggVFdgg>WFdggXFdgg[Fdgg{]Fdgg]Fdgg!_FdggHaFdggc,FdggdFdgg5gFdgghFdggViFdggjFdggPlFdgg6nFdggnFdgguoFdggkqFdggsFdggsFdgg_tFdggFdggFdggqFdgg_FdggFdggFdggmFdgg'FdggKFdggFdggFdggةFdgg5FdggxFdggFdggFdggFdgg,FdggQFdggFdggpFdggGFdggFdggFdgg,FdggFdggjFdggVFdggFdggFdggFdggFdgg4Fdgg FdggFdggFdggFdggFdggn Fdgg,FdggFdggFdgg,FdggFdgg#FdggZ&Fdgg&Fdgg'Fdgg/Fdgg1Fdgg2,Fdggj:Fdgg<Fdgg4=Fdgg=FdggDFdggFFdgg GFdggGFdggNFdgg$QFdggQFdggVRFdggXFdggu[Fdgg[Fdgg\Fdgg cFdgg\eFdggeFdggfFdggZmFdggoFdgg*pFdggpFdgg[wFdggyFdgg>{Fdgg{FdggFdggȄFdggWFdgg.FdggFdggu,FdggFdggFdggFdggRFdggtFdgg%FdggFdggFdgg<FdggթFdgglFdggŬFdggFdggFdggFdggjFdggyFdggCFdggFdggFdggaFdggFdggFdgg Fdgg2FdggFdgg,FdggFdggFdggFdggFdggFdggiFdggTFdggFdggFdggFdggQ,Fdgg@FdggeFdgg,FdggFdgg<Fdgg? ,Fdgg~ Fdgg #.......######## ###≈≈≈≈..................##..###...##≈≈#................##..P#...<##≈##....#........[..#..........####....# Fdgg !.......÷...........P..÷##.#.....P .......####.#....#....# ....#..#####.#................... .......##PP.....#÷.......# ................÷..........--925.3 (75.0) Fdgg ].......................... .................P~~~...... ................PFdgg$ ~≈≈≈...... ......#.....####......P~≈≈≈≈P..P FdggQ .P###.##....###.......~≈≈~≈~~~ P## #.##....##.......~~≈≈~.≈~.P ..###.##.....#........~.≈~.....P Fdgg~ N#.............~~.~~.Fdgg6 9--Fdggm Fdgg T _Key pressed, stopping explore.Fdggl; FdggD< Fdgg> Fdgg #≈.# #.......Fdgg$ R #~.## #....... ###≈..# #....... ##≈≈≈..####### # ###### ###≈≈≈≈........####. .Fdggg ##..###...##≈≈#@....### .##..P#...<##≈##....## # .#Fdgg ...####....## ##....#P..÷##.#.....P# #### #..............#....## ##...## .#.............Fdgg S# #...#~# l   frilled lizard (wandering) ....#.......÷.## ##.#~#~Fdggo ........÷...### ##..##~. ........###.#.~~~~Fdgg -38.3 (13Fdgg ~A frilled lizard comes into view.Fdgg ,9.3 (14Fdgg Fdgg ; _The frilled lizard moves out of view.Fdgg0 Fdgg% Fdgg Fdggx Fdgg Fdgg ,Fdgg BFdgg Fdgg Fdgg ,Fdgg Fdgg Fdgg! Fdgg9" Fdgg" Fdgg % Fdgg& Fdgg>' Fdgg' Fdggl* Fdgg4 Q .#  # .# .... #.^ .# #..# # #.... .# #.~##S # ##Fdgg5  ~~≈~~ # ~≈≈## # # ###~≈≈# # #≈~≈≈≈# # #@≈# # #≈.# # #~.## #. .# ###≈..# # .# ##≈≈≈..####### #....FdggR6 ####### ###≈≈≈≈........####.... S   electric eel (asleep)#..###...##≈≈#.....###......##..P#...<##≈##....## #...... .[..#..........####....## ##....#You enter the shallow water.Fdgg: c 44.3 (5.0)  Moving in this stuff is going to be slow.FdggB g~SSFdggC c5.3 (6Water Fdgg J FdggN ` _An electric eel comes into view.Fdgg  .... #.^ #..# #  #.~##~  ~~≈~S  ~≈≈## # ###~≈≈#  #≈~≈≈≈#  #@≈#  #≈.# Fdgg #~.##  ###≈..#  ##≈≈≈..#  ...#≈≈#..<##≈##....## .[ GdggeQ .... #.^ #..# #  #.~##~  ~~≈~S  ~≈≈##  ###~≈≈#  #≈~≈≈≈#  #@≈#  #≈.#  #~.##  ###≈..#  ##≈≈≈..#  ...#≈≈#..<##≈##....## [ GdggZGdgg[GdgghbGdgg6fd _An electric eel is nearby!Gdgg .... #.^ #..# #  #.~##~  ~~≈~S  ~≈≈## # ###~≈≈#  #≈~≈≈≈#  #@≈#  #≈.#  #~.##  ###≈..#  ##≈≈≈..#  Gdgg\Z...#≈≈#..<##≈##....## .[ Gdgg̀ .... #.^ #..# #  #.~##~  ~~≈~S Gdggށ ~≈≈##  ###~≈≈#  #≈~≈≈≈#  #@≈#  #≈.#  #~.##  ###≈..#  ##≈≈≈..#  ...#≈≈#..<##≈##....## [ GdggيGdggGdggGdggݕd _An electric eel is nearby!Gdgg3 ((((poisoned)  You throw a poisoned dart.  The poisoned dart hits the electric eel.  The electric eel is poisoned.Gdgg- Gdgg v(S≈≈Gdgg ^6.3 (16Gdggo Gdgg ( _You hear a splash.Gdgg M(( _You hear a splash.  You throw a poisoned dart.  The poisoned dart hits the electric eel.  The electric eel is lightly wounded.Gdgg! GdggM+ s≈S≈≈Gdgg@, Y75GdggQ4 Gdgg98 ( _You hear a splash.Hdggi- (((((((You throw a poisoned dart.Hdgg .~≈≈S≈The poisoned dart barely misses the electric eel.Hdgg\ *****Hdggf**The electric eel shoots out a bolt of lightning at you!HdggA]≈@≈~≈≈≈Hdgg^j===8.4 (1.14HdgghHdggzlJ _The bolt of electricity hits you but does no damage.HdggMV P# # ..# ll #. ..# ..(.  #.^.# #..# ### # ..# #.~##~~ # ###Hdgg8W ~~≈~(~ # ~≈≈## # ###S≈≈# ###≈@≈≈≈# # ..##.#~≈## # ..#...#≈.# # :.##..##~.## # ..######≈..# # .HdggW .# ##≈≈≈..####### #ll 2 komodo dragons (asleep)######## ###≈≈≈≈........####S   electric eel (poisoned).##..###...##≈≈#.....### .....##..P#...<##≈##....## #.....Hdgg!n O llllHdggn  2 komodo dragons come into view.The komodo dragon hisses angrily. x2Hdggay ****The electric eel shoots out a bolt of lightning at you!Hdggw Hdggz HdggK ..ll@...The bolt of electricity hits you.Hdgg ****The electric eel shoots out a bolt of lightning at you!Hdgg9 Hdgg$ Hdgg4 .l@...The bolt of electricity hits you but does no damage.Hdgg c98/103 --50.0 (1.6HdggƬ Hdgg Hdgg /  --more--Idgg1. _You hear an angry hiss.IdggDSYou slash the electric eel! You burn the electric eel.Idgg/S|~  You kill the electric eel!Idgg`( _You hear an angry hiss. x2Jdgg)F#############################. P# ### #. .# ##.. #... .# ..l. . #.^# #.l# ###≈l #. .# ~~####.~##~~~JdggGY#. ##~~~~~≈~(~ #. #~~≈≈## #. # ###@≈≈# #. ## #≈~≈≈≈# #. .# #.#~≈##. .# ...#≈.# #. .# #..##~.## #. .# #####≈..# #. .# ##≈≈≈..####### #.l   iguana (asleep)######## ###≈≈≈≈.....###..###...##≈≈#.#.JdggTKAn iguana comes into view.JdggUJdggWJdgg YJdgg\RThe iguana hisses angrily. You hear an angry hiss. x2Jdgg]Jdgg^Jdgg_Jdggn& (k.llll 3 komodo dragons (1 wandering)k   swamp drake (wandering)  A swamp drake comes into view. A komodo dragon comes into view.The iguana moves out of view.Jdgg6p103/103==---2.4 (1.6JdggBzJdgg- _You hear an angry hiss.Jdgg N.P# ### # ..###.. # ..# ..(. k #.^.# #..# ###≈l #. ..#~~####.l##~~~ # ### ~~~~~≈~(~  # # Jdggך  #~~l≈## # ## ###~≈≈# # .## #≈@≈≈≈# # ..# #.#~≈## # ..#...#≈. # :.##..##~.## # ..# #####≈..# # ..# ##≈≈≈..####### #Jdggo  2 komodo dragons.######## ###≈≈≈≈........####.......##..###...##≈≈#....##..P#...<##≈## #Jdggҟ Jdgg Jdgg Jdgg JdggP ~≈l   komodo dragonJdggN Q=-4.0Jdgg Jdgg ; _You block the komodo dragon's attack.Kdgg{n..#.. #.# ..(. k #.^.# #..# ###≈l #..#~~####.~##~~~ # .### ~~~~~≈~(~  # .#  #~~≈≈## # .##Kdggo ###l≈≈# # ..## #≈~≈≈≈# # ...# #@#~≈## #.##......#≈.# # .:.#####..##~.## # ...# #####≈..# #.# ##≈≈≈..####### #.######## ###≈≈≈≈........####....##..###...##≈≈#..##..P#...<##≈##....## #[..#..........####....## ##Kdggr,KdggvKdgg`wKdgg Q~lKdgg05.6KdggKdggڌ; _You block the komodo dragon's attack.Kdgg  You hit the komodo dragon. You burn the komodo dragon.  The komodo dragon is lightly wounded.Kdggll 2 komodo dragonsKdggǘ-6.4 (0.8KdggФKdgg; _You block the komodo dragon's attack.Kdgg[  You hit the komodo dragon. You burn the komodo dragon.Kdgg ≈   komodo dragonThe komodo dragon is moderately wounded.KdggE==7.2Kdgg KdggE _The komodo dragon bites you but does no damage.Kdgg[ [  You hit the komodo dragon. You burn the komodo dragon.Kdgg ,Kdgg ll 2 komodo dragonsKdggɗ (8.0Kdgg Kdgg( e _The komodo dragon is heavily wounded.Kdgg  You slice the komodo dragon!! You burn the komodo dragon.  The komodo dragon is almost dead.Kdgg1 /==8Kdgg& Kdgg3 _The komodo dragon barely misses you. You block the komodo dragon's attack.Ldgg)B  You hit the komodo dragon but do no damage.The komodo dragon is almost dead.You block the komodo dragon's attack.LdggYC1--9.6Ldgg#KLdggNE _The komodo dragon bites you but does no damage.LdggX]  You slash the komodo dragon! You burn the komodo dragon.Ldggv≈   komodo dragonLdgg_3--60.5 (0.9LdggLdggQ _You kill the komodo dragon!Ldgg;  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is moderately wounded.Ldgg<b98/103 --1.3 (0.8LdggDDLdggG2 _The komodo dragon bites you.Ldggg  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is heavily wounded.Ldgg|0=2.1Ldgg+Ldgg; _You block the komodo dragon's attack.Ldggb  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is severely wounded.Ldggd &9Ldgg|i LdggAm ; _You block the komodo dragon's attack.Ldgg ]  You slash the komodo dragon! You burn the komodo dragon.Ldgg g†Ldgg/ i9=-53.7Ldgg Ldgg3 Q _You kill the komodo dragon!Ldgg.Ldgg 0Ldgg6Ldgg9H _No target in view!Mdgga#...# ..(. k # P...# #..# ###≈l #..#~~####.~##~~~ #### ~~~~~≈~(~  # ..#  #~~≈≈## # ..## ≈ ###~≈≈# # ...## #.. #≈†≈≈≈# #..# #...###.#~≈## #.##....@.#≈. #:.# ####..##~.## # ....# #####≈..# #.# ##≈≈≈..####### #.######## ###≈≈≈≈........####....##..###...##≈≈#..##..P#...<##≈## #Mdggb[..#..........####....## ## .÷.....P..÷##.#.....P# ###MdggmMdggnd101/103=--Mdggo4.7 (1.0 _MdggouMdggwMdggE~#...# ..(. k # #P...# #..# ###≈l #.# ~ ~~####.~##~~~ #.### ~≈ ~~~~~≈~(~ #MdggF .# ≈~. #~~≈≈## #.## ≈≈.. ###~≈≈# #.## #... #≈†≈≈≈# #.# #...###.#~≈## #.# #...@..#≈.# #.:.# ####..##~.## #.# #####≈..# #.# ##≈≈≈..# #Mdgg^G.# ###≈≈≈≈.####.##..###...##≈≈#.....###.##..P#...<##≈##....## #.[..#.####....## ## ..÷.P..÷##.#.....P# Mdgg@TMdgg U#3MdggnUD=--5Mdgg\Mdgg`Mdgg, ##...# ..(. k #P...# Fl≈ #..# ###≈l #.....# ≈~≈ ~~####.~##~~~ #...### ≈~≈l ~~~~~≈~(~ .# #≈~.. #~~≈≈## #...## #≈≈..# ###~≈≈# #....## #...# #≈†≈≈≈# .# #...###.#~≈## .# #..@...#≈.# .:.# ####..##~.## .# #####≈..# .# ##≈≈≈..#.#dgg9m ###≈≈≈≈..##..###...##≈≈#.....###. F   bullfrog (wandering).##..P#...<##≈##....## #. l   iguana (wandering).[..#.####....## ## l   frilled lizard (wandering).÷.P..÷##.#.....P# Mdgg  An iguana, a frilled lizard and a bullfrog come into view.MdggMdggMdggMdggMdggMdgg?  The iguana hisses angrily.Mdgg~Fllll≈l   komodo dragonF   bullfrog (wandering)l   iguanall 2 frilled lizards (wandering)Mdgg&6Mdgg Mdgg ` _A komodo dragon comes into view.MdggJ # ##...# ..(. k#P...# #~Fl. #..# ###≈l ##.....# #lll≈ ~~####.~##~~~ .#...### #≈~≈≈. ~~~~~≈~(~MdggK M.# #≈~.. #~~≈≈## ##...## #≈≈..# ###~≈≈# ##....## #...## #≈†≈≈≈#.# #...###.#~≈##.# #.@....#≈.#.:.# ####..##~.##.# #####≈..# .# ##≈≈≈..#.# ###≈≈≈≈..##..###...##≈≈#.....###MdggL $.##..P#...<##≈##....## #.[..#.####....## .÷.P..÷##.#.....P# MdggU MdggV MdggGZ _  The frilled lizard hisses angrily. You hear an angry hiss.Mdgg\ Mdggi_ Mdgg` Mdgg` Mdggp dl≈l≈~≈lllllll 3 iguanas (2 wandering)ll 2 frilled lizardsMdggp &7Mdgg{ Mdgg2 ] _An iguana comes into view. x2Ndgg4NdggCNdggF _Unknown command.Ndgg- ##...# ..(. k P...# #l≈l. #..# ###≈l .....# #≈~≈l ~~####.~##~~~ Ndgg^#...### #lll≈. ~~~~~≈~(~ # #≈~.. #~~≈≈## ...## #≈≈..# ###~≈≈# ....## #...## #≈†≈≈≈# # #...###.#~≈## # #..@...#≈.# :.# ####..##~.## # #####≈..# # ###≈≈≈≈.###..###...##≈≈#.....###.##..P#...<##≈##....## #.[..#.####....## #   frilled lizard÷.P..÷##.#.....P# #NdggNdggNdggNdggNdggNdgg0NdggNdgg=Ndgg ~F≈≈≈~llllF   bullfrog (l   iguanall 2 frilled lizardsNdgg Ndgg Ndgg\ &8 _Ndggn"Ndgg'OdggDW##...# ..(. k # #P...# #~F≈. #..# ###≈l # .....# #≈~≈≈ ~~####.~##~~~ # ...### #≈~ll. ~~~~~≈~(~ ## #≈ll. #~~≈≈## # OdggX...## #≈≈..# ###~≈≈# # ....## #...## #≈†≈≈≈# ## #...###.#~≈## ## #...@..#≈.# #:.# ####..##~.## ## #####≈..# ## ##≈≈≈..# ## ###≈≈≈≈.###..###...##≈≈#.....###.##..P#...<##≈##....## #.. l   iguana[..#.####....## ##. l   frilled lizard÷.P..÷##.#.....P# ##Odgg?_OdggaOdggaOdggl*≈~lll   iguanal   frilled lizardOdggmB=9OdggwOdggzOdggXOdggUF≈.l.lOdgg(F   bullfrog (wandering)l 2 frilled lizardsOdggg'70OdggOdgggOdggOdggBOdgg≈.ll.ll   iguanaOdgg&1Odgg1OdggߴOdggl Odggm Odggn Odggo Odgg.p OdggL} ≈lF.ll.lOdgg~ F   bullfrogll 2 iguanas (1 wandering)ll 2 frilled lizardsOdgg~ &2OdggP Odgg" OdggY i  You closely miss the frilled lizard.Odgg[ Odgg&] Odggp^ Odggb ?  The iguana hisses angrily.Odgg c Odggd Odggq ~ll..FlOdggnr l.lll 3 iguanas (1 wandering)Odggr 5=3.5 (0.8Odgg{ Odgg Z _An iguana comes into view.OdggH  The iguana hisses angrily.  You slash the frilled lizard! You burn the frilled lizard.Odggfa  You kill the frilled lizard!OdggOdgg߾Odgg OdggPOdggOdggll~l.Fll.Odggl   komodo dragonF   bullfroglll 3 iguanasl   frilled lizardOdgg)(4.3Odgg4Odgg- _You hear an angry hiss.Pdgg`  You slice the frilled lizard!! You burn the frilled lizard.PdggPdggka  You kill the frilled lizard!PdggPdggPdggPdgg3PdggPdgg ≈(l....FF   bullfrogPdggl   iguana...[..#..........####....## ##. l(wandering) ..÷...........P..÷##.#.....P# ##A komodo dragon comes into view. A frilled lizard comes into view.Pdgg/(5.1Pdgg2P _The komodo dragon moves out of view.Pdgg]{  The frilled lizard hisses angrily.  You hit the bullfrog. You burn the bullfrog.  The bullfrog is moderately wounded.Pdgg~l~ lPdgga&9PdggPdgg6 _You block the bullfrog's attack.Pdgg  You slash the bullfrog! You burn the bullfrog.  The bullfrog is severely wounded.Pdgg0=6.7PdggNPdgg6 _You block the bullfrog's attack.Pdgga Q  You hit the bullfrog. You burn the bullfrog.Pdggd Pdggf PdggCg Pdggg Pdggh Pdggu 4llll.ll   komodo dragonll 3 iguanasPdggz 0-7.5Pdgg Pdgg L _You kill the bullfrog!Pdgg M  You hit the iguana. You burn the iguana.Pdgg Pdgg Pdgg %  Pdgg HThe iguana is heavily wounded.Pdgg Pdgg (.lllll 2 komodo dragonsPdgg B-8.3Pdgg Pdgg > _The iguana bites you but does no damage.Pdgg eO  You slash the iguana! You burn the iguana.PdggjPdggOkPdgg#lPdggmPdgghqY  You kill the iguana!Pdgg|~Nl≈.~l.## #≈ll†l 2 iguanas (1 wandering)Pdgg0=9.1PdggrPdggZ _An iguana comes into view.Qdgg" ##...# ..(. k #P...# #~≈≈. #..# ###≈l #.....# #≈~≈≈ ~~####.~##l~~ #...### #≈~≈≈. ~~~~~≈~(~ .# #≈~.. #~~≈≈## #...## #≈≈.l# ###~≈≈# #....## #.l.## #≈l≈≈≈# Qdgg .# #..l###.#~≈## .# #..@...#≈.# .:.# ####..##~.## .# #####≈..# .# ##≈≈≈..#.# ###≈≈≈≈..##..###...##≈≈#.....###.##..P#...<##≈##....## #   iguana.[..#.####....## ##.÷.P..÷##.#.....P# QdggDQdggQdgg_QdggQdgg,X..l## #≈†l.###lll   frilled lizardQdgg7--80.1 (1.0QdggG Qdggu _You see here a bullfrog corpse.QdggD0]  You slash the komodo dragon! You burn the komodo dragon.QdggC1Qdgg2Qdgg>..l###.ll@.lQdggE@4==9 (0.8QdggZKQdggNh _The komodo dragon is moderately wounded.Qdgg3'  You hit the komodo dragon. You burn the komodo dragon.  The komodo dragon is heavily wounded.Qdgg(_89/103 ----1.7Qdggc5Qdgg8X _The komodo dragon bites you! You block the komodo dragon's attack.Qdgg:| [  You hit the komodo dragon. You burn the komodo dragon.Qdgg~ Qdgg ll.l 2 iguanas  The komodo dragon is severely wounded.QdggΎ x72--------=2.5Qdgg] Qdggn Y _You block the komodo dragon's attack. The komodo dragon bites you!!Qdgg6  You hit the komodo dragon. You burn the komodo dragon.  The komodo dragon is severely wounded.Qdgg .lYou block the frilled lizard's attack. The komodo dragon barely misses you.Qdgg 1--3.3Qdgg Qdgg ; _You block the komodo dragon's attack.QdggC]  You slash the komodo dragon! You burn the komodo dragon.QdggG`  You kill the komodo dragon!QdggvQdgg.l@l.l   komodo dragonQdggw3/104----7=-4.1QdggQdggT _The frilled lizard misses you.Rdgg<  You barely miss the iguana.The komodo dragon hisses menacingly.You block the komodo dragon's attack. You block the frilled lizard's attack.RdggF>.-9RdggGRdgguLk _The iguana misses you. You block the iguana's attack.RdggtRdggYv8-Rdgg}RdggF _Unknown command.Rdggt p  You hit the komodo dragon but do no damage.Rdgg&w Y74=5.7RdggX t _The komodo dragon completely misses you.Rdgg  You hit the komodo dragon. You burn the komodo dragon.  The komodo dragon is lightly wounded.  The frilled lizard bites you but does no damage.Rdgg (6.5Rdgg Rdgg ^ _You block the iguana's attack. x2; You block the komodo dragon's attack.Rdgg{# The frilled lizard bites you but does no damage. _You block the iguana's attack. x2; You block the komodo dragon's attack.slice the komodo dragon!! You burn the komodo dragon.  The komodo dragon is severely wounded.You block the frilled lizard's attack. You block the iguana's attack.  The iguana misses you.RdggG====7.3RdggRdggXE _The komodo dragon bites you but does no damage.Sdggh^  You slice the komodo dragon!! You burn the komodo dragon!SdggyG †ll 2 iguanasl   frilled lizard  You kill the komodo dragon!Sdgg =9==--8.1SdggSdggڏ^ _You block the frilled lizard's attack. You block the iguana's attack. x2Sdgg7 # ##...# ##..  ##...# ~≈≈. ..(. k ###P...# #~≈≈. #..# ###≈l ##.....# #≈~≈≈ ~~####.~##l~~ .#...### #≈~≈≈. ~~~~~≈~(~ .....# #≈~.. #~~≈≈## ###≈≈..# ###~≈≈# ##....##.## #≈†≈≈≈#.#.@###.#~≈##...#.l†l..#≈.:.#####l.##~.##.#####≈..#.# ##≈≈≈..############### ###≈≈≈≈........##.##..###...##≈≈#.....###....##..P#...<##≈##....## ....[..#..........####....##SdggAkll.5---9.1 (1.0 _The iguana misses you. _You see here a komodo dragon corpse.Sdggh  You slash the iguana! You burn the iguana.  The iguana is almost dead.=9 (0.8SdggbSdggs[ _You block the frilled lizard's attack. You block the iguana's attack.Sdgg  You hit the iguana. You burn the iguana.  The iguana is almost dead.Sdgg 1-90.7Sdgg Sdgg/ [ _The frilled lizard barely misses you.Sdggg M  You hit the iguana. You burn the iguana.Sdggau q†   iguanaSdgg{ X6-1.5Sdggf Sdgg J _You kill the iguana!Sdgg_  You slash the frilled lizard! You burn the frilled lizard.Sdgg[SdggYl.Sdgg(2.3SdggSdggR _You kill the frilled lizard!TdggP  You slash the iguana! You burn the iguana.  The iguana is almost dead.=3.1TdggTdggn4 _You block the iguana's attack.TdggMO  You slash the iguana! You burn the iguana.TdggWh†Tdgg9]67-9TdggdTdggshJ _You kill the iguana!TdggNTdgg[8-TdggɯTdggH _No target in view!Tdgg̦ Tdgg 3Tdggo Tdgg : _Tdggѱ Tdggb Tdgg Tdgg9 Tdgg Tdgg K8=Tdggչ Tdgg TdggWTdggQ^l-6.9 (3.0l   iguana (wandering)Tdgg_8-TdggiTdggl^ _An iguana is nearby!Udgga  ##.. #  ~≈≈. ..(. k  #~≈≈. #..# ###≈l  #≈~≈l   #≈~≈≈.   #≈~..   #≈≈..#   #...##   #..@#  ##.††...#≈.# :.# ####..##~.##  #####≈..#  UdggcJ  < [ Udggn  ##..   ~≈≈. ..(. k  #~≈≈. #..# ###≈l  #≈~≈l   #≈~≈≈.   #≈~..   #≈≈..#  Udgg} #...##   #..@#  ##.††...#≈.# :.# ####..##~.##  ####  < [ Udgg'4UdggUdggt#^ _An iguana is nearby!Udgg@7  ##.. #  ~≈≈. ..(. k  #~≈≈. #..# ###≈l  #≈~≈l   #≈~≈≈.   #≈~..   #≈≈..#   #...##   #..@#  ##.††...#≈.# :.# ####..##~.##  #####≈..#    < [ Udgg|[  ##..   ~≈≈. ..(. k  #~≈≈. #..# ###≈l  #≈~≈l   #≈~≈≈.   #≈~..   #≈≈..#   #...##   #..@#  ##.††...#≈.# :.# ####..##~.##  ####  < [ UdggUdggUdggUdgg   #.#.P# ### ## ##...##≈~≈≈≈ ##.. .# ##...#≈~≈≈.. ..(. k##P...# #~≈≈.# #..# ###≈l#.....# #≈~≈l~~~####.~##l~~ #.#...### #≈~≈≈. ~~~~~≈~(~ ......# #≈~.. #~~≈≈## .###≈≈..## ###~≈≈# ###....#### #≈†≈≈≈# #.#.†###.#~≈##...#Udgg |.††...#≈. #.....:.#####..##~.##.#####≈..#.# ##≈≈≈..##### ######### ###≈≈≈≈.........##..###...##≈≈#.....#....##..P#...<##≈##....## _An iguana is nearby!UdggUdggcR≈llUdgg l80==7.9 (1Udggc)Udgg -0 _The iguana hisses angrily.Udggtt.################################ .# #.#.P###~$$≈ #### ##...##≈~≈≈≈ ##.. ..# ##...#≈~≈≈.. ..(. k##P...# #~≈≈.#### #..# ###≈l ..##.....# #≈~≈≈~~~####.~##l~~ ##.#...### #≈~≈l.. ~~~~~≈~(~ #......# #≈~..# #~~≈≈## ..##Udggu#≈≈.@## ###~≈≈# ####....## ###...## #≈†≈≈≈# ##.#.†###.#~≈## .........#.††...#≈. .#.....:.#####..##~.##.#####≈..# ..# ##≈≈≈..##### .######### ###≈≈≈≈.........##..###...##≈≈#.....#UdggW{Udgg:≈lUdgg\3=-8UdggUdggT+ _Found 61 gold pieces.Udgg  You hit the iguana. You burn the iguana.4==9.7 (0.8Udgg Udgg a _The iguana is moderately wounded.Udgg O  You slash the iguana! You burn the iguana.Udgg+ o.Udgg5 3=9000.5Udgg: Udgg= J _You kill the iguana!UdggUdgg}UdgghUdggH _No target in view!VdggsVdgg3VdggWVdgg5$ _Vdgg0Vdgg~Vdgg#%5VdggVdgg.,Vdgg؟VdggDQ6VdggBVdgg,VdggVdggaw7=VdggVdgg:,Vdggq,Vdgg/VdggVdgg@8=9VdggBVdggVdgg<90Vdgg` Vdggl--l   frilled lizard (wandering)VdggB015.5 (15.0)Vdgg G--6.5 (16Vdgg*VdggS.a _A frilled lizard comes into view.Vdgg\e1 ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~  #≈~≈≈.l   #≈~..#   #≈≈.@##   ###...##   ##..†#  ##.††. :.# ####..  #####≈..#   Vdgg ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~  #≈~≈≈.l   #≈~..#   #≈≈.@##   ###...##   ##..†#  ##.††.:.# ####.. #####≈..#   VdggL4Vdggr$Vdgg(e _A frilled lizard is nearby!Vdggm1 ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~  #≈~≈≈.l   #≈~..#   #≈≈.@##   ###...##   ##..†#  ##.††. :.# ####..  #####≈..#   Vdggǭ$ ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~  #≈~≈≈.l   #≈~..#   #≈≈.@##   ###...##   ##..†#  ##.††.Vdgg]:.# ####.. #####≈..#   VdggùVdggٺVdggVdgg ...# ##.#.##...............P.##.############################### #.#.P###~$$ ### .###≈~≈≈≈##. .# ##...#≈~≈≈.. ..(. k .####P~≈≈.#### #..# ###≈l ..##.....~~~####.~##l~~ ##.#...### #≈~≈≈.l~~~~~~≈~(~ #......# #≈~.@# #~~≈≈# Vdgg..##...## #≈≈..## ###~##....## ###...## #≈†≈≈≈ ####..†###.#~≈## ........##.††...#≈.##.....:####..##~.#######. ##≈≈≈..###### .######### ###≈≈≈≈........ _A frilled lizard is nearby!Vdgg llThe frilled lizard hisses angrily.Vdgg;===7.0)Vdgg~VdggC< _You block the frilled lizard's attack.Vdgg Vdgg[ d1=--8.3 (0.8Vdgg% Vdgg' Z _You closely miss the frilled lizard.Vdgg#O ]  You hit the frilled lizard. You burn the frilled lizard.VdggZ o.Vdgg_ C--9.1Vdggh Vdgg[j R _You kill the frilled lizard!WdggWdgg WdggWdggH _No target in view!WdggWdggWdggWdgg;Wdgg: _WdggWdggU2=WdggcWdggWdgg5WdggWdgg7WdggWdggcWdgghWdgg%3WdggWdgg,WdggWdggKWdgg%4WdggNWdggWdgg,Wdgg,WdggWdggRWdgg%5WdggWdgg,WdggWdgg Wdgg` Wdgg WdggWdggK6=WdggNWdggx,WdggWdggn,WdggWdgg$WdggU7=WdggWdgg",Wdgg$Wdgg(Wdgg(%8Wdgg)Wdgg+,Wdgg,Wdgg#1,Wdgg?2WdggW5Wdgg8WdggH9%9Wdgg;Wdgg>WdggQWdggk-40.1 (21.0)k   swamp drake (wandering)Wdgg8-Wdgg{Wdggb _A swamp drake is nearby!WdggY ##### ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~####  #≈~≈≈..~~~~~~≈~(~  #≈~.@#   #≈≈..## Wdgg/  ###...##   ##..†  ##.†† :.# ####.  ###   WdggF ##### ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~####  #≈~≈≈..~~~~~~≈~(~  #≈~.@#   #≈≈..##   ###...##   ##..†Wdgg4HU ##.††:.# ####.  ###  Wdgg0U4Wdgg _Wdggbb _A swamp drake is nearby!Wdggk ##### ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~####  #≈~≈≈..~~~~~~≈~(~  #≈~.@#   #≈≈..##   ###...##   ##..†  ##.†† :.# ####.  ### Wdggl0  Wdgg  ##### ##~$$≈ ###  ##...##≈~≈≈≈ ##..  ~≈≈.. ..(. k  #~≈≈.#### #..# ###≈l  #≈~≈≈~~~####  #≈~≈≈..~~~~~~≈~(~ Wdgg2  #≈~.@#   #≈≈..##   ###...##   ##..† ##.††:.# ####.  ###  Wdgg Wdgg Wdgg7 Wdgg # b _A swamp drake is nearby!WdggC ###.........#. ...# ##.#.##...............P.##.. ################################# # #.#.P###~$$≈ # ## ##...##≈~≈≈≈ ##..  ##...#≈~≈≈.. ..(. k ####P...# #~≈≈.#### #..# ###≈l .##.....# #≈~≈≈~~~####k~##l~~#...### #≈~≈≈.@~~~~~~≈~(~ ....# ##≈~..#####~~≈≈## WdggE .##...## #≈≈..## ###~≈≈# #....## ###...## #≈†≈≈# ## ##..†###.#~≈# ........# ##.††...#≈.# #.....:.# ####..##~.### #####≈..#.# ##≈≈≈..#######Wdgg>H WdggP n.WdggQ l100/104=1.1 (1.0) _WdggLY Wdgg[ Xdgg Xdgg3XdggXdggXdggBXdggyXdgg3k2k   swamp drake (wandering)XdggVXdggXdggPb _A swamp drake is nearby!Xdgg ###.#.# ##.#.##.P.##.####  #.#.P###~$$≈ ###  ##...##≈~≈≈≈ ##.. # ##...#≈~≈≈.. ..(. k P...# #~≈≈.#### #..# ###≈l ##.....# #≈~≈≈~~~####.k##l~~ .#...### #≈~≈≈.Xdgg ≈~(~ # ##≈~..#####~~≈≈## ##...## #≈≈..## ###~≈≈# ....## ###.. .# ##.# ##.††...#≈.# Xdgg݈  _A swamp drake is nearby! _A swamp drake is nearby! _ You enter the shallow water.  Moving in this stuff is going to be slow.XdggÓ ]~kkXdgg 1===3Water Xdgg Xdgg! , _The swamp drake roars!YdggiG###.#. .# ##.#.##.P.##.##.#.P###~$$≈ ###  ##...##≈~≈≈≈ ##..  ##...#≈~≈≈.. ..(. k P...# #~≈≈.#### #..# ###≈l .....# #≈~≈≈~~~####.~##l~~ #...### #≈~≈≈..~@~~~k≈~(~ # ##≈~..#####~~≈≈## ...## #≈≈..## ###~≈≈# YdggkJ....## ###...## #≈†≈≈≈# # ##.††...#≈.# Ydgg2nYdggy>k~Ydggz6--4.7 (1.6Ydgg3YdggYdggH###.#. # ##.#.##.P.##....# #.#.P###~$$≈ ### # ##...##≈~≈≈≈ ##.. # ##...#≈~≈≈.. ..(. k # #P...# #~≈≈.#### #..# ###≈l # .....# #≈~≈≈~~~####.~##~~~ # ...### #≈~≈≈..~~@~k~≈~(~ ## ##≈~..#####~~≈≈## # ...## #≈≈..## ###~≈≈# # ....## ###...## #≈†≈≈≈# ## ##..†###.#~≈## ## ##.††...#≈.# #YdggW:.# ####..##~.## ## #####≈..# ## ##≈≈≈..# #Ydgg"6(catching breath)Ydgg. **The swamp drake breathes poison at you.YdggԴYdggYdgg YdggK°°####°°°°@k°°°°Ydggk92==6.3YdggYdggS _The noxious blast misses you.Ydgg # You slash the swamp drake! You burn the swamp drake!  The swamp drake is almost dead.Ydgg5=7.1 (0.8Ydgg5Ydgg9 _You block the swamp drake's attack.Ydggz_\  Your unstable footing causes you to fumble your attack.Ydgg]mJ~~####.~##l.~~@k~~~~l   iguana (wandering)Ydggn73--9Ydgg+Y _The swamp drake bites you but does no damage.Ydggc Ydgg R---8.7Ydgg` Ydgg M _Your unstable footing causes you to fumble your attack.Ydgg.1\ _The swamp drake bites you but does no damage. _Your unstable footing causes you to fumble your attack.  The iguana hisses angrily. hit the swamp drake. You burn the swamp drake.  The swamp drake is almost dead.  You hear an angry hiss.Ydgg(=]~llYdggp>0=9.5Ydgg/HYdgg L9 _You block the swamp drake's attack.ZdggxY  You slash the swamp drake! You burn the swamp drake.Zdgg1~Zdgg †~~≈l(l   iguanaZdggZdgg###........................#..... deadiverson the Carver # ##.#.##...............P.##....# Human of the Shining One ****** ################################# Health: 103/104 =======================- #.#.P###~$$≈#### Magic: 13/13 ======================== ##...##≈~≈≈≈##..# AC: 21Str: 17 ##...#≈~≈≈....(. k # EV: 14Int: 11 #P...# #~≈≈.#### #..# ###≈l # SH: 16Dex: 15 Zdgg.....# #≈~≈≈~~~####.~##~~~# XL: 13 Next: 100% Place: Lair:2 ...### #≈~≈≈..~~@†~~≈l(~# Noise: =--------  Time: 19050.3 (0.8) ...# ##≈~..#####~~≈≈### a) +0 scimitar (flame) ...## #≈≈..## ###~≈≈## Throw: 4 darts (poison) ....## ###...## #≈†≈≈≈## Water .....# ##..†###.#~≈### .....# ##.††...#≈.## l   iguana ...:.#####..##~.### .....######≈..## .....###≈≈≈..####### #The iguana hisses anZdgggrily.  You hit the swamp drake. You burn the swamp drake.  The swamp drake is almost dead.You hear an angry hiss. _You block the swamp drake's attack.  You slash the swamp drake! You burn the swamp drake.Zdgg> _You kill the swamp drake!You have reached level 14!Zdgg/  --more--Zdgg! G10/1114/144 0% Zdggs AiguanaZdgg9 4 _[dggo.#.  ##.#.##.P.##....#.. .#.P###~$$≈ ### #. #...##≈~≈≈≈ ##..##. #...#≈~≈≈.. ..(.# k #. P...# #~≈≈.#### #..# ###≈l #.# #≈~≈≈~~~####.~##~~~ #.### #≈~≈≈..~~~@~~≈l(~##.# ##≈~..#####~~≈≈##.## #≈≈..## ###~≈≈# #.## ###...## #≈†≈≈≈# #.# ##..†###.#~≈## #.# ##.††...#≈.# #.:.# ####..##~.##[[dggbm #.# #####≈..# #.# ##≈≈≈..# #.[dggp[dgg[dggAl≈~[dggj1=-1.9 (1.6 _[dgg![dggx _You see here a swamp drake corpse.[dgg.#. ##.#.##.P.##....#.. #.P###~$$≈ #####. ...##≈~≈≈≈ ##..# #. ...#≈~≈≈.. ..(.# k #.^ ...# #~≈≈.#### #..# ###≈l #.# #≈~≈≈~~~####.~##~~~ #. .### #≈~≈≈..~~~†@l≈~(~# [dgg#. .# ##≈~..#####~~≈≈### #. .## #≈≈..## ###~≈≈# #.## ###...## #≈†≈≈≈# #.# ##..†###.#~≈## #.# ##.††...#≈.# #. .:.# ####..##~.## #.# #####≈..# #.# ##≈≈≈..# #.[dgg[dgg0=3.5[dgg[dgg4 _You block the iguana's attack.[dgg߹\  Your unstable footing causes you to fumble your attack.[dgg8-4.3 (0.8[dggt[dgg4 _You block the iguana's attack.[dgg<  You hit the iguana. You burn the iguana.  The iguana is heavily wounded.[dgg> (5.1[dggI [dggM L _The iguana misses you.[dggk ..#.. .........#...... #.#.##...............P.##....#. ##############################. .P###~$$≈ ## #.##≈~≈≈≈ ###..# #...#≈~≈≈.. ..(.# k #.^# #~≈≈.#### #..# ###≈l #. ..# #≈~≈≈~~~####@~##~~~#. ### #≈~≈≈..~~~†~l≈~(~# #. # ##≈~..#####~~≈≈###. [dggl ## #≈≈..## ###~≈≈# #. .## ###...## #≈†≈≈≈# #.# ##..†###.#~≈##. ..# ##.††...#≈.# #. :.# ####..##~.## #.# #####≈..# #.[dggr} [dgg~ Q=6.7 (1.6[dgg [dgg 4 _You block the iguana's attack.[dggd  You hit the iguana. You burn the iguana.  The iguana is heavily wounded.[dgg9f-7.5 (0.8[dggo[dggrS _The iguana barely misses you.\dggO  You slash the iguana! You burn the iguana.\dggh†\dgg˗0=8.3\dgg \dggJ _You kill the iguana!\dgg^\dgg~\dgg\dggH _No target in view!\dggg\dggh3\dggj\dggm\dggr: _\dggds\dggu\dgg9v\dggv\dgg~z\dgg{\dggw{\dgg n _f - 5 poisoned darts (gained 1)\dgg[\dggՁ3\dggڂ\dgg.A  You enter the shallow water.\dggɇ@Water \dggH\dgg N _Moving in this stuff is going to be slow.\dgg\dgg\dgg:\dggP\dgg#.. .##P.##....# ###########################...~$$≈ #### #... #≈~≈≈≈ ###..# . #... \dggC≈~≈≈.. #....# ... #.^.  #~≈≈.#### ##..#####≈... #.....  #≈~≈≈~~~####.~##~~~≈..l #...  #≈~≈≈..~~~†~†≈~@~# #...--  ##≈~..#####~~≈≈### #...  #≈≈..## ###~≈≈# #...5  ###...## #≈†≈≈≈# #...  ##..†###.#~≈## #... \dgg S##.††...#≈.# #...l   komodo dragon (wandering) ####..##~.## #...... #####≈..# #...... ##≈≈≈..####### #......\dgg.64.9 (6.6\dgg l.\dgg֨H--6.5 (8.2\dgg\dgg\dgg^7.5 (96\dggC\dgg_ _f - 6 poisoned darts (gained 1)\dggv \dggؠ 4\dgg֣ \dgg #.. .....#.....................P.##....#.########################. #~$$≈ ####  #.\dgg ≈ ###..# .. #... ~≈≈.. #....# ...# #.^ #~≈≈.#### ##..#####≈...# #. #≈~≈≈~~~####.~##@~~≈.... #. #≈~≈≈..~~~†~†≈~~~##l≈... #. ##≈~..#####~~≈≈### ... #.#≈≈..## ###~≈≈# # #.###...## #≈†≈≈≈# #.##..†###.#~≈##......> l   komodo dragon##.††...#≈.# #.####..##~.## #.#####≈..# #.\dgg (0.0\dggE \dgg| Ul~\dgg 5=9.1 (1.6\dgg \dgg0 ; _You block the komodo dragon's attack.\dgg< $$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   \dgg/$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   \dgg\dgg\dgg\dggd _A komodo dragon is nearby!]dgg$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dggBU/$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg9^]dgg_]dggg]dggwjd _A komodo dragon is nearby!]dgg;$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg8$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## > ]dgg9! ##.††...#≈.#  ####..   ]dggC]dggIE]dggM]dggSQd _A komodo dragon is nearby!]dggo$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg $$≈ ####   ..  ]dgg W ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg]dggw]dgg]dgg!d _A komodo dragon is nearby!]dggC $$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg /$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg6 ]dgg^ ]dggK ]dggs d _A komodo dragon is nearby!]dgg $$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg /$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ]dgg ]dgg ]dgg ]dgg _ _A komodo dragon is nearby!]dggO$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #   #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ^dgg$$≈ ####   ..   ...# #.^ ##..#####≈...# #@l~≈.... ~†~†≈~~~##~≈... ##~~≈≈### ...   ###~≈≈# #  ^dgg!2 #≈†≈≈≈#  ##..†###.#~≈## >  ##.††...#≈.#  ####..   ^dggh*^dgg,^dggq2^dgg7^dgg9^dggյll   frilled lizard (wandering)  You hit the komodo dragon but do no damage.^dgg+9 (0.8^dgg^dgga _A frilled lizard comes into view.^dggG  You hit the komodo dragon. You burn the komodo dragon.  The komodo dragon is lightly wounded.^dggo.ll70.8 (0.9^dgg^dgg E _The komodo dragon bites you but does no damage.^dgge \  Your unstable footing causes you to fumble your attack.^dggg -1.6 (0.8^dggp ^dggu S _The komodo dragon misses you.^dgg ^dgg7! .lYour unstable footing causes you to fumble your attack.2.4 _You block the komodo dragon's attack._dgg4[  You hit the komodo dragon. You burn the komodo dragon._dgg@ l. The komodo dragon is moderately wounded._dggB(3.2_dggSJ_dgg~L[ _The komodo dragon closely misses you._dggHB H..# .##P.##....##########################~$$≈ #### # #≈~≈≈≈ ###..#.. #.. #....# ...# #.^  #~≈≈.#### ##..#####≈l..# #.  #≈~≈≈~~~####.~##~l~≈.... # _dggC I #≈~≈≈..~~~†~†≈~@~##~≈... #  ##≈~..#####~~≈≈### ... #  #≈≈..## ###~≈≈# # # ###...## #≈†≈≈≈# # ##..†###.#~≈## # ##.††...#≈. #...... ####..##~.## # #####≈..# # ##≈≈≈..####### #_dggG _dggH _dggJ _dgg_X u.~ll_dggfY -4.8 (1.6_dgg4d _dggj ; _You block the komodo dragon's attack.`dgg^h.# #.##.P.##....###~$$≈ #### # ##≈~≈≈≈ ###..# .. # #≈~≈≈.. #....# ...# #.^ `dgg# #~≈≈.#### ##..#####≈...# # # #≈~≈≈~~~####.~##~~l≈.... # # #≈~≈≈..~~~†~†≈@~l##~≈... # ##≈~..#####~~≈≈### ... # #≈≈..## ###~≈≈# # # # ###...## #≈†≈≈≈# # # ##..†###.#~≈## # # ##.††...#≈.# # # ####..##~.## # # #####≈..# `dgg# # ##≈≈≈..# #`dgg`dggQ  The komodo dragon attacks as it pursues you!`dgg=rl~l~`dgg(6.4`dgg`dgg> _You block the komodo dragon's attack. x2`dggQ ........#.... .#.##...............P.##....########################### P###~$$≈ #### # .##≈~≈≈≈ ###..# .. #. .#≈~≈≈.. #....# ...# #.^ .# #~≈≈.#### ##..#####≈...# # .# #≈~≈≈~~~####.@##~l~≈.... # ## #≈~≈≈..~~~†~†≈~l~##~≈... ##≈~..#####~~≈≈### ... # #≈≈..## ###~≈≈## # ## ###...## #≈†≈≈≈# # .#.†###.#~≈## # .#.††...#≈.#`dgg+ #.... .#####..##~.## # .####≈..# #`dgg]`dggk`dgg `dgg`dgg(~l~l l   frilled lizard`dgg0-8.0`dggw`dgg`dgg####..#....P .........#.... #.#.##...............P.##....# ############################## .P###~$$≈ #### # ..##≈~≈≈≈ ###..# .. #. ..#≈~≈≈.. #....# ...# #.^.# #~≈≈.#### ##@.#####≈...# # ..# #≈~≈≈~~~####.~##~~~≈.... # ### #≈~≈≈..~~~†~†l~l~##~≈... ##≈~..#####~~≈≈### ... # #≈≈..## ###~≈≈## ## ###...## #≈†≈≈≈# # ..#.†###.#~≈## # ..#.††...#≈.# # :.#####..##~.##`dgg:; #`dggC`dggLQ  The komodo dragon attacks as it pursues you!`dgg}`dggmll≈~~`dgg8=9.6`dggX `dgg ; _You block the komodo dragon's attack.`dgg  You hit the komodo dragon but do no damage.The komodo dragon is lightly wounded.`dgg .80.4 (0.8`dgg `dgg ; _You block the komodo dragon's attack.`dggDs   You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is heavily wounded.The frilled lizard bites you but does no damage.`dggt 0=1.2`dggy `dgg_} ; _You block the komodo dragon's attack.adgg  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is severely wounded.adgg10-2.0adgg?adggz _You block the frilled lizard's attack. The komodo dragon misses you.adgg']  You slash the komodo dragon! You burn the komodo dragon.adgg5 †l   frilled lizard  You kill the komodo dragon!adgg;61=8adggCadggIH< _You block the frilled lizard's attack.adgg)]  You hit the frilled lizard. You burn the frilled lizard.adggGf~adggܮ0-3.6adggh _You kill the frilled lizard!adgg:adgg<8-adggbdggbdggH _No target in view!bdgg6bdggbdgg bdggH _No target in view!mdggV3 mdggg4 3mdgg5 mdgg: g _No target in view!  You enter the shallow water.mdgg: @Water mdgg? d _Moving in this stuff is going to be slow.mdggI ....#....... #.##P.##....# ############################ ###~$$≈ #### #..≈~≈≈≈ ###..# .. #.. #≈~≈≈.. #....# ...# #.^ mdggJ n# #~≈≈.#### ##..#####≈...# #.. # #≈~≈≈~~~####†~##~~l≈.... #.... # #≈~≈≈..~~~†~†≈@~~##~≈... #..-  ##≈~..#####~~≈≈### ... #..  #≈≈..## ###~≈≈# # #..###...## #≈†≈≈≈# #.. # ##..†###.#~≈## .. # ##.††...#≈.# mdggK #..l   iguana (wandering) # ##..##~.## #..... # #####≈..# #..... #  ##≈≈≈..####### #.....mdggoP -4.6 (1.0mdggQ mdggs^ ~An iguana comes into view.mdgg_ G-6.2 (2.6mdggg mdgg/l 3 _The iguana moves out of view.mdgg s `mdgg>x mdggy mdggI| mdggt mdggt mdggɄ mdgg< mdgg mdgg mdgg1!mdggP- #.... ....#........ #...............P.##....#...######################... ~$$≈ #### ?..#... ~≈≈≈ ###..# ....#..... ≈≈.. #....# ...# #.^. ~≈≈.#### ##..#####≈...###... mdgg.{≈~≈≈~~~####†~##~@~≈.....#...91.0 (4.8 ≈~≈≈..~~~†~†≈~~~##~≈...##... #≈~..#####~~≈≈### ≈l..##... #≈≈..## ###~≈≈# .####... ###...## #≈†≈≈≈# # #...  ##..†###.#~≈## #......>. l   iguana (wandering)  ##.††...#≈.# #...  ####..##~.## #... #####≈..# #...mdgg/mdgg9mdgg=^ _An iguana is nearby!mdgg7&## ~$$≈ #### ?..  ....  ...# #.^ ##..#####≈...##†~##~@~≈.....†~†≈~~~##~≈...##~~≈≈### ≈l..# ###~≈≈# .###mdgg9 #≈†≈≈≈# #  ##..†###.#~≈## >  ##.††...#≈.#     ndggJ4##$$≈ #### ?..  ....  ...# #.^ ##..#####≈...##†~##~@~≈.....†~†≈~~~##~≈...##~~≈≈### ≈l..# ###~≈≈# .###ndgg; #≈†≈≈≈# #  ##..†###.#~≈## >  ##.††...#≈.#     ndggndggndggandggo^ _An iguana is nearby!ndggrn## ~$$≈ #### ?..  ....  ...# #.^ ##..#####≈...##†~##~@~≈.....†~†≈~~~##~≈...##~~≈≈### ≈l..# ###~≈≈# .### #≈†≈≈≈# #  ##..†###.#~≈## > ndgg²q ##.††...#≈.#     ndggQ ##$$≈ #### ?..  ....  ...# #.^ ##..#####≈...##†~##~@~≈.....†~†≈~~~##~≈...#ndggRC#~~≈≈### ≈l..# ###~≈≈# .### #≈†≈≈≈# #  ##..†###.#~≈## >  ##.††...#≈.#     ndgg]ndgg^ndggendgg2h^ _An iguana is nearby!ndggndgg _No reachable target in view!ndgg/ ndgga ndgg[ ndgg$ R _No reachable target in view!odgg) #.##.# .P.##....#.#######.# $$≈ odggg #### .[?..#.# ≈≈≈ ###..# #.....#.#.. #....# ....# #.^......# ≈≈.#### ##..#####≈...###.# ~≈≈~~~####†~##~~@≈.....#.# ~≈≈..~~~†~†≈~~~##~≈...##.# ≈~..#####~~≈≈### ≈≈l..##. ≈≈..## ###~≈≈# #≈.####.#...## #≈†≈≈≈# ..# #.#odgg ##..†###.#~≈## ..# #......>.###.††...#≈.# ## #.#####..##~.## #.######≈..# #.#odgg _An iguana is nearby!No reachable target in view!  Found a pair of gloves.odgg yl.lodggY 6==2.6 (1.6odggn odgg 0 _The iguana hisses angrily.odggkc# P.##....## #######################.# $≈ #### .[?..#.# ≈≈ ###..# ##.....#.# .. #....# #....# #.^# odggm#### ##..#####≈...###........# ~~~####†~##~~~≈.....#.# ≈≈..~~~†~†≈~~~##@l...##.# ~..#####~~≈≈###~≈≈...##...## ###~≈≈####≈.####.## #...## #≈†≈≈≈# ..# #.# †###.#~≈## ..# #......>.#††...#≈.# ### #..# ##..##~.#  #####≈..# #.#≈≈≈..####### #.odggoPodggM  The iguana bites you but does no damage.odgg0-4.2odggodggL _The iguana misses you.pdgguc  Your unstable footing causes you to fumble your attack.pdgg@-5.0 (0.8pdggpdggG4 _You block the iguana's attack.pdgg\  Your unstable footing causes you to fumble your attack.pdgg&8pdgg؍pdggR4 _You block the iguana's attack.pdgg&#..# ..#......# .............P.##....#.# ######################.pdgg\k#  #### #.[?..#.# ≈ ###..# ##.....#........# . #....# #....# #.^# .#### ##..#####≈...###.# ~~~####†~##~~~≈@....#.# ≈..~~~†~†≈~~~##~l...##.## ..#####~~≈≈###~≈≈...##. ..## ###~≈≈####≈.####.# ...## #≈†≈≈≈# ...# #.pdgg@_.# #..†###.#~≈## ...# #......>.# ##.††...#≈.# ####  ####..##~.## #.######≈..# #.##pdggqpdgg57.4 (1.6pdggpdgg4 _You block the iguana's attack.pdgg pdgg؛ -8.2 (0.8pdgg@ pdgg (  Your unstable footing causes you to fumble your attack. _You block the iguana's  Your unstable footing causes you to fumble your attack. _You block the iguana's _You barely miss the iguana. You block the iguana's attack.pdggwG pdggH !9.0pdggP pdggS _You block the iguana's  Your unstable footing causes you to fumble your attack. _You block the iguana's _You barely miss the iguana. You block the iguana's attack.pdgg O  You slash the iguana! You burn the iguana.pdggF≈pdgg.=8pdggpdggJ _You kill the iguana!qdggqdggqdggqdggH _No target in view!qdggf4qdgggqdggsjH _No target in view!qdggqdggqdggqdggH _No target in view!qdgg7 qdggo qdgg9 qdgg qdggݯ qdgg $ _qdgg5 qdgg qdgg qdggN qdggI qdgg qdgg qdggM qdgg1 qdgg qdgg qdgg& qdggR qdgg} i≈#≈~...#†### ~~≈~..##.#### P..#P.##....##....##.# ..............#....P..# .............#........qdgg S# ..............#.......# ..........P.##....#........# ####################..#  #### #.[@..#..# --  ###..# ##.....#..#  #....# #....###.^# qdgg[ ### ##..#####≈...###..# ~~####†~##~~~≈..... .~~~†~†≈~~~##~≈...##..#####~~≈≈###~≈≈...##. ## ###~≈≈####≈.####..## .## #≈†≈≈≈# ...# #..qdgg "#qdgg= /103.8 (4.0qdgg F--4.8 (5qdgg qdgg 4 _V - a scroll of enchant armourqdgg Iqdgg| qdgg qdggJ qdggb ,qdgg ,qdgg qdggã qdgg* qdgg qdggj qdgg qdgg ,qdggƪ qdgg qdggr qdgg qdgg qdgg qdgg ............P.##....#........# #####################........# #### #.[...#........# ###..# ##.....#.# qdgg #....# #....###.^......# #### ##..#####≈...###.# ~~~####†~##~~~≈.....#.# ..~~~†~†≈~~~##~≈...##.## .#####~~≈≈###~≈≈@..##..# .## ###~≈≈####≈.####.## ..## #≈†≈≈≈# #...# #..# ..†###.#~≈##.....# #>.# #.††...#≈.#l..#### #.# ####..##~.#### #.l   frilled lizard (asleep)  #####≈..# ###  ##≈≈≈..####### #.P# # ###≈≈≈≈........####..##qdggF &9qdgg% ,10.8 (6qdgg qdgg a _A frilled lizard comes into view.qdggO: ######  #### #.[..   ##....  qdgg; #....###.^  ##..#####≈...### †~##~~~≈.....# ##~≈...# #~≈≈@..#  ###≈.###   #...#  †.....# >.# ††..####  ####        #  rdggŖ  ######  #### #.[..   ##....   #....###.^rdgg5  ##..#####≈...### †~##~~~≈.....# ##~≈...# #~≈≈@..#  ###≈.###   #...#  †.....# >††..#### ####        rdgg& rdggrdggJrdggXrdggde _A frilled lizard is nearby!rdgg+ ######  #### #.[..   ##....   #....###.^  ##..#####≈...### rdgg†~##~~~≈.....# ##~≈...# #~≈≈@..#  ###≈.###   #...#  †.....# >.# ††..####  ####        #  rdggr} ######  #### #.[..   ##....   #....###.^  ##..#####≈...### †~##~~~≈.....# ##~≈...#rdgg" #~≈≈@..#  ###≈.###   #...#  †.....# >††..#### ####        rdgg4rdggҖrdgge _A frilled lizard is nearby!rdgg=s#################### #### #.[...###..# ##.........###.^ rdgg@#### ##..#####≈...###.. ~~~####†~##~~~≈..... ..~~~†~†≈~~~##~≈...### .#####~~≈≈###~≈≈.. ###~≈≈####≈@#### ..## #≈†≈≈≈# #...#  †###.#~≈##..> #.††...#≈.#l..###. ####..##~.####  #####≈..# # ##≈≈≈..#######P # ###≈≈≈≈........###.## ###...##≈≈#.....###...##rdggFLrdggCM21.8 (1 _rdggWrdggZrdggu\  #### #.[..   ##....rdggew   #....###.^  ###≈...### †~##~~~≈.....# ##~≈...# #~≈≈...#  #≈@#   #...#  †#.....# >.# ††#l..####  ####        #  rdggv  #### #.[..   ##....   #....###.^  ###≈...### rdgg&†~##~~~≈.....# ##~≈...# #~≈≈...#  #≈@#   #...#  †#.....# >.# ††#l..#### ####        rdgg rdgg!rdgg*rdgg.e _A frilled lizard is nearby!rdgg≈ #### #.[...#.# ≈ ###..# ##.....#.# . #....# #....###.^......# .#### ##..#####≈...###..# ≈~~~####†~##~~~≈.....#rdgg.# ≈..~~~†~†≈~~~##~≈...##.#######~~≈≈###~≈≈...##..# ..## ###~≈≈####≈.##### ...## #≈†≈≈≈# #.@.# #. #..†###.#~≈##.....# #>.# ##.††...#≈.#l..#### #........#  ####..##~.#### #.#  #####≈..#  #.## ##≈≈≈..####### #.P# ## ###≈≈≈≈........####..## .###...##≈≈#...# .P#...<##≈## #..rdggrdgg"-2 _rdggm rdgg rdggς ≈ ###..# ##.....#.# .. #....# #....###.^......# ≈.#### ##..#####≈...###..# ≈≈~~~####†~##~~~≈.....#.#≈..~~~†~†≈~~~##~≈...##.## ~..#####~~≈≈###~≈≈...##..# ≈..## ###~≈≈####≈.##### #...## #≈†≈≈≈###...# #. rdgg ##..†###.#~≈##..@..# #>.#  ##.††...#≈.#l..#### #........#  ####..##~.#### #.# #####≈..#  #.## ##≈≈≈..####### #.P# ### ###≈≈≈≈........####..# ..###...##≈≈#... ..P#...<##≈## #. .........####....## ##....#rdgg rdggӏ &3rdggf rdgg rdgg x≈ ###..# ##.....#.# ≈.. #....# #....###.^......#≈.#### ##..#####≈...###.# ~≈≈~~~####†~##~~~≈.....#.# ~≈≈..~~~†~†≈~~~##~≈...##. ≈~..#####~~≈≈###~≈≈...##.≈..## ###~≈≈####≈.####. #rdggE#...## #≈†≈≈≈###...# #.#  ##..†###.#~≈##.@...# #......>.# ##.††...#≈.#l..#### #.# ####..##~.##### #.# #####≈..# #. ##≈≈≈..# #.P# ###≈≈≈≈.####. #..###...##≈≈#.....### #..P#...<##≈##....## #.####....## ##....#rdgg rdgg( &4rdggrdggsdggÖ~≈≈≈ ###..# ##.....#.≈.. #....# #....###.^...... ~≈≈.#### ##..#####≈...###. ≈~≈≈~~~####†~##~~~≈.....#. ≈~≈≈..~~~†~†≈~~~##~≈...##. #≈~..#####~~≈≈###~≈≈...## #≈≈..## ###~≈≈####≈.####.#...## #≈†≈≈≈###...# #. ##..†###.#~≈##@....# #......>. ##.††...#≈.#l..#### #. ####..##~.##### #. #####≈..#sdgg] #. ##≈≈≈..# #.# ###≈≈≈≈.#### ##..###...##≈≈#.....### ##..P#...<##≈##....## # #.####....## ##....#sdggsdgg&5sdggsdgg*sdgg0_  You slash the frilled lizard! You burn the frilled lizard.sdggL<p.sdggB5=6.6 (0.8sdgg$Lsdgg OR _You kill the frilled lizard!sdgg3sdggsdggsdggdsdgghsdgg_sdggqsdggsdggsdggsdgghsdggsdggsdggysdggsdggsdggTsdggsdggBsdggqsdggsdggsdggsdgg sdgg   You enter the shallow water.Water sdgg`sdggN _Moving in this stuff is going to be slow.sdgg/sdggsdggsdggLsdggsdggW sdgg0!sdggw$sdggR'sdgg'sdgg+sdgg-sdggw0sdgg0sdgg1sdgg<5sdgg7sdgg;8sdgg9sdgg:sdgg=sdgg>,sdggAsdggDsdggE!sdggEsdggHi  You see here a komodo dragon corpse.sdggALA  You enter the shallow water.sdggLVWater sdgg5ON _Moving in this stuff is going to be slow.sdggPsdggTQ4sdgg7Sg  You see here a swamp drake corpse.sdggTsdgg]U _sdggUsdggXsdgg[sdgg4\sdgg\sdggU^sdggT`sdgg asdggasdggdsdggsdggsdggsdggA  You enter the shallow water.sdgg5VWater sdggN _Moving in this stuff is going to be slow.sdgg 4sdggrsdggsdgg,sdggsdggsdgg` sdgg sdgg sdgg6 sdggM ,sdgg sdgg sdgg sdggb! sdgg" sdgg- sdggj/ sdgg0 !sdgg0 sdgg; sdggN> 0sdgg ? sdggH sdggJ sdggUK sdggK sdggW sdggX sdgg7Y ,sdggc i  You see here a komodo dragon corpse.sdgge sdggf  _sdggdg sdggt f  You see here a bullfrog skeleton.sdggRv sdggv  _sdggw sdggi sdgg2 sdggT ,sdgg{ sdggR sdgg ,sdgg sdgg A  You enter the shallow water.sdgg0 @Water sdgg sdgg _Moving in this stuff is going to be slow.  You see here a komodo dragon skeleton.sdgg| sdgg9 _sdggЭ sdgg׵ sdggҷ sdggU !sdgg sdgg \sdgg} sdgg sdgg sdggD sdgg sdgg  #≈~≈≈..~~~†~†≈~~~##~≈...##  ##≈~..#####~~≈≈###~≈≈...##  #≈≈..## ###~≈≈####≈.####  ###...## #≈÷≈≈≈###...# # sdgg  ##..†###.#~≈##.....# # ##.†÷...#≈.#...#### # ####..##~.##### # #####≈..# # ##≈≈≈.@####### #.....- ####### ###≈≈≈≈........#### ..##..###...##≈≈#.....## ..##..P#...<##≈##....## ..#..........####....## ##....# ........P..÷##.#.....P# ####sdggq Ml   komodo dragon (wandering) .#..............#....## ##...#.#................l..# #...#~ .....#.......÷.......## ##.#~#sdgg 089.4 (72.8)sdggR F.lsdgg- G-90.4 (73sdgg[ sdggf ` _A komodo dragon comes into view.sdggo F #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.  #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#...##≈≈#.....##..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷ sdggc } #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.  sdgge #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#...##≈≈#.....##..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷ sdgg"p sdggLq sdggy sdgg} d _A komodo dragon is nearby!sdggxZ  #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.  #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#...##≈≈#.....##sdgg\ ..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷ sdgg~E #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.  #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#sdgg...##≈≈#.....##..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷ sdgg+sdggsdgg sdggd _A komodo dragon is nearby!tdggC #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.tdggm  #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#...##≈≈#.....##..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷ tdgg! #≈~≈≈..~~~†~†≈~~~##~≈.  ##≈~.~.  #≈≈..## ###~.  ###...## #≈÷...#  ##..†###.#~≈##.....#  ##.†÷...#≈.  #~.#####  #####≈..#  ##≈≈≈.@#  ###≈≈≈≈........#...##≈≈#.....##..<##≈##....## ####....## ÷##.#.....P# ....## ...l.# ÷dgg7;24H tdggŎtdggtdggtdggd _A komodo dragon is nearby!tdgg<y##≈~..#####~~≈≈###~≈≈...##.≈≈..## ####≈.####.###...## #≈÷≈≈≈###...# #. ##..†###.#~≈##.....# #......>†÷...#≈.#...#### #.tdgg=z##..##~.##### #. #####≈..# #.##≈≈≈..####### #. ###### ###≈≈≈≈..@.....####. .##..###...##≈≈#.....###... .##..P#...<##≈##....## #. .#..........####....## ##....#.....P..÷##.#.....P# ####... #.......#....## ##...##....l.# #...#~ ....#÷.......## ##.#~.....÷...# ##..##~.tdgg4DtdggNall.tdggO11.4 (1.0)tdggYtdgg]7 _The komodo dragon hisses angrily.tdgg≈≈..## ####≈.####. ###...## #≈÷≈≈≈###...# #. ##..†###.#~≈##.....# #......>†÷...#≈.#...#### #..##..##~.##### #. #####≈..# #.#≈≈≈..####### #. ##### ###≈≈≈≈........####...###...##≈≈#.@...###... tdgg^ ##..P#...<##≈##....## #. #..........####....## ##....# ......P..÷##.#.....P# ####..........#..l.## ##...##........# #...#~#. ...#÷.......## ##.#~#~~.....÷..........### ##..##~....###.#.~~~~>tdggtdggjFl.tdgg&2tdggtdggtdgg7Oq##...## #≈÷≈≈≈###...#  ##..†###.#~≈##..> ##.†÷...#≈.#...###. ####..##~.#####  #####≈..#  ##≈≈≈..####### ##### ###≈≈≈≈........###tdggP..###...##≈≈#.....###..P#...<##≈##.@..## ..........### ##....# ......P..÷##.#..l..P# ####..........#....## ##...## #.........# #...#~ ...#.......÷## ##.#~#~~......÷..........### ##..##~.....###.#.~~~~>P~~~÷.......~~~.tdggStdgg\Fl.tdgg~]&3tdggyetdgggtdggUT  You slash the komodo dragon! You burn the komodo dragon.  The komodo dragon is heavily wounded.tdggU 7===4.2 (0.8tdgg_ tdgga [ _The komodo dragon closely misses you.tdggB ^  You slice the komodo dragon!! You burn the komodo dragon!tdgg0 p.tdgg1 025.0tdggF tdgg Q _You kill the komodo dragon!tdggctdggtdgg"tdgg%H _No target in view!udggudggo"3udgg5udgg{7udgg^8$ _udggL=udgg@udggGBudggBudggnCudggIudggKudgg LudggLudggSudggUudgg1VudggHWudgg\udggV_udggC`udggaudggfudgg iudggiudggjudgg_pudggrudgg sudggMtudggCyudgg~{udgg|udgg]}udgga  You see here a yak skeleton.udggoudggA _udggNudggudgg8udggudggudggudggudggudgg~udggeudgg udggDudgg֟udggjudggEudggۥudggTudggudggudggudggudgghudggudggudgg$udggudggudgg udggudgg@udgg,udggudggudggudgg udggudggudggRudggudggudggudggudggBudggudggmudgg)udggudgg&udgg(udgg^,udggUudggudggzudggudggudgggudgg,udggudggyudggbudggudggudggudggudgg,udgg>udggudggudgg<udggudggXudggudgg@ udggudggudggudggudggudggudggudggudggudgg[!udgg!udgg#udgg)&udggK(udgg(udgg)udgg-udgg/udggU0udgge1udggm4udgg6udgg7udggZ8udgg;udggI>udgg>udgg?udggBudggEudggEudggFudggIudggLudggLudggMudggPudggRudgg_SudggTudgg>Wudgg]Yudgg%ZudggW[udgg3^udgg`udgg audggpbudggeudggg,udggbiudggludggn,udggpudgg@rudggtudgg?uudgguudgg=xudggzudgg2{udgg;|udgg~udgg̀udggNudggudggudggudgg-udggˆudggudggudggudggJudggٍudgg[udggudgg\udggMudggudgg)udggudggGudggudggudggudggudggqudggudgg~udggudgghudggudggudggudgg-udggudgg#udgg udggudgg,udggR  There is a stone staircase leading down here.udggudgg _udggudggEudggBudggudggudgg.udggudgg|udggudggudggbudggudggIudggudggudggudggudggudgggudggjudggudggnudggudgg udgg udggw udggy udgg udggR,udgg$udgg=udgg^udggudggA!udgg&udggh(udgg(udgg*udgg.udgg0,udgg 2udgg*7udgg;udgg<<udgg=udggGCudggFudgg~GudggNudggPudggySudggdTudggOVudgg[udgg^udgg_udgg audggeudggphudgghudggsjudgg[nudggpudggCqudgg"rudgg"vudggxudggxudggyudggR~udggGudggudggudggnudggudggcudggVudgg֍udggudggudggudggudggM,udggudggudggbudggf,udgg+udggpudgg udggudggUudggudggudggsudggҬudggĮudgg|udgg4udgguudggwudgg9udggudggudggudggaudgg+udggudggNudgg%udggudggudggudggdudggudggudggudggudgg,udggudggudggzudggudgg6udgg2,udggudggudgg,udggudggudggudggvudggudggjudgg,udggnudggudgg8udggudggudgg udggBudggV .........##  #............####  udgg #.............#P##  ##....#..........#  ####............#  ##...##.##....##   #...#~#.###....#   ##.#~#~~~.##..##  # ##..##~...~#..@#  ---288.0 (93.0)udggQ##.#.~~~~>.~....#  .......~~~..~##..##  #...##.~~~##~...#  .##....#~#.#~#....#  ##.##...##~##....##  #####P...........#  .# ###.#...#.##.P#  udgg## #############  ---udgg!j _Key pressed, stopping explore.udgg&IudggB9udggx;udggAf _udggAudggxBudggCudggoE,udgg$FudggGudggHudggZIudggIudggKudggLudgg MudggyMudggNudgg!PudggPudggQudgg.RudggSudggTudggkTudggXM ##.#~#~~~.##..## # ##..##~...~#...###.#.~~~~>.~.... .......~~~..~##..## ..#...##.~~~##~...# .##....#~#.#~#....# ##.##...##~##....# #####P...........## .# ###.#...#.##@P#95.0 (7.0) ############# ### .######## .......# .#####.## udgg*udggȉudggE _Done exploring.udggxudggy3udggf.......0udggCudggludggE _Done exploring.udggV6 udgg7 3udgg^ udgg_ udgge udgg|h  udggh 7_Done exploring.vdgg2 vdgg4 deadiverson the Carver (Human Fighter) Turns: 19126, Time: 00:33:23 Health: 111/111 AC: 21 Str: 17 XL: 14 Next: 2% Magic: 14/14EV: 14 Int: 11 God: the Shining One [******] Gold: 968SH: 16 Dex: 15 Spells: 13/13 levels left rFire . . .vdgg5 qa - +0 scimitar (flame) rCold + . . l - +1 kite shield rNeg + + + c - quicksilver dragon scales of the Indigo Skies {rC+ WillrPois + T - +0 helmet rElec .w - +2 cloak {Stlth+} rCorr .P - +0 pair of gloves SInv .A - +0 pair of boots Will ++...d - amulet of faith Stlth +L - +4 ring of slaying HPRegen 0.38/turn D - ring of poison resistance MPRegen 0.14/turn %: faith @: glowing A: explore regen, iridescent scales 1, large bone plates 1, inability to drink after injury 1wdggs wdgg4  ##.#~#~~~.##..##   deadiverson the Carver # ##..##~...~#...#   Human of the Shining One ****** ###.#.~~~~>.~....#   Health: 111/111 ======================== wdggv .......~~~..~##..##   Magic: 14/14 ======================== ..#...##.~~~##~...#   AC: 21Str: 17 .##....#~#.#~#....#   EV: 14Int: 11 ##.##...##~##....##   SH: 16Dex: 15 #####P...........##   XL: 14 Next:  2% Place: Lair:2 .# ###.#...#.##@P#   Noise: ---------  Time: 19295.0 (0.0) ## #############   a) +0 scimitar (flame) ##  Throw: 6 darts (poison) .# wdggD  .# ##   .########   ........#   .#####.##   _You see here a yak skeleton. _There is a stone staircase leading down here. _Key pressed, stopping explore. _Done exploring. _Done exploring. _Done exploring.wdgg wdgg[ wdgg xdggnCxdggD%Where to? (Tab - Lair:2 @ (x,y), ? - help) D - DungeonT - Temple L - Lair  A - Shoals  N - Spider Nest O - Orcish Mines V - Vaultsxdgg xdgg: ##.#~#~~~.##..##   deadiverson the Carver # ##..##~...~#...#   Human of the Shining One ****** ###.#.~~~~>.~....#   Health: 111/111 ======================== .......~~~..~##..##   Magic: 14/14 ======================== ..#...##.~~~##~...#   AC: 21Str: 17 .##....#~#.#~#....#   EV: 14Int: 11 ##.##...##~##....##   SH: 16Dex: 15 #####P...........##   XL: 14 Next:  2% dgg73mPlace: Lair:2 .# ###.#...#.##@P#   Noise: ---------  Time: 19295.0 (0.0) ## #############   a) +0 scimitar (flame) ##  Throw: 6 darts (poison) .# .# ##   .########   ........#   .#####.##   _You see here a yak skeleton. _There is a stone staircase leading down here. _Key pressed, stopping explore. _Done exploring. _Done exploring. _Done exploring.xdggxdggP _xdgg-xdgg,xdggxdggxdggxdgg,xdggxdgguxdgg,xdgg"xdgg{xdgg0xdggxdgg0xdgg+,xdggxdgg xdggxdggOxdggxdggHxdggc,xdggxdgg0!xdgg"xdgg@#xdgg#xdgg*xdgg+xdgg,xdggR-xdgg_2xdgg3xdgg4xdgg4xdggX;xdggk=,xdgg>xdgg$ExdggnGxdgg Hxdgg0IxdggOxdggQQxdggQxdgg`RxdggUxdggVxdggrWxdgg'Xxdgg[xdggu^,xdgg_xdggcxdgg?exdggexdggDfxdggKjxdgglxdgglxdggnxdgg rxdggsxdggBtxdggtxdgg`xxdggzxdggxzxdgg{xdgg@xdggxdggZxdggKxdggцxdggxdggrxdggHxdggmxdgg@xdggxdggxdgg\xdggb,xdggxdggbxdggxdggbxdggxdggxdgg,xdggPxdgg׬xdgg,xdggXxdggmxdgg[,xdggxdggxdggS.................P~~~.......÷.... ..........P......~≈≈≈..........#. #.....####......P~≈≈≈≈P..P....##. ##....###.......~≈≈~≈~~~.....##.# ##.xdgg......~~≈≈~.≈~.P....#### ##.....#........~.≈~.....P....# ...................~~.~~.....## ......[..~~~~P.....## ...............@...~~........# ....>..##..................#..# P....###....................## #.<....##...............#.#...###....##...............####...........##..............# ###.### l   iguana (wandering) ####...##l..........<.## ### ##.#..[#P.............# ###...............#####xdgg11323.0 (28.0)xdgg?T.lxdgg,4.0 (29xdggxdggxdgg(] F÷.....P......~≈≈≈....#......P~≈≈≈≈P..P...........~≈≈~≈~~~...........~~≈≈~.≈~.P..........~.≈~.....P....# ..........~~.~~.....## .......[..~~~~P. .......@...~~.. >..##............... ............... <.............................#..............# ...........<.## ### [#Pl............#  xdgg w÷.....P......~≈≈≈....#......P~≈≈≈≈P..P...........~≈≈~≈~~~...........~~≈≈~.≈~.P..........~.≈~.....P....# ..........~~.~~.....## .......[..~~~~P. .......@...~~.. >..##............... ............... <.............................#..............# ...........<.## xdggH }[#Pl............#xdgg xdgg xdggxdgg^ _An iguana is nearby!ydgg6 P......~≈≈≈....# .#.....####P~≈≈≈≈P..P....## .##.....~≈≈~≈~~~..... .##....~≈≈~.≈~.P....## .##.....#..~.≈~.....P....# ............~~.~~.....##[..~~~~P.....##.....~~........#>..##...........#..# .#P....###..........## .#.<....###.#...## ..#ydgg :###.....#.....##.# ###.## .####...##<.## ### .##.#..[#Pl... .###......##### .# ##...P#ydgg1 ydggT.lydgg85.0 (1.0) _ydgg$ydgg&ydggDul#.....####P~≈≈≈≈P..P #.##.....~≈≈~≈~~~. #.##....~≈≈~.≈~.P....## #.##.....#..~.≈~.....P.... .............~~.~~.....##[..~~~~P.....##.....~~........#>..##..#..##P....###...## ..#.<....###.#...# ...####....#.....##.# ###.# ..####...##<.## # ..##.#..[#P...# .###.....l##### ..# #.....#...P#.###......#ydggwydgg~Ml.ydgg&6ydggydggydgg> ##.##.....~≈≈~≈~~~.  #.##....#~≈≈~.≈~.P.... ##.##.....#..~.≈~.....P.... ..............~~.~~.[..~~~~P..........~~........>..##..#..#P....###..#.<....###.#.....####...#.....##.# ###.####...##<.## #.##.#..[#P...#.###....l#####.# #....#...P#.###......#..####ydgg0 ydggi E.ydgg% &7ydgg ydgg@ ydggM ydggN ydggwV ydggBX H _No target in view!ydggydggCydgg>ydggH _No target in view!zdggszdggtzdggwzdgg!<0zdggzdgg٤E _Done exploring.zdggzdggzdggzdggH _No target in view!zdgg߰zdgg:zdggzdgg-H _No target in view!zdggr zdggt zdgg9~ zdgg H _No target in view!zdggp 3zdgg zdgg: zdggI< zdggD zdggG RDone exploring.No target in view!Done exploring.zdggzdggMzdggzdggkDone exploring.No target in view!Done exploring.No target in view!{dgg[U #.##....~≈≈~.≈~.P.... ###.##.....#..~.≈~.....P... ...............~~.~~..[..~~~~P............~~.......>..##..##P....###..#.<....###.#....#{dggV####.....##.# ###.####...##<.## #.##.#..[#P...#.###.....#####.# ##...P.###......#..##########.{dgga{dggb{dggUc+8.0 (1 _{dggk{dgg?m{dgg|f.###.##.....#..~.≈~.....P ................~~.~~....[..~~~~P........~~.>..##..# #....#P....###. #....#.<....###.# #.....#....#### #....##.....##.# ##.####...##{dgg~e<.## .##.#..[#P...# .###.....##### #....# #..#...P# #....###......# #.....### #.######........#{dgg{dggJll   iguana (wandering){dgg&9{dggB{dggF{dgg#................~~.~~....[..~~~~P.......~~.>..##.. ##....#P....###.  #....#.<....###.#  #.....#....#### ##....##.....##.# #.####...##<.## {dggS#.....##.#..[#P... #.....###.....##### ##....# #..l#...P##....###........# ##.....### .#.######. .........# #.##P##.##.#{dgg{dgg& a.ll{dgg '30{dggj {dgg sNo target in view!Done exploring. _No target in view! _The iguana hisses angrily.{dggQ .[..~~~~P......~~.>..##.. ###....#P....### #....#.<....### # #.....#....### ###....##.....##{dggR .# .####...##<.## #.....##.#..[#P... ##.....###.....##### ###....# #...l#...P# #....###.........# .##.....#### #.#.######. ..........# ##.##P##.##.#  #######.######{dggFT {dgg a yl.1{dgge {dggi {dgg[~ D.....~~.>..##.. .###....#P....### .# #....#.<....### .# #.....#....##.# .###....##.....##.# ..####...##<.## .##.....##.#..[#P... .##.....###....l##### .###....# #....#...P# .###....###......# ..##.....####.#.######. ...........# ###.##P##.##.# # #######.####{dgg4 ]## ##.###..#.##..#{dgg {dgg .=2{dgg {dgg 4 _You block the iguana's attack.{dgg >..##.. #.###....#P....###. #.# #....#.<....##. ..# #.....#....##. ..###....##.....##{dgg . #..####...##<.## #.##.....##.#..[#P... ..##.....###....l##### ..###....# #....#...P# .###....###......# ...##.....###.#.######. ..............# .###.##P##.##.# #######.###### ##.###..#.##.. ### ###.####.#{dgg {dgg* &3{dgg{dggWS _The iguana barely misses you.|dgg:|dgg+8 (0.8|dggN|dgg _You hit the iguana but do no damage. The iguana barely misses you.|dggRw  You hit the iguana. You burn the iguana.|dggS-4.7 (0.9|dggZ[|dggf^^ _The iguana is heavily wounded.|dgg  You hit the iguana but do no damage.The iguana is heavily wounded.|dgg-5.5 (0.8|dgg|dgg4 _You block the iguana's attack.|dgggP  You slice the iguana!! You burn the iguana.|dgg_qE†|dggt0=6.3|dgg ||dgg}J _You kill the iguana!|dgg |dgg |dgg |dggy H _No target in view!|dggC |dgg?E |dggG |dggx :0|dggn |dgg E _Done exploring.}dgg}dgg}dggО}dgg}dgg}dgg}dggpE _Done exploring.}dggw3}dgg}dgg!4}dgg(}dgg+E _Done exploring.}dgg }dgg& Where to? (Tab - Lair:3, ? - help) D - DungeonT - Temple L - Lair  A - Shoals  N - Spider Nest O - Orcish Mines V - Vaults}dgg!m}dggܣ(.............>..##............... deadiverson the Carver #.###....#P....###............... Human of the Shining One ****** #.# #....#.<....##............... Health: 111/111 ======================== ..# #.....#....##...............# Magic: 14/14 ======================== ..###....##.....##..............# AC: 21Str: 17 #.##.....####...##...........<.## EV: 14Int: 11 #.##.....##.#..[#P.............# SH: 16}dggDex: 15 ..##.....###....†..........##### XL: 14 Next:  2% Place: Lair:2 ..###....# #....@......#...P#Noise: ==-------  Time: 19336.3 (0.0) ..###....###................#a) +0 scimitar (flame) ...##.....##...............##Throw: 6 darts (poison) ..#.#.######...............# ...........................# .###.##P##.#.............#.# ## #######.#...........#######.###..#.##..#### ###.####.#You slice the iguana!! You burn the iguana. _You kill the iguana! _No target in view! _Done exploring. _Done exploring. _Done exploring.}dggɦ}dgg}dgg}dgg}dgg: _}dgg}dggo}dgg}dggX}dggA}dgg}dgg9}dggD}dgge}dgg}dggn}dgg}dggF}dgg}dggW}dggh}dgg}dgg}dgg}dgg}dgg}dgg}dgg<}dgg}dgg}dgg}dgge}dgg }dgg Y  There is a stone staircase leading down here.}dgg% }dggU }dgg $ _}dgg }dgg_ %--}dgga --You climb downwards.  You hear a distant snort.}dgg /  --more--~dgg܄- ## .# ... .# ...# ###.P .... ...# ~dgg#..#...# ##..#..##  #.......##### 3   #.#.#.#.##..#  # #.. #  ...S ....P ##..### S   water moccasin (asleep) ..## ### ~dgg~dggMSS~dgg.46.1 (9.8~dgg~dgg0  Hark! There is a gateway to a gauntlet on this level. Find the entrance quickly_before the gate is sealed! _There is a stone staircase leading up here.~dggO ~dgg URead which item? ~dggӢ MScrolls  g - 4 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesia  O - a scroll labelled XEPREURAUKKV - a scroll of enchant armour [!] read|quaff|evoke[?] describe selecteddgg dgg dgg 0deadiverson the Carver##.#Human of the Shining One ******... .#dgg uHealth: 111/111 ========================...# ###.PMagic: 14/14 ========================.... ...#AC: 21Str: 17#..#...#EV: 14Int: 11##..#..##SH: 16Dex: 15#.......#####XL: 14 Next:  2% Place: Lair:3#....@......#dggn Noise: ---------  Time: 19346.1 (0.0)#.#.#.#.##..#a) +0 scimitar (flame)# #.. #Throw: 6 darts (poison)...S....P##..###S   water moccasin..##### _There is a stone staircase leading down here.  You climb downwards.  dggҕ You hear a distant snort.Hark! There is a gateway to a gauntlet on this level. Find the entrance quickly_before the gate is sealed! _There is a stone staircase leading up here.dgg  As you read the scroll labelled XEPREURAUKK, it crumbles to dust.  You feel aware of your surroundings. You sensed 1 shop/portal.dgg$ *,**** **,* **,** *,*****,,**,**,* **##..###..####..* *,,**,*,,****,.....###.###...****,,*,,**,*,,,,...#.###.P###<.**,,,,,*,dgg^ H**,*,,,,.....?...####..,,,,,,,,, **,,*,,,,.###...**,,,*,*, *,,,,,,,,..####****,**** ,,,,,,,,,##*,,** *,,,*,,**##*,,,* *,,,**,* ##****,,* *,,,**,* ##.####.S.#...#,,*,,,* ,,,**,,**##.............,,,,,** *,,,**,,*##.P#P....P##.#****** *,,,,,,,,.#.##P.# ,,,,,,,,,......####.# ,,,****,*#..#..#####.# ,,,** **,******* **,*dgg +7.1 (1dggM dgg _It was a scroll of revelation. _Found a scroll of vulnerability. Found an escape hatch in the ceiling.dggdggdgg2dggF _Unknown command.dgg4dggdggbF _Unknown command.dgg dgg Level 3 of the Lair of Beasts <<<<>>>>∩(Press ? for help)**,** **,*** **** *,,,,,,,,* *****,,**,,,**,,****,** *,** *,**,,,*****,,******,*,,* *,,,,,,**,,,***,** *,,***,,***,***,,**,**,,**************,,,,,* *,,,,*****,** *,,* *,,,,,,,**,,** dggv *,,**,,,,,,,,,,**,**,,**,,,*,** *,**** **,* **,** *,*****,,**,,* **,,,,,,,,,,,,,,,,,,,****,,*** **,* **##..###..####..* *,,**,,* **,,,,,,,,,,,****,*,,,,**,,,,* *,,****,.....###.###...****,,*,,** *,,,,,,,,,,,,* *****,****,,,* **,*,,,,...#.###.P###<.**,,,,,*,** ****,,,,,,,*** *,,,* *,,,* **,*,,,,.....?...####..,,,,,,,,,,* **,,,,,** ********,** *,,********,,*,,,,.##..#...###...**,,,*,*,** **,,,,* *,**,,,,,* **,,,,,,,**,,,,,,,,..##..#..######****,******,,∩,** *,,,,,,,,* *,,,,,,,,,,,,,,,,,,###.......##### *,,*****>** **,*,,**** **,,,**,***,,,*,,**###....@......# *,,,***,,** *,**** ***,**** *,,,**,* ###.#.#.#.##..#****,,**,,,,* *,,**dgg *** **,,,**,* ##.####.S.#...#,,*,,,***,,,* *,,,**,,,**,,**##.............,,,,,****,,* *,,****,,,**,,*##.P#P....P##.#*******,** *,****,,,,,,,,.#.####..###P.#*,* **,************** *,,,,,,,,,........#####.#*,* *,,,**,,,,**,,*,*** *,,,****,*#..#..#######.#**,* *,,,,,,,,,,,,,,,,,***,,,** **,******* **,***,,** *,,,**,****,**,*,,,***,,,* ****,,***,*,,* ******** ******,,,* *,,*****,,***,<****,** *,**,***********,**dggN@#dgg+ <##dggW<#.dgg 7..dgg7..dgg d 7#.dggr 7##dggQ 7*#dggB 7**dggE 7,*dggx 7,,dgg?> 7*,dgg 7**dggF, 7,*dgg 7,,dggA^7,,dggJ7*,dgg7 *dgg-  dgg1-  dgg-  dgg-  dgg`[7* dggA,*dggmA,,dggA,,dggcA,,dgg4A*,dggcA,*dgg{@,,dggL@,,dggO@*,dgg[@**dgg3 *,** *,,*,***,,*******,*,*,** *** *,,***,,,,,,,,,,,*********,** ,*dgg:,*dgg[^:**dgg:*,dggZ :,,dgg ;,,dgg7 ;,*dgg;*,dggSQdggcq *,**** **,* **,** *,*****,,**, deadiverson the Carver**,* **##..###..####..* *,,**, Human of the Shining One *******,,****,.....###.###...****,,*,, Health: 111/111 ========================**,*,,,,...#.###.P###<.**,,,,,*, Magic: 14/14 ========================dgge**,*,,,,.....?...####..,,,,,,,,, AC: 21Str: 17 **,,*,,,,.##..#...###...**,,,*,*, EV: 14Int: 11 *,,,,,,,,..##..#..######****,**** SH: 16Dex: 15 ,,,,,,,,,###.......##### *,,**XL: 14 Next:  2% Place: Lair:3 *,,,*,,**###....@......# *,,,*Noise: ---------  Time: 19347.1 (0.0) *,,,**,* ###.#.#.#.##..#****,,*a) +0 scimitar (flame) *,,,**,* ##.####.S.#...#,,*,,,*Throw: 6 darts (poison) ,,,**,,**##........dgg:f[40m.....,,,,,** *,,,**,,*##.P#P....P##.#****** *,,,,,,,,.#.####..###P.#S   water moccasin ,,,,,,,,,........#####.# ,,,****,*#..#..#######.# ,,,** **,******* **,*As you read the scroll labelled XEPREURAUKK, it crumbles to dust.  You feel aware of your surroundings. You sensed 1 shop/portal. _It was a scroll of revelation. _Found a scroll of vulnerability. Found an escape hatch in the ceiling. _Unknown command. _Unknown command.dggfdggndggqdggm **,* **##..###..####..* ,,****,.....###.###...****,,*,*,*,,,,...#.###.P###<.**,,,,,*.....?...####..,,,,,,,, **,##..#...**,,,*,* *,,,,,,,,..##..#..######****,**** ,###.......##### *,,** *,,,*,,**<......dgg ,*,* ###.#.#@#.##..#****.####.S.#...#,,*, ,,,**,,**##.............,,,,,* *,,,**,,*##.P#P....P##.#******,,,,,.#.####..###P ,.......#####****,*#..#..## **,###### *,,,* *** *,,**dgg ..###.###....###.P###<..###...###.....###########.#.#@#.##..###.####.S.#...###......##.P#.#.#P.#........#####.##..#..#######.##############.#dgg 3=8.1 (1dggT dgg. k  You feel aware of your surroundings. You sensed 1 shop/portal. _It was a scroll of revelation. _Found a scroll of vulnerability. Found an escape hatch in the ceiling.Unknown command. _You block the water moccasin's attack.dgg  You slash the water moccasin! You burn the water moccasin.  The water moccasin is severely wounded.dggS 4==9 (0.8dgg dgg < _You block the water moccasin's attack.dgg  You closely miss the water moccasin.The water moccasin is severely wounded.The water moccasin bites you but does no damage.dggDe08---9.8 (0.9dggΐdggW3 _The water moccasin bites you.dggih  You barely miss the water moccasin.The water moccasin is severely wounded.9dgg;jB---50.6 (0.8dgg>odggrF _The water moccasin bites you but does no damage.dggE_  You slash the water moccasin! You burn the water moccasin.dggF†dggE-3=dgg 1.4dggIdgg!R _You kill the water moccasin!dgg^PdggQdggXdgg[H _No target in view!dgg M *,**** **,* **,** *,*****,* **##..###..####..* *,,**,,****,.....###.###...****,,*,...#.###.P###<.**,,,,,*  **....?#..,,,,,,,, *dggK 2*,,*,,,,.##..#...###...**,,,*,*, *..##..#..######****,**** ,,,,,,,,,...####*,,**###....@......# *,#.#.#.#.##..#**** *,,,**,* ##.####.†.#...#,,*,,, ,,,**,,**##.............,,,,,**P....P##.##dggW dggY =--2.4 (1.0 _dggg dgg a _There is a stone staircase leading up here.dggZ+HM,,,*****,** *,,* *,,,,,,,**, *,**** ##,* **.#* *,*****,* **##..###..####..* *,,**dgg,A,,****,.....###.###...****,,*,...#.###.P###<.**,,,,,*  **....?#..,,,,,,,, **,,*,,,,.##..#...###...**,,,*,*, *..##..#..######****,**** ,,,,,,,,,##### *,,*,,**###....<......# *,#.#.#.#.##..#**** *,,,**,* ##.####.†.#...#,,*,,,*..###..#####dggO3dgg4I11=--dgg5&3 _dgg;dgg @dggM,,**,,,***,** *,,***,,***,,,*****,** *.P* *,,,,,,,**, *,**** ##,* **.#* *,****dgg*,* **##..###..####..* *,,**,,****,.....###.###...****,,*,..#.###.P###<.**,,,,,*  **....?#..,,,,,,,, **,,*,,,,.##..#...###...**,,,*,*, *..##..#@.######****,**** ,,,,,,,,,...##### *,,*,,**###....<......# *, *,,,**,* ###.#.#.#.##..#****,,*.#.......#..##dgg8dgg&4dggdggdgg>g *****,,**,,,**,,****,** *,** * *,,,,,,**,,,***,** *,,***,,*** *,,,,****#,** *.P* *,,,,, *,**** ##.* **.#* *,*****,,** **,* **##..###..####..* *,,** *,,****......###.###...**** **,*,,,....#.###.P###<.**,,,,,*  **,*,,,......?...####..,,,,,,, ***,,*,,,,dgg i.###...**,,,*, **,..##..##****,*** ,,,,,,,,,,###.......##### *,,** **,,,*,,**###....<......# ,,,*  *,,,**,* ###.#.#.#.##..#****,,* **,,,**,* ##.####.†.#...#,,*,,,**##.............,,,,,** **,,,**,,*##.P#P....P##.#****** **,.#.####..###P.#dggdgg&5dggdggdgg *** *,,***,,,,,,,,,,,******* *****,,**P,,**,,****,** *,**  *,,,,,,**.,,***,** *,,***,,** *,,,,****#.** *.P* *,,,,, *,**** ##.* **.#* *,*****,, **,* #*##..###..####..* *,,* *,,***#......###.###...**** **,*#.###.P###<.**  **,*,,.......@...####..,,,,,,,dgg**,,*,,...#.###...**,,,*, ,**,..##..##****,** ,,,,,,,,,,,###.......##### *,,** ***,,,*,,**###....<......# ,,,* * *,,,**,* ###.#.#.#.##..#****,,*  **,,,**,* ##.####.†.#...#,,*,,,*  *##.............,,,,,**  **,,,**,,*##.P#P....P##.#******dgg dgg&6dggdggdggbG=7.4 (2dggcdggJ _ _g - 5 scrolls of vulnerability (gained 1)dgg *****,,**P,,**,,****,** *,** *,,,,,,**.,,***,** *,,***,,****,,,,****#.** *.P* *,,,,,,,**,*,**** ##.* **.#* *,*****dgg9**,* #*##..###..####..* *,,**,,***#......###.###...****,,*,**,*,,.....#.###.P###<.**,,,**,*,,...........####..,,, ***,,*,,...##..#@..###...**,,,*,*,,,,,,,,..#######****,*** ,,,###..... *,,** **,,,*,,**###....<......# *,,,*  *,,,**,* ###.#.#.#.##..#****,,**,,,**,* ##.####.†.#...#,,*,,,* *,,,**,,**##.............,,,,,** *##.P#P....P##.#******dggZ][39;49m **,,,,,,,,.#.####..###P.#dggdgg+8.4 (1dggm dggdgg *,,,,,,**.,,***,** *,,***,,***,*,,,,****#.** *.P* *,,,,,,,**,,*,**** ##.* **.#* *,*******,* #*##..###..####..* *,,**,*,,***#......###.###...****,,*,,**,*,,.....#.###.P###<.**,,,**,*,,...........####..,,,,,,,,, **,,*,,...##..#...###...**,,,*,* *,,,,,,,,######****,*** ,,###..... *,,** *,,,*,,**###....<......# *,,,* dggs V,,,**,* ###.#.#.#.##..#****,,* *,,,**,* ##.####.†.#...#,,*,,,* ,,,**,,**##.............,,,,,**##.P#P....P##.#******,,,,,,,,.#.####..###P.# ,,........#####.#dgg+ dgg. &9dgg dgg dggp>  ****#.** *.P* *,,,,,,,**,dgg@ Y**** ##.* **.#* *,*****,,****,* #*##..###..####..* ,,***#......###.###...****,,*,*,*,,.....#.###.P###<.**,,,,,*........####..,,,,,,,, **,##..#...**,,,*,* *,,,,,,,,..##..#..######****,**** ,###....@..##### *,,** *,,,*,,**<......# *,,,*,* ###.#.#.#.##..#****.#.......#..## ,,,****,*#..#..#######.#dggF dgg-G '60dggJ dggL dggS **** ##.* **.#* *,*****,,****,* #*##..###..####..* ,,***#......###.###...****,,*,*,*,,.....#.###.P###<.**,,,,,*.........####..,,,,,,,, **,##..#...**,,,*,* *dgg,,,,,,,,..##..#..######****,**** ,###.......##### *,,** *,,,*,,**....# *,,,*,* ###.#.#.#.##..#****.####.†.#...#,,*,..###..##### ,,,** **,#############.#dggdgg&1dggLdgga _There is a stone staircase leading up here.dggdggedggdgg dgg=-2 _dggdggE#....................P......~≈≈≈#..........#.....####......P~≈≈≈##.#..P###.##....###.......~≈≈~≈ # ###.P## #.##....##.......~~≈≈~. dgg # #....###.##.....#........~.≈~. # ##.#........................~~ #####.......................[..~~ .........................~2 dgg/............dgg0##............ dgg..##.###....#P....###............ dgg..##.# #....#.<....##............ dgg÷##..# #.....#....##............. dgg..#..###....##.....##............ .###.##.....####...##...........< dgg\=..##.##.....##.#..[#P............ ..#..##.....###....†..........### ..#..###....# #...........#...P#dggOdggdggh^-3.9 (2.5dggedggj} _You climb upwards. _There is a stone staircase leading down here.dgg4dgg)LLevel 2 of the Lair of Beasts <<<<>>>>>>^(Press ? for help)#...^..^^..^.# #..........................÷..........### ##..##~...~#...##....^..^....# #.......................................###.#.~~~~>.~....###..^^......^.# #...........................P~~~.......÷.......~~~..~##..###..^^^.^>^..^.# #....................P......~≈≈≈..........#...##.~~~##~...###..^.^...^...# #..........#.....####......P~≈≈≈≈P..P....##....#~#.#~#....##....^.^^....# ##.#..P###.##....###.......~≈≈~≈~~~.....##.##...##~##....####.^^..^.....## ###.P## #.##....##.......~~≈≈~.≈~.P....#####P...........###....dggXS^^......# #....###.##.....#........~.≈~.....P....# ###.#...#.##.P##.....^......# ##.#........................~~.~~.....## ###############...........#####.......................[..~~~~P.....###.....#......................................~~........###....##.....................@..##..................#..###...##.#.....##.###....#P....###....................###....#..#..#..##.# #....#.<....##...............#.#...#########....#...#..÷##..# #.....#....##...............####..........###.........#..#..###....##.....##..............# ###.#####.###.......###.###.##.....####...##...........<.## ### #.##....P..# #..##.##.....##.#..[#P.............##.###.....## #..#..##.....###....†..........#######.######P...#.####..#..###....# #...........#...P##..##..........#.....#..###....###................##..##...............#....##.....##...............####.####..................#.#.######...............##..#dgg[S.@dggd; A..dgg A..dgg*- A..dgg @..dgg @..dgg @..dgg @..dgg #.......^.^^.###...........##PP.....#.......÷.......## ##.#~#~~~.##..##dggC 5..dggw: " dgg: #.....^.^....##.........#..#####.#...................# #...#~#.###....#..dgg% #..######..#.###...........####.#..............#....## ##...##.##....##..dgg5. #.## ###### #P.#........÷...........P..÷##.#.....P# ####............#Pdgg5%.dgg}6 ###dgg####...........[..#..........####....## ##....#..........##PdggL- ##..............##..P#...<##≈##....## #.............#P####dggr #.^.............##..###...##≈≈#.....###............####.#dggA ##...#.......######## ###≈≈≈≈........####.........##dgg5[.dgg ##...........###≈≈≈..####### #........P#.[dgg dgg$x##............######≈..##........##dgg:.dggb%.dgg% dgg##.....#.....:.#####..##~.##### #........##.dgg ########..##..........# ##.†÷...#≈.#...#### #........###dgg"dggh  ####P#P.P## ### ##...###.......# ##..†###.#~≈##.....# #......>.###dggdgg8  #.........###.# #..)..####....## ###...## #≈÷≈≈≈###...# #........##dggk%#dgg}s  ##........##..# #...:...##...## #≈≈..## ###~≈≈####≈.####........####dgg  ###........##..####.....#......# ##≈~..#####~~≈≈###~≈≈...##.........##dggz%#dggv?  #.#.(.......#...P..#....##.#...### #≈~≈≈..~~~†~†≈~~~##~≈...##........####dgg1  ##.........#........#.....##.....###≈~≈≈~~~####†~##~~~≈.....#........###dgg  ##.........#........#...####P...#~#~≈≈.#### ##..#####≈...###........###dgg`  #........##.............# ##...#≈~≈≈...~# #....# #....###.^......#.#dgg=<  #.........P............## ##...##≈~≈≈≈### ###..# ##.....#........#..dggJ  #............P####.....# #.#.P###~..≈≈# #### #.[...#........##.dggm  #........P...## ##....####################################........# #dggE  #.........#..#####........# ##.#.##...............P.##....#........## dggp  #........##...#.##........###........................#.............###dgg[  #.........#................##.......................#..............#.#dggp  #........#...#.###.........##..####..................#....P........#..dgg  ##........#...P.# #........###.## #............P..#P.##....##....##.#..dgg[  #.........##....###........###.####P...~~~≈~..##.................####..dggE  #................##........##..#.......~≈#≈~...#...............###..dggtq  #...............#....>......##.........~≈#≈~...#...............#.dggq%.dgg)^  #.........#.P#.####............†.......~≈#≈~..##...............#.dgg^$.dgg~  ##.........##### #....................~#≈≈~......#.#..#.###..##..dgg   #..........##..................<.~~~~~.>.....####### ##.#>.dggGdgg? #....................P......~≈≈≈ deadiverson the Carver#..........#.....####......P~≈≈≈ Human of the Shining One ******##.#..P###.##....###.......~≈≈~≈ Health: 111/111 ======================== dgg S# ###.P## #.##....##.......~~≈≈~. Magic: 14/14 ======================== # #....###.##.....#........~.≈~. AC: 21Str: 17 # ##.#........................~~ EV: 14Int: 11 #####.......................[..~~ SH: 16Dex: 15 ................................~ XL: 14 Next:  3% Place: Lair:2 ................@..##............ Noise: ---------  Time: 19363.9 (0.0) ..##.###....#P....###............ a) +0 scimitar (flame) dggaH..##.# #....#.<....##............ Throw: 6 darts (poison) ÷##..# #.....#....##............. ..#..###....##.....##............ dgg.###.##.....####...##...........< ..##.##.....##.#..[#P............ ..#..##.....###....†..........### ..#..###....# #...........#...P# dggQ_No target in view! _There is a stone staircase leading up here. _g - 5 scrolls of vulnerability (gained 1) _There is a stone staircase leading up here. _You climb upwards. _There is a stone staircase leading down here.dgg۩dggdggdgg*dgg$ _dggdggEdggdggdggdggBdggdgg(dgg3dggdgg@dggdggdggdggdggdggdggBdgg<dggdggxdggdggB dggdgg<dgg|dggdggdgg,dgg"!dggq,dgg0dggQ0dgg2dggp:dgg=,dgg(@dggFdggLBdggQdggRdggRdgg[TdggZZdgg\,dgg]dggjXdggldggndgg0odggRpdggudggxdggDxdggydgg~dggȀdggdggdgg*dgg,dggOdggdgg,dggdggdgg4,dggܠdgg dggL,dggidggdgg%,dggdggrdgga,dgg/dggdggdggdggdggpdgg,dggYdggDl  You see here a book of Wicked Creation.dgg=dggK _dggXdgg,dggdggdggdggdggdgg,dggdgguBdgg-dggdggkdggdggdgg dgg?,dggdggdggwdggdggdggdgg*Bdggdgg ,dgg!dgg!$dgg'Bdgg,dggS.dgg|.dgg/dgg7ndgg8dgg9dgg9dgg;dgga=dgg=dgg>dggBBdgg1CdggM ##### ### ## .##### #####.########.# ## .....## ....##..####. ......# #.< ......##### #.....#.P#.####†........#....##405.9 (42.0)..........##........##..#...##....###........###.####P .....#...P.# #........###.## #...#...#.###.........##..#### ......#................##. ...##...#.##........### ....#..#####........# ##.#.##.. ...P...## ##....############## dggN<dggqy _There is a stone staircase leading down here.dgg: 4dgg dggҢ dgg 86.9 (1.0) _dgg dggmO  You climb downwards.  You hear a distant snort.dgg/  --more--dgg  **,,,* *,,,*  *#..* *,,**  #.#* *,**    #.# **,********    #.# *,,,**,,,,*    ##.# *,,,,,,,,,, dgg  #*..## *,,,**,****   #.#YP# ******** *3   *#Y@#*   *#YYP#   #.#.##**   *#Y...,,* ***   *.,...,,* *******,,   #.#....,* *,,,,,,,, YYYYY 5 death yaks (asleep)   #,.#..#,*****,,,,,**,   **,##>..,,,,,,,,***,**   *,,,,**,,,****,** ***  Hark! Thdggoere is a gateway to a gauntlet on this level. Find the entrance quicklybefore the gate is sealed!dggxdgg   You hear the loud beating of a drum very nearby.The death yak bellows! x4; You hear a bellow!dggidggS YYYYdggeY...YYYYYYY 6 death yaksYou block the death yak's attack. x3  A death yak comes into view.dgg`}00---====7.7 (1.8dggڱdggݲdgg/  --more--dgg _The death yak gores you!  Found a stone staircase leading down. _There is a stone staircase leading up, spattered with blood here.dggD dggE dggO dggT > _Unknown command.dggP 4dggb dgg\ > _Unknown command.dgg dgg dgg` dgg E _You can't go down here!dgg)dgg+dgg4dgg<>P  The death yak gores you but does no damage.dgg Y.You block the death yak's attack. The death yak closely misses you.dggA88/111 -----==--80dgg dggIJ  ##  ### ### ## .##########.########.# ##. dgg.....###.........##..####.. ......##..................< dgg......##### #................... .....#.P#.####...Y........†......dgg2 dgg...........#...Y@Y.....##........ ............##...Y....##..#...... dgga.....##....###........###.####P.. dgg5.....#...P.# #........###.## #... dggM.....#...#.###.........##..####.. ......#................##........ 4dggd  dggs.....##...#.##........###........ dgg......#..#####........# ##.#.##.. .....P...## ##....############## dgg6_The death yak gores you!dggmB----dggqdgg)7--10.2 (2.5dgg5dgg;} _You climb upwards. _There is a stone staircase leading down here.dgg(dgg9--dggdggF _Unknown command.dggm  ######### # #.##########.########.# ......## #.........##..##..# #.........##### #..P#.####...Y†.......#...Y>Y.....##...##.@.Y###....###........###.####P.#...P.# #.###.## #.#...#.###dggVn ..##..####..#.......##.....#...#.###..#..#####.# ##.#.##P...## ##....#############.....P##.# #.#.P###~.dggq dgg6t %  dggt (The death yak attacks as it pursues you!dggw P  The death yak gores you but does no damage.dgg< I.Y.Ydgg =9=1.2 (1.0dgg dgg 7 _You block the death yak's attack.dggK   ###  ### ### ##.### #####.########.# ## ###..####.# #..##### #.#.P#.####......†#.dgg..##.........##..YY....##..#....##....###.###.####P.#...P.# ##.## #.###.##..####..#........##dgg#...#.##.###.......#..#####........# ##.#.dgg(WP...## ##....############dggdggdggdgg\<YY.dggg77---=2dggdgg . _The death yak gores you!dgg!X# .#### ### ####.##### #####.#.# .## #.##...# #.##### #.#.P#.####.†.#.@.YY......##.##.YY.....##..#.##....###.###.####.#...P.# #.###.## #.#...#.###.##...#........##.##...#.##.###.#..#####.# ##.#..P...## ##....dgg]dggS^dgg `dgg`dgglqYYYY>..dggfm/--3dggwdggzdgg# #.#### ### ### dgg.###.##### #####.#.#.## #.........##...# #.. #dgg%~.##### #..#.P#.####YY.†dggG.#@.YY>......##.##.##..#dggõS.##....###..###. #.#...P.# #........###.## #.#...#.###.........##.. #.#................## #dgg.##...#.##........### #.#..#####........# ##.#. #dggL.P...## ##....dggdggCdggdggR4YY.dgg\g8-----4dggdggdggq '###.#########.##########.########. #.........## #.........##. #..# #...... ##..##### #.#.P#.####YY† #.......#.YY.>##. #dgg=s .......@##.....# ####........###.## ##.#...P.# #........###.  #.#...#.###.........##..#  #..#................##...  ###...#.##........###  #..#..#####........# ##.#  #P...## ##....#########  #.....P##.# #.#.Pdggaw dggvx dggy dggy dgg {..Y 3dggW &5dgg dgg dgg dgg zYY 4 death yaksdgg^5=6.0 (0.8dgg\dgg3 _You hit the death yak but do no damage. The death yak closely misses you.dgg}U  You slash the death yak! You burn the death yak.dgg^~dgg0s. 3dggی_79==8dgg)dggd _The death yak is moderately wounded.dggv  You slash the death yak! You burn the death yak.  The death yak is heavily wounded.dggCwdgg8Ydgg-7.7 (0.9dgggdggA _The death yak gores you but does no damage.dgg  You slash the death yak! You burn the death yak.  The death yak is severely wounded.dgg_-8.5 (0.8dggʚ$ dgg)_You block the death yak's attack.dgg  You hit the death yak but do no damage.The death yak is severely wounded.dgg! dgg1+ dgg, k80=-9.3dgg5 dgg#: A _The death yak gores you but does no damage.dgg}  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dggh C-20.1dgg dgg 7 _You block the death yak's attack.dggV  You slice the death yak!! You burn the death yak.dggu† 2dggI75==9dgg]dgg5M _You kill the death yak!dgg+cG#   #  ### ### .###.##### #####.######## .## #.##..## ...# #..##### #.. .#.P#.####......† .......#@YY.>.... ...Y.......##..#.. ..##....###........###.# #.#...P.# #........###.## #.#...#.###.........##..## #.#................##.Y 3 death yaks #.##...#.##........###.... #.#..#####........# ##.#. #.P...## #########dggamdggn>1--1.9 (1.0dgg,xdgg} _You block the death yak's attack. _You see here a death yak corpse.dgg3  You slice the death yak!! You burn the death yak.  The death yak is moderately wounded.==2.7 (0.8dgg>dggD7 _You block the death yak's attack.dgg K###.#########.##########.########. #.........## #.........##. #..# #dgg% ...... ##..##### #.#.P#.####† #.......#†YY.>##. #.......@##Y....# ####........###.## ##.#...P.# #........###.  #.#...#.###.........##..#  #dggc n..#................##...  ###...#.##........### 2  #dgg ..#..#####........# ##.#  #P...## ##....######### dggǩ z #.....P##.# #.#.Pdgg( dgg® dgg dgg: Y.Y 3 death yaksdgg 7---3.7 (1.0dgg dgg5 dgg%]  You hit the death yak. You burn the death yak.  The death yak is moderately wounded.dgggs. 2dggbh_2=--4.5 (0.8dgg8qdggt7 _You block the death yak's attack.dggz _You block's attack.  You hit the death yak. You burn the death yak.  The death yak is moderately wounded. _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is moderately wounded.dgg[%{YY 3 death yaksdggB&(5.3dgg[0dgg-6w  You hit the death yak. You burn the death yak.  The death yak is moderately wounded. _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is moderately wounded. _You block the death yak's attack.dggIn _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is moderately wounded. _You block the death yak's attack.  You slice the death yak!! You burn the death yak.  The death yak is severely wounded.dggo1==6.1dggydgg|A _The death yak gores you but does no damage.dgg?l  You hit the death yak but do no damage.dgg s. 2dgg73--9dggdggb _The death yak is severely wounded.dggOP  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dggs]YY 3 death yaks--7.7dgggdggmW _The death yak closely misses you.dgg#j  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dggv s. 2dggw (8.5dggQ dgg 7 _You block the death yak's attack.dggEI  You slash the death yak! You burn the death yak. 5/113=8==9.3 _You kill the death yak!dggdgg j _Your Fighting skill increases to level 11!dggt  You slash the death yak! You burn the death yak.  The death yak is lightly wounded.74----30.2 (0.9dggkdgg. _The death yak gores you!dgg  You slash the death yak! You burn the death yak.  The death yak is moderately wounded.dgg?5---dgg+)-1.1dgg dgg7 _You block the death yak's attack.dggU  You slash the death yak! You burn the death yak.dggp3=9 (0.8dggdggb _The death yak is severely wounded.dgg[  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dgg\g6---2.7dggfdgg;l. _The death yak gores you!dggX  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dgg 6=---3.6 (0.9dggn dgg 7 _You block the death yak's attack.dggI  You hit the death yak. You burn the death yak.  The death yak is severely wounded.dggJ G-4.4 (0.8dgg[S dggV s  You hit the death yak. You burn the death yak.  The death yak is severely wounded. _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is severely wounded. _You block the death yak's attack.dggfz _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is severely wounded. _You block the death yak's attack.  You hit the death yak. You burn the death yak.  The death yak is almost dead.dggg-5.3 (0.9dggpdgg?vW _The death yak closely misses you.dgg%  You hit the death yak but do no damage.The death yak is severely wounded.dggg[7=6.1 (0.8dggdgg57 _You block the death yak's attack.dggFl  You hit the death yak but do no damage.dggG&9dgg>sx _The death yak is severely wounded.dgg   You hit the death yak. You burn the death yak.  The death yak is almost dead.dgg(7.7dggdggKO _The death yak misses you.dgg, V  You slice the death yak!! You burn the death yak.dggV. dgg7 .   death yakdgg= U810=8.5dggYE dggG M _You kill the death yak!dgg ~  You slash the death yak! You burn the death yak.  The death yak is lightly wounded.dgg (9.3dggM dgg 7 _You block the death yak's attack.dgg }  You hit the death yak. You burn the death yak.dgg 1-40.1dgg<dggyd _The death yak is moderately wounded.dgg  You slash the death yak! You burn the death yak.  The death yak is heavily wounded.dggX/==9dggdggA _The death yak gores you but does no damage.dgg  You completely miss the death yak.The death yak is heavily wounded.dgggg5---1.7dggq%dgg(. _The death yak gores you!dggM  You hit the death yak but do no damage.The death yak is heavily wounded.dgg4Q--2.5dggdggA _The death yak gores you but does no damage.dgg=  You slice the death yak!! You burn the death yak!  The death yak is almost dead.dgg> 1==3.3dggE dggG 7 _You block the death yak's attack.dggm U  You slash the death yak! You burn the death yak.dggv g†dgg| p9--3--4.1dgg dgg< M _You kill the death yak!dgg dgg9--dggdggH _No target in view!dggdgg  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting11.3  13.5   0   j - Spellcasting   0.0   1.2  -1           b - Unarmed Combat   0.0   1.0   0      dgg0 c - Throwing   0.7   1.0   0   k - Invocations   0.0   0.8  +1       l - Evocations   0.0   1.0   0   d - Short Blades   9.0   1.0   0       e - Long Blades  14.0  18.0   0               f - Armour   8.0   9.0   0       g - Dodging  12.0  15.0   0  ggL9;49m     h - Shields  10.0  12.0   0       i - Stealth   0.0   0.8  +1                                              The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] autogg-0m|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsdgg a * Fighting  11.3dgg+ o a - Fighting  11.3dggK> k + Invocations 0.0dggk'TargetTarget15.0 --  --  10.0 --  --  --  --  --  --  --  7.0  a-z] set[-] clear selected targetcost|targetsdggz<[?25h[?0c0 dggZ" dgg^_ [?25l[?1cdggd12.0 current training targets, if any.=] set aall targetsdggdggdgg% ###deadiverson the Carver ##.######### Human of the Shining One ****** #.###.##########.########. Health: 59/113 ============------------ #.........###.........##..# Magic: 14/14 ======================== #..........##.............. AC: 21Str: 17 dggk&J##.........##### #.............. EV: 14Int: 11 #.........#.P#.####............†. SH: 16Dex: 15 #...............#†...>......##... XL: 14 Next: 13% Place: Lair:2 #...............@##........##..#. Noise: =--------  Time: 19444.1 (0.0) #.........##....###........###.## a) +0 scimitar (flame) ##........#...P.# #........###.## Throw: 6 darts (poison)#........#...#.###.........##..#dgg&#.........#................##...#........##...#.##........###... #.........#..#####........# ##.# dgg&#........P...## ##....######### #............P####.....# #.#.P# dgg&You slice the death yak!! You burn the death yak!  The death yak is almost dead. dgg'u_You block the death yak's attack.  You slash the death yak! You burn the death yak. dgg8'[_You kill the death yak! _No target in view!dgga/dgg/dgg6dgg8dggz#   #  ### ### .###.##### #####.######## .## #.##..## ...# #..##### #.. .#.P#.####......† .......#@...>.... ...........##..#.. ..##....###........###.# #.dgg| #...P.# #........###.## #.#...#.###.........##..## #.#................##. #.##...#.##........###.... #.#..#####........# ##.#. #.P...## #########dggdgg:-5.1 (1 _dggdgg  Things that are here: _a death yak corpse; a death yak corpsedgg .#### ### ### ###.##### #####.#.# ## #.........##..## #... .##### #..#.P#.####.†.#†@..>......##.##.##..#.##....###..###.# .dgg#...P.# #........###.## # .#...#.###.........##..# .#................##. .##...#.##........###. .#..#####........# ##.#.# .P...## ##....#dggdggG-6 _dggdggdgg' #### ### ### .##### #####.#.# ### #.##..## #.##### #.#.P#.####.†.dggR)#†.@.>......##.##.##..#.##....###.###.####P#...P.# #.###.## #.#...#.###.##..##........##.##...#.##.###.#..#####.# ##.#.#P...## ##....#dgg51dgg1C607dgg8dgg<dggh X ### ### # #.##### #####.#.# ### #.##..####.# #.##### #.#.P#.####.†.#†..@>......##.##.##..#.dgg ##....###.###.####P.#...P.# #.###.## #.#...#.###.##..####.#.......##.##...#.##.###.#..#####.# ##.#.##.P...## ##....#dggs dggM &8dgg0 dggH dggi  ### ### # .##### #####.#.# ##.## #.##..####.# #.<##### #.#.P#.####.†.#†...@......##.##.##..#.##....###.###.####P.#...P.# #.dgg ###.## #.#...#.###.##..####.#.......##.##...#.##.###.#..#####.# ##.#.##.P...## ##....#dggN dggmB19dgg dggQ c _There is a stone staircase leading down here.dggdggٛdggdgg&dggdgg XdggdggS2=dgg_dgga,dggdgg-,dggdggYa3=dggdgg;,dggdggBdgg94dggndggĿ,dggdgg,dggdgg5dgg95dggdgg,dggdgg|dggdgg@dggndggS6=dggdgg,dggdggdgg-K7=dggdggJ,dggdgg ,dggpdggfdgg98dggdggH,dggdggdggs99dgg#dgg,dggRdgg,dggdggP70dggdgg\,dggdgg,dggdgg dggN S1=dggN dgg6dggdggdggpdggK2=dggdgg,dggdgg,dggdggdgg1 93dgg!dgg$%,dggL&dgg(dggy(dgg+)dgg545dggI7dgg7dggB8dgg 9dgg<,dgg=dgg?dgg;@S6=dgghAdggD,dggEdggHdggIK7=dggJdggM,dggNdggQ,dggQdgg$UdggSU98dggRVdggaX,dggYdgg!],dgg]dgg`O9dggadgge,dgggdgg6idggi:80dggUjdggmdgg(ndggodggzq,dggxrdggudggvN81=dgg,wdgg+ydggydggzdgg%~,dggmdggm2=dgg^dgg',dggddgg;3dggdgg,dggdgg֒,dggdggP;4dgg\dggݚ,dggdgg,dgg dgg?dggD5=dggdgg-,dggdggdggDN6=dgg dggBdgg,dggRdggķ;7dggdggdgg_dggdgg?dggu%8dggdgg,dggdgg,dggdgg;9dggdgg(,dggdggfdggdggdggKdggL90=dggrdgg,dgg>dgg1k1=dggqdggR,dggZdgg,dggdggdgg%2dggdgg,dggUdggdggdggdggdgg_%3dggrdggq,dggWdggdgg6%4dggjdggdggdggPdggJ,dggNdggdggQ55=dggtdgg} dgg ,dggpdgg(dggU6=dggdgg>,dggdggJ,dgg2dgg;7dggdggdgg dgg dgg%,dgg-&dgg(dgg(%8dgg)dggD-,dgg<.dgg0dggL0K9=dgg1dgg4,dgg5dgg7,dgg69dgg`<q100/113=dgg=dggz?,dgg@dggC,dggDdggF;1dggGdggbK,dggLdggNdggN%2dggOdgg$S,dgg TdggV,dggVdggZdggZ%3dgg[dggE],dggh^dgg adggNadgg9bdggddggidD4=dggIedgg^h,dgg@idggkk5=dggldggo,dggpdggr,dggtdggwdggow%6dgg.xdggJz,dgg|{dgg~dgg~%7dggdgg,dggdgg|dgg…dggdgg[;8dggGdgg,dggdgg0,dggdgga9=dgg4dgg,dggdggڜdggPV10=dggdggdgg1dggdgg,dggUdggdgg%1dgg,dgg`,dggǯdgg,dggsdggdggڸ%2dggdgg[,dggݽdgg_ _You start resting.dgg"258536.0)dggZ3=67dgg8dgg" _HP restored.dggr dgg}s dggz dgg dgg 17.0)dgg؈ dgg+ =You climb downwards.  You hear a distant snort.dggN /  --more--dgg  **,,,* *,,,*  *#..* *,,**  #.#* *,**    #.# **,********    #.# *,,,**,,,,*    ##.# *,,,,,,,,,,   #*..## *,,,**,****   #.#.P# ******** *3   *#.@#*   *#Y.P# dgg  #.#.##**   *#.Y..,,* ***   *.,...,,* *******,,   #.#....,* *,,,,,,,, YY 2 death yaks   #,.#..#,*****,,,,,**,   **,##>..,,,,,,,,***,**   *,,,,**,,,****,** ***  Hark! There is a gateway to a gauntlet on this level. Find the entrance quicklybefore the gate is sealed!dggdgg|dgg Y.You hear the thunderous beating of a drum very nearby.dggV5=8.6 (2.5dggZdgg2` _The death yak gores you but does no damage. _There is a stone staircase leading up, spattered with blood here.dggA U  You slash the death yak! You burn the death yak.dgg! Y.The death yak is lightly wounded.dggk" 5=9.4 (0.8dgg+) dgg8- A _The death yak gores you but does no damage.dgg  You hit the death yak but do no damage.The death yak is lightly wounded.  The death yak gores you but does no damage.dgg 1-90.2dgg dgg 7 _You block the death yak's attack.dgg2  You slash the death yak! You burn the death yak.  The death yak is moderately wounded.dgg/30=1.0dggV:dggo>y _You block the death yak's attack. The death yak closely misses you.dgglS  You hit the death yak. You burn the death yak.dggIm.-8dggsdggwa _The death yak is heavily wounded.dgg|   You hit the death yak but do no damage.The death yak is heavily wounded.dggfw02---=2.6dggfp _The death yak gores you! The death yak closely misses you.dgg w  You hit the death yak. You burn the death yak.  The death yak is heavily wounded.dggw0-3.4dgg~dggZ _The death yak closely misses you. x2dgg  You hit the death yak. You burn the death yak.  The death yak is heavily wounded.You block the death yak's attack.dggR `3----4.2dgg dgg A _The death yak gores you but does no damage.dgga  You hit the death yak. You burn the death yak.  The death yak is heavily wounded.The death yak gores you but does no damage.dggb (5.0dggLj dggm W _The death yak closely misses you.dggfU  You slash the death yak! You burn the death yak.dgg~.=8dggVdgg%b _The death yak is severely wounded.dggX8_The death yak closely misses you.You slash the death yak! You burn the death yak. _The death yak is severely wounded.  You hit the death yak. You burn the death yak.  The death yak is severely wounded.  The death yak gores you but does no damage.4=-6.6dggdgg0V _The death yak barely misses you.dggMY  You slash the death yak! You burn the death yak.  The death yak is almost dead.dggYB-7.4dgg`dggFe: _You block the death yak's attack. x2dggzU  You slash the death yak! You burn the death yak.dggP †   death yakYou kill the death yak!dgg 5--5=8.2 _You block the death yak's attack.dggdggpl _Your Invocations skill increases to level 1!dggd |  You hit the death yak. You burn the death yak.  The death yak is lightly wounded.dgge h5=-9.0dggk dggp Z _The death yak completely misses you.dgg l  You hit the death yak but do no damage.dgg @-8dgg dgg 7 _The death yak is lightly wounded.dgg  You hit the death yak but do no damage.The death yak is lightly wounded.dgg *600.6dgg!dgg7 _You block the death yak's attack.dggT~  You slash the death yak! You burn the death yak.  The death yak is lightly wounded.dgggU@--=dggU 1.4dggt\dgg;`7 _You block the death yak's attack.dgg~k _You block the death yak's attack.  You slash the death yak! You burn the death yak.  The death yak is lightly wounded _You block's attack.  You slash the death yak! You burn the death yak.  The death yak is moderately wounded.dgg86-2.2dgg:dggV _The death yak barely misses you.dggE  You hit the death yak. You burn the death yak.  The death yak is heavily wounded.dggFh0--3.0dggLdggO. _The death yak gores you.dgg l  You hit the death yak but do no damage.dgg\ &8dgg dgg K _The death yak is heavily wounded.dgg dgge  You hit the death yak. You burn the death yak.  The death yak is heavily wounded.dggf V1-4.6dggGm dggr A _The death yak gores you but does no damage.dggM  You slice the death yak!! You burn the death yak!  The death yak is almost dead.dgg#5dgg-=====5.4dggdggO _The death yak misses you.dgg  You hit the death yak but do no damage.The death yak is almost dead.dgg1--6.2dggdggV _The death yak barely misses you.dggT  You hit the death yak. You burn the death yak.  The death yak is almost dead.dggUN98/113 ---dggV!7.0dgg\dggb. _The death yak gores you.dggYS  You hit the death yak. You burn the death yak.dgg&8dggdgg] _The death yak is almost dead.dgg5  You hit the death yak but do no damage.The death yak is almost dead.dggj E==8.6dgg dgg 7 _You block the death yak's attack.dgg7AU  You slash the death yak! You burn the death yak.dggH†dggw 89.4 _You kill the death yak!dgg#dggl _Your Invocations skill increases to level 2!dggUjdggjdggNqdggtH _No target in view!dggM,***.$,*#..,*** *,** *,******* **,,,,* ##.# ,,,,,,,dgg##..## *,,,**,***#.#@P# ******** *.<#*#††P#  #.#.##**. #.... dgg. ##>.. dggo%dgg&Y101/113=-dgg0&10.4 (1.0dgg+dgg/+ _Found 10 gold pieces.dgg|M*,,*****,..***.$,*#..,*** *,** *,******* dgg***,,,,* ##.# ,,,,,,,#.@## *,,,**,***#.#.P# ******** *##.<##  *#††P###..#..#dggdgg#3dggU=-1dgg.dggkdggJd :M*>** **,*,,*****..##****,..***.$,*#..,*** *,** *,******* **,,,,*dggd 8 ##@# ,,,,,,,##..## *,,,**,***.#.P# ******** *  ##.<#####.#...dggm dggn T4=2dggDu dggw dggr M,,∩,** *,,,,,,,,##>#* **,*,,*****..##****,...#***.$,*#..dgg4 ,*** *,** *,******* **,,,,* ##.# ,,,,,,,##..## *,,,**,***  #.#.P# ******** *#.......dgg dgg dgg dggE W5=3dgg dgg ; _Found a stone staircase leading down.dgg#'M*,,,,* *,**,.∩.** *,,,,,,,,dgg'##>#* **,*,,****#..#****,...#***.$.#,*#..,*** *,** dgg'R*,******* **,,,,* ##.# ,,,,,,,  ##..## *,,,**,****dgg)(<.##...dgg1f∩64dggx7:∩dgg ;9 _Found a gate leading to a gauntlet.dggk[M**,,,,,** ********,***...,* *,**,.∩.** *,,,,,,,,#>#* **,*,,****##..#****...*dgg\l**.$.#,*#..#,*** *,** *,******* **,,,,*  ##.# *,,,,,,,,,,dggl0#.##**dggCvdgg wdggwwM9=5dggF}dggTdgg9M****,,,,,,,*** *,,,**,...,** ********,***...,* *,**,.∩.** *,,,,,,,,*##>#* **,*,,****##..#****#...**#.$,dgg\*#@.#,**# *,** *,*******  #.# *,,,**,,,,*Pdgg6∩dggs_11=6dgg7:∩dggNdggTM,,,,,* *****,*****,.....,*** *,,,**,...,** ********,***...,* *,**dggSU,.∩.** *,,,,,,,,*##>#* **,*,,****#..#****#...**#.,##..,**# *,**  #.# **,********.<#dggc\4∩dggV]#3dgg]1=7dggnb<∩dggj:∩dggj+8.4 (2dgg"odggr? _You now have 978 gold pieces (gained 10).dgg{ M****,*,,,,,,,.......,,* *****,*****,.....,*** *,,,dgg ;**.....** ********,***...,* *,**,.∩.** *,,,,,,,,*##>#* **,*,,****#..#****#.*dggT ##.,##..,**  #.## *,**#.Pdgg| D dgg 4∩dgg dgg $9.4 (1dgg~ :∩dgg dgg M **,,,,,,,,,**,..P****,*,,,,,,,........,* *****,*****.......*** *,,,**.....#* ********,**dggC #....* *,**,.∩.** *,,,,,,,,*##>#* **,*,,****##.@##****.*##.,  ##..# *,,**dgg ..#dgg dgg@ dggi 20dgg dggз dgg M,,****,**,, ##P..,,,,,,,,**P.P****,*,,,,,,..,* *****,*****.......*** *,,,**.....#* ********,**##....# *,**#..∩.#* *,,,,,,,,*##@#* **,*,,****dgg %##..##****....#*  ##...# *,,,*#.#dgg[dgg8B=1dggdggc _There is a stone staircase leading down here.dgg6M*,,**,**,,************..##......P..,**,**,, ##P...,,,,,,,*#PP#***,*,,,,,..dgg.P* *****,****#.......#** *,,,*#.....#* ********,**#....# *,**#..@.#* *,,,,,,,,###>## **,*,,****##..#****  dgg{#....# *,,**##.#dgg dggHdggI -2 _dggdggM  There is a gate leading to a gauntlet here. _Beware, the minotaur awaits!dgg dgg/ dgg dgg dggJ C3 _dgg dgg     #.©#.#.#.   ≈..##5#©#   #..#5#.#.   ≈..##5#.#   ###..######   #≈.........  ##...###### a Gauntlet #≈.@.#....z  ##...#....z  #≈...#####+  ##.ß©#©...+ dggw P ≈...#.##.+ ##...#.# # zz 2 laughing skulls (wandering) ≈.∩.#.. 555 3 white imps (wandering)   #...####  The world spins around you as you enter the gateway.  You enter a gauntlet!dgg dggx zz1 wandering)∩The nature of this place prevents you from teleporting.dgg&s -4.1 (1.7dgg| =∩dgg! _The laughing skull gives a hideous shriek!  Found a gate leading back out of this place.  Found two transporters. Found a runed translucent gate.dgg /  --more--dgghd _There is an empty arch of ancient stone here.dgg# dgg# dgg& dgg4- dgg3 dgg4 dgg5 dgg=6 dgg6 dgg7 dgg9 dgg= : _dgg]B dggfU The white imp shouts, "Go and return not, thou mewling ditch-delivered  vulture!"  The white imp shouts!  The laughing skull gives a hideous shriek!dggnZ dgg] dggb dggc dgge dgg)i dggl dggfp dgg_s dggw 3dgg{ dggІ 7 _You hear a hideous shriek!dgg dgg P _The white imp shouts!dgg 3dgg dgg dgg dgg dgg ,dggo dgg3 dgg/ ,dgg dggz dgg8 ,dgg; dggC _The white imp shouts, "Away with thee, thou canting moldwarp snake-molt!"dggY 3dgg([ dgg_ dgg[p ,dggr dggF{ dgg dgg dgg ,dgg dgg dgg ,dgg dgg dgg dgg dgg dgg dgg3 dgg n _The white imp sputters.dgg  #########  dgg ]#§#≈#≈#§#≈#≈ ##...@.......36.1 (12.0) #§........... ##..######### dgg: &#≈..##5#.#.## dgg ##..#5#.#.#[# #§..##.#.#?#4   ice devil ##.©#5#5#.#©#55 2 white imps #≈..##4#©#dgg .## ##..#.#.#.#.dgg dgg dgg [§#§§##§dggY ≈..##54.dgg ,7.1 (13dgg dgg~ * _Found a transporter.dgg dgge dgg: dgg dggb ,dgg dgg dggB dgg3 dgg dggG dgg),dggtdggadgg1,dgg4dgg;;dgg#FdggJdggKdggMdggSdggϗdggdgg dggdggڬdggdggdggldggdggdggTdggdggdgg8dggdgg dgg~ _The white imp summons a swarm of flies.dggdggdgg"3dgg[%dgg-dgg;dggI@dggdggBdgg^ dggdgg dgg),dgg,dgg*3dggr=dgg|?dgg5E,dgghGdgg^Pdgg\dggf`dggedggJfdgggdggodgg,dggdggdgg",dggdggK _The ufetubus shouts! You hear a shout!dgg,dgg,dggydgg.,dggdggdggdggdggdgg` .............#≈# §.#########....### ..##5#5#5##.....≈# ..#5#5#5#4####..## ..##5#.#5##..#..§# dgg.©#.#.#.#5#©.#..## ..##.#©#.##..#..≈# # ..#.#.#.#.#..#..##≈##..# ..##.#.#.##..##54.1 (17 ..#########..#..# dgg..........#..## ..#########..#..#5#.#.. ∩.#zz.....#..#.#.©5.... dgg..#z......#..## #.#.##. ..#####+###..# .#.#    white imp ß©#©...+ ©#©©# ## # 55 2 ufetubi (1 wandering) ..#.##.+dggG dgg}5.5dgg,5.1 (18dgg)dggo.- _Found two transporters.dggdggdggdggdgg dgg,dggdgg*$.#≈# ##....### ##5#5#5##.....≈# #5#5#5#4####..## ##5#.#5##..#..§# #.#.#.#5#©.#..## © ##.#©#.##..#..≈### #.. #dgg+).#..##≈##..#.. ##.#.#.##..#....@....#..6.0) ##..#..#..#..##.. ##dgg%,..#..#5#5#..#.. #zz.....#..#.#.©.....#.. #z......#..##.#.#.##.#..55 2 ufetubi #####+###..# ...#.# #.. #©...+ ©#©©## .#### #©© dgg, dggz>dggz?+7.1 (2dggGdggL- _Found two transporters.dggZ3dgg\dggbdggm#≈# ....### 5#5#5##.....≈# # 5#5#5#4####..## ##5#.#5##..#..§# ..# .#.#.#5#©.#..## #.©#dgg>n.#©#.##..#..≈### .#..# .#.#.#.#..#..##≈##..#..#.#.#.##..#.....@...#..#0..#.#..##..#..#dggn..#..#5#5#..#..# zz.....#..#.#.©.....#..# z......#..##.#.#.##.#..#dggnS5 3 ufetubi (1 wandering)+###..#....#.# .#..# dggno©...+ ©#©©## .#### 5#©©# .##.+dggw9  Found a transporter.dgg{dggr55©dgg+8.1 (1dggޒdgg˖* _The ufetubus shouts!dgg>dgga?dggHAdgg HdggbMdggNdggTdgg^XdggXdgg]dgg^dggybdgg\ddgg fdgggdggidggkdgg]rdggrdgg5udgg{dggadgg:dggdggdggKdggdggpdggAdggdggsdggdgg.dggdggLdggdggIdggdggdggdggdggVdggCdggdgg,dggxdggdgg ,dgg3 dggF dgg2 ,dgg dgg dggI" dgg* ,dgg+ dgg0 dgg9 dgg> dggD dggD dggF dgg=L t _The quicksilver ooze quivers.dggX  ## ##### # ≈### ###≈#≈#§#≈#≈### ###≈#........ ...#≈# #≈#..@.......69.1 (11.0)....### ###....####### #.....≈# #≈.....#..##.....## ##..####J#... # #..#..§# #§..#..#.#..#. #©.#..## ##..#.©#..#©#?©J   quicksilver ooze..#..≈###§..#..#..ggY m#..#) #..#..##≈##..#..###...# #..#.........#..#...#dgg` dggo k§§J.dggp -70.1 (12dggN{ dgg * _Found a transporter.dggj dgg+k dgg m dggq dggI BdggW dgg dgg| dggؙ dgg1 dgg, dgg ,dggz dgg dgg! ,dgg% dgg; dgg dgg ,dgg dgg dgg@ dgg dgg dggO dgg dgg dgg dggo dggG dgg dgg) dgg4 dggE ,dggmI dggW dggi ,dggl dggr dgg ,dgg dgg dgg ,dgg dggŤ dggҷ ,dggg dgg dggv dgg ,dgg dgg dggN dgg ,dggw dgg dgg dgg dgg" ,dgg' dggS3 dgg:H $  dggH #≈#.............§# ###....#########.§## #≈.....#..##..J#..§# dggH *##..####.#...###.§## #§..#..#.#..#.[#..§#dggI ..#.©#..#©#?©#..## dgg2I o#≈..#..#..#..#)#..≈# ##..#..###...#.#..## dggiI .#..#...##..#@.≈# 85.1 (15 dggI ....#..#########..## ####..#..........# dgg$ dgg4_The hell hog squeals angrily. The hell hound barks!dggdggdgg8dgg,$dgg+dgg33dgg:dgg^dgg* dggQdggTdgg!dgg&dggO1dgg1dggy6dgg?dggHdgggMdggRdggWdggedggp,dggudggt _The hell hound stops to sniff the ground.dggUdggpdgg-dggbdggjdggX3dggٵdggdggdgg,dggdggdgg,dggXdggdggldggmdgg&dgg.,dgg2dggq<dggK#####..#..........##..# 5#.5######..#...## ....#..#b...bhh#..#..... .##.#..#h#.###h#.ß#.©.## .# ..###)#..#...##dggoL ©#©©#..©###h#.∩#.©... #.^.b#..#...## ##^..b#.ß#.©.## ......#@.#.....95.1 (9.0) #...##dgg"M #..# # #... ......#..≈ ### .##..##..## h   hell hog ..###..≈ dgg\Mh ^©# ©#.§# dggMAbb 2 fire batsdggQdggSdgg.Ydgg?Zdgg[dggbadggzbdggw.bh#.∩hbdggxs§§§.b 3 fire batsdggx,6.1 (10.0)dgg:∩dgga* _Found a transporter.dgg܆3dggddggdggdggdgg/dggdggĢdgg,dggdggdgg/dggdggdggdggdggCdggIdgg,dgg;dggQdggHdggdgg dggdggXdggdggddgg$dggY5dgg<,dgg:BdggJdgg UdggQ\dgg1]dggDadggedggmdggudgg~dgg˃dggdgg ,dggdggĜ _The moth of wrath's fur bristles in rage as it notices you.dggdggdgg3dgg۶dggdggdgg,dgg&dggR,dggdggdggdggcdggJ,dgg3dggdgg dggU dggdgg*,dggdggP(dgg5dgg@,dgg`FdggOdggWdgg ^dggddgghdggYidggldggvdgg7,dggތdggÖdgg,dggdggdggdggldggdggg,dggdgg dgg.©.....#..#b.....h#..#..... #.#.##.#..#.#.###.#.ß#.©.###.# .#..#...###)#..#...#### ©#©©#..©###©#.∩#.©... .# #.^.h#..#...## dgg.#.##^.hb#.ß#.©.##.#...bhhb#..#......#########..#...###.....@....##..#709.1 (13.###..###...#s#..≈# ###.#..##..##..##dgg%#. #..###..≈#©# #^©##s#..##. #..##sy#..≈# ..##.)?#..##s   redback......#..≈bbb 3 fire batsdgg4dggdggdggv?hs.dgg/-10.1 (14dggw"dgg&* _Found a transporter.dgg&dggdggvdggqdggdggqdggdggdgg9dgg,dgg dggdgg,dgg`dggj  _The hell hound stops to sniff the ground.dgg93dgg >dggFdggOX,dgg\dgggdggtqdggZydggBdggdggMdggdggœ,dggYdggmdggdggjdgg$dggOdggdggdggx,dggadggdggdggdggRdggl,dggwdgg?dggdgg) ,dggdgg?dgg"dgg %dgg+dgg70dgg4,dgg8dgg=dgguL,dggOdggWdgg`dgg dgg? ,dgg ! dgg& dggV2 ,dggG4 dgg: dggG ,dggI dggN dgg*Y ,dgg\Z dgg] dggh #####+###..#....#.# .#..#...###)# #©...+ ©#©©###.####.©#©©#..©###© #.##.+ ..##.#.#### #..#.##.^.?# #.# .# ..#.##..#.)##..#.##^hhb# #....#.#..#..#.#..#...bhhb# #### ..####..##.##..#########dgg#i ..###########..#..........#.........#..#########..#....@....#..#.......#40.1 (8.0)..#..##≈##..#..#..##..##..# ###≈..#..#.##..###© ##..#.©###^©##©#§..#..##..##".###..####sy##.)?#dgg\i #≈.....#s......####....######### #≈#........... dggn dgg~ 55   ufetubus (wandering)dggU +1.1 (9dgg dgg} $ _Found a flail.dgg dggP dgg6 dgg dggB 4.#####+###..#....#.# .#..#...###) ©#©...+ ©#©©###.####.5#©©#..©###© .#.##.+ #..##.#.####)#..#.##.^.? .#.# .# #..#.##..#.)##..#.##^hhb dggk .#.. #..#.#..#..#.#..#...bhhb .#### #..####..##.##..#..#..##..#.#..#..#...@.....#..#.0#..#..##≈##..#..#..##..#..#. ###≈..#..#.##..#©.# ##..#.©###^©##©#.. #§..#..##..##".## ##..####sy##.)?# #≈.....#s...... ###.... #≈#dgg 2  Found a club.dgg dggS z©55dgg +2.1 (1dgg( dgg * _The ufetubus shouts!dggdggdgg8dggdgg.#####+###..#....#.# .#..#...### ß©#©...+ ©#©©###.####.©#©©#..©### ..#.##.+ ##..##.#.####)#..#.##.^. ..#.# .# (#..#.##..#.5##..#.##^hh ∩.#.. ?#..#.#..#..#.#..#...bhh .dggt.#### ##..####..##.##...#..#..##..#.#..#..#.#..#0W#..#..##≈##..#..#..##..$#..#.. ###≈..#..#.##..©#©.#.. ##..#.©###^©##:#..#.. #§..#..##..##".####.. ##..####sy##.) W   shadowghast (wandering)#..... #≈.....#sdgg5   ufetubus##....# ###.... #≈#dggdggdgg"dgg15)5.W§5 2 ufetubi (1 wandering)dgg6+3.1 (1dggAdgg: _Found 9 stones. Found a transporter.dggIdggdggzdggdggndggdggCdggndggdggfdggq#,dgg(dgg.dggI8dggu?dgg[Edgg*IdggN,dggRdggZdgg=cdggkdggTs,dggvdggY}dggdggW,dggڏdggdggdggdggdgg{dggЮdgg,dggVdggdgg?dggdggdggdgg1dggdgg~dggodgg,dggdggdggdggU dgg,dggdggdgg$dggT(dgg*dgg.dggD.dgg0dgg@5dgg8?dggBdggEdggJ,dggMdggzRdggYdgg]dggb,dggddggjdggv ..###..#.........#. ##..##..#..#..##≈##..#. #.##.#.$#..#..≈###≈..# © #W#©.#©#©.#..## ##..#. dggw.#.#.#.#:#..#..≈# #§..#. .#.#..##W####..## ##..#.##.W##....§§# #≈.#########....### ###.........§@....#≈# #≈#54.1 (dggx11.0)....§.§§.#≈### ###§#≈#≈#§#§#§### # #######  WWW 3 shadowghasts (1 wandering) dggdgg.W....≈# #######Wdgg ,5.1 (12dggxdgg* _Found a transporter.dggxdgg#dgg(dgg dggdggldgg!,dgg'dgg,dgg5dgg9dgg=dgg>dgg@dgghCdggJdgg,MdggxMdgg~NdggYQdgg \dggL_dggcdggcdggedgggldggwdggGzdgg%}dgg}dggdggdggԍdgg}dggdgg,dggdggdggˤdggdggdggdggKdggvdggdggdggdggdggdggdggdggdgg|dgg-dggdggddgg@dggdggdggdggdgg dgg= dgg dggldgg,A  There is a transporter here.dggxdggXdgg"dgg#5 _dgg (dgg\0dgg5,dggw8dgg?dggKdggPdgg Sdgg@UdggUdgg~VdggZdgge,dgghdgg#mdggdgg:BdggJdggdggUdggΞdggdggdggjdggŦdggdggdggjdgg/,dggudgg[ ###..#########..#.   #≈...........#..###   ##...#########..#.   #≈.∩.#.......#..#.#   ##...#zz.....#..#   #§.§.#####+###..#..   ##.ß©#©...+.©#©©### dggi  #§...#.##.+###..##   ##@..#.##.#.(#..#.#74.1 (19   #≈.∩.#....#.?#..#.#   ##...#########..#   #≈...........#..###  ###..#########..#..  #≈..#W##..###..#..  dggu##..##W.##..#..#.. zz 2 laughing skulls (1 wandering)  #≈..#W##.#.$#..#..  ##.©##W#©.#©#©.#..dgg7dgg] _Partly explored, unvisited transporter.dgg8 3dgg: dggBO G0.0).dggO Z......©dggT dggZ dgg~^ ] _Partly explored, unvisited transporter.dgg^ 3dgg` dggKx 4dgg dgg ] _Partly explored, unvisited transporter.dggC #≈...........#..#### ##...#########..#.. #≈.∩.#.......#..#.# ##...#zz.....#..# #§.§.#####+###..#.. ##.ß©#©...+.©#©©###dgg3EH #§...#.##.+###..##. ##...#.##.#.(#..#.## #≈.@.#....#.?#..#.#. ##...#########..### #≈...........#..# ###..#########..#... ≈..#W##..###..#. ##..##W.##..#..#..#W 4 shadowghasts #≈..#W##.#.$#..#..≈ dggF##.©##W#©.#©#©.#..# #≈..#W#.#.#:#..#..≈dgg[#≈§..#zz≈§.zdgg]25.1 (1 _dgg!idggFpj _There is a gate leading back out of this place here.dgg  ##...#########..#..#5   #≈.∩.#.......#..#.#.©   ##§..#zz.....#..#   #≈§..#####+###..#....   ##.ß©#©...+.©#©©###.#   #§...#.##.+###..##.   ##...#.##.#.(#..#.##.   dgg* #≈.∩.#....#.?#..#.#..   ##..@#########..####5   #≈...........#..#   ###..#########..#....   #≈..#W##..###..#.   ##..##W.##..#..#..##   #≈..#W##.#.$#..#..≈   ##.©##W#©.#©#©.#..##   #≈..#.#.#.#:#..#..≈   ##..#W#..##.####..##dgg dgg dgg ≈z..≈z 3 laughing skulls (1 wandering)dgg= &6dgg- <∩dgg _The laughing skull chuckles harshly at the Dungeon's lack of mercy or dignity.dgg≈.∩.#...z...#..#.#.©##...#zz...#.#.#≈...#####+###..#...##.ß©#©...+.©#©©###.##≈...#.##.+###..##.#.##.#.(#..#.#dgg^≈.∩.#....#.?.#...#########..####5#≈..@........###..#########..#.... #≈..#W##..###..##W.##..###≈..#W##.#.$≈dgg ##.©##W#©.#©#©.#..#≈..#.#.#.#:#..#..≈ 2 laughing skulls#..#.#..##.####..#§§.##.##..##.....§dgg6∩dgg&7dgg+:∩dggS1dggCW#...#zz..#.#.#≈...#####+###..#...##.ß©#©...+.©#©©###.##≈...#.##.+###..##.#.###.#.(#..#.#dggX≈.∩.#....#.?.#...#########..####5≈...........####.@#########..#.... #≈..#W##..##..##W.##..###≈..#W##.#.$≈dggY)##.©##W#©.#©#©.#..##≈..#.#.#.#:#..#..≈#..#.#..##.####..##≈..##.##..##.....§#..#########dggdggVi ##.ß©#©...+.©#©©###.# deadiverson the Carver  dggvW#≈...#.##.+###..##.#. Human of the Shining One ******  ##...#.##.#.(#..#.##. Health: 113/113 ========================  #≈.∩.#....#.?#..#.#.. Magic: 15/15 ========================  ##...#########..####5 AC: 21Str: 17  #≈...........#..##### EV: 14Int: 11  ###..#########..#.... SH: 16Dex: 15  #≈..#W##..###..#.... XL: 14 Next: 18% Place: a Gauntlet  ##.@##W.#ggYX34m#..#..#..## Noise: ---------  Time: 19780.1 (0.0)  #≈..#W##.#.$#..#..≈# a) +0 scimitar (flame)  ##.©##.#©.#©#©.#..## Throw: 6 darts (poison)  #≈..#W#.#.#:#..#..≈#  ##..#.#..##.####..##  #≈..##.##..##.....§# WWWW 4 shadowghasts  ##..#########....###  #≈.............#≈#  ##§§......§..#≈### _There is a transporter here. dggX_Partly explored, unvisited transporter. _Partly explored, unvisited transporter. _Partly explored, unvisited transporter. _There is a gate leading back out of this place here. _The laughing skull chuckles harshly at the Dungeon's lack of mercy or dignity.dggZdgg.edgg-hdggG ≈...#.##.+###..##.#.###.#.(#..#.##≈.∩.#....#.?.#...#########..####5≈...........###..#########..#.... #≈..#W##..##..##W.##..###≈.@#W##.#.$≈dgg 2#.©##.#©.#©#©.#..#≈..#W#.#.#:#..#..≈##..#.#..##.####..##≈..##.##..##.....§##..#########≈.............#≈##.§..#≈## #§#≈#≈#§##≈###dgg 8§dggn +1.1 (1dggN) dgg+ dgge #.ß©#©...+.©#©©###.##≈#.+###..##.##...#.##.#.(#§.∩.#....#.?#..#.#..#...########5≈...........#..########..#######≈..#W##..##..##.@##W.##..#dggf }≈..#W##.#.$#..#..≈#.©##.#©.#©#©.#..##≈..#W#.#.#:#..#..≈##..#.#..##.####..##≈..##.##...§#..#########....###≈......#≈##..........#≈###dgg s dgg~ TW.dgg9 &2dgg dggҎ dggk≈...#####+###..#....##.ß©#©...+.©#©©###.##≈#.+###..##.##...#.##.#.(#§.∩.#....#.?#..#.#..##...########5≈...........#..########..########≈.@#W##..##..#..##W.##..#dgg3{≈..#W##.#.$#..#..≈##.©##W#©.#©#©.#..##≈..#.#.#.#:#..#..≈##..#.#..##.####..#≈..##.##...§#..#########....###≈.....#≈dgg{4∩dggG&3dggFdggbdgg#...#zz.....#..##.##≈...#####+###..#....##.ß©#©...+.©#©©###.##≈#.+###..##.##...#.##.#.(#dggf§.∩.#....#.?#..#.#..##...########5#≈...........#..########.@#######≈..#W##..##..#..##W.##..##≈..#W##.#.$#..#..≈##.©##W#©.#©#©.#..##≈..#.#.#.#:#..#..≈dgggt#..#.#..##.####..#≈..##.##...§#..#########....###dgg_g≈.∩dgg,4dggxdggdggAJ≈.∩.#...z.#.©##...#zz.....#..##.##≈...#####+###..#....dggBC##.ß©#©...+.©#©©###.##≈#.+###..##.#...#.##.#.(#≈.∩.#....#.?#..#.#..#...########5#≈..@........#..########..#######≈..#W##..##..##..##W.##..##≈..#W##.#.$#..#..≈##.©##W#©.#©#©.#..#dggC≈..#.#.#.#:#..#..≈# zz 2 laughing skulls#..#.#..##.####..#≈..##.##...§dggXdggY&5dggd<∩dgghdgg^}#...#########..#..#5#≈.∩.#......#.©dggQ~##...#zz.....#..##.##≈...#####+###..#....##.ß©#©...+.©#©©###.#≈#.+###..##.#...#.##.#.(#≈.∩.#....#.?#..#.#..##..@########5≈...........#..#####dgg###..########≈..#W##..##..##..##W.##..##≈..#W##.#.$#..#..≈#.©##W#©.#©#©.#..#dggT≈..#.#.#.#:#..#..≈#..#.#..##.####..#dggdggÛ&6dgg<∩dggJdggω ≈...........#..#######...#########..#..#5#≈.∩.#.......#..#.#.©##...#zz.....#..##.##≈...#####+###..#....#.ß©#©...+.©#©©###.#≈#.+###..##.dgg #...#.##.#.(##≈.∩@#....#.?#..#.#..#...########5≈...........#..########..########≈..#W##..##..##..##W.##..#≈..#W##.#.$#..#..≈dggE J#.©##W#©.#©#©.#..#≈#.#:#..#..≈dggۣ dgg &7dgg dggc dgg ^##..#########..#....#≈...........#..#######...#########..#..#5#≈.∩.#...#.©##...#zz.....#..##.#≈...#####+###..#....#.ß©#©...+.©#©©###.#dgg Z≈#.+###..##.##..@#.##.#.(#≈.∩.#....#.?#..#.#..#...########5≈...........#..########..########≈..#W##..##.. 3#..##W.##..#≈..#W##.#.$#..#..≈#.©##W#©.#©#©.#..#dgg5 dgg5 dgg dgg #§§z§§z 3 laughing skulls (1 wandering)dgg &8dgg dgg dgg/$E #§..##.#.#.###..#########..#....≈...........#..######...#########..#..#5#§.∩.#......#.©#§..#zz..z..#..##.#§§..#####+###..#....#.ß©#©...+.©#©©###.##≈+###..##.#...#.##.#.(#≈.∩.#....#.?#..#.#..dgg%#...########5#≈...........#..########..####### 2≈..#W##..##..#..##W.##..#≈..#W##.#.$#..#..≈dgg*dgg;##≈.#.§§##.§.#zz.z.#§§§§∩zdgg< dgg<dgg<9dggdgg dgg|5#..#.#.#.#.## #≈..##.#.#.##..#########..#....≈...........#..######...#########..#..#5§§§.#.....#.©#.§.#zz.z...#..##.##§§§.#####+###..#....##§ß@#©...+.©#©©###.#≈#.+###..##.#...#.##.#.(#≈.∩.#....#.?#..#.#..##...########5#≈...........#..##### W   shadowghast###..#######dgg~≈..#W##..##..#..##W.##..#dgg΃dggdggdgg ...§.§∩.#z§..§dggȗ'90dgg*=∩dggR _There is a transporter here.dggXM≈..##.#©#.#≈#..#5#.#.#.## #≈..##.#.#.dgg###..#########..#....≈...........#..######§.§#########..#..#5§§∩.#z..#.©#§§.#zz.....#..##.#§§.@#####+###..#....##§ß©#©...+.©#©©###.#≈dggil#.+###..##.  ##...#.##.#.(#..#.##.#.#zzz 3 laughing skulls..dgg5   white imp (wandering)###..#######≈..#W##..##..dgg6....##.#≈.∩§.§#§§#∩dgg-1 _dggB;∩dgg+dgg@#.©#.#.#.#5#©.#..#§..##.#©#5#≈#..#5#.#.#.## #≈..##.#.#.###..#########..#....≈...........#..######...#########..#..#5#≈.∩§#z..#.©#§.@#zz.....#..##.#§§..#####+###..#....dggL#§ß©#©...+.©#©©###.#§§..#.##.+###..##.#...#.##.#.(##≈.∩.#....#.?#..#.#..##...########5 55 2 white imps (wandering)#≈...........#..########..######dggy dggBdgg§.##5#©#..#.#5..#≈.##.##dggK&2dggP(;∩dgg+dggk>≈..##5#.#5##..#..§#.©#.#.#.#5#©.#..#§§.##5#©#.#≈##..#.#.#5#.## #≈..##.#.#.##..#########..#....≈...........#..######...#########..#..#5#≈.∩@#z..#.©#...#zz.....#..##.#dgg≈...#####+###..#....#.ß©#©...+.©#©©###.##§§..#.##.+###..##.##...#.##.#.(#dgg<#≈.∩.#....#.?#..#.#.. 5   white imp##...########5≈...........#..#####dggidggf  The white imp shouts, "Quit, thou paunchy hasty-witted codpiece!"dggdggXdgg9.5#.5z.55 2 white imps (1 wandering)dgg-&3dgghdgg' _You hear a shout!dgg#..#5#5#5#4####..#≈..##5#.#?##..#..§#.©#.#.#.#5#©.#..##§§.##.#©#.#≈##..#.#5#.#.## #≈..##.#5#.dggl##..#########..#....≈...........#..#######..@#########..#..#5≈.∩.#zz.#.©#...#z......#..##.#≈...#####+###..#....##.ß©#©...+.©#©©###.##§§..#.##.+###..##.##...#.##.#.(##≈.∩.#....#.?#..#.#..#...########5dgg8dggdgg1..##5#5.5 3 white imps (1 wandering)4dggdggdggs ≈..##5#5#5##.....≈#..#.#5#.#4####..#≈..##5#.#?##..#..§##.©#.#.#.#5#©.#..##§..##5#5#.#≈##..#.#.#.#.## #≈..##.#5#.##..#########..#....#≈..@........#..######...#########..#..#5dggu ≈.∩.#zz.#.©#...#z......#..##.##≈...#####+###..#....##.ß©#©...+.©#©©###.##§§..#.##.+###..##.##...#.##.#.(#≈.∩.#....#.?#..#.#..dggB dggˉ dggw dgg dggś \..#54≈..##.#©5#54   ice devil.zzz 3 laughing skulls5555 4 white imps∩dgg &5dgg dgg: e _The white imp shouts, "Remove thy stench, thou rough-hewn miscreant malt-worm!"dgg6 #§.#########§..##5#5#.##.....≈#..#.#.#.#4####..##≈..##.#5#?##..#..§##.©#4#.#.#5#©.#..##≈..##.#©#.#≈#..#5#5#.#.## #≈..##.#5#.dgg7 v###.@#########..#....≈...........#..######...#########..#..#5≈.∩.#zz.#.©##...#z......#..##.##≈...#####+###..#....##.ß©#©...+.©#©©###.##§#.+###..##. 3#...#.##.#.(#dgg+G dggG ,dggZ ..#54.55 4 white impsdggo[ &6dggRk dggq dggx§.............#≈# #..#########§..##5#.#.##.....≈##..#.#.#.#4####..##≈..##.#.#?##..#..§##.©#.#5#.#5#©.#..#≈..##4#©#.#≈#..#5#.#.#.##dggf #≈.@##5#5#.###..#########..#....#≈...........#..######...#########..#..#5#≈.∩.#zz.#.©##...#z......#..##.##≈...#####+###..#....##.ß©#©...+.©#©©###.# 2§+###..##.dggVdggdggvdgg54#..5.5 3 white impsdgg&7dggdggqn _The white imp disappears for a moment.dggXH_#§#≈##≈.............#≈# #..##########§..##.#.#.##.....≈##..#.#.#.#4####..##≈..##5#.#?##..#..§#.©#4#.#.#5#©.#..#≈..##.#©#.#≈##.@#5#5#.#.##dggIx #≈..##5#.#.##..#########..#....#≈...........#..######...#########..#..#5#≈.∩.#zz.#.©##...#z......#..##.##≈...#####+###..#....5 4 white imps#.ß©#©...+.©#©©###.#dggSdggbN5.dggc&8dggRmdggpdgg #§#≈#≈#≈#≈#≈### #...........#≈##≈.............#≈# ##..##########§..##.#.#.##.....≈##..#.#.#.#4####..#≈..##5#.#?##..#..§#.©#4#.#.#5#©.#..##≈.@##5#©#.#≈#..#5#.#.#.## #≈..##5#.#.##..#########..#....≈...........#..######...#########..#dgg..#5#≈.∩.#zz....#.©##...#z......#..##.# 3≈...#####+###..#....dggGdggDi§5.dgg[&9dgg dggQn _The white imp disappears for a moment.dgg############  #≈#≈#≈#≈#≈#≈### #...........#≈###≈.............#≈# ##§.##########§..##.#.#.##.....≈#..#5#.#.#4####..#≈..##.#.#?##..#..§dgg##.@#4#.#.#5#©.#..#≈..##5#©#.#≈#..#5#.#.#.## #≈..##5#.#.##..#########..#....≈...........#..######...#########..#..#5 2dgg.$#≈.∩.#zz.....#..#.#.©5 4 white imps#...#z......#..##.#dggR.≈dgg(800dggdgg _You hear a shout! _Remove thy stench, thou rough-hewn miscreant malt-worm!"The white imp disappears for a moment.The white imp disappears for a moment.lashes its tail. _There is a transporter here.dgg≈#≈#≈#≈#≈#≈#####...........#≈###≈.............#≈##..#########....####≈..##.#.#..≈##..#5#.#.#4####..#≈..##.#.#?##..#..§#.©#4#.#.#5#©.#..##≈.@##5#©#.##..#..≈#..#5#.#.#.#≈..##5#.#.#..dggY###..#######≈...........#..######...#########..#..#5≈.∩.#zz.....#..#.#.©z 3 laughing skulls##...#z......#..##.#. 3≈...#####+###..#...dggdgg[* .5The laughing skull chuckles harshly at how history will forget everyonepresent.1dggR4dgg68_ _The white imp sputters.dgg##...........#≈###≈.............#≈#..#########....####≈..##.#.#..≈##..#.#.#.#4####..##≈..##5#.#?##..#..§#.©#4#.#.#5#©.#..#≈..##5#©#.##..#..≈##.@#5#.#.#.#≈..##5#.#.#..###..#######≈...........#..######...#########..#..#5≈.∩.#zz.....#..#.#.©##gg1m...#z....#.#.#≈...#####+###..#...5 4 white imps#.ß©#©...+.©#©©###.#dgg\dggp&2dggCdggdggt>≈..#≈#..#########....###≈..##.#.#..≈##..#.#.#.#4####..##≈..##5#.#?##..#..§##.©#4#.#.#5#©.#..#≈..##5#©#.##..#..≈#..#5#.#.#.##≈.@##5#.#.#..dgg?###..#######§...........#..#######...#########..#..#5≈.∩.#zz.....#..#.#.©##...#z.#.#.#≈...#####+###..#...##.ß©#©...+.©#©©###.# 3§...#.##.+###..##.#.dggHdgg ZP.5dgg'[&3dgg2idggldgg #..#########....###≈..##.#.#..≈#..#.#.#.#4####..##≈..##.#.#?##..#..§##.©#4#5#.#5#©.#..##≈..##5#©#.##..#..≈#..#5#.#.#.#≈..##5#.#.#..###.@########§...........#..#######...#########..#..#5≈.∩.#zz.....#..#.#.©##...#z.dgg #.#.#≈...#####+###..#...##.ß©#©...+.©#©©###.##≈...#.##.+###..##.#.5 4 white imps##.(#..#.#dgg" dggl# &4dgg$. dggf2 dgg% ≈..##.#.#..≈#..#.#.#.#4####..#≈..##.#.#?##..#..§##.©#4#5#.#5#©.#..##≈..##5#©#.##..#..≈##..#5#.#.#.#≈..##5#.#.#..dgg% ###..########§..@........#..######...#########..#..#5≈.∩.#zz.....#..#.#.©#...#z.#.#.#≈...#####+###..#...##.ß©#©...+.©#©©###.##≈...#.##.+###..##.#.###.#.(#..#.#≈.∩.#....#.?.dgg 2 Bdgg\A .#.4#55dggB &5dggP dggU dggs_ #≈..##.#.#.##.....≈#  ##..#.#.#.#[####..##  #≈..##.#.#?##..#..§#  ##.©#.#.#.#5#©.#..##  #≈..##4#5#.##..#..≈# ##..#5#5#.#.#..#..##≈ #≈..##5#.#.##..#. ###..#..#. #§.#..# ##...#..#..#5# dgguU#≈.∩.#zz.....#..#.#.©. ##...#z......#..##.#.# #≈...#####+###..#....# ##.ß©#©...+.©#©©###.## zzz 3 laughing skulls #≈...#.##.+###..##.#.# 5555 4 white imps ##...#.##.#.(#..#.##.. #≈.∩.#....#.?#..#.#..#dgg~,dggVt544   ice devilzzz 3 laughing skulls555 3 white imps∩dggD&6dggQ;∩dggdgg#≈..##.#.#.##.....≈# ###..#.#.#.#[####..## ##≈..##.#.#?##..#..§# ###.©#.#.#.#©#©.#..## ##≈..##5#5#.##..#..≈###..#4#5#.#.#..#..##≈#dgg#≈..##5#.#.##..#.###..#..#.#§.#..###...#..#..#5#5#≈.∩.#zz.....#..#.#.©.##...#z......#..##.#.#.#≈...#####+###..#....#.##.ß©#©...+.©#©©###.#zzz 3 laughing skulls#≈...#.##.+###..##.#.## 5555 4 white imps##...#.##.#.(#..#.##..##≈.∩.#....#.?#..#.#..#.dggZ#dgg$dgga6©.#55##§§#§#§§##§∩dggZ7&7dggF;∩dggRJdggH #≈..##.#.#.##.....≈# #≈##..#.#.#.#[####..## ##≈..##.#.#?##..#..§# #§##.©#.#.#.#©#©.#..## ##≈..##5#©#.##..#..≈###≈##..#4#.#5#.#..#..##≈##≈..##5#5#.##..#.###..#..#.#§§.#..###...#..#..#5#5#dgg #≈.∩.#zz.....#..#.#.©.##§..#z......#..##.#.#.##§§..#####+###..#....#.###§ß©#©...+.©#©©###.#4   ice devil#≈...#.##.+###..##.#.#zzz 3 laughing skulls##...#.##.#.(#..#.##..#. 5555 4 white imps#≈.∩.#....#.?#..#.#..#.dgg dggE ##§§§§.5##≈.#∩dgg &8dgg dgg f _The white imp lashes its tail.dggi #≈..##.#.#.##.....≈# #≈.##§.#.#.#.#[####..## ##.#§§.##.#.#?##..#..§# #§.##§©#.#.#.#©#©.#..## ##.#≈..##.#©#.##..#..≈###≈.##..#4#5#5#.#..#..##≈##.#≈..##5#5#.##..#.###..#..#.#≈.#..##ggj 77m#...#..#..#5#5#.#≈.∩.#zz.....#..#.#.©.##§..#z......#..##.#.#.##§§..#####+###..##§ß©#©...+.©#©©###.####.#≈...#.##.+###..##.#.###...#.##.#.(#..#.##..#.) 3#≈.∩.#....#.?#..#.#..#..#dggn dgg2p Bdggp ,dgg} §§5#5#.4#5#5z.≈.§§dgg[~ &9dggԊ ;∩dgg dgg#≈..##.#.#.##.....≈# #≈.##§.#.#.#.#[####..## ##.#§§§##.#.#?##..#..§# #§.##.©#.#.#.#©#©.#..## ##.#≈§§##.#©#.##..#..≈###≈.##..#5#5#.#.#..#..##≈##.#≈..##4#5#5##..#.###..#..#.#≈.#..###...#..#..#5#5#.5#≈.∩.#zzz....dggG#..#.#.©.##§..#.#..##.#.#.##.#≈§..#####+###..#....#.# .##.ß©#©...+.©#©©###.####.©#§§..#.##.+###..##.#.####)##...#.##.#.(#..#.##..#.)#5 4 white imps#≈.∩.#....#.?#..#.#..#..#.dgg dggdgg%&Q.≈...§§∩.#z.zz.§.∩dgg/''10dgg]7dggV=dgg46 #≈..##.#.#.##.....≈# #≈ ##..#.#.#.#[####..## ## #≈..##.#.#?##..#..§# #§ ##.©#.#.#.#©#©.#..## ## #≈..##.#©#.##..#..≈###≈ ##..#5#5#.#.#..#..##≈##dgg5 #≈..##4#5#5##..# ###..#..# #≈.#.. ##§..#..#..#5#5#. #§§∩.#z.zz...#..#.#.© ##§..#.#..##.#.#.## #§...#####+###..#....#.# ##§ß©#©...+.©#©©###.####. #≈...#.##.+###..##.#.####dgg<6 ##...#.##.#.(#..#.##..#.) 3 #≈.∩.#....#.?#..#.#..#..#dggFdgg#Y5§..≈.dggqZ&1dggidggkm  The white imp shouts, "Scamper hence, thou plume-plucked weevil-witted _brigand!"dgg- #≈..##.#.#.##.....≈# #≈ ##..#.#.#.#[####..## ## #≈..##.#.#?##..#..§# #§ ##.©#.#.#.#©#©.#..## ##dgg* #≈..##.#©#.##..#..≈###≈ ##..#5#5#5#.#..#..##≈## #§..##4#5#.##..# ###..#..# #≈.#.. ##§..#..#..#5#5# #§§∩.#z.zz...#..#.#.© ##...#.#..##.#.#. #≈...#####+###dggj.#....#.# ##.ß©#©...+.©#©©###.#### #≈...#.##.+###..##.#.dgg ##...#.##.#.(#..#.##..#.5 4 white imps #≈.∩.#....#.?#..#.#..#..dggodggNdggCzz.dgg&2dggn=∩dggdgg  #≈..##.#.#.##.....≈# # ##..#.#.#.#[####..##  #≈..##.#.#?##..#..§# # ##.©#.#.#.#©#©.#..##  #≈..##.#©#.##..#..≈### ##..#5#5#5#.#..#..##≈ #§..##4#5#.##..# ###..#..# #≈.#.. ##§..#..#..#5#5 #§§∩.#zzz....#..#.#.©gg# ^0m ##...#.#..##.#.#. #≈...#####+###..#....#. ##.ß©#©...+.©#©©###. #≈...#.##.+###..##.#. ##...#.##.#.(#..#.##..# 3 #≈.∩.#....#.?#..#.#..#dggdgg)§5..#≈.#∩dgg*&3dgg9;∩dgg>dgg$  #≈..##.#.#.##.....≈#  ##..#.#.#.#[####..##  #≈..##.#.#?##..#..§#  ##.©#.#.#.#©#©.#..##  #§..##.#5#.##..#..≈ ##..#5#5#.#.#..#..##≈ #§..##4#5#.##..# ###..#..# #≈.#.. ##...#..#..#5# #≈.∩.#zzz....#..#.#.© ##...#.#..##.#.# #≈...#####+###..#....# ##.ßgg$ 0m©#©...+.©#©©###. #≈...#.##.+###..##.#. ##...#.##.#.(#..#.##..5 4 white imps #≈.∩.#....#.?#..#.#..#dgg( dgg-) dgg5 \##§≈##§§§§§∩.#zz.§..#z∩dggJ6 &4dgg= dgg@ dggZ   ##..#########....###   #≈..##.#.#.##.....≈#   ##§.#.#.#.#[####..##  dgg+  #≈..##.#.#?##..#..§#   ##§©#.#.#.#©#©.#..   #§§.##.#5#.##..#..≈#   ##§.#5#5#.#.#..#..##   #§..##4#5#.##..#   ###.@#########..#....   #≈...........#..####  dgg P ##...#########..#..#5   #§§∩.#zz.....#..#.#.©   ##§..#z......#..##.#.   #≈...#####+###..#....   ##.ß©#©...+.©#©©##  dggB  #≈...#.##.+###..##.# 2  dgg g ##...#.##.#.(#..#.##.dgg <5dgg/ dgg dggM≈.............#≈# #.§#########≈..##.#.#.##.....≈#§.#.#.#.#[####..#≈..##.#.#?##..#..§#§©#.#.#.#©#©.#..##§§.##.#©#.#≈#§.#5#5#5#.## #§.@##4#5#.dggu\###..#########..#....#≈...........#..#####  ##...#########..#..#5#zzz 3 laughing skulls≈555 3 white imps≈+###..##.dgg(dgg!.≈.##≈5.§.≈dgg&6dgg`dggie _The white imp laughs crazily.dggLGM##≈##≈.............#≈# #..#########≈..##.#.#.##.....≈##..#.#.#.#[####..##≈..##.#.#?##..#..§#§©#.#.#.#©#©.#..#dgg{N}≈§.##.#5#.#≈##§@#5#5#.#.## #§..##4#5#.##..#########..#....  #≈...........#..######4   ice devil5 4 white imps#.ß©#©...+.dggRVdgg`f...##.#©... 3dggg&7dggrdggudggn #≈#≈#≈#≈#≈#≈### #...........#≈##≈.............#≈# ##..##########≈..##.#.#.##.....≈##..#.#.#.#[####..#≈..##.#.#?##..#..§#.©#.#5#.#©#©.#..##≈.@##.#©#.#≈#..#5#5#.#.## #§..##4#5#.##..#########..#....dgg≈...........#..######...#########..#..#5#§.∩.#zz....#.©##...#z......#..##.#5 4 white imps≈...#####+###..#....dggdggԟ≈##§§§.≈≈ 3dggҠ&8dggէdggdggX ############  #≈#≈#≈#≈#≈#≈### #...........#≈##≈.............#≈# #§.##########§..##.#.#.##.....≈#§.#.#.#.#[####..#≈..##.#.#?##..#..§dgg&Z ##.@#.#.#.#©#©.#..#≈..##5#©#.#≈#..#5#5#.#.## #≈..##4#5#.##..#########..#....≈...........#..######...#########..#..#5 2#≈.∩.#zz.....#..#.#.© 2#...#z......#..##.#dggwe dggj dggC{ §#≈#§§5.§5 3 white impsdgg{ &9dgg dgg R _There is a transporter here.dggˢdggcInventory: 47/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar of flaming (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)p - 9 boomerangs  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  U - 4 javelins Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn) dggJewellery (go to first with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)H - a ring of willpower Wands (go to first with /) [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]dgg] dgg dgg  #############deadiverson the Carver  #§#≈#≈#≈#≈#≈###Human of the Shining One ******  ##...........#≈###Health: 113/113 ========================  #≈.............#≈#Magic: 15/15 ========================  ##§.#########....### AC: 21Str: 17  #§§.##.#.#.##.....≈# EV: 14Int: 11  ##§.#.#.#.#[####..## SH: 16dgg Dex: 15  #≈§.##.#.#?##..#..§# XL: 14 Next: 18% Place: a Gauntlet  ##.@#5#.#.#©#©.#..## Noise: ---------  Time: 19819.1 (0.0)  #≈..##5#©#.##..#..≈# a) +0 scimitar (flame)  ##..#5#.#.#.#..#..## Throw: 6 darts (poison)  #≈..##4#5#.##..#....  ###..#########..#....  #≈...........#..##### 4   ice devil  ##§..#########..#..#5 dgg P zz 2 laughing skulls  #≈.∩.#zz.....#..#.#.© 555 3 white imps  ##...#z......#..##.#. _The white imp sputters. _The white imp lashes its tail.The white imp shouts, "Scamper hence, thou plume-plucked weevil-witted _brigand!" _The white imp laughs crazily. _There is a transporter here.dgg dgg dgg dgg dggtdggio.dgg #§#≈#≈#≈#≈#≈###  ##...........#≈### ## #§.............#≈# #≈ ##§.#########....### ###. #§§.##.#.#.##.....≈# #≈.. ##§.#.#.#.#[####..## ##..dgg=` #≈§.##5#.#?##..#..§# #§.. ##.§#5#.#.#©#©.#..## ##.. #≈..##.#@#.##..#..≈###≈.. ##..#5#5#.#.#..#..##≈##.. #≈..##4#.#.##..#......... ###..#########..#..... dgg2#≈...........#..########## ##§..#########..#..#5#5#.5 #≈.∩.#z..z...#..#.#.©..... ##...#z......#..##.#.#.##.5 dggM4 white imps #≈...#####+###..#....#.# dgg,20.1 (1dggdggL _You enter the transporter and appear at another place.dgg\ dgg$ dgg dgg F _Unknown command.dggo& dgg?' dgg2 dgg5 F _Unknown command.dgg + ############# §#≈#≈#≈#≈#≈### ##...........#≈### ####§.............#≈# #≈###§.#########....### ####§§.##.#.#.##.....≈# #≈.dgg, ##§.#.#.#.#[####..## ##..##≈§.##5#.#?##..#..§# #§..###.§#5#.#@#©#©.#..## ##..##≈..##.#©#.##..#..≈###≈..###..#5#5#.#.#..#..##≈##..#≈..##4#.#.##..#.####..#########..#.........#≈...........#..#############§..######ggL- Wm###..#..#5#5#.5# z   laughing skull#≈.∩.#z..z...#..#.#.©.....# 3##...#z......#..##.#.#.##.#dgg3 dgg65 dgg7 dggh8 dggH9 dgg;< M  The white imp attacks as it pursues you!dgg< dggI `..#55#5.#4.z..5 4 white imps.dggTJ .=1dggW dggZ 7 _You block the white imp's attack.dgg Y#############  §#≈#≈#≈#≈#≈### ##...........#≈### ###≈#§.............#≈# #≈###§.#########....### ####§§.##.#.#.##.....≈# #≈....dgg ##§.#.#.#.#[####..## ##..##≈..##5#.#@##..#..§# #§..#.##.§#.#5#.#©#©.#..## ##..#.#≈..##5#5#.##..#..≈###≈..#.##..#.#4#.#.#..#..##≈##..#.≈..##.#.#.##..#.#.###..#########..#.........#.#≈...........#..###########. 555 3 white impsdgg 5##§..#########..#..#5#5#.5#.#≈.∩.#zz.....#..#.#.©.....#.dgg5 dggp* §§5.©5 4 white impsdggz+ .-2dgg4 dgg7 Z _You see here a scroll of revelation.dggO #############  §#≈#≈#≈#≈#≈### #####...........#≈### ###≈##§.............#§# #≈###§.#########....### ####§§§##.#.#.##.....≈# #≈.....dgga ##§.#.#5#.#@####..## ##..####≈..##.#.#?##..#..§# #§..#.##.©#.#5#.#©#©.#..## ##..#.©#≈..##5#5#.##..#..§###≈..#.##..#.#4#.#.#..#..##≈##..#.≈..##.#.#.##..#.#.###..#########..#.........#. 2dggM #≈...........#..###########.##§..#########..#..#5#5#.5#.dgg dgg dgg dgg dggo.55.#455 3 white impsdggdG-3 _dgg~dgg"{ _You see here a +1 cloak of willpower.dggh############# #§#≈#≈#≈#≈#≈#####...........#≈### ###≈ #§.............#§# #≈#. ##§.#########....### ###. #§§.##.#.#.##.....≈# #≈ ##§.#.#.#.#[####..## ##..## #≈..##.#5#@##..#..§# #§..#. ##.©#.#5#5#©#©.#..## ##..#dgg #≈..##.#4#.##..#..§###≈..#. ##..#.#5#.#.#..#..##≈##..# #≈..##.#.#.##..#.........###..#########..#.# #≈...........#..########### ##§..#########..#..#5#5#.5# #≈.∩.#zz.....#..#.#.©.....#dgg dgg 55   ufetubus (wandering)dgg" **The white imp gestures at you.dggY dgg 5#[.#@5 4 white impsdgg /==4dgg dgg  _The puff of frost misses you. _You see here a scroll of revelation.dgg} 55The puff of frost misses you. _ The ufetubus shouts!  You hit the white imp. You burn the white imp.  The white imp is severely wounded.  The white imp puffs mist at you.dgg **The white imp gestures at you.dgg} §[####.§@§§dgg.~ +9 (0.8dggl dgg S _The puff of frost misses you.dgg!#############  §#≈#≈#≈#≈#≈### #####...........#≈### ###≈#dggs#§.............#§# #≈###§.#########....### ####§§.##.#.#.##....§§# #≈.....##§.#.#.#5#@####.§## ##..####≈..##.#.#?##..#..≈# #§..#.dgg##.©#.#5#5#©#©.#.§## ##..#.©#≈..##.#4#.##..#..≈###≈..#.##..#.#5#.#.#..#.§##≈##..#.≈..##.#.#.##..#.#.###..#########..#.........#. 3#≈...........#..###########..##§..#########..#5.#5#5#.5#.dggHBdgg ≈§§##5##...§.4.5.The white imp attacks as it pursues you!dgg=5-5.9 (1.0dggdggz _You block the white imp's attack. _You see here a +1 cloak of willpower.dgg  You slash the white imp! You burn the white imp.  You kill the white imp!dgg...##.§ 2dggaG-6.7 (0.8dggPdggRX _The Shining One accepts your kill.dggd\############# #§#≈#≈#≈#≈#≈#####...........#≈### ###≈ #§.............#≈# #≈#. ##§.#########....### ###. #§§.##.#.#.##.§.§§§# #≈ ##§.#.#.#.#[####.§## ##..## #≈..##.#.#@##..#..≈# #§..#.dggHe ##.©#.#5#4#©#©.#..## ##..# #≈..##.#5#.##..#..≈###≈..#. ##..#.#5#.#.#..#..##≈##..# #≈..##.#.#.##..#.........###..#########..#.# #≈...........#..###########5 3 white imps ##§..#########..#55#5#5#.5#. 55 2 ufetubi (1 wandering) #≈.∩.#zz.....#..#.#.©.....#dggmdgg6qdgg ;...dggn-7.7 (1.0dggdggF _You block the ice devil's attack. _You see here a scroll of revelation.dgg < . 55You slash the ice devil! You burn the ice devil.  The ice devil is moderately wounded.dgg k99/113 ---=8.5 (0.8dgg dgg T _The ice devil hits you. The ice devil freezes you! You resist.dggi .You hit the ice devil but do no damage.The ice devil is moderately wounded.dggi 0-9.3dggu dggy 7 _You block the ice devil's attack.dggr §You hit the ice devil. You burn the ice devil.  The ice devil is heavily wounded.dggC-30.1dggdgg5V _The ice devil barely misses you.dggy ##§§§You barely miss the ice devil.dgg\100/113---9dggdgga _The ice devil is heavily wounded.dgg  You completely miss the ice devil.The ice devil is heavily wounded.The white imp grinds its teeth.dgg (1.7dggdgg7 _You block the ice devil's attack.dgg7 ##≈ You slash the ice devil! You burn the ice devil!  The ice devil is almost dead.dgg80=2.5dgg"DdggFI@ _The ice devil hits you but does no damage.dggh ...You hit the ice devil but do no damage.The ice devil is almost dead.dggJi 81-3.3dggdw dggn{ @ _The ice devil hits you but does no damage.dggb  _The ice devil hits you but does no damage.  You hit the ice devil but do no damage.  The ice devil is almost dead. _The ice devil hits you but does no damage.  You hit the ice devil but do no damage.  The ice devil is almost dead.dggc B-4.1dgg6r dggu   You hit the ice devil but do no damage.  The ice devil is almost dead. _The ice devil hits you but does no damage.  You hit the ice devil but do no damage.  The ice devil is almost dead. _The ice devil closely misses you.dgg  You slash the ice devil! You burn the ice devil.  You kill the ice devil!The Shining One accepts your kill.dggdgg8 (§5©555 3 white imps55 2 ufetubidgg13===6--95.0 (0.9dggadgg!& _You feel better.dgg]  You slash the white imp! You burn the white imp!  dggw7You kill the white imp!dgg^dgg+§.5. 2dggN--=8 (0.8dgg,dggX _The Shining One accepts your kill.dggm############# #≈#§#≈#≈#≈#≈#####...........#§### # #§.............#≈# #≈# ##§.#########....### ###. #§§.##.#.#.##.....§# #≈ ##§.#.#.#.#[####..## ##..# #≈..##.#.#?##..#..≈# #§.. ##.©#.#5#@gg:o6m#©#©.#..## ##..# #≈..##.#5#.##..#..≈###≈..# ##..#.#.#.#.#..#..##≈##..# #≈..##.#.#.##..#.........###..#########..#.# #≈...........#..########### zz 2 laughing skulls ##§..#########..#55#5#5#.5# 55 2 white imps #≈.∩.#zzz....#..gg p 6m#.#.©.....# 5   ufetubus ##...#.......#..##.#.#.##.#dggK§§§§dgg5-6.8 (1.0dggRdggC7 _You block the white imp's attack.dgg  You slice the white imp!! You burn the white imp.  You kill the white imp!The Shining One accepts your kill.dgg dgg0§..   white impdggv#d6===7.6 (0.8dgg*dgg.4 _You feel your power returning.dggm " §§§..§ You hit the white imp. You burn the white imp.  The white imp is heavily wounded.dggo N===-8.4dgg9w dggz 7 _You block the white imp's attack.dgg  You hit the white imp. You burn the white imp.  You kill the white imp!dgg% ≈§.©5   ufetubus==-9.2 _The Shining One accepts your kill.dggJfdgggdggqdggtR _No reachable target in view!dggdggdggdgg}R _No reachable target in view!dggY%m#############  §#§#≈#≈#≈#≈### ##§§§§.......#§### ###≈#§............§#≈# #≈###§.#########....### ####§§.##.#.#.##.....§# #≈....dgg(& ##§.#.#.#.#[####..## ##..##≈..##.#.#@##..#..≈# #§..#.##.©#.#.#.#©#©.#..## ##..#.#≈..##.#©#.##..#..≈###≈..#.##..#.#.#.#.#..#..##≈##..#.≈..##.#.#.##..#.#.dgg&###..#########..#.........#. 55 2 ufetubi#≈...........#..###########.##§..#########..#55#5#5#.5#.#≈.∩.#zzz....#..#.#.©.....#.dgg<d..§§dgg0>=-40.2 (1.0 _dggCdggO##..§≈§§§dggcPE-1.2 (2dgg@Vdgg|X0 _O - a scroll of revelationdggM#############  §#§#≈#≈#≈#≈### ###dgg##§...§......#≈### ###≈##§.............#≈# #≈###§.#########....### ####§§.##.#.#.##....§§# #≈.....##§.#.#.#.#@####§§## ##..####≈..##.#.#.##..#.§§# #§..#.##.©#.#.#.#©#©.#.§## ##..#.©#≈..##.#©#.##..#.§§###≈..#.##..#.#.#.#.#..#..#gg3m#≈##..#.≈..##.#.#.##..#.#.###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#.. dgg^≈..#dgg͗+2.2 (1dggdgg#{ _You see here a +1 cloak of willpower.dgg) #§§.≈...dggO &3dgg dgg^ Q _W - a +1 cloak of willpowerdggdggtWear which item? Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  w - a +2 cloak of stealth (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +1 cloak of willpower[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip dggdgg#dgg++dgg,deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 21Str: 17dgg,_#§...........§.#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15dggU.#§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19843.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#.§## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..§###≈..#..##..#.#.#.#.#..#..##dgg.##..#..#≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#..  _The Shining One accepts your kill. _No reachable target in view! _No reachable target in view! _O - a scroll of revelation _You see here a +1 cloak of willpower. _W - a +1 cloak of willpowerdgg@U.≈dggB+4.2 (1dggIHdggY §≈You start removing your armour.dggZ+5.2 (2dgg`dggHrN§§§§dggr+6.2 (3dggxdgg###§.§dgg+7.2 (4dgg?dggʜd§§≈§dgg+8.2 (5dggdgg5 18 _You continue removing your +2 cloak of stealth. x4  You finish removing your +2 cloak of stealth.dggdggdgg ##§§.§#≈....You feel less stealthy.  You start putting on your armour.dggv+9.2 (6dggdgg4##≈.≈§dgg",50.2 (7dggdgg@..dgg;+1.2 (8dggdgg##§#≈§..dgg4+2.2 (9dgg dgg5 T≈.dgg ,3.2 (10.0)dggs dgg _You continue putting on your +1 cloak of willpower. x5dgg /  --more--dgg! h 20  You finish putting on your +1 cloak of willpower.dgg dggjdggE _You feel strong-willed.dggdggDrop what?49/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)dgg2p - 9 boomerangs  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  U - 4 javelins Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +1 cloak of willpower (worn)  w - a +2 cloak of stealth Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand) [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]dgg*  T - a +0 helmet (worn)  W - a +1 cloak of willpower (worn)  w - a +2 cloak of stealth Jewellery (select all with "=)d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)dggH - a ring of willpower Wands (select all with /)  h - a wand of roots (14)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12)  N - a wand of charming (7) Scrolls (select all with ?)  g - 5 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence38%dgg(1 turn)  T - a +0 helmet (worn)  w + a +2 cloak of stealth[Enter] accept (1 chosen)dgg>dgg\deadiverson the CarverHuman of the Shining One ******#############dgg]S# Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 20Str: 17#§.............#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15dgg?^#§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19853.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#..## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..##..#.#.#.#.#..#..##≈##..#.dgg _.#≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#.. You finish putting on your +1 cloak of willpower. _You feel strong-willed.dgg&b+4.2 (1dggkC _You drop a +2 cloak of stealth.dgg dggE Read which item? Scrolls  g - 5 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear dgg H n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesiaO - a scroll of revelation  V - a scroll of enchant armour [!] read|quaff|evokedggg G[?] describe selecteddgg dggdggxdeadiverson the CarverHuman of the Shining One ******#############dgg# Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 20Str: 17#§.............#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15#§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####..## dggI[40m##..### Noise: ---------  Time: 19854.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#..## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..##..#.#.#.#.#..#..##≈##..#..#≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########..gg7m ##§..#########..#55#5#5#.5#.. You finish putting on your +1 cloak of willpower. _You feel strong-willed. _You drop a +2 cloak of stealth.dggMdggOReally read the scroll of noise? Y - Yes dggO' N - Nodgg# dgg`2 deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 20Str: 17dgg3 #§.............#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15#§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19854.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#..##gg5 -m ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..##..#.#.#.#.#..#..##≈##..#..#≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#.. You finish putting on your +1 cloak of willpower. _You feel strong-willed. _You drop a +2 cloak of stealth.  Okay, then.dggC6 dgg= dggC . _dgg dgg dgg$ dgg > _Unknown command.dggRead which item? Scrolls  g - 5 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesiaO - a scroll of revelation  V - a scroll of enchant armour [!] read|quaff|evoke[?] describe selecteddggӚ dgg dggr 5deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 20Str: 17#§.............#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15dggǯ #§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19854.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#..## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..##..#.#.#.#.#..#..##≈##..#.dggӰ .#≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#.. You finish putting on your +1 cloak of willpower. _You feel strong-willed. _You drop a +2 cloak of stealth. _Okay, then. _Unknown command.dggδ dgg Enchant which item? Armour  l - a +1 kite shield (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +1 cloak of willpower (worn)[?] describe selecteddgg_z dgg dgg͇ deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#≈#≈#≈#≈###### Magic: 16/16 ========================##§..........#§### ###≈# AC: 20Str: 17#§.............#≈# #≈#.. EV: 14Int: 11##§.#########....### ###.... SH: 16Dex: 15#§§.##.#.#.##.....≈# #≈..... XL: 14 Next: 19% Place: a Gauntletdgg ##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19854.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)##.©#.#.#.#©#©.#..## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..##..#.#.#.#.#..#..##≈##..#..#≈..##.#.#.##..#.........#.. ###..#########..#.........#..dgg U #≈...........#..###########.. ##§..#########..#55#5#5#.5#.. You finish putting on your +1 cloak of willpower. _You feel strong-willed. _You drop a +2 cloak of stealth. _Okay, then. _Unknown command.dgg ##§§§§§As you read the scroll of enchant armour, it crumbles to dust.dggl 315.2 (1dggq dgg I _Your +1 cloak of willpower glows green for a while.dggfdggrTDrop what?47/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)p - 9 boomerangs  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  dggs4U - 4 javelins Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)H - a ring of willpower [Up|Down] select [PgDn|>] page down [PgUp|<] page updggt [Esc] exit Letters toggle [.|Space] toggle selected[top]dggt2 dggv T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery"=)d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)H - a ring of willpower Wands (select all with /)  h - a wand of roots (14)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12)  N - a wand of charming (7) Scrolls (select all with ?)  g - 5 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon41%dggI  Scrolls (select all with ?)  g - 5 scrolls of vulnerability  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  v - 2 scrolls of noise  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesia  dggɤ qO - a scroll of revelation Potion!  e - 2 potions of enlightenment  i - 2 potions of cancellation  k - 5 potions of mutation  q - 2 potions of attractiont - a potion of heal wounds  u - a potion of magic dgg  z - 3 potions of haste79dgg)(1 turn)  g - 5 scrolls of vulnerability  v + 2 scrolls of noise[Enter] accept (1 chosen)dggr2 turns)  g + 5 scrolls of vulnerability  v + 2 scrolls of noise2dgg dgg," 1deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#≈#§#≈#≈###### Magic: 16/16 ========================##§....§§§...#§### ###≈# AC: 21Str: 17#§.............#≈# #≈#.. EV: 14dgg" Int: 11##§.#########....### ###.... SH: 16Dex: 15#§§.##.#.#.##.....§# #≈..... XL: 14 Next: 19% Place: a Gauntletdgg" ##§.#.#.#.#@####..## ##..### Noise: ---------  Time: 19855.2 (0.0)#≈..##.#.#.##..#..§# #§..#.. a) +0 scimitar (flame)dgg:# a##.©#.#.#.#©#©.#..## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..dgg# ##..#.#.#.#.#..#..##≈##..#..dggU$ #≈..##.#.#.##..#.........#.. ###..#########..#.........#.. #≈...........#..###########.. ##§..#########..#55#5#5#.5#..  _You feel strong-willed. _You drop a +2 cloak of stealth. _Okay, then. dgg$ _Unknown command.As you read the scroll of enchant armour, it crumbles to dust. _Your +1 cloak of willpower glows green for a while.dggw% dgg* dgg;; B##§§§§§dgg; §dggU? +6.2 (1dggF dggPX ##§.§§§ _You drop 5 scrolls of vulnerability.dggY +7.2 (2dgg_ dgg` dgg5g dggTj 2 _You drop 2 scrolls of noise.dgg@edggniIRead which item? Inventory Items Scrolls  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogdggir - a scroll of silence  s - a scroll of enchant weapon  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesiaO - a scroll of revelation dggiFloor Items ([,] to select) Scrolls 5 scrolls of vulnerability dggj2 scrolls of noise [!] read|quaff|evoke[?] describe selecteddgg`- dgg6 dgg> deadiverson the CarverHuman of the Shining One ******############## Health: 113/113 ========================#§#≈#§#§#§#≈###### Magic: 16/16 ========================##§....§§....#§### ###≈# AC: 21Str: 17dggT? #§.......§§...§#≈# #≈#.. EV: 14Int: 11##§.#########...§### ###.... SH: 16Dex: 15#§§.##.#.#.##....§§# #≈..... XL: 14 Next: 19% Place: a Gauntlet##§.#.#.#.#@####.§## ##..### Noise: ---------  Time: 19857.2 (0.0)dgg? #≈..##.#.#.##..#.§§# #§..#.. a) +0 scimitar (flame)dgg? t##.©#.#.#.#©#©.#.§## ##..#.© Throw: 6 darts (poison)#≈..##.#©#.##..#..≈###≈..#..dgg%@ ##..#.#.#.#.#..#..##≈##..#..#≈..##.#.#.##..#.........#.. dggG@ ###..#########..#.........#.. dgg@ \#≈...........#..###########.. ##§..#########..#55#5#5#.5#..  _Okay, then. _Unknown command.dgg@ As you read the scroll of enchant armour, it crumbles to dust. _Your +1 cloak of willpower glows green for a while. _You drop 5 scrolls of vulnerability. _You drop 2 scrolls of noise.dggbH P  Okay, then.dggH dggN dggU . _dgg############# #§#≈#§#§#§#≈#####§....§§....#§### ###≈ #§.......§§...§#≈# #≈#. ##§.#########...§### ###. #§§.##.#.#.##....§§# #≈dggl ##§.#.#.#.#?####.§## ##..## #≈..##.#.#@##..#.§§# #§..#. ##.©#.#.#.#©#©.#.§## ##..# #≈..##.#©#.##..#..≈###≈..#.dggX ##..#.#.#.#.#..#..##≈##..# #≈..##.#.#.##..#.........###..#########..#dggR.#. 55 2 ufetubi #≈...........#..###########.dgg}: ##§..#########..#55#5#5#.5#. #≈.∩.#zzz....#..#.#.©.....#.dgg####≈≈.......dgg28.2 (1 _dggdgg^dgg ###############§#≈#§#§#≈#≈########§....§§....#≈### ###≈#§.............#≈# #≈#..##§.#########...§### ###...#§§.##.#.#.##....§§# #≈..##§.#.#.#.#?####.§## ##..####≈..##.#.#.##..#..≈# #§..#..dgg{ w##.©#.#.#.#@#©.#..## ##..#.©#≈..##.#©#.##..#..≈###≈..#.##..#.#.#.#.#..#..##≈##..#.#≈..##.#.#.##..#.........#.###..#########..#.#.#≈...........#..###########.. zzz 3 laughing skullsdgg !##§..#########..#55#5#5#.5#.. 55 2 ufetubidggH Y#≈.∩.#z.zzz..#..#.#.©.....#.##...#.......#..##.#.#.##.#.dggo dgg= dgg! ... 2.zz.dgg &9dgg dggf  dgg D_There is a transporter here.dgg dggR dgg 1## ###§#≈#§#≈#≈#≈### ###≈##§..........#≈### ###≈#..#§.......#≈# #≈#..##§.##dggw y....### ###....###§§.##.#.#.##.....§# #≈.....###§.#?####..## ##..####.#≈..##.#.#.##..#..≈# #§..#..#dgg F##.©#.#.#.#§#@.#..## ##..#.©#.dgg r#≈..##.#©#.##..#..≈###≈..#..###..#..#..##≈##..#..##dgg #≈..##.#.#.##..#....§....#..####..##..#..dggv #..###≈....#..##..#z 3 laughing skulls##§..##dgg ..#55#.#5#.5#..##5 3 ufetubi (1 wandering)dgg .#≈.∩.#.zzz...#..#.#.©5....#..#b##...#.......#..##.#.#.##.#..#dgg] '60dgg dgg L _You enter the transporter and appear at another place.dgg§#≈#§#≈#≈#≈######≈##§..........#≈### ###≈#..§.............#≈≈#..#§.#########....### ###....##§§.##.#.#.##.....§# #≈.....#.dgg'#§.#.#.#.#?####..## ##..###≈..##.#.#.##..#..≈# #§..#..#.©#.#.#.#§#©.#..## ##..#.©≈..##.#©#.#≈###≈..#..#..#.#.#.#.##≈##dggP#≈..##.#.#.#..§..dgg.###..########.#dgg̉q≈...........#..###########..#.#§..#########..#55#.#5#.5#..## 2dggD≈.∩.#.zzz...#..#.#.©5....#..#b#...#....dgg$#.#.#.##.#..#.≈...#####+###..#....#.# dggdggזdggZdgg<≈©.5..dgg.5zdgg&1dggdgg < _The ufetubus shouts! You hear a shout!dggˍ##§..........#≈### ###≈#..§.............#≈≈#..#§.#########....### ###....##§§.##.#.#.##.....≈# #≈.....#.#§.#.#.#.#?####..## ##..###≈..##.#.#.##..#..≈# #§..#..#.©#.#.#.#©#©.#..## ##..#.©≈..##.#©#.##..#..≈###≈..#..dgg]#..#.#.#.#.##≈###≈..##.#.#.#......###..#########≈...........#..###########..#.#§..#########..#55#5#5#.5#..##≈.∩.#..zz...#..#.#.©.....#..#bz 3 laughing skulls#...#...#.#.#.##.#..#.≈...#####+###..#....#.# #.ß©#©...+.©#©©###.####.©#©©dgg+dggʗdggdgg؛dggɜdgg..z.z55 4 ufetubi5dgg&2dggdggdgg.9§...#≈≈#..dgg+#§.#########....### ###....##§§.##.#.#.##.....≈# #≈.....#.#§.#.#.#.#?####..## ##..###≈..##.#.#.##..#..≈# #§..#..dgg#.©#.#.#.#©#©.#..## ##..#.©≈..##.#©#.##..#..≈###≈..#..#..#.#.#.#.##≈###≈..##.#.#.#.....dggIN.###..#########≈...........#..###########..#.#§..#########..#55#.#5#.5#..##dggq≈.∩.#...z.z.#..#.#5©.....#..#b#..dggf..#..##.#.#.##.#..#.≈...#####+###..#...5#.#  3dggԻ#.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###..##.#.####)#..dgg dggudggdgg#dgg-dggdgghdgg§.z.z.z#..#5#..5#5.5 4 ufetubidgg&3dgg[dggKdgg{\#§.#########....### ###....##dgg§§.##.#.#.##.....≈# #≈.....#.#§.#.#.#.#?####..## ##..###≈..##.#.#.##..#..≈# #§..#..dggL#.©#.#.#.#©#©.#..## ##..#.©≈..##.#©#.##..#..§###≈..#..#..#.#.#.#.dgg=##≈###dgg≈..##.#.#.#......###..########dgg#dgg  ≈...........#..###########..#.#§..#########..#5.#.#5#.5#..##dgga≈.∩.#..z.z.z#..#5#.©.....#..#bdggT#...#.......#..##5#5#.##.#..#.≈...#####+###..#....#.# dggp#.ß©#©...+.©#©©###.####.©#©©dgg≈...#.##.+###..##.#.####)#..#dgg2a#.(#..#.##..#.)#dgg$dgg&dggd'dgg)dgg|<x5z...z.dgg=&4dggLdggRdgge §§.##.#.#..≈# #≈.....#.#§.#.#.#.#?####..## ##..###≈..##.#.#.##..#..≈# #§..#..#.©#.#.#.#©#©.#..## ##..#.©≈..##.#©#.##..#..§###≈..#..#..#.#.#.#.##≈###≈..##.#.#.#......###..#########≈...........#@.###########..#.#§..#########..#55#.#5#.5#..##≈.∩.#.z...zz#..#5#.©.....#..#b#...#.......#..#dggzg #5#.#.##.#..#.≈...#####+###..#....#.# #.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###..##.#.####)#..#...#.##.#.(#..#.##..#.)#≈.∩.#....#.?..#..#.dgghh .z#..##.dggh <5∩dgg#i &5dggs A∩dgg n#§.#.#.#.#?####..## ##..###dgg 2≈..##.#.#.##..#..≈# #§..#..#.©#.#.#.#©#©.#..## ##..#.©≈..##.#©#.##..#..§###≈..#..dggB #..#.#.#.#.##≈###≈..##.#.#.#......###..########dgg #≈...........#..###########..#.#§..#########@.#55#.#5#.5#..##dggʾ ≈.∩.#.z....z#..#5#.©.....#..#b#...#..#.#.#.##.#..#.≈...#####+###..#5...#.# dgg l#.ß©#©...+.©#©©###.####.©#©©dgg8 ≈...#.##.+###..##.#.####)#..#...#.##.#.(#..#.##..#.)#dggf ≈.∩.#....#.?#..#.#..#..#.#...#########..####5.##.##..##dgg i§###§dggQ &6dgg dgg dgg/#≈..##..#..≈# #§..#..#.###.©#.#.#.#©#©.#.§## ##..#.©#.#≈..##.#©#.##..#..§###≈..#..#.##..#.#.#.#.#..#.§##≈##..#..####≈..##.#.#.##..#.........#..#..###..#########..#.#..####≈...........#..###########..#..##§..#########..#55#.#5#.5#..####≈.∩.#.z....z#.@#5#.©.....#..#b.##...#......z#..##.#.#.##.#..#.##≈...#####+###..#5...#.# .#..#.##.ß©#©...+.gg?37m©#©©###.####.©#©©#.#≈...#.##.+###..##.#.####)#..#.###...#.##.#.(#..#.##..#.)##..#.# 2  #≈.∩.#....#.?#..#.#..#..#.#..#.##...#########..####..##.##..####≈...........#..###########..#...zz 3 laughing skulls∩dgg0@&7dggTLdggUTdgg6t#.©#.#.#.#©#©.#.§## ##..#.©#..≈..##.#©#.##..#..§###≈..#..#..#.#.#.#.#..#.§##≈####≈..##.#.#.##..#.........###..##########≈...........#..###########..#..#§..#########..#55#.#5#.5#..###≈.∩.#..z...z#..#5#.©.....#..#b.#...#...#.#.#.##.#..#.#≈...#####+###..#5...#.# .#.ß©#©...+.©#©©###.####.©#©©dgg (≈...#.##.+###..##.#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#..#.#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..##..#########..#.........#..###dggdgg#dgg h≈...zdgg &8dggTdggdgg≈..##.#©#.##..#..≈###≈..#..#..#.#.#.#.##≈####≈..##.#.#.#.......###..########.##≈...........#..###########..#..#§..#########..#55#.#5#.5#..###≈.∩.#....z.z#..#5#.©.....#..#b.#...#.#.#.##.#..#.#≈...#####+###.@#5...#.# dggY|.#.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###..##.#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#..#.#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..##..#########..#.........#..### #≈..#W##....dggdggD.zdggӮ&9dggdgg  The laughing skull chuckles harshly at how history will forget everyone _present.dgg_#..#.#.#.#.##≈####≈..##.#.#.#.......###..########.##≈...........#..###########..#..#§..#########..#55#.#5#.5#..###dggy≈.∩.#.....zz#..#5#.©.....#..#b.#...z#..##.#.#.##.#..#.#≈...#####+###..#5...#.# .#.ß©#©...+.©#©@###.####.©#©©≈...#.##.+###..##.#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#..#.#..#..#.#..#..dgg#...#########..####..##.##..###≈...........#..###########..#..##..#########..#.........#..### #≈..#W##..#...#..##W.##..##≈##dgg,dggdggi].5∩dggF'70dgg:∩dggtR _There is a transporter here.dgg≈..##.#.#.#.......###..########...##≈...........#..###########..#..#§..#########..#5.#.#.#.5#..###≈.∩.#.....zz#..#5#.©.....#..#b.#...z#..##.#.#.##.#..#.#dggW ≈...#####+###..#55..#.# .#.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###.@##.#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#..#.#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..##..#########..#.........#..### #≈..#W##..#......#..##W.##..##≈##≈..#W##.#.$≈###≈#dgg* dgg H.5dgg -1 _dgg0, dggC0 dgge ###..#########≈...........#..###########..#..#§..#########..#5.#.#.#.5#..###≈.∩.#.....zz#..#.#.©.....#..#b.#...z#..##5#.#.##.#..#.#≈...#####+###..#55..#.# .#.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###..##.#.####)#..#.###.(#.@#.##..#.)#dgg 9≈.∩.#....#.?#..#.#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..##..#########..#.........#..### #≈..#W##..#...#..##W.##..##≈##≈..#W##.#.$≈###≈##.©##W#©.#©#©.#..## ##..#.©##dgg dggk dgg8 dgg dgg dggA Y.W   shadowghast (wandering).Wzzz 3 laughing skulls555 3 ufetubidgg &2dggc dgg dggx"≈...........#..###########..#..#§..#########..#..#.#.#.5#..###≈.∩.#.....zz#..#.#.©.....#..#b.#...z#..##5#.#.##.#..#.#≈...#####+###..#55..#.# .#.ß©#©...+.©#©©###5####.©#©©≈...#.##.+###..##.#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#.@#.#..#..#.#..#..#...#########..####..#dgg##.##..###≈...........#..###########..#..##..#########..#.........#..### #≈..#W##..#...#..##.W##..##≈##≈..#W##.#.$≈###≈##.©##W#©.#©#©.#..## ##..#.©##5 4 ufetubi≈..#.#.#.#:#..#..≈# #§..#..##.dgg,dgg-dgg/dggA..5W.W 3dggA&3dggY@∩dgg#§..#########..#..#.#.#.5#..###≈.∩.#.....zz#..#.#.©.....#..#b.#...z#..##.#.#.##.#..#.#≈...#####+###..#555.#.# .#.ß©#©...+.©#©©###.####.©#©©≈...#.##.+###..##5#.####)#..#.###.(#..#.##..#.)#≈.∩.#....#.?#..#.#..#..#.#..#..#...#########.@####..##.##..###≈...........#..###########..#..##..#########..#.........#..###dgg #≈..#W##W.#...#..##..##..##≈##≈..#W##.#.$≈###≈##.©##W#©.#©#©.#..## ##..#.©##≈..#.#.#.#:#..#..≈# #§..#..##.5 4 ufetubi#.##.####..## ##..####sydgg֦dggdgg dggdggǯdgg dgg(..55.W§dgg &4dggdggdgg=}8≈...........#..###########..#..#§..#########..#..#.#.#.5#..###≈.∩zz#..#.#.©.....#..#b.#...#......z#..##.#.#.###≈...#####+###..#5...#.# .#..#.ß©#©...+.©#©©###5####.©#©©#..≈+###..##5#.####)#...#.##.#.(#..#.##..#.)##..#.#≈.∩.#....#.?#.@#5#..#..#.#..#..dgg~.#...#########..####..##.##..###≈...........#..###########..#..###..#######.##≈..#W##.W##.....#..##..##..##≈##.≈..#W##.#.$#..#..≈###≈..#..#.#.©##W#©.#©#©.#..## ##..#.©###≈#.#:#..#..§# #§..#..##.dggdggdggdggv.5.Wdgg&5dggodggdgg "##..#########..#.........#..###≈...........#..###########..#..#§..#########..#..#.#.#.5#..###≈.∩zz#..#.#.©.....#..#b.#...#......z#..##.#.#.###≈...#####+###..#5...#.# .#..#.ß©#©...+.©#©©###.####.©#©©#..≈dgg8 M+###..##5#.####)#...#.##.#.(#.@#5##..#.)##..#.#≈.∩.#....#.?#..#5#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..###..#######.##≈..#W##..##.....#..##..##W.##≈##.≈..#W##.#.$#..#..≈###≈..#..#.#.©##W#©.#©#©.#..## ##..#.©###dgg dgg f∩W.dggi &6dgg <∩dgg dgg  #≈..##.#.#...##..#########..#.........#..###≈...........#..###########..#..#§..#########..#..#.#.#.5#..###≈.∩zz#..#.#.©.....#..#b.#...#......z#..##.#.#.##dgg #≈...#####+###..#5...#.# .#..#.ß©#©...+.©#©©###.####.©#©©#..≈+###.@##5#.####)#...#.##.#.(#..#5##..#.)##..#.#≈.∩.#....#.?#..#5#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#..###..#######.##dgg ≈..#W##.W##.....#..##..##..##≈##. 3≈..#W##.#.$#..#..≈###≈..#..#.dgg dgg W 2 shadowghasts (1 wandering)Wdgg &7dgg 4∩dgg dgg #..#.#.#.#.##≈#### #≈..##.#.#.#§....##..#########..#.........#..###≈...........#..###########..#..#§..#########..#..#.#.#.5#..###≈.∩zz#..#.#.©.....#..#b.#...#......z#..##.#.#.###≈...#####+###..#5...#.# .#..dgg#.ß©#©...+.©#©@###.####.©#©©#..≈+###..##5#.####)#...#.##.#.(#..#5##..#.)##..#.#≈.∩.#....#.?#..#5#..#..#.#..#..#...#########..####..##.##..###≈...........#..###########..#.. W   shadowghast  ###..#######....##≈..#W##.W##.....5 4 ufetubi#..##.W##..##≈##.dgg^,dggI-&8dggY:<∩dgg?R _There is a transporter here.dgggZ dgg_ dggVp .##.#.#.##..#..≈# #§..#..#.#..#.[ ©#.#.#.#©#©.#..## ##..#.©#..#©#?© .##.#©#.##..#..≈###≈..#..#..#..#) .#.#.#.#.#..#..##§##..#..###...# .##.#.#.##..#...§.....#..#...##.. dggp !.#########..#.........#..######## .........#..###########..#....... .#########..#..#.#.#..#..######## .#.....zz#..#.#.@.....#..#b.....h dggGq .#......z#..##5#.#.##.#..#.#.###. .#####+###..#....#.##.#..#...###) ©#©...+.©#©§###5####.3#©©#..©###© .#.##.+###..##.#.####)#..#.##.^.? dggq .#.##.#.(#..#5##..#.)##..#.##^hhb 3   sixfirhy dggq W.#....#.?#..#5#..#..#.#..#...bhhb 5555 4 ufetubi .#########..####..##.##..######## .........#..###########..#.....dggs &9dgg- dggs L _You enter the transporter and appear at another place.dgg$.##.#.#.##..#..≈# #§..#..#.#..#. .©#.#.#.#©#©.#..## ##..#.©#..#©#?.##.#©#.##..#..≈###≈..#..#..#..# ..#.#.#.#.#..#..##§##..#..###...# ..##.#.#.##..#...§.....#..#...## ..#..#.........#...#..###########..# ..#..#..#.#.#..#.. ∩.#.....zz#..#.#@©.....#..#b..... ..#......z#..##5#.#.##.#..#.#.### ..#####+###..#...gg%m.#.##.#..#...### ß©#©...+.©#©§###5####.3#©©#..©### ..#.##.+###..##.#.####)#..#.##.^. ..#.##.#.(#..#5##..#.)##..#.##^hh 555 3 ufetubi ∩.#....#.?#..#5#..#..#.#..#...bhh.##..####..##.##...#..#..#dgg+dgg.dgg1dgg2dgg4dgg6dgg:e  The ufetubus slips past you! You block the ufetubus's attack. x3dgg)<dgg(=dgg]K.53.#5©###.5.3   sixfirhy.555 3 ufetubidggQL/=80dggXdgg\? _The ufetubus hits you but does no damage.dggаQ  You hit the ufetubus. You burn the ufetubus.dggdggѲdggɸp  The ufetubus is severely wounded.dggdgg* ≈3...5.You block the sixfirhy's attack. You block the ufetubus's attack. x2  The ufetubus closely misses you.dgg[-1.0 (0.8dgg!dgg? _The ufetubus hits you but does no damage.dggi  You closely miss the ufetubus.The ufetubus is severely wounded.dggJkdggw 5.You block the ufetubus's attack. x2; The ufetubus slips past you!dggx&8dggdggno _You block the ufetubus's attack. The ufetubus misses you.dggӠ  You hit the ufetubus. You burn the ufetubus.  You kill the ufetubus!dgg dgg g  The Shining One accepts your kill.dgg׸ .5. 2dgg/ (2.6dggp dgg 9 _You block the ufetubus's attack. x2dgg8 ∩dggdggq9 ∩dgg<F _Unknown command.dgg>x2 _Unknown command.  You hit the sixfirhy. You burn the sixfirhy.  The sixfirhy is moderately wounded.  The ufetubus hits you but does no damage.  You block the ufetubus's attack. x2dgg^ #§§§5 5 3 ufetubiThe ufetubus hits you but does no damage.dgg(3.4dgg_dggr _You block the sixfirhy's attack. The ufetubus misses you. x2dggK  You slash the sixfirhy! You burn the sixfirhy.  The sixfirhy is heavily wounded.dggT  You block the sixfirhy's attack. x2; The ufetubus barely misses you.You block the ufetubus's attack. The sixfirhy closely misses you.dggc f#§§ ∩dggc 0=4.2dggp 9 ∩dgg:s _The ufetubus closely misses you. The ufetubus barely misses you. x3dgg RThe ufetubus closely misses you.barely misses you. x3  You closely miss the sixfirhy.  The sixfirhy hits you. The sixfirhy shocks you!  The sixfirhy hits you but does no damage.  You block the sixfirhy's attack.dgg j. 2dgg" f99/113 ----5.0dgg4 9 ∩dgg Q _You block the ufetubus's attack. x2; The ufetubus hits you.dgg  You miss the sixfirhy.The sixfirhy is heavily wounded.dgg #.§§.5 ∩5 3 ufetubiYou block the sixfirhy's attack. You block the ufetubus's attack.  The ufetubus closely misses you.100/113----9 (0.9dgg/; ∩dggzB _The ufetubus hits you but does no damage. x2dggf  You completely miss the sixfirhy.dgg(  The sixfirhy is heavily wounded.You block the ufetubus's attack. The ufetubus closely misses you.dgg ###... ∩You block the ufetubus's attack. x2; The ufetubus closely misses you.dgg(6.8dggdgg&? _The ufetubus hits you but does no damage.dgg  You closely miss the sixfirhy.The sixfirhy is moderately wounded.You block the ufetubus's attack. x3; The ufetubus closely misses you.dgg§§.. 2dgg^(7.7dggdggw _The ufetubus misses you. The ufetubus barely misses you.dgg hit the sixfirhy. You burn the sixfirhy.  The sixfirhy is heavily wounded.  You block the sixfirhy's attack.  The sixfirhy hits you but does no damage.  The sixfirhy barely misses you. You block the ufetubus's attack.  You block the ufetubus's attack.dggn ..≈55 3 ufetubidgg 518.5 (0.8dgg' dggy( dgg6 /  --more--dgg# _The ufetubus barely misses you. The sixfirhy barely misses you.dggǩ #.©©#©.#..## ##..#.©#..#©# ≈..##.#©#.##..#..≈###≈..#..#..#.. #..#.#.#.#.#..#..##≈##..#..###... ≈..###..#.........#..#...# #..#########..#.........#..######.........#..###########..#..... §..#########..#.5#.#.#..#..###### .∩.#......z#..#.#.3.....#..#b.... dgg ...#......z#..##@#5#.##.#..#.#.##.#####+###..#...5#.##.#..#... .ß©#©...+.©#©©###.####.3#©©#..© ...#.##.+###..##.#.####)#..#.##.^.#.##.#.(#..#.##..#.)##..#.##^h .∩.#....#.?#..#.#..#..#.#..#...b dggڪ ...#########..####..##.##..###### z   laughing skull.........#..###########..#..... 5   ufetubus #..#########..#.........#..######dggܯ dggf The sixfirhy attacks as it pursues you! The sixfirhy hits you!  The sixfirhy shocks you! You block the sixfirhy's attack.dgg dgg| The sixfirhy barely misses you.The laughing skull gibbers darkly at the inescapable nature of violence.dggl 3©.5.You block the sixfirhy's attack. You block the ufetubus's attack.dggR l81/113 ----=9.5 (1.0dgg :∩dgg_ U _The ufetubus barely misses you.dgg  You hit the sixfirhy. You burn the sixfirhy.  The sixfirhy is heavily wounded.dgg") 5∩5 2 ufetubidgg) 6-90.3 (0.8dgg6 dgg8 w _The ufetubus closely misses you. You block the ufetubus's attack.dggc  You closely miss the sixfirhy.The sixfirhy is heavily wounded.dgg5#3©.   ufetubusdggB-1.1dgg:∩dggoV _The ufetubus slips past you! You block the ufetubus's attack. x2dgg  You hit the sixfirhy. You burn the sixfirhy.  The sixfirhy is severely wounded.dgg 5∩ 5 2 ufetubidgg W2----9dggdggv _You block the ufetubus's attack. The ufetubus barely misses you.dggN:The sixfirhy is severely wounded. _You block the ufetubus's attack. The ufetubus barely misses you.  You slash the sixfirhy! You burn the sixfirhy.  The sixfirhy is almost dead.  The sixfirhy hits you but does no damage. x2 dggJ ©    ufetubusThe ufetubus hits you but does no damage.dggK0=2.7dggYdgg]6 _You block the sixfirhy's attack.dgg  You miss the sixfirhy.The sixfirhy is almost dead.The sixfirhy hits you but does no damage.dggZYou miss the sixfirhy.  The sixfirhy is almost dead.  The sixfirhy hits you but does no damage.  You block the sixfirhy's attack. You block the ufetubus's attack. x2  The sixfirhy hits you but does no damage.ufetubusdgg<∩dgg.0-3.5dgg:∩dgg߳2-dgg/  --more--dgg_W _The ufetubus completely misses you.dggYou closely miss the sixfirhy.The sixfirhy is almost dead.You block the sixfirhy's attack. The sixfirhy barely misses you.dggJ)n55 2 ufetubidgg*034.3dgg6<∩dgg:1 _You block the ufetubus's attack. x2dgg   You closely miss the sixfirhy.The sixfirhy is almost dead.dgg§§© .∩   ufetubusdgg2(5.1dgg*:∩dgg.9 _You block the ufetubus's attack. x2dggA  You slash the sixfirhy! You burn the sixfirhy.  You kill the sixfirhy!The Shining One accepts your kill.dggt u  You feel better. The ufetubus barely misses you.dggA dgg- .55z   laughing skull555 3 ufetubidggF5 9==219 _You block the ufetubus's attack.dggC dggwH l _Your Invocations skill increases to level 3!dgg  You hit the ufetubus. You burn the ufetubus.  The ufetubus is moderately wounded.You block the ufetubus's attack. x3dgg ..© 2dggZ a4==6.7dgg! dgg ? _The ufetubus hits you but does no damage.dgg  You slash the ufetubus! You burn the ufetubus.  You kill the ufetubus!dggܸdgg*§..5slash the ufetubus! You burn the ufetubus.  You kill the ufetubus!  The Shining One accepts your kill.  slips past you! You block the ufetubus's attack. x3  The ufetubus barely misses you.  The ufetubus hits you but does no damage.dgg037.5dgg)dggpdgg/  --more--dgg؈ - _The ufetubus hits you.dggA You slice the ufetubus!! You burn the ufetubus.  You kill the ufetubus!The Shining One accepts your kill.dgg ..   ufetubusdgg ^5==8.3dgg dgg B _You feel better. You block the ufetubus's attack. x2dgg496dggn5E=-9.1dgg@dggCs _You completely miss the ufetubus. You block the ufetubus's attack. x2dggړ  You hit the ufetubus. You burn the ufetubus.  The ufetubus is moderately wounded.dgg|@-9dgg<∩dggo _The ufetubus misses you. You block the ufetubus's attack.dgg# ∩You hit the ufetubus. You burn the ufetubus.  The ufetubus is heavily wounded.dgg$*900.7dgg53dgg7 _The ufetubus barely misses you. The ufetubus closely misses you.dgg  You hit the ufetubus. You burn the ufetubus.  You kill the ufetubus!The Shining One accepts your kill.dggYF.dgg#071.5dggdggW& _You feel better.dgg dggw dgg dgg R _No reachable target in view!dgg_3H Ability - do what?CostFailure  Invocations -  X - Renounce ReligionNone0% a - Divine Shield3 MP, Piety-1%  b - Cleansing Flame5 MP, Piety-50%  c - Summon Divine Warrior8 MP, Piety--71%  W - Brand Weapon With Holy Wrath None0% [?] toggle between ability selection and description.dggNescribe what?dggW.q Brand Weapon With Holy Wrath Permanently blesses a weapon of your choice with the holy wrath of the Shining One. Demon weapons will be converted into a more powerful sacred weapon. This blessing may only be used once, and it cannot be used on artefact weapons. Range: N/A This ability costs: nothing.dggH~ Ability - describe what? CostFailure  Invocations -  X - Renounce ReligionNone0%  a - Divine Shield3 MP, Piety-1%  b - Cleansing Flame5 MP, Piety-50%  c - Summon Divine Warrior8 MP, Piety--71%  W - Brand Weapon With Holy Wrath None0% [?] toggle between ability selection and description.dggmdgghdgg#.©#.#.#.#©#©.#..## ##..#.©#..#©# deadiverson the Carver ≈..##.#©#.##..#..≈###≈..#..#..#.. Human of the Shining One ****** #..#.#.#.#.#..#..##≈##..#..###... Health: 97/113 ====================---- ≈..##.#.#.##..#.........#..#...## Magic: 16/16 ======================== #..#########..#.........#..###### AC: 21Str: 17 ...........#..###########..#..... EV: 14Int: 11 §..#########..#..#.#.#..#..###### dggRSH: 16Dex: 15 .∩.#......z#..#.#.©.....#..#b.... XL: 14 Next: 21% Place: a Gauntlet ...#......z#..##@#.#.##.#..#.#.## Noise: =--------  Time: 19901.5 (0.0) ...#####+###..#....#.##.#..#...## a) +0 scimitar (flame) .ß©#©...+.©#©©###.####.3#©©#..©## Throw: 6 darts (poison) ...#.##.+###..##.#.####)#..#.##.^ ...#.##.#.(#..#.##..#.)##..#.##^h dgg.∩.#....#.?#..#.#..#..#.#..#...bh z   laughing skull ...#########..####..##.##..###### ...........#..###########..#..... #..#########..#.........#..###### _The ufetubus barely misses you. The ufetubus closely misses you.You hit the ufetubus. You burn the ufetubus.  You kill the ufetubus!The Shining One accepts your kill. _You feel better. _No reachable target in view!dggd ∩Okay, then.dgg6dggCdgg(. _dggF c..##.#©#.##..#..≈###≈..#..#..#.. ..#.#.#.#.#..#..##≈##..#..###...# ..###..#.........#..#...## ..#########..#.........#..##### ..........#..###########..#......#########..#..#.#.#..#..####### ∩.#......z#..#.#.©.....#..#b..... ..#......z#..##.#.#.##.#..#.#.########+###..#..@.#.##.#..#...# dgg ß©#©...+.©#©©###.####.3#©©#..©# ..#.##.+###..##.#.####)#..#.##.^.#.##.#.(#..#.##..#.)##..#.##^hh ∩.#....#.?#..#.#..#..#.#..#...bh ..#########..####..##.##..####### zz 2 laughing skulls.......#..###########..#......#########..#.........#..####### ..#W##.W###..#.#..#......dgg 8 ∩dgg B8-2.5 (1 _dgg 9 ∩dggQ dgg8 ∩dgg8-dggmdggMdggR##.#©#.##..#..≈###≈..#..#..#..#)#.#.#.#.#..#..##≈##..#..###...#. .##.#.#.##..#.........#..#...##. .#..#.........#..##..###########..#. .##..#..#.#.#..#..# .#......z#..#.#.©.....#..#b.....h .dgg+S#......z#..##.#.#.##.#..#.#.###. .#####+###..#...@#.##.#..#...###) ©#©...+.©#©©###.####.3#©©#..©###©#.##.+###..##.#.####)#..#.##.^.?#.##.#.(#..#.##..#.)##..#.##^hhb .#....#.?#..#.#..#..#.#..#...bhhb .#..####..##.##..# dggS#..###########..#.  .##..#.........#..#  .#W##.W###..#.#..#. dggudggv&3dgg|dgg~dggn.#.#.#.#.#..#..##≈##..#..###...# ..##..#.........#..#...# ..#########..#.........#..####### ..........#..###########..#......#########..#..#.#.#..#..####### ∩.#......z#..#.#.©.....#..#b..... ..#......z#..##.#.#.##.#..#.#.### ..#####+###..#....#.##.#..#...### ß©#©...+.©#©©###@####.3#©©#..©### ..#.##.+###..##.#.####)#..#.##.^. ..#.##.#.(#.dggo.#.##..#.)##..#.##^hh ∩.#....#.?#..#.#..#..#.#..#...bhh ..#########..####..##.##..####### ..........#..###########..#...... zz 2 laughing skulls#########..#.........#..#######.#W##.W###..#.........#..#.......##.W##..#..#..##≈##..#..#..##..dgg: ∩dgg%T9=4dgg9 ∩dggҎdgg##..#.........#..#...##.. .#########..#.........#..########.......#..###########..#....... .#########..#..#.#.#..#..######## .#......z#..#.#.©.....#..#b.....h .#......z#..##.#.#.##.#..#.#.### .#####+###..#....#.##.#..#...###) ©#©...+.©#©©###.####.3#©©#..©###© .#.##.+###..##.#@####)#..#.##.^.?#.##.#.(#..#.##..#.)##..#.##^hhb .#....#.?dggW[40m#..#.#..#..#.#..#...bhhb .#########..####..##.##..########.......#..###########..#....... .#########..#.........#..########  .#W##.W###..#.........#..#.......  .##.W##..#..#..##≈##..#..#..##..#  .#W##.#.$#..#..≈###≈..#..#.##..## dgg09§dgg &5dggdggdgglf #########..#.#..######### ........#..###########..#........ #########..#..#.#.#..#..######### #......z#..#.#.©.....#..#b.....h #......z#..##.#.#.##.#..#.#.###.# dggg #####+###..#....#.##.#..#...###)# #©...+.©#©©###.####.©#©©#..©###©# #.##.+###..##.#.####)#..#.##.^.?# #.##.#.(#..#.##.@#.)##..#.##^hhb# #....#.?#..#.#..#..#.#..#...bhhb# #########..####..##.##..######### ........#..###########..#........ #########..#....ggkh m.....#..######### #W##.W###..#.........#..#....... ##.W##..#..#..##≈##§.#..#..##..## #W##.#.$#..#..≈###≈§.#..#.##..## ##W#©.#©#©.#..## ##..#.©###^©##©dgg} dgg~ &6dggO dgg dgg9P.......#..###########..#......... ########..#..#.#.#..#..######### ......z#..#.#.©.....#..#b.....h#. ......z#..##.#.#.##.#..#.#.###.#. ####+###..#....#.##.#..#...###)#. ©...+.©#©©###.####.©#©©#..©###©#. dggXC.##.+###..##.#.####)#..#.##.^.?#. .##.#.(#..#.##..#.)##..#.##^hhb#. ....#.?#..#.#..#@.#.#..#...bhhb#. ########..####..##.##..#########. .......#..###########..#......... ########..#.........#..######### W##.W###..#.........#..#.......#. #dgg.W##..#..#..##≈##§.#..#..##..##. W##.#.$#..#..≈###≈§.#..#.##..###.dgg©.#©#©.#..## ##..#.©###^©##©#. .#.#.#:#..#..§# #§..#..##..##".#.dggndggQd100/113=7dggdggdggk#######..#.........#..######### ......#..###########..#......... #######..#..#.#.#..#..#########.z#..#.#.©.....#..#......h#. .....z#..##.#.#.##.#..#.#.###.#.ß ###+###..#....#.##.#..#...###)#. .dggl~..+.©#©©###.####.©#©©#..©###©#.∩ ##.+###..##.#.####)#..#.##.^.?#. ##.#.(#..#.##..#@)##..#.##^hhb#.ß ...#.?#..#.#..#..#.#..#...bhhb#. #######..####..##.##..######### ......#..###########..#......... #######..#.........#..#########. #dggl#.W###..#.........#..#.......#. .W##..#..#..##≈##§.#..#.. ##.#.$#..#..≈###≈§.#..#.##..###. W#©.#©#©.#..## ##..#.©###^©##©#.dggrdgghh   hell hound (wandering)..dgg&8dggޖ:∩dggՙdggu 5..#.#..#..##..###########..#.#..#..#.#.#..#..#..#z#..#.#.©.....#..#......h#..#z#..##.#.#.##.#..#.#.###.#.ß#+###..#....#.##.#..#...###)#..#+.©#©©###.####.©#©©#..©###©#.∩# #dggi I.+###..##.#.####)#..#h##.^.?#..# #.#.(#..#.##..#.@##..#.##^hhb#.ß##.?#..#.#..#..#.#..#...bhhb#..#..####..##.##..#..##..###########..#.#..#.........#..#..# #.W###..#.........#..#.#..≈ W##..#..#..##≈##..#..#..##..##..# #dggȯ .#.$#..#..≈###≈..#..#.##..###..≈ #©.#©#©.#..## ##..#.©###^©##©#..#dggO dggD n.dgg &9dggL :∩dggP | _The hell hound barks! You hear a bark! _You see here a +0 flail.dgg6H .#.##..#.#..#...##..#..≈ #####..#.........#..#########..# ....#..###########..#..........# #####..#..#.#.#..#..#########..#.z#..#.#.©.....#..#......h#..#. ...z#..##.#.#.##.#..#.#b###.#.ß#. #+###..#....#.##.#..#...###)#..#. .+.©#©©###.####.©#©©#..©###©#.∩#. .+###..##.#.####@#..#.##.^.?#..#. .dgg'I #.(#..#.##..#.)##..#h##^hhb#.ß#. .#.?#..#.#..#..#.#..#..bbhhb#..#. #####..####..##.##..#########..#. ....#..###########..#..........# #####..#.........#..#########..## h   hell hound .W###..#.........#..#.......#..≈# bb 2 fire bats (wandering)#..#..#..##≈##..#..#...## .#.$#..#..≈###≈..#..#.##..###..≈#dgg_X dggX dgg5Z dggZ dggb^ dggh .b∩h...b   fire batdggi 6110 _dggs :∩dggw M _You see here a +0 club.dggEM#.#.##≈####...#.#..# .#.........##..#..≈ #####..#.........#..######### ....#..###########..#..........## #####..#..#.#.########.#.©.........h#.. dggG...z#..##.#.#.###.###.#.ß #+###..#....#.##.#..#...###)#...©#©©###.####.@#©©#b.©###©#.∩ .+###..##.#.####)#..#h##.^.?#..(#..#.##..#.)##..#.##^hhb#.ß .#.?#..#.#..#..#.#..#...bhhb#..#.#h   hell houndb   fire bat..##≈##..#..#..#dggKdggOdgg[^bb 2 fire bats (1 wandering)dgg[-1 _dggHddggfR _There is a transporter here.dgg' dgg, dggw; .#..##≈##..#..###...#.#..## #..#.........#..#...##..#..≈# ..#.........#..##..###.#..###########..#..##....#..#.#.#..#..##..#.. .z#..#.#.©.....#..#......h#..#.. .z#..##.#.#.##.#..#.#.###.#.ß#.© #dgg< ##..#....#.##.#..#...###)#..#.. .©#©©###.####.§#@©#b.©###©#.∩#.© ###..##.#.####)#..#h##h^.?#..#.. .(#..#.##..#.)##..#b##^hhb#.ß#.© .?#..#.#..#..#.#..#...bhhb#..#....####..##.##..##..#..#..###########..#..##.. h   hell hog..#.........#..##..###. h   hell hound ###..#....ggO= 0;1m.....#..#.......#..≈# # bb 2 fire bats dgg> .22dggI dggGM L _You enter the transporter and appear at another place.dggԢdgggA Gauntlet∩∩∩(Press ? for help) #≈..##.#.#.##..#..≈# #§..#..#.#..#.[#..§#  ##.©#.#.#.#©#©.#..## ##..#.©#..#©#?©#..##  #≈..##.#©#.##..#..≈###≈..#..#..#..#)#..§#  ##..#.#.#.#.#..#..##≈##..#..###...#.#..##  #≈..##.#.#.##..#.........#..#...##..#..≈# ###  ###..#########..#.........#..#########..###...  #≈...........#..###########..#..........##..#  dgg*##§..#########..#..#.#.#..#..#########..#...##  #≈.∩.#......z#..#.#.©.....#..#......h#..#.....  ##...#......z#..##.#.#.##.#..#.#.###.#.ß#.©.##  #≈...#####+###..#....#.##.#..#...###)#..#...##  ##.ß©#©...+.©#©©###.####.§#@©#b.©###©#.∩#.©...  #≈...#.##.+###..##.#.####)#..#h##h^.?#..#...##  ##...#.##.#.(#..#.##..#.)##..#b##^hhb#.ß#.©.##  #≈.∩.#....#.?#..#.#..#..#.#..#...bhhb#..#.....  ##...#########..####..##.##..#########..#...##  #≈...........#..###########..#..........##..#  ###..#########..#.........#..#########..###...  #≈..#W##.W###..#.........#..#.......#..≈# ###  ##..##.W##..#..#..##≈##..#..#..##..##..##  #≈..#W##.#.$#..#..≈###≈..#..#.##..###..≈#  dgg##.©##W#©.#©#©.#..## ##..#.©###^©##©#..##  #≈..#.#.#.#:#..#..§# #§..#..##..##".#..≈#dgg]x.@∩dggNV.#∩dgg]dgg#.#..#..##≈##..#..###...#.#..##deadiverson the Carver .##..#.........#..#...##..#..≈# # Human of the Shining One ****** ###..#.........#..#########..###. Health: 102/113 =====================--- ..#..###########..#..........##.. Magic: 16/16 ======================== ###..#..#.#.#..#..#########..#... AC: 21Str: 17 .z#..#.#.©.....#..#......h#..#... EV: 14Int: 11 dgg.z#..##.#.#.##.#..#.#.###.#.ß#.©. SH: 16Dex: 15 ###..#....#.##.#..#...###)#..#... XL: 14 Next: 21% Place: a Gauntlet .©#©©###.####.§#@©#b.©###©#.∩#.©. Noise: ---------  Time: 19912.5 (0.0) ###..##.#.####)#..#h##h^.?#..#... a) +0 scimitar (flame) .(#..#.##..#.)##..#b##^hhb#.ß#.©. Throw: 6 darts (poison) .?#..#.#..#.dgg[.#.#..#...bhhb#..#... ###..####..##.##..#########..#... ..#..###########..#..........##.. h   hell hog ###..#.........#..#########..###. h   hell hound dgg###..#.........#..#.......#..≈# # bb 2 fire bats ..#..#..##≈##..#..#..##..##..## _Okay, then. _The hell hound barks! You hear a bark! dgg_You see here a +0 flail. _You see here a +0 club. _There is a transporter here. dgg >_You enter the transporter and appear at another place.dgg-dgg:∩dggdgg- .#..#..##≈##..#..###...#.#..## ##..#.........#..#...##..#..≈# #..#.........#..#..###. .#..#####..#.##..#..#..#.#.#..#..#########..#...# z#..#.#.©.....#..#......h#..#. z#..##.#.#.##.#..#.#.###.#.ß#.©.#..#....#.##.#..#...###)#..#...# ©#©©###.####.§#©@#b.©###©#.∩#.©.dgg. ..##.#.####)#..#h##h^.?#..#...# (#..#.##..#.)##..#b##^hhb#.ß#.©.# ?#..#.#..#..#.#..#...bhhb#..#...####..##.##..#########..#...# .#..###########..#.##..#..#.........#..#..###...#.........#..#.#..≈# # dgg4 dgg6 dgg7 dggE ^©h.dggF +3.5 (1dgg9R dggYU R _There is a transporter here.dggv.#..#..##≈##..#..###...#.#..##deadiverson the Carver ##..#.........#..#...##..#..≈# ## Human of the Shining One ****** ##..#.........#..#########..###.. Health: 102/113 =====================--- .#..###########..#..........##..# Magic: 16/16 ======================== dgg##..#..#.#.#..#..#########..#...# AC: 21Str: 17 z#..#.#.©.....#..#......h#..#.... EV: 14Int: 11 z#..##.#.#.##.#..#.#.###.#.ß#.©.# SH: 16Dex: 15 dggCR##..#....#.##.#..#...###)#..#...# XL: 14 Next: 21% Place: a Gauntlet ©#©©###.####.©#©@#b.h###©#.∩#.©.. Noise: ---------  Time: 19913.5 (0.0) dgg"##..##.#.####)#..#h##.^.?#..#...# a) +0 scimitar (flame) (#..#.##..#.)##..#b##^hhb#.ß#.©.# Throw: 6 darts (poison) ?#..#.#..#..#.#..#...bhhb#..#.... ##..####..##.##..#########..#...# .#..###########..#..........##..# h   hell hog ##..#.........#..#########..###.. h   hell hound dgg_##..#.........#..#.......#..≈# ## bb 2 fire bats .#..#..##≈##..#..#..##..##..## _There is a transporter here. _You enter the transporter and appear at another place. _There is a transporter here.  dggPress: ? - help, v - describe, . - travelA transporter.  This square is lit by a halo.dggxT@#lucent stone wall.dgg#bHere: a fire bat (haloed, fire blocked by a translucent stone wall)e floor.dgg'b.∩The floor.is square is lit by a halo.dgg&^ .h∩Here: a hell hog (haloed, fire blocked by a translucent stone wall)  A transporter landing site.dgg h#A crystal wall.  This square is lit by a halo.dggJ##  You can't see that place.  [a crystal wall.]dgg&r5##dggJ )#dggm, g - get itemStash: the +7 captain's cutlass {speed, disarm}]  [the floor.]dggU.#..#..##≈##..#..###...#.#..##deadiverson the Carver ##..#.........#..#...##..#..≈# ## Human of the Shining One ****** ##..#.........#..#########..###.. Health: 102/113 =====================--- .#..###########..#..........##..# Magic: 16/16 ======================== dgg##..#..#.#.#..#..#########..#...# AC: 21Str: 17 z#..#.#.©.....#..#......h#..#.... EV: 14Int: 11 z#..##.#.#.##.#..#.#.###.#.ß#.©.# SH: 16Dex: 15 ##..#....#.##.#..#...###)#..#...# XL: 14 Next: 21% Place: a Gauntlet dgg%©#©©###.####.©#©@#b.h###©#.∩#.©.. Noise: ---------  Time: 19913.5 (0.0) dgg%##..##.#.####)#..#h##.^.?#..#...# a) +0 scimitar (flame) (#..#.##..#.)##..#b##^hhb#.ß#.©.# Throw: 6 darts (poison) ?#..#.#..#..#.#..#...bhhb#..#.... ##..####..##.##..#########..#...# dgg.#..###########..#..........##..# h   hell hog ##..#.........#..#########..###.. h   hell hound ##..#.........#..#.......#..≈# ## bb 2 fire bats .#..#..##≈##..#..#..##..##..## _You enter the transporter and appear at another place. _There is a transporter here.  dggPress: ? - help, . - travel, g - get itemYou can't see that place.  [Stash: the +7 captain's cutlass {speed, disarm}]  [the floor.]dgg:dgg<∩dgg$. _dgg9 9∩dgg$ dgg dgg F _Unknown command.egg#........##..#..≈# ##.########..###.. egg.#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©.........h.#.#.#.###.###.#.ß#.©.# ##..#....#.##..###)#..#.. eggQl©#©©###.####.©#©©#b.h###©#.∩#.©.. egg|##..##.#.####)#.@#h##.^.?#..#...# egg(#..#.##..#.)##..#b##^hhb#.ß#.© ?..#..#.#..#....hhb#..#.... egg##..####..##.##..######### .egg#######..#..........## ##..#.........#..#########..###..egg&........#..≈# ## s   wolf spider (wandering) egg.##≈####.s##..## h   hell hound $≈###≈##..###..≈bb 2 fire batseggEegg[eggh©ss.eggW+4.5 (1egg:∩egg: _The wolf spider's many legs skitter.eggxL########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...eggx......h.#.#.#.###.###.#.ß#.©.# ##..#....#.##..###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# eggy(#..#.##..#.)##.@#b##^hhb#.ß#.© ?egg0y...#..#.#..#......b#..#.... ##..####..##.##..########egg^yl# .#######..#..........## eggy##..#.........#..#########..###.......s..#..≈# ## .egg`z##≈####..##..## $≈###≈##.s###..≈ ©#©.#..## ##..#.©###^©##©#..#s   redback (wandering)(…)eggSegg6eggކeggegg eggeggegg5eggTeggeggegghhh.hhs.s.hhh 3 hell hounds (2 wandering)s egg^.35eggaeggheggb(.#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©......h..h.#.#.#.###.###.#.ß#.©.# ##..#....#.##.#..#h..###)#..#.. ©#©©###.####.©#©©#b.©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##..#b##^..b#.ß#.© ?..#..#.#.@#.h....b#..#.... ##..####..##.##..######### .#######..#..........## egg)##..#.........#..#########..###.....s.s..#..≈# ## .##≈####..##..## $≈###≈##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #§..#..##..##".#..≈egg>/egg/,egg0eggK0egg0egg4egg8G.h.h∩h##^beggHb.s.s.§hhheggCH&6eggPYeggx_. _The hell hound barks! x2egg ##..#..#.#.#..#..#########..#. z#..#.#.©.........h.#.#.#.###h###.#.ß#.©.# ##..#....#.##..###)#..#.. eggR ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##..#h##^b.b#.ß#.© ?..#..#.#..#b.....b#..#.... egg ##..####..##.##.@######### .egg _#######..#..........## ##..#.........#..#########..###...s.s...#..≈# ## .egg ##§##.##..##..## $egg? z≈###≈##..###..≈ eggz ©#©.#..## ##..#.©###^©##©#..# egg e:#..#..§# #§..#..##..##".#..≈ .####..## ##..####sy##.)?#..#egg ,egg egg, eggE eggS egg egg ,egg egg G.hh##^.bss.. 24=7egg egg  eggX Dz#..#.#.©.........h.#.#.#.###.###.#.ß#.©.# ##..#....#.##..###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##..#h##^..b#.ß#.© eggY x?..#..#.#..#bb....b#..#.... ##..####..##.##..######### .#######.@#..........## ##..#.........#..#########..###..ss.....#..≈# ## .##§##..##..##..## egg$Z $≈###≈##..###..≈ eggbZ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #§..#..##..##".#..≈ eggP[ .####..## ##§.####.y##.)?#..# ##.....§# #≈.....#s......#.§≈egg#b eggw i.s≈egg)x &8egg :∩egg egg+#.#.#.###.###.#.ß#.©.# ##..#....#.##..###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##..#h##^..b#.ß#.© eggx-J?..#..#.#..#bb....b#..#.... ##..####..##.##..######### .#######..#..........## ##..#.........#.@#########..###..s......#..≈# ## .##§##s.##..##..## $≈###≈.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ .####..## ##§.####.y##.)?#..# ##.....§# #§.....#.......#.§≈egg-V### ###....#########§§#egg-9∩egg&9eggx:∩egg$eggZh##..#.....###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##..#h##^..b#.ß#.© ?..#..#.#..#bb....b#..#.... eggL\1##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###..s......#..≈# ## .##§##s.##..##..## $≈###≈.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ .####..## ##§.####.y##.)?#..# ##.....§# #§.....#.......#.§≈### ###....#########§§# ....#≈# #≈#...........§§§egg\eggyx~∩≈.#eggy_5=20eggx:∩egg;eggB> eggM pA Gauntlet∩∩∩(Press ? for help) ##§..#########..#..#.#.#..#..#########..#...##  #≈.∩.#......z#..#.#.©.....#..#......h#..#.....  ##...#......z#..##.#.#.##.#..#.#.###.#.ß#.©.##  #≈...#####+###..#....#.##.#..#...###)#..#...##  eggN ##.ß©#©...+.©#©©###.####.©#©©#bh©###©#.∩#.©...  #≈...#.##.+###..##.#.####)#..#h##.^.?#..#...##  ##...#.##.#.(#..#.##..#.)##..#h##^..b#.ß#.©.##  #≈.∩.#....#.?#..#.#..#..#.#..#bb....b#..#.....  ##...#########..####..##.##..#########..#...##  #≈...........#..###########..#..........##..#  egg] page down [PgUp|<] page up [Esc] exit[top]egg{+  W - a +2 cloak of willpower (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)H - a ring of willpower Wands (go to first with /)h - a wand of roots (14)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12)  N - a wand of charming (7) Scrolls (go to first with ?)  j - a scroll of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  x - 6 scrolls of teleportation  egg7,zJ - 4 scrolls of identify  K - a scroll of amnesia48% egg3  eggB  eggS .#..#..##≈##..#..###...#.#..##deadiverson the Carver ##..#.........#..#...##..#..≈# ## Human of the Shining One ****** ##..#.........#..#########..###.. Health: 107/113 ======================-- .#..###########..#..........##..# Magic: 16/16 ======================== ##..#..#.#.#..#..#########..#...# AC: 21Str: 17 z#..#.#.©.....#..#......h#..#.... EV: 14Int: 11 z#..##.#.#.##.#..#.#.###.#.ß#.©.# SH: 16Dex: 15 ##..#....#.##.#..#h..###)#..#...# eggV [40m XL: 14 Next: 21% Place: a Gauntlet ©#©©###.####.©#©@#bh©###©#.∩#.©.. Noise: ---------  Time: 19927.5 (0.0) ##..##.#.####)#..#h##.^.?#..#...# a) +0 scimitar (flame) (#..#.##..#.)##..#h##^..b#.ß#.©.# Throw: 6 darts (poison) ?#..#.#..#..#.#..#bb....b#..#.... ##..####..##.##..#########..#...# .#..###########..#..........##..# h   hell hog ##..#.........#..## eggW #######..###.. s   wolf spider ##..#.........#..#ss.....#..≈# ## hhh 3 hell hounds .#..#..##≈##..#..#..##..##..##s   redback(…)_The hell hound barks! x2  Press: ? - help, . - travel, g - get itemYou can't see that place.  [Stash: a wavering tin amulet] _[the floor.] _There is a transporter here. eggi 4 egg| <∩ egg  egg#≈###≈..#..#)#..§ .##≈####...#.#..## ...##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#.@#h..###)#..#...# ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#.. (#..#.)##..#h##^.[0;10; egg1m.b#.ß#.©.# ?#..#.#..#..#.#..#bb....b. #..##.##..#########..#. .#..###########..#..........##..# hhh 3 hell hounds.########..###.. bbb 3 fire bats #.....ss.....#..≈# ## egg egg4Ph. eggI:88.5 (1 _ egg egg. eggK'©#©.#..## ##..#.©#..#©#?©#..# #≈###§..#..#)#..§ .##≈####...#.#..## ...##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#.@#.#.###.#.ß#.© ##..#....#.##.#..#hh.###)#..#...#  egg(©#©©###.####.©#©©#b.©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#.. (#..#.)##..#h##^..b#.ß#.©.# ?#..#.#..#..#.#..#bb....b. #..##.##..#########..#. .#..###########..#..........##..#########..###.. eggg- egg., egg0, eggLR§hb.hh eggS&9 eggb:∩ eggf eggx ##..#..≈# #§..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###§§.#..#..#..#)#..§ .##≈####...#.#..## ...##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#.@#......h#..#.... z#..##.#.#.##.#..#h#.###.#.ß#.© ##..#....#.##.#..#b..###)#..#...# ©#©©###.####.©#©©#h.©###[39; egg 49m©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#h##^..b#.ß#.©.# ?#..#.#..#..#.#..#bb....b. #..##.##..#########..#. .#..###########..#..........##..# egg  egg , egg  egg  egg  egg[  egg ≈.hb.h.h∩b. egg$ '30 egg ;∩ egg#  egg ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## ...##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#h.....h#..#.... z#..##.#.#.##.#..#b#.###.#.ß#.© ##..#....#.##.#..#.h.###)#..#...# ©#©©###.####.©#© egg ©#.h©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#b.....b. #..##.##..#########..#. egg  egg]  egg'  egg)  eggm  egg  egg  eggm  egg J egg% /hh egg h. egg ∩ egg b eggj . egg J   quicksilver ooze (wandering) egg 7hhh 3 hell hou egg nds egg Abbb 3 fire bats egg  egg M9=1 egg 0  egg4  eggu##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#J.#)#..§ .##≈####...#.#..## ...##..#..≈# ##  eggE##..#.........#..#########..###.. .#..###########.@#..........## ##..#..#.#.#########.#.©.....#..#h.....h#..#.... z#..##.#.#.##.#..#b#.###.#.ß#.© ##..#....#.##.#..#hh.###)#..#...# ©#©©###.####.©#©©#h.©###©#.∩#.©.. ##..##.#.####)#..#b##.^.?#..#.. (#..#.)##..#.##^..b#.ß#.©.# ?#..#.#..#..#.#..#b.....b. 2 egg" egg\ egg, egg, eggB egg egg< egg egg egg eggw(.Jbh#h.b.J. egg &2 egg egg eggJ### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####J..#.#..## ...##..#..≈# ## ##..#.........#.@#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hb....h#..#....  eggsz#..##.#.#.##.#..#h#h###.#.ß#.© ##..#....#.##.#..#.hb###)#..#...# ©#©©###.####.©#©©#b.©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#.##^..b#.ß#.©.#b 3 fire bats egg< egg eggy, egg, egg<, egg.Jhbhhbb..∩ egg_10=3 egg9 ;∩ eggX egg....#≈# #≈#.............§### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.######### egg.#.©.....#..#hbh...h#..#.... z#..##.#.#.##.#..#h#h###.#.ß#.© ##..#....#.##.#..#bb.###)#..#...# ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####).^.?#..#.. egg egg eggfhb. egg&4 egg egg eggx#≈####≈## ....#≈# #≈#.............§### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈ egg ..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hbhh..h#..#.... z#..##.#.#.##.#..#h#b###.#.ß#.© ##..#....#.##.#..#b..###)#..#...# ©#©©###.####.©#©©#..©###©#.∩#.©.. egg^  egg~ &5 egg=∩ egg egg #≈### ###≈#≈#≈#≈#≈#§# #≈####≈#...........# ....#≈# #≈#.............§### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ##  egg 4##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hbhh..h#..#.... z#..##.#.#.##.#..#h#b###.#.ß#.© ##..#....#.##.#..#b..###)#..#...# 2 egg D16 egg  egg  egg+x#≈######≈#≈#≈#≈#≈#§#deadiverson the Carver ..#≈### ###≈#...........##Human of the Shining One ****** ....#≈# #≈#.............§#Health: 111/113 =======================- ##....### ###....#########.§##Magic: 16/16 ======================== ##.....≈# #≈.....#..##..J#..§#AC: 21Str: 17 ?####..## ##..####.#...###..##EV: 14Int: 11 ##..#..≈# #≈..#..#.#..#.[#..§#SH: 16Dex: 15  eggzy©#©.#..## ##..#.©#..#©#?©#..##XL: 14 Next: 21% Place: a Gauntlet ##..#..≈###≈..#.@#..#..#)#..§#Noise: ---------  Time: 19936.5 (0.0) .#..#..##≈##..#..###...#.#..##a) +0 scimitar (flame) ##..#.........#..#J..##..#..≈# ## Throw: 6 darts (poison) ##..#.........#..#########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#...# h   hell hog z#..#.#.©.....#..#hbhh..h#..#.. eggy!.. J   quicksilver ooze z#..##.#.#.##.#..#h#b###.#.ß#.©.# hhh 3 hell hounds ##..#....#.##.#..#b..###)#..#...# bb 2 fire bats  [Stash: a wavering tin amulet] _[the floor.] _There is a transporter here.  Press: ? - help, v - describe, . - travelThe floor.  This square is lit by a halo. egg)[@#A translucent stone wall. eggY#.The floor. egg?.. egg- e.#A translucent stone wall. eggp Y#.The floor. egg ?.. eggHr<?. _[the floor.] _There is a transporter here.  Press: ? - help, v - describe, . - travel, g - get itemItem here: a scroll of blinking. egg[?  You can't see that place.  [Stash: a pair of twisted boots]  [the floor.]egg6#≈######≈#≈#≈#≈#≈#§#deadiverson the Carver ..#≈### ###≈#...........##Human of the Shining One ****** ....#≈# #≈#.............§#Health: 111/113 =======================- ##....### ###....#########.§##Magic: 16/16 ======================== egg:##.....≈# #≈.....#..##..J#..§#AC: 21Str: 17 ?####..## ##..####.#...###..##EV: 14Int: 11 ##..#..≈# #≈..#..#.#..#.[#..§#SH: 16Dex: 15 ©#©.#..## ##..#.©#..#©#?©#..##XL: 14 Next: 21% Place: a Gauntlet ##..#..≈###≈..#.@#..#..#)#..§#Noise: ---------  Time: 19936.5 (0.0) .#..#..##≈##..#..###...#.#..##eggՁfa) +0 scimitar (flame) ##..#.........#..#J..##..#..≈# ## Throw: 6 darts (poison) ##..#.........#..#########..###.. .#..###########..#..........##..# eggH>##..#..#.#.#..#..#########..#...# h   hell hog z#..#.#.©.....#..#hbhh..h#..#.... J   quicksilver ooze z#..##.#.#.##.#..#h#b###.#.ß#.©.# hhh 3 hell hounds ##..#....#.##.#..#b..###)#..#...# bb 2 fire bats egg_[the floor.] _There is a transporter here.  Press: ? - help, . - travel, g - get itemYou can't see that place.  [Stash: a pair of twisted boots]  [the floor.]eggeggVegg. _egg..#≈### ###≈#...........##..#≈≈#.............§ ##....### ###....#########.§#.≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ eggR5©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....J..##..#..≈# ##########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbhh..h.#.#.#.##.#..#h#b###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. ©#©©###.####.©#©©#..©###©#.∩#.©..b 3 fire batsegg9§egg/27.5 (1 _eggfegg$egg\ ..#≈≈#..§ ##....### ###....#########.§#.≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##§####...#.#..# #..§..J..##..#..≈# ##.egg-^ K########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbhh..h.#.#.#.##.#..#h#b###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...#eggx h≈§∩eggy &8egg ;∩egg egg3 ##....### ###....#########.§#.≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# egg4 i##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #..§§.J..##..#..≈# ##..########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbhh..h.#.#.#.##.#..#h#b###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. egg>5 ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)#^..b#.ß#.©eggN O..∩egg O .29egga ;∩egg0f egg.≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....eggJ..##..#..≈# ##########..###.. .#..###########.@#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbhh..h.#.#.#.##.#..#h#b###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?..#..#.#..#......b#..#....eggegg>eggeggL.begg'40eggegg4egg.j?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....J..##..#..≈# ##########..###.. eggV/b.#..###########..#..........##..# ##..#..#.#.#..#.@#########..#. z#..#.#.©...hbhh..h.#.#.#.##.#..#h#.###.#.ß#.©.# ##..#....#.##.#..#bb.###)#..#.. ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# egg/(#..#.##..#.)##^..b#.ß#.© ?..#..#.#..#......b#..#.... ##..####..##.##..#########eggP6egg#JT.hegg.K53=eggK1eggZegg^eggD##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....egg? J..##..#..≈# ##########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbh...h.#.#.#.##.#..#h#h###.#.ß#.©.# ##..#....#.##.#..#bb.###)#..#.. ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© eggq?..#..#.#..#......b#..#.... ##..####..##.##..######### .#######..#..........##eggeggeggegga.b∩egg&2egg";∩egg egg9©#©.#..## ##..#.©#..#©#?©#..# ##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....J..##..#..≈# ##########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hbh...h.#.#.#.##.#.@#h#h###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. ©#©©###.####.©#©©#b.©###©#.∩#.©.. ##..##.#.####)#..#.##[egg:{40m.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?..#..#.#..#......b#..#.... ##..####..##.##..######### .#######..#..........## 2 ##..#.........#..#########..###..egg=eggC@eggTA,eggQhb.h#.heggVS&3eggjaegghgeggj p##..#..≈###≈..#..#..#..#)#..§ .##≈####...#.#..# #.....J..##..#..≈# ##########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hb....h.#.#.#.##.#..#h#h###.#.ß#.©.# ##..#....#.##.#.@#bh.###)#..#.. ©#©©###.####.©#©©#b.©###©#.∩#.©.. egg ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?..#..#.#..#......b#..#.... ##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###..h 3 hell houndsss.....#..≈# ##egg, eggA §.h4eggR eggX egg .##§####...#.#..# #.....J..##..#..≈# ##########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hb....h.#.#.#.##.#..#h#.###.#.ß#.©.# egg} ##..#....#.##.#..#bhh###)#..#.. ©#©©###.####.©#©@#b.©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?egg9 ..#..#.#..#......b#..#.... ##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###.. s   wolf spider.ss.....#..≈# ## J   quicksilver ooze .##≈##eggw ..##..##..## hhh 3 hell hounds(…)egg9 egg egg egg$ Z..hhegg$ B=5egg25 eggW= R _There is a transporter here.egg #.....J..##..#..≈# ##.########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...hb....hegg .#.#.#.##.#..#h#.###.#.ß#.©.# ##..#....#.##.#..#b..###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.@#h##.^.?#..#...# (#..#.##..#.)##..#.##^..b#.ß#.© ?..#..#.#..#......b#..#.... ##..####..##.##..######### .eggc#######..#..........## ##..#.........#..#########..###...ss.....#..≈# ## .##≈##..##..##..## hhh 3 hell hounds $≈###≈##..###..≈s   redback eggeggnegg&].b∩egg'-6 _egg?6:∩egg:egg"########..###.. .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...h.....h.#.#.#.##.#..#h#.###.#.ß#.©.# ##..#....#.##.#..#bb.###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# egg(#..#.##..#.)##.@#.##^..b#.ß#.© ?..#..#.#..#......b#..#.... ##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###...ss.....#..≈# ## .##§##..##..##..## $≈###≈##..###..≈ ©#©.#..## ##..#.©###^©##©#..#egg- egg ,egg egg& l.hb∩hegg &7eggR* :∩eggQ. egg .#..###########..#..........##..# ##..#..#.#.#..#..#########..#. z#..#.#.©...h.....h.#.#.#.##.#..#.#.###.#.ß#.©.# ##..#....#.##.#..#bh.###)#..#.. ©#©©###.####.©#©©#bb©###©#.∩#.©.. ##..##.#.####)#..#h##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?..#..#.#.@#......b#..#.... egg ##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###...ss.....#..≈# ## .##§##..##..##..## $≈###≈##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #§..#..##..##".#..≈egg_ ,egg egg՟ egg1 eggơ eggk egg .h..hbh8egg' <∩egg egg Z ##..#..#.#.#..#..#########..#. z#..#.#.©.........h.#.#.#.##.#..#h#.###.#.ß#.©.# ##..#....#.##.#..#...###)#..#.. ©#©©###.####.©#©©#bbh###©#.∩#.©.. ##..##.#.####)#..#b##.^.?#..#...# (#..#.##..#.)##..#h##^..b#.ß#.© ?..#..#.#..#h.....b#..#.... eggU ##..####..##.##.@######### .#######..#..........## ##..#.........#..#########..###..ss.....#..≈# ## .##§##..##..##..###≈..#..## .####..## ##..####.y##.)?#..##bbb 3 fire batseggeggegg-M.hhegg-f©∩≈h   hell hogs   wolf spiderhhh 3 hell houndsegg.s   redback (…)eggc/&9egg0GeggMr _The hell hound pauses to sniff the ground.eggxz#..#.#.©.........h.#.#.#.###.###.#.ß#.©.# ##..#....#.##.#..#hh.###)#..#.. ©#©©###.####.©#©©#bb©###©#.∩#.©.. ##..##.#.####)#..#b##.^.?#..#...# (#..#.##..#.)##..#h##^..b#.ß#.© ?eggy ..#..#.#..#h.....b#..#.... ##..####..##.##..######### .#######.@#..........## ##..#.........#..#########..###..ss.....#..≈# ## .##≈##..##..##..## $≈###≈##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ eggy9.####..## ##..####sy##.)?#..# ##.....§# #§.....#.......#.§≈s 2 redbacks (1 wandering)eggeggegg׃egg΄eggegg؇egghh∩.bh.s.   redbackegg'50egg)eggײeggV#.#.#.###.###.#.ß#.©.# ##..#....#.##.#..#hh.###)#..#.. ©#©©###.####.©#©©#bb©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#...# (#..#.##..#.)##..#b##^..b#.ß#.© ?..#..#.#..#hh....b#..#.... egg##..####..##.##..######### .#######..#..........## ##..#.........#.@#########..###..s......#..≈# ## .##≈##s.##..##..## $≈###≈.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ .####..## ##..####.y##.)?#..# ##.....§# #≈.....#.......#.§≈### ###....#########§§#eggeggeggeggPeggch.hbegg&1eggKeggegg¹##..#...h..###)#..#.. ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#..#b##.^.?#..#...# (#..#.##..#.)##^..b#.ß#.© ?..#..#.#..#hh....b#..#.... ##..####..##.##..######### .#######..#..........## ##..#.........#..#########..###..s......#..≈# ## .##≈##s.##..##..## $≈###≈.##..###..≈ ©#©.#..## ##..#.[3egg9;49m©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ .####..## ##..####.y##.)?#..# ##.....§# #≈.....#.......#.§≈### ###....#########§§# 2 ....#≈# #≈#...........§§§egg<2egg%egg<eggz#..##.#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. #..##.##..#########..#. .#..###########..#..........##..#########..###.. #egg.....s......#..≈# ## .##≈##s.##..##..# $#..#..≈###≈..#..#.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈ eggc.####..## ##..####.y##.)?#..#.§# #≈.....#.......#.§≈h 3 hell hounds eggf##....### ###....#########§§#egg]EeggF&3egg9WeggYeggF_.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)egg#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. eggS5#..##.##..#########..#. .#..###########.@#..........##..#########..###.. #.....s......#..≈# ## .##≈##egg|gs.##..##..# egg$#..#..≈###≈..#..#.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# eggɏ:#..#..§# #≈..#..##..##".#..≈ .####..## ##..####.y##.)?#..#.§# #≈.....#.......#.§≈eggeggegg\Ls.egg&4eggִeggegg ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. egg`:#..##.##.@#########..#. .#..###########..#..........##..#########..###.. #egg.....ss.....#..≈# ## .##≈##.##..##..# egg$#..#..≈###≈..#..#.##..###..≈ egg ©#©.#..## ##..#.©###^©##©#..# egg,:#..#..§# #≈..#..##..##".#..≈ eggP.####..## ##..####.y##.)?#..#eggK9∩egg&5eggegg!egg+.#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# egg,©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#.@#hh....b. #..##.##..#########..#. .#..###########..#..........##..#########..###.. #.....ss.....#..egg -≈# ## .##≈##.##..##..# egg]-j$#..#..≈###≈..#..#.##..###..≈ ©#©.#..## ##..#.©###^©##©#..# :#..#..§# #≈..#..##..##".#..≈egg-eggD9∩egghE&6egg*R:∩eggXegg ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# egg ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##.@#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. #..##.##..#########..#. .#..###########..#..........##..#.########..###.. #.....ss.....#..≈# ## .##≈##.##..##..# $#..#..≈###≈..#..#.##..###..≈ ©#©.#..## ##..#.©###^©##eggN F[39;49m©#..#egg ,egg Phhegg$ &7egg :∩egg eggN= /J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#h..###)#..#...# egg > 2©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####).^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. #..##.##..#########..#. .#..###########..#..........##..#.eggs> @########..###.. #egg> D.....egg> ss.....#..≈# ## .##≈##.##..##..# egg> f$#..#..≈###≈..#..#.##..###..≈egguV eggV &8egg?f egg0m eggk.##§####...#.#..## .J..##..#..≈# ## ##..#.........#..#########..###.. eggLB.#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© eggv##..#....#.##.#..#h..###)#..#...# egg©#©©###.####.©#©@#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....begg. #..##.##..#########..#. eggA.#..###########..#..........##..#.########..###.. eggc##.....egg ss.....#..≈# ## J   quicksilver ooze .eggW##≈##.##..##..#hhh 3 hell houndseggD§§∩egg4&9egg~eggR _There is a transporter here.egg#≈###≈..#..#)#..§ .##≈####...#.#..## §§J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.........h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© egg##..#....#.##.#.@#h..###)#..#...# ©#©©###.####.©#©©#bh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....b. #..##.##..#########..#. eggde.#..###########..#..........##..# J   quicksilver ooze.########..###.. hhh 3 hell hounds #.....ss.....#..≈# ## bbb 3 fire batseggC%eggDo..h.eggE.60 _eggFWegg`]egg O©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########egg|O.#.©.........h#..#.... z#..##.#.#.##.#.@#.#.###.#.ß#.© ##..#....#.##.#..#hh.###)#..#...# eggO©#©©###.####.©#©©#b.©###©#.∩#.©.. ##..##.#.####)egg PD#.^.?#..#.. (#..#.)##..#b##^..b#.ß#.©.# ?#..#.#..#..#.#..#hh....beggFP . #eggQM..##.##..#########..#. .#..###########..#..........##..#########..###..eggUegg_VeggVegg}Wegg-XeggXegg ZeggZegg]eggpghhbb.eggmqJh.eggr&1egg eggegg.}##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## egg~J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#.@#......h#..#.... z#..##.#.#.##.#..#h#.###.#.ß#.© ##..#....#.##.#..#hb.###)#..#...# ©#©©###.####.©#©©#bb©###©#.∩#.©.. ##..##.#.####)#..#.##.^.?#..#.. (#..#.)##..#h##^..b#.ß#.©.# ?#..#.#..[40eggm#..#.#..#h.....b. #..##.##..#########..#. .#..###########..#..........##..#eggeggegg?egg2h.∩h.egg8&2eggLeggegg ^?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. egg .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#h.....h#..#.... z#..##.#.#.##.#..#.#.###.#.ß#.© ##..#....#.##.#..#hb.###)#..#...# ©#©©###.####.©#©©#bb©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#h##^..b#.ß#.©.# egg 7?#..#.#..#..#.#..#......b. #..##.##..#########..#.eggv ,egg egg$ eggN egg egg egg egg bbbhh∩..egg &3egg ;∩egg' egg ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########.@#..........## ##..#..#.#.#egg՝ ########.#.©.....#..#h.....h#..#.... z#..##.#.#.##.#..#b#.###.#.ß#.© ##..#....#.##.#..#hbb###)#..#...# ©#©©###.####.©#©©#hh©###©#.∩#.©.. ##..##.#.####)#.^.?#..#.. (#..#.)##..#.##^..b#.ß#.©.# egg n?#..#.#..#..#.#..#......b. 2eggS eggޤ egg egg egg޹ egg޽ egg bb... 2b 3 fire batsegg &4eggd egg eggw### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# eggx#≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#.@#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hb....h#..#.... z#..##.#.#.##.#..#b#b###.#.ß#.© ##..#....#.##.#..#h.h###)#..#...# ©#©©###.####.©#©©#h.©###©#.∩#.©.. ##..##.#.####)#.^.?#..#..eggyh 3 hell hounds (#..#.)##..#.##^..b#.ß#.©.#egg|eggu~egg~eggIybhh..eggd&5egg=∩eggegg&0....#≈# #≈#.............§### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ egg'%©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##≈####...#.#..## J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hbb...h#..#.... z#..##.#.#.##.#..#b#h###.#.ß#.© egg\(##..#....#.##.#..#hh.###)#..#...# ©#©©###.####.©#©©#..©###©#.∩#.©.. ##..##.#.####).^.?#..#..egg0egg6L§§§h.∩6egg[;∩eggae _The quicksilver ooze jiggles.eggW#≈####≈## ....#≈# #≈#.............§### ###....#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# ##..#..≈# #≈..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈egg$..#..#)#..§ .##§####...#.#..## §§J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########egg|.#.©.....#..#hbbh..h#..#.... z#..##.#.#.##.#..#b#.###.#.ß#.© egg##..#....#.##.#..#hh.###)#..#...# ©#©©###.####.©#©©#..©###©#.∩#.©..eggeggegg4w§§§h.egg&7eggeggegg \#≈### ###≈#≈#≈#≈#≈#§# #≈####≈#...........# ....#≈# #§#.............§### ###§...#########.§# ##.....≈# #≈.....#..##..J#..§ ?####..## ##..####.#...###..# eggP ##..#..≈# #§..#..#.#..#.[#..§ ©#©.#..## ##..#.©#..#©#?©#..# #≈###≈..#..#)#..§ .##§####...#.#..## egg §§J..##..#..≈# ## egg ##..#.........#..#########..###.. .#..###########..#..........## eggƻ ##..#..#.#.########egg #egg |.#.©.....#..#hbbh..h#..#.... z#..##.#.#.##.#..#b#h###.#.ß#.©eggo k 2 ##..#....#.##.#..#h..###)#..#...#eggL ##.§§##§#§§§egg &8egg egg egg ##  ############ #≈### ###≈#≈#≈#§#≈#§# #≈#####≈#...........# ....#≈# #§#.............§### ###.§..#########.§# ##.....≈# #≈..§..#..##..J#..§ ?####..## ##§.####.#...###..# ##..#..≈# #§§.#..#.#..#.[#..§ egg ©#©.#..## ##§©#?©#..# #≈###≈..#..#)#..§ .##§####...#.#..## §§J..##..#..≈# ## ##..#.........#..#########..###.. .#..###########..#..........## ##..#..#.#.#########.#.©.....#..#hbbh..h#..#.... h   hell hound z#..##.#b#h###.#.ß#.© 2egg ##..##≈.§9eggY eggN R _There is a transporter here.egg;eggu@Drink which item? Potions  e - 2 potions of enlightenment  i - 2 potions of cancellation  k - 5 potions of mutation eggwAG q - 2 potions of attraction  t - a potion of heal wounds  u - a potion of magic  z - 3 potions of haste  C - 4 potions of curingE - 2 potions of brilliance  G - a grey potion  Q - 2 bubbling red potionsR - 2 potions of might [!] read|quaff|evoke[?] describe selectedegg,egg:eggGL################eggGTdeadiverson the Carver #≈###eggH###≈#≈#≈#§#≈#§#Human of the Shining One ****** egg4H..#≈### ###≈#...........##Health: 113/113 ======================== eggYH....#≈# #§#.............§#egg~HMagic: 16/16 ======================== ##....### ###....#########.§##eggHYAC: 21Str: 17 eggH##.....≈# #≈.....#..##..J#..§#EV: 14eggH Int: 11 ?####..## ##§.####.#...###..##SH: 16eggI,Dex: 15 eggFI##..#..≈# #≈.§#..#.#..#.[#..§#eggkIXL: 14 Next: 21% Place: a Gauntlet eggI©#©.#..## ##§.#.@#..#©#?©#..##Noise: ---------  Time: 19969.5 (0.0) eggI##..#..≈###≈..#..#..#..#)#..§#egg+Ja) +0 scimitar (flame) .#..#..##§##..#..###...#.#..##eggRJThrow: 6 darts (poison) ##..#....§§...#..#J..##..#..≈# ## eggyJk##..#.........#..#########..###.. eggJ.#..###########..#..........##..# h   hell hog eggK##..#..#.#.#..#..#########..#...# J   quicksilver ooze z#..#.#.©.....#..#hbbh..h#..#.... h   hell hound z#..##.#.#.##.#..#b#h###.#.ß#.©.# bb 2 fire bats _[the floor.] egg,K_There is a transporter here. _The hell hound pauses to sniff the ground. _There is a transporter here. eggRK_The quicksilver ooze jiggles. _There is a transporter here.egg"`≈.§...§§#..egg6ad70.5 (1Might eggleggoe _You feel very mighty all of a sudden.egg NDrink which item? Potions  e - 2 potions of enlightenmenti - 2 potions of cancellation  k - 5 potions of mutation  q - 2 potions of attraction  t - a potion of heal wounds  u - a potion of magic  z - 3 potions of haste  C - 4 potions of curingE - 2 potions of brilliance  G - a grey potion  Q - 2 bubbling red potionsR - a potion of might [!] read|quaff|evoke[?] describe selectedegg,eggegg8################deadiverson the Carver #≈######≈#≈#≈#§#≈#§#Human of the Shining One ****** ..#≈### ###≈#...........##Health: 113/113 ======================== ....#≈# #≈#.............§#eggMagic: 16/16 ======================== ##....### ###....#########.§##AC: 21Str: 17 ##.....≈# #≈.....#..##..J#..§#EV: 14Int: 11 ?####..## ##..####.#...###..##SH: 16Dex: 15 ##..#..≈# #§..#..#.#..#.[#..§#XL: 14 Next: 21% Place: a Gauntlet ©#©.#..## ##..#.@#..#©#?©#..##Noise: ---------  Time: 19970.5 (0.0) ##..#..≈###§§.#..#..#..#)#..§#a) +0 scimitar (flame) .#..#..##§##..#..###...#.#..##Thregggow: 6 darts (poison) ##..#.........#..#J..##..#..≈# ## Might ##..#.........#..#########..###.. .#..###########..#..........##..# h   hell hog ##..#..#.#.#..#..#########..#...# J   quicksilver ooze z#..#.#.©.....#..#hbbh..h#..#.... h   hell hound z#..##.#.#.##.#..#b#h###.#.ß#.©.# bb 2 fire bats _There is a transporter here. egg_The hell hound pauses to sniff the ground. _There is a transporter here. _The quicksilver ooze jiggles. _There is a transporter here. eggP_You feel very mighty all of a sudden.egg§#≈§≈§#1.5 (1Fast Might eggeggH(1 _You feel yourself speed up.egg K #####  ###≈#≈#§#≈#§#≈# eggi ## ###≈#......§....## ≈# #≈#.......§.§...§# .### ###....#########.§## ..≈# #≈.....#..##..J#.§§# ..## ##..####.#...###§§## ..≈# #≈..#..#.#..#.[#..≈# ..## ##§.#.§#..#@#?©#..## eggӣ ..≈###§§.#..#..#..#)#..≈# .##§##..#..###...#.#.§## .........#..#J..##..#..§# ### egg m.........#..#########..###... ##########..#..........##..# ..#.#.#..#..#########..#...## bb 2 fire bats .#.©.....#..#hbbh...#..#..... #.#.#.##.#..#b#h###.#.ß#.©.##2.1 (0.6egg egg L _You enter the transporter and appear at another place.egg4egggegg3F _Unknown command.egg& M ############# ###≈#≈#§#≈#§#≈# ###≈#......§....# ≈# #≈#.......§.§...§ .### ###....#########§§#≈# #≈.....#..##...#.§§## ##..####.#...###§§#≈# #≈..#..#.#.@#.[#..≈## ##§.#.§#..#©#?©#..#≈###§§.#..#..#..#)#..≈##§##..#..###...#.#.[4eggK' v0m§## .........#..#J..##..#.§§# ###.§##..#...#.###...#hbbh...#..egg48 ≈..§...8 (0.7 _egg@ eggB egg e #############  ###≈#≈#§#≈#≈#≈# # ###≈#....§...§..## eggM l# #≈#.............§# ### ###....#########§§## ≈# #≈.....#..##...#.§§# ## ##..####.#..@###§§## ≈# #≈..#..#.#..#.[#..≈# ## ##§.#.§#..#©#?©#..## ≈###§§.#..#..#..#)#..≈# egg C##§##..#..###...#.#.§###..#J..##..#.§§# ### ........#..#########.§###... #########..#..........#egg n##.#..#..#########..#...##egg ..§§.§##.§#§egg-3.4 (0.6egg egg egg?> ################≈#≈#§#≈#≈#≈# ###≈#....§.....§## #≈#............§§# # ###....#########.§## eggC? ≈# #≈.....#..##...#..§# ## ##..####.#...###.§## ≈# #≈..#..#.#..#@[#..≈# ## ##§.#.§#..#©#?©#..## ≈###§§.#..#..#..#)#..§# ##§##..#..###...#.#.§## ......#..#J..##..#.§§# ####..#########.§###... J   quicksilver ooze egg? ########..#..........##..#.#.#..#..#########..#...# .©.....#..#hbbh...#..#.....eggD eggO ≈..J≈##eggP -4.1 (0.7eggY egg\  egg_'############# ###≈#≈#§#≈#≈#≈# ###≈#....§.....§## #≈#............§§#  ###....#########§§## # #≈.....#..##...#..≈#  ##..####.#...###..## # #≈..#..#.#..#.@#..≈#  ##§.#.§#..#©#?©#..## ###§§.#..#..#..#)#..§# §##..#..###...#.#.§## #..#.J.##. egg#..#########.§###... ..#...... .#.#..#..#######  egg egg4y##§..§§ eggz§§##.J.. eggd&8 eggD egg' _You see here the +0 pair of boots of the Other World {Fly Str+2 Dex+3}.!egg!egg̼#.##..≈#!egg+..§J.#.#§..§!egg<(5.5!egg!egg  _g - the +0 pair of boots of the Other World {Fly Str+2 Dex+3}!egg################≈#≈#§#≈#≈#≈####≈#...........## #≈#.§.....§.....≈# !egguG## ###...§#########..## ≈# #≈.....#..##...#..≈## ##..####.#...###..## ≈# #≈..#..#.#..#..#..≈## ##§.#.©#..#©#@©#.§## !eggr≈###§§.#..#..#..#)#§§§#§##..#..###.J.#.#§.## .......#..#...##..#.§≈# ###.#..#########..###... ########..#..........##..#!egg3h   hell hog.#.#..#..#########..#...##!egg^rJ   quicksilver ooze!egg©.....#..#hbbh...#..#..... #.#.##.#..#b#h###.#.ß#.©.##!egg!egg&§......§J..#.#§§#.§##!egg(6.2!eggs!egg _You see here a scroll of blinking."egg ≈..§...§§#..#"eggr≈##(engulfing you)You closely miss the quicksilver ooze. The quicksilver ooze hits you.  The quicksilver ooze engulfs you!"egg;%="eggk=8 (0.6Engulf "egg"eggw!> _You block the quicksilver ooze's attack."egg[§.  The quicksilver ooze engulfs you! _You block the quicksilver ooze's attack.  You slice the quicksilver ooze!! You burn the quicksilver ooze!  The quicksilver ooze is severely wounded.  Your lungs strain for air!  The quicksilver ooze hits you!"egg\V04--===="egg\&7.2 (0.4"eggd"eggf> _You block the quicksilver ooze's attack."egg" M§.§§.≈# "eggG# qThe quicksilver ooze hits you!ash You burn the quicksilver ooze.!"eggb$ 83/113 -------===-8 (0.6"egg?. "eggn1  "egg1 0_You block the quicksilver ooze's attack."egg( x  Your lungs strain for air!  The quicksilver ooze hits you!! _You block the quicksilver ooze's attack.  You slash the quicksilver ooze! You burn the quicksilver ooze.  You kill the quicksilver ooze!  The ooze engulfing you falls away."egg7 p§..."eggk@ 4-----7--5"egg@ --8.4 _You gasp with relief as air once again reaches your lungs."eggH "eggM l _Your Invocations skill increases to level 4!#egg0g###≈#≈#§#≈#≈#≈# # ###≈#...........## # #≈#.............§# ### ###....#########..## .≈# #≈.....#..##...#..≈# .## ##..####.#...###..## #eggJ1 .≈# #≈..#..#.#..#..#..≈# .## ##§.#.©#..#©#?©#..## .≈###§§.#..#..#.@#)#..≈# .##§##..#..###...#.#..## ........#..#...##..#..≈# ###.#..#########..###... #egg2#########..#..........##..# .#.#.#..#..#########..#...##©.....#..#hbbh...#..#.....b   fire bat#.#.##.#..#b#h###.#.ß#.©.## ...#.##.#..#h..###)#..#...###eggvCA§§#eggSD^---9.1 (0.7 _#eggM#eggqP#egg+## ###≈#§..........## ≈# #≈#.............§# .### ###....#########..## #egg..≈# #≈.....#..##...#..§# ..## ##..####.#...###..## ..≈# #≈..#..#.#..#..#..≈# ..## ##§.#.©#..#©#?©#..## .#eggf.≈###§§.#..#..#..#)#..≈# ..##§##..#..###.@.#.#..## .........#..#...##..#..≈# ###.#..#########..###... #eggj##########..#..........##..# ..#.#.#..#..#########..#.##©.....#..#hbbh...#..#.....#.#.##.#..#b#h###.#.ß#.©.##hh 2 hell hounds...#.##.#..#h..###)#..#...##bbb 3 fire bats #egg##.####.©#©©#..©###©#.∩#.©...#egg#eggh!b.h∩#egg"A--8#egg+#egg0#egg! ###≈#≈#§#≈#≈#≈# # ###≈#...........## # #≈#.............§# ### ###....#########..## ≈# #≈.....#..##...#..§# ## ##..####.#...###..## ≈# #≈..#..#.#..#..#..≈# #eggA## ##§.#.©#..#©#?©#..## ≈###§§.#..#..#.@#)#..≈# ##§##..#..###...#.#..## #..#...##..#..≈# ### ........#..#########..###... #########..#..........##..##eggY#.#..#..#########..#...## ©.....#..#hbbh...#..#..... b   fire bat#.#.##.#..#b#h###.#.ß#.©.## ...#.##.#..#.h.###)#..#...###eggJ?80.5#egg< #egg #egg  #############  ###≈#≈#≈#≈#≈#≈#  ###≈#...........##  #≈#.............§# ## ###....#########..## ≈# #≈.....#..##...#..§# #egg ## ##..####.#...###..## ≈# #≈..#..#.#..#..#..≈# ## ##§.#.©#..#©#@©#..## #eggq ≈###§§.#..#..#..#)#..≈# ##§##..#..###...#.#..## #..#...##..#..≈# ### .......#..#########..###... ########..#..........##..# #egg #.#..#..#########..#...##©.....#..#hbbh...#..#..... #.#.##.#..#b#h###.#.ß#.©.###eggY 9§#eggl i5=--1.2#egg& #egg" C§##eggK# +8 (1.3#egg* #egg- d _j - 2 scrolls of blinking (gained 1)$egge Wear which item? Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} l - a +1 kite shield (worn)  A - a +0 pair of boots (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn)  g - the +0 pair of boots of the Other World {Fly Str+2 Dex+3}[?] describe selected [!] equip|wield|wear|put on[tab] equip|unequip %eggĒ %egg* %eggd #############deadiverson the Carver###≈#≈#≈#≈#≈#≈#Human of the Shining One ******###≈#...........##Health: 85/113 ==================------#≈#.............§#Magic: 16/17 ======================-- %egg (## ###....#########..##AC: 21Str: 17 ≈# #≈.....#..##...#..§#EV: 14Int: 11 ## ##..####.#...###..##SH: 16%egg9 %Dex: 15 ≈# #≈..#..#.#..#..#..≈#XL: 14 Next: 25% Place: a Gauntlet ## ##§.#.©#..#©#@©#..##Noise: ---------  Time: 19981.8 (0.0) %egga ≈###§§.#..#..#..#)#..≈#a) +0 scimitar (flame) %egg ##§##..#..###...#.#.§##Throw: 6 darts (poison) .......#..#...##..#..§# ###%egg Fast Might .......#..#########..###... %egg ########..#..........##..#h   hell hog %egg G#.#.#..#..#########..#...## .©.....#..#hbbh...#..#..... %egg4 #.#.##.#..#b#h###.#.ß#.©.##You slash the quicksilver ooze! You burn the quicksilver ooze.  %egg^ You kill the quicksilver ooze!The ooze engulfing you falls away. _You gasp with relief as air once again reaches your lungs. _Your Invocations skill increases to level 4! %egg e_j - 2 scrolls of blinking (gained 1)%egg3 B≈§§§#%egg )§#%eggY -2.5 (0.7%egg, %egg , §.§≈#.≈##You start removing your armour.%egg -3.1 (1.3%egg %eggz  .. _You continue removing your +0 pair of boots. x267==7 (1.9%egg %egg7 4 _Magic restored.%egg -4.4 (2.6%egg %egg M§§≈%egg= -5.1 (3.3%egg %egg6" 0 _You continue removing your +0 pair of boots. x2%egg# %egg* %egg;  ≈.You finish removing your +0 pair of boots.  You start putting on your armour.8 (4.0%eggS@ %egg%P .7==6.4 (4.6%egggV %eggb %eggXc -7.1 (5.3%egg>r %egg %egg +7 (5.9%eggLj %egg %egg8 -8.4 (6.6%eggm %egg %eggA /  --more--&eggRx 19678continue putting on the +0 pair of boots of the Other World {Fly Str+2Dex+3}. x5  You finish putting on the +0 pair of boots of the Other World {Fly Str+2  Dex+3}.  You feel stronger. You feel agile.&egg|FFly &eggK&eggF _You fly up into the air.&eggk&eggDrop what?46/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)p - 9 boomerangs  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  U - 4 javelins Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} g - the +0 pair of boots of the Other World (worn) {Fly Str+2 Dex+3}  l - a +1 kite shield (worn)  P - a +0 pair of gloves (worn) &egg: T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn)A - a +0 pair of boots Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand) [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top](eggb  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn)  A - a +0 pair of boots Jewellery (select all with "=)d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)H - a ring of willpower Wands (select all with /)  h - a wand of roots (14)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12) (egg) N - a wand of charming (7) Scrolls (select all with ?)  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon42%)egg(1 turn)  T - a +0 helmet (worn)  A + a +0 pair of boots[Enter] accept (1 chosen))egg )egga #############deadiverson the Carver###≈#≈#≈#≈#≈#≈#Human of the Shining One ******###≈#...........##Health: 87/113 ==================------#≈#.............≈#)eggq Magic: 17/17 ======================== ## ###....#########..##AC: 21Str: 19 ≈# #≈.....#..##...#..≈#EV: 16Int: 11 ## ##..####.#...###..##SH: 17Dex: 18 ≈# #≈..#..#.#..#..#..≈#XL: 14 Next: 25% Place: a Gauntlet ## ##§.#.©#..#©#@©#..##Noise: ---------  Time: 19988.4 (0.0) ≈###§§.#..#..#..#)#..≈#a) +0 scimitar (flame) ##§##..#..)eggQ `###...#.#..##Throw: 6 darts (poison) .......#..#...##..#..≈# ###Fast Might Fly .......#..#########..###... ########..#..........##..#h   hell hog #.#.#..#..#########..#...## .©.....#..#hbbh...#..#..... #.#.##.#..#b#h###.#.ß#.©.##You continue putting on the +0 pair of boots of the Other World {Fly Str+2 _Dex+3}. x5  You finish putting on the +0 pair of boots of the Other World {Fly Str+2  Dex+3}.  You feel stronger. You feel agile. _You fly up into the air.)egg/ 589.0 (0.6)eggP )egg  2 _You drop a +0 pair of boots.*egg# ###≈#≈#≈#≈#§#≈# ###≈#...........## #≈#.............≈#  ###....#########..## # #≈.....#..##...#..≈#  ##..####.#...###..## # #≈..#..#.#..#..#..≈#  ##§.#.©#..#©#[@#..## ###§§.#..#..#..#)#..≈# §##..#..###...#.#..## #..#...##..#..≈# *eggT^### #..#######..#..........##..# h   hell hound .#.#..#..####### ©.....#..#hbbh.. *eggV*egg*egg≈b   fire bat.bh*egg&6*egg*egg~R _There is a transporter here.+eggV .You enter the transporter and appear at another place.  A minotaur comes into view. It is quivering silver javelins.+egg7g #.©#..#©#[©#..## #..#..#..#)#..≈# #..###...#.#..## #..#...##..#..≈# ### +eggg..#########..###... ..#..........##..# ##...#########..#...##...H..#hb.b.h.#..#......#..#b#h###.#.ß#.@.## ..#.h.###)#..#...## +eggLh©©#..©###©#.∩#.©... #..#.##.^.?#..#...##.# #..#.##^..=#.ß#.©.## ..+eggh..#.......#..#..... #. H   minotaur (missile) #..#########..#...## +eggh=h   hell hound #..#..........##..# #..#########..###...  The minotaur bellows!+eggr (((((((The minotaur throws a silver javelin. The silver javelin pierces through you.+eggH t.....@.+egg T3-==+egg  90.2+egg+egg)+ _The silver sears you!,egg ?..#..#..#)#..≈# ..###...#.#..## ..#...##..#..≈##### ..#########..###... ..#..........##..# ##. ..#########..#...##...H ..#hb.b.h.#..#......# ..#b#h###.#.ß#.©.## ,egg ..#.h.###)#..#..@## ©©#..©###©#.∩#.©....# ..#.##.^.?#..#...##.# ..#.##^..=#.ß#.©.## .. ..#.......#..#..... #.# ..#########..#...##  ..#..........##..# ..#########..###... ..#ss.....#..≈# ###,eggo# ,egg1 .h∩h   hell hound,eggN2 b4---9 (0.7,egg< ;∩,egg@ -egg ,-eggW -eggbhb   fire bat5=--1.6-egg$=∩-egg&.egg:∩.egg^(2.3.egg".egg&.egg#:∩.egg(3.0.egg=∩.eggm.eggvD .eggE +6 (0.6.eggO ;∩.eggQ /egg/egge6=4.3 (0.7/egg4/egg/egg/eggք+9 (0.6/egg/egg/egg. 4M/egg. 7©#..#©#[©#..#..#..#)#..≈##...#.#..## ...##..#..≈#####/egg&/ u########..###... ..........##..# ##..#######/eggZ/ ##....#hb.b...#..#....H.#/egg/ b#h###b#.ß#.© /egg/ |..#.h.###h#..#...## ©©#..©###©#.∩#.©....#/egg0 <.^.?#..#...##.# ..#.##^..=#.ß#.©.## ..#.#H   minotaur (missile)/egg>0 A.##..###../eggCC /eggK E(((((/egg z.©@./eggw =7=5.6 (0.7/egg ;∩/eggh z _The minotaur throws a silver javelin. The silver javelin misses you.0eggQ Ability - do what?CostFailure  Invocations -  X - Renounce ReligionNone0% a - Divine Shield3 MP, Piety-1%  b - Cleansing Flame0eggq5 MP, Piety-43%  c - Summon Divine Warrior8 MP, Piety--65%  W - Brand Weapon With Holy Wrath None0% [?] toggle between ability selection and description.2eggJ2egg$V2eggd.©#..#©#[©#..##deadiverson the Carver ..#..#..#)#..≈#Human of the Shining One ****** ..###...#.#..##Health: 87/113 ==================------ ..#...##..#..≈#####Magic: 17/17 ======================== ..#########..###...AC: 21Str: 19 ..#..........##..# ##..EV: 16Int: 11 2eggd..#########..#...##....#SH: 17Dex: 18 ..#hb.b...#..#....H.#XL: 14 Next: 25% Place: a Gauntlet ..#b#h###b#.ß#.©@##Noise: =--------  Time: 19995.6 (0.0) ..#.h.###h#..#...##a) +0 scimitar (flame) ©©#..©###©#.∩#.©....#Throw: 6 darts (poison) ..#.##.^.?#..#...##.#2eggeVFast Might Fly ..#.##^..=#.ß#.©.## .. ..#.......#..#..... #.#H   minotaur (missile) 2eggie..#########..#...## .h   hell hound ..#..........##..#b   fire bat ..#########..###...2eggeYou enter the transporter and appear at another place.  A minotaur comes into view. It is quivering silver javelins.The minotaur bellows!  The minotaur throws a silver javelin. The silver javelin pierces through you. _The silver sears you! _The minotaur throws a silver javelin. The silver javelin misses you.2eggif2eggj2eggxEH.2eggx4------6.2 (0.6 Shield (4) Fly 2eggc=∩2egg@ _A divine shield manifests in front of you!2eggoX } ∩You hit the minotaur. You burn the minotaur.2eggNY ;8=7 (0.52eggc 2eggf 6 _The minotaur is lightly wounded.3eggV!H∩H  , blind, unable to s…)§You hit the minotaur. You burn the minotaur.minotaur is lightly wounded.  You slice the minotaur!! You burn the minotaur.  The minotaur is heavily wounded.block the minotaur's attack.  struck blind by the light of your shield.3egg====7.3 (0.623eggV;∩3egg6 _You block the minotaur's attack.3eggp  §.You slice the minotaur!! You burn the minotaur!3eggp`===-8 (0.53egge|3egg`\ _The minotaur is almost dead.4egg §§§.You hit the minotaur. You burn the minotaur.  The minotaur is almost dead.You block the minotaur's attack. x24eggޒ--------8.4 (0.6 Fly 4egg4egg^ _Your divine shield fades away.5eggBS  You slash the minotaur! You burn the minotaur.5egg4(∩..h   hell hound.b   fire bat5egg\8=-8 (0.45egg;∩5egg'L _You kill the minotaur!5egg#.#..#..#..≈# ©#..#©#[©#..## #..#..#)#..≈# ###...#.#..## #...##..#..≈##### #########..###... ##..........##..# ##...5eggy#########..#...##....##hb.b...#..#...@..##b#h###b#.ß#.©.##.# .#.h.###h#..#...## .. ©#..©###©#.∩#.©....##.'#.##.^.?#..#...##.# ###.##^..=#.ß#.©.## ..#.......#..#..... #.#5egg#########..#...## . .#..........##..#5egg5egge90=--9.5 (0.75egg# 5eggcw  Things that are here: _2 silver javelins; a +0 plate armour6egg6egg wPick up what? 45/52 slots (_ for help) 6eggw Missiles (select all with ()a - 2 silver javelins Armour (select all with [)b - a +0 plate armour [Up|Down] select[Esc] exit 6egg Letters toggle [.|Space] toggle selected[top]7eggY  a + 2 silver javelins[Enter] accept (1 chosen)7egg 7egg߫ 7egg 7eggH .#.#..#..#..≈#deadiverson the Carver ©#..#©#[©#..##7egg Human of the Shining One ****** .#..#..#)#..≈#Health: 90/113 ===================----- .###...#.#..##Magic: 14/17 ===================----- .#...##..#..≈#####AC: 21Str: 19 .#########..###... #EV: 16Int: 11 7egg .#..........##..# ##...SH: 17Dex: 18 .#########..#...##....#7eggr XL: 14 Next: 28% Place: a Gauntlet .#hb.b...#..#...@..#Noise: ---------  Time: 19999.5 (0.0) .#b#h###b#.ß#.©.##.#a) +0 scimitar (flame) 7egg 5.#.h.###h#..#...## ..Throw: 6 darts (poison) ©#..©###©#.∩#.©....##.'Fast Might Fly 7egg B.#.##.^.?#..#...##.# ## .#.##^..=#.ß#.©.## .. .#.......#..#..... #.# 7egg0 .#########..#...## . .#..........##..#You block the minotaur's attack. x2 _Your divine shield fades away.7eggs You slash the minotaur! You burn the minotaur. _You kill the minotaur!Things that are here: _2 silver javelins; a +0 plate armour7egg 7egg\ 120000.2 (0.77egg[ 7egg + _v - 2 silver javelins8egga#.#..#..#..≈# #..#©#[©#..## #..#..#)#..≈# ###...#.#..## ## #...##..#..≈#####.. #..###....# ##. #.##..# .##. #..#...##....# #hb.b...#..#...[@.# #b#h###b#.ß#.©.##.# #.h.###h#..#...##... #..©###©#.∩#.©....##.' #.##.^.?#..#...##.# ## #.##^..=#.ß#.©.##gg*cZ40m... #.#..#......##.# #..#...##.# . 8egg!m:∩8eggFn`45==8 (0.68eggy8eggH{8egg ..#©#[©#..## ..#..#)#..≈# #...#.#..## ### ...##..#..≈#####.. #######..###....# ##. ..........##..##.##.... #######..#...##....# hb.b...#..#...[..# b#h###b#.ß#.©.##@# .h.###h#..#...##....# ..©###©#.∩#.©....##.'... .##.^.?#..#...##.# #### .##^..=#.ß#.©.##... .......#..#......##.# #8egg #######..#...##.#  ..........##..##..#######..###...8egg58egg#68egg`=7=====8egg&&1.5 (0.78egg"=∩8egg$8egg  -#..#)#..≈# #...#.#..## ### ..##..#..≈#####.. #######..###....# ##. .........##..##.##.... #######..#...##....# # b.b...#..#...[..# ##... #h###b#.ß#.©.##.##....# h.###h#..#...##.@..#8eggb ©###©#.∩#.©....##.'...∩ ##.^.?#..#...##.# ##### ##^..=#.ß#.©.##... .....#..#......##.# #######..#...##.#  .........##..##.. #######..###.... s.....#..≈# ###8egg~ 8  Found a chain mail.8egg y103/113==2.28eggQ% 8egg( B _Found a gate leading back out of this place.8egg_H #..#)#..≈# ...#.#..## ### ####..#..≈#####.. .#..###....# .##. ##..##.##.... ..#...##....# ##. .b...#..#...[..# .##. 8egg I }h###b#.ß#.©.##.##....# .###h#..#...##..@.# ©###©#.∩#.©....##.'...∩#.^.?#..#...##.# .#^..=#.ß#.©.##....##..#......##.#..#...##.# ..8eggRI ##..##.. .#..###.... .# 8eggwV 8eggV #98egg6W O===98egg\ <∩8egg^ 8egg..#)#..≈# #.#..## ###### ##..#..≈#####....# 8egg ..###....##.##. ##..##.##.... ..#...##....# ##. b...#..#...[..##.##....# ###b#.ß#.©.##.##....# ###h#..#...##...@# ###©#.∩#.©....##.'...∩# 8egg .^.?#..#...##.##.###### 8egg  ^..=#.ß#.©.##....# #..#......##.#8egg |..#...##.##..##..##...8egg!i.#..###.... #8eggC!R.# 8egg213===3.68egg6<∩8egg99egg#.#..## ###### #..#..≈#####....# ##..###....##.##. ......##..##.##.... ####..#...##....# ##.. 9eggOe...#..#...[..##.##....# ##b#.ß#.©.##.##....# h#..#...##....######©#.∩#.©....##.@...∩# ^.?#..#...##.##.###### .=#.ß#.©.##....# 9eggb...#..#......##.# ####..#...##.##.. ......##..##....# 9egg+@####..###.... #.# ...#..≈# ### #.##..##9eggѧ9egg%===9egg!4.39egg9eggKQ _There is an open door here.9egg1u#.#..## ###### ..#..≈#####....# ..###....##.##. ##..##.##.... ..#...##....# ##.. #..#...[..##.##....# 9eggub#.ß#.©.##.##....# h#..#...##....###### ©#.∩#.©....##.'@..∩# .?#..#...##.##.###### =#.ß#.©.##....# 9eggu#..#......##.# ..#...##.##.9eggv5.##..##....9eggAvx#..###.... #.#9eggfv#..≈# ### #. 9eggz6∩9eggX9 (0.6Fast 9egg9∩9eggh _Your extra speed is starting to run out.9eggo.#..## ###### #..≈#####....# ..###....##.##. ##..##.##.... ..#...##....# ##.. #..#...[..##.##....# 9eggMb#.ß#.©.##.##....# h#..#...##....###### ©#.∩#.©....##.'.@.∩# ?#..#...##.##.###### =#.ß#.©.##....# #..#......##.# ..#...##.##.. 9egg9eggEc∩5.6 (0.79egg 9egg 9egg #..## ######  #..≈#####....#  #..###....##.##.  ##..##.##....  #..#...##....# ##..  #..#...[..##.##....#  #.ß#.©.##.##....#  #..#...##....######  9egg #.∩#.©....##.'..@∩#  #..#...##.##.######  #.ß#.©.##....#  #..#......##.#  #..#...##.##..  ##..##....#    #..###.... #.#    #..≈# ### #.    #..##   9egg 9egg< I=6.2 (0.69eggб :∩9egg 9egg8 ..## ######  ..≈#####....#  ..###....##.##.  ##..##.##....  ..#...##....# ##..  9egg {..#...[..##.##....#  .ß#.©.##.##....#  ..#...##....######  .∩#.©....##.'...@#  ..#...##.##.######  .ß#.©.##....# 9egg   ..#......##.#  ..#...##.##..  ##..##....#  9eggv &..###.... #.#  ..≈# ### #.  ..##  9egg* 6 ∩9egg+ +9 (0.79egg2 9eggE ~  h - a wand of roots (21) (gained 7 charges)  You pick up Great Wizards, Vol. VII and begin reading...  You add the spells Tukima's Dance, Passage of Golubria and Yara's Violent  Unravelling to your library.  J - 5 scrolls of identify (gained 1); w - a +6 ring of strength  There is a gate leading back out of this place here.9eggE -7.6 (1.49eggJ 9egg(K 9egg^W /  --more--:egg'/ :egg/k_Items here: )) [[.:egg/:egg4Pick up what? 47/52 slots (_ for help) Hand Weapons (select all with ))  a - a +2 arbalest of freezing  b - a +0 mace of venom Armour (select all with [)c - a +0 chain mail :egg4 d - the +3 leather armour "Jaggeog" {rC++ Dex+4} [Up|Down] select[Esc] exit Letters toggle [.|Space] toggle selected[top]>eggh>egg)>eggc..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21>eggStr: 19 ..#...[..##.##....#  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20007.6 (0.0) ..#...##.##.######  a) +0 scimitar (flame) .ß#.©.##....#>egg{  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#   ..###.... #.#   ..≈# ### #.   ..##   >egg_Items here: )) [[.  Okay, then.>eggb9∩>egg>egg>eggN. _>eggy6>egg~BInventory: 47/52 slots Hand Weapons (go to first with ))  a - a +0 scimitar of flaming (weapon) Missiles (go to first with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)p - 9 boomerangs  v - 2 silver javelins  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  U - 4 javelins Armour (go to first with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} g - the +0 pair of boots of the Other World (worn) {Fly Str+2 Dex+3}  l - a +1 kite shield (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck) >eggCp D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)w - a +6 ring of strength [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]?egg  T - a +0 helmet (worn)W2 cloak of willpower (worn) Jewellery"=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)?eggw - a +6 ring of strength  H - a ring of willpower Wands (go to first with /)h - a wand of roots (21)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12)  N - a wand of charming (7) Scrolls (go to first with ?)  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon ?eggi x - 6 scrolls of teleportation45%@egg Scrolls (go to first with ?)  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fog  r - a scroll of silence  @egg{s - a scroll of enchant weapon  x - 6 scrolls of teleportation  J - 5 scrolls of identify  K - a scroll of amnesia  O - a scroll of revelation Potions (go to first with !)e - 2 potions of enlightenment  i - 2 potions of cancellation  k - 5 potions of mutation  q - 2 potions of attractiont - a potion of heal wounds  u - a potion of magicz - 2 potions of haste  C - 4 potions of curing@eggE - 2 potions of brilliance  G - a grey potion87Aeggr, e - 2 potions of enlightenment  Q - 2 bubbling red potionsR - a potion of might Miscellaneous (go to first with }) Aegg m I - a Gell's gravitambourine (2/2)botBegg$2 nN - a wand of charming (7) Scrolls (go to first with ?)  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolation84%BeggP &  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery (go to first with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)w - a +6 ring of strength  H - a ring of willpower Wands (go to first with /)h - a wand of roots (21)  y - a wand of digging (12)  B - a wand of mindburst (37)  M - a wand of flame (12)N - a wand of charming (7) Begg9 Scrolls (go to first with ?)  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolationo - 2 scrolls of fog  r - a scroll of silence  s - a scroll of enchant weapon  x - 6 scrolls of teleportation45Beggܘ BeggB BeggJ V..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.Begg 1  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#BeggȤ  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Begg uDex: 18 ..#...##....######Begg ^  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#BeggE ^  Noise: ---------  Time: 20007.6 (0.0) ..#...##.##.######  a) +0 scimitar (flame) Beggo .ß#.©.##....#  Throw: 6 darts (poison) ..#......##.#Begg  Fast Might Fly ..#...##.##.. ..##..##....#   Begg ..###.... #.#   ..≈# ### #.   ..##   _Items here: )) [[. _Okay, then.BeggZ Begg Begg[ 9∩Begg CeggڙCeggqRead which item? Scrolls  j - 2 scrolls of blinking  m - 2 scrolls of fear CeggB n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon  x - 6 scrolls of teleportationJ - 5 scrolls of identify  K - a scroll of amnesiaO - a scroll of revelation [!] read|quaff|evoke[?] describe selectedDeggDeggDegg..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21DeggStr: 19 ..#...[..##.##....#  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20007.6 (0.0) Degg..#...##.##.######  a) +0 scimitar (flame) .ß#.©.##....#Degg(  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#Degg;d   ..###.... #.#Degge   ..≈# ### #.   ..## Deggֺ  _Items here: )) [[. _Okay, then.DeggDeggIdentify which item? (\ to view known items) Potions (select first with !)  G - a grey potion Degg! Q - 2 bubbling red potions[?] describe selectedEeggEegg7!Eegg)..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#  EV: 16EeggJ*Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20007.6 (0.0) ..#...##.##.######  a) +0 scimitar (flame) .ß#.©.##....#Eegg*  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#   ..###.... #.#   ..≈# ### #. Eegg*  ..##   _Items here: )) [[. Eegg+6_Okay, then.Eegg?Hq∩As you read the scroll of identify, it crumbles to dust.Eegg#I-8.2 (0.6EeggYO9∩EeggRR _G - a potion of resistanceEegg^ Eegg1 Read which item? Scrolls  j - 2 scrolls of blinking  m - 2 scrolls of fear  n - a scroll of immolation  o - 2 scrolls of fogr - a scroll of silence  s - a scroll of enchant weapon Eegg>  x - 6 scrolls of teleportationJ - 4 scrolls of identify  K - a scroll of amnesiaO - a scroll of revelation [!] read|quaff|evoke[?] describe selectedFeggFeggFeggi4..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20008.2 (0.0) ..#...##.##.######FeggF  a) +0 scimitar (flame) .ß#.©.##....#  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#   ..###.... #.#   ..≈# ### #.   ..##   _Items here: )) [[. _Okay, then.As you read the scroll of identify, it crumbles to dust. _G - a potion of resistanceFegg?FeggdIdentify which item? (\ to view known items) Potions (select first with !)  Q - 2 bubbling red potions[?] describe selectedFeggp Feggx ..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#  EV: 16Int: 11 FeggPy ..ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20008.2 (0.0) ..#...##.##.######  a) +0 scimitar (flame) .ß#.©.##....#  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#   ..###.... #.# Feggy *  ..≈# ### #.   ..##   _Items here: )) [[. _Okay, then.As you read the scroll of identify, it crumbles to dust. _G - a potion of resistanceFegg q∩As you read the scroll of identify, it crumbles to dust.FeggU +9 (0.7Feggʘ 9∩Fegg L _Q - 2 potions of lignificationGegg$ Gegg`1 ODrop what?47/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing nets  f - 6 poisoned darts (quivered)p - 9 boomerangs  v - 2 silver javelins  F - 6 atropa-tipped darts  S - 9 curare-tipped darts  U - 4 javelins Armour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+}Gegg^2 k g - the +0 pair of boots of the Other World (worn) {Fly Str+2 Dex+3}  l - a +1 kite shield (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand) [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]Jegg-"(1 turn)  a - a +0 scimitar of flaming (weapon)  F + 6 atropa-tipped darts[Enter] accept (1 chosen)Legg 2 turns)  f + 6 poisoned darts (quivered)  F + 6 atropa-tipped darts2LeggVLeggSd..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##....  Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet .∩#.©....##.'...@#  Noise: ---------  Time: 20008.9 (0.0) ..#...##.##.######Leggqe  a) +0 scimitar (flame) .ß#.©.##....#  Throw: 6 darts (poison) ..#......##.#  Fast Might Fly ..#...##.##.. ..##..##....#   ..###.... #.#   ..≈# ### #.   ..##   _Items here: )) [[. _Okay, then.As you read the scroll of identify, it crumbles to dust. _G - a potion of resistanceAs you read the scroll of identify, it crumbles to dust. _Q - 2 potions of lignificationLeggBfLeggk;∩Legg vh ∩You drop 6 poisoned darts.Leggwq9.5 (0.6Nothing quiveredLegg{Legğk _You feel yourself slow down.LeggX,10.5 (1LeggLeggLeggːLeggt5 _You drop 6 atropa-tipped darts.LeggV Legg: 4Drop what?45/52 slots (_ for help) Hand Weapons (select all with ))  a - a +0 scimitar of flaming (weapon) Missiles (select all with ()  b - 3 throwing netsp - 9 boomerangs  v - 2 silver javelins  S - 9 curare-tipped darts  U - 4 javelins Legg< tArmour (select all with [)  c - the quicksilver dragon scales of the Indigo Skies (worn) {rC+ Will+ Stlth+} g - the +0 pair of boots of the Other World (worn) {Fly Str+2 Dex+3}  l - a +1 kite shield (worn)  P - a +0 pair of gloves (worn)  T - a +0 helmet (worn)  W - a +2 cloak of willpower (worn) Jewellery (select all with "=)  d - an amulet of faith (around neck)  D - a ring of poison resistance (right hand)  L - a +4 ring of slaying (left hand)w - a +6 ring of strength  H - a ring of willpower [Up|Down] select [PgDn|>] page down [PgUp|<] page up[Esc] exit Letters toggle [.|Space] toggle selected[top]_egg? _eggn ..## ######  deadiverson the Carver ..≈#####....#  Human of the Shining One ****** ..###....##.##.  Health: 113/113 ======================== ..##..##.##...._eggҮ   Magic: 17/17 ======================== ..#...##....# ##..  AC: 21Str: 19 ..#...[..##.##....#  EV: 16Int: 11 .ß#.©.##.##....#  SH: 17Dex: 18 ..#...##....######  XL: 14 Next: 28% Place: a Gauntlet _egg s.∩#.©....##.'...@#  Noise: ---------  Time: 20010.5 (0.0) ..#...##.##.######  a) +0 scimitar (flame) .ß#.©.##....#  Nothing quivered _egg- ..#......##.#  Might Fly ..#...##.##.. ..##..##....#   ..###.... #.# _egg G  ..≈# ### #.   ..##  As you read the scroll of identify, it crumbles to dust. _Q - 2 potions of lignificationYou drop 6 poisoned darts. _You feel yourself slow down. _You drop 6 atropa-tipped darts.  Okay, then._egg _eggj 9∩_egg . _iegg"ieggiegg9∩iegg+X_Q - 2 potions of lignification ieggy You drop 6 poisoned darts. _You feel yourself slow down. _You drop 6 atropa-tipped darts. _Unknown command.iegg? V ∩iegg 9∩iegg2 F _Unknown command.jegg jeggܫ jegg ;∩jegg jegg tjegg~tjeggrz9∩jeggG}F _Unknown command.kegg) #..## ###### #..≈#####....# #..###....##.##. .##..##.##.... #..#...##....# ##.. #..#...[..##.##....# #.ß#.©.##.##....# #..#...##....###### #.∩#.©....##.'..@∩# #..#...##.##.###### #.ß#.©.##....#keggA  #..#......##.# #..#...##.##.. .##..##....# #..###.... #.# #..≈# ### #. #..## kegg keggا 21.5 (1 _kegg ;∩keggp legg16∩legg8legg6legg legg8_Unknown command.legglegghlegglegg F _Unknown command.leggzleggFleggÒlegglUnknown command. __megg^megg_-2 _meggve:∩megggnegg^negg3Save game and exit? Y - Yes  N - NooeggQoegg;oegg$oeggD [?25h[?0c [?1051l[?1052l[?1060l[?1061l