bgg|  Player: ssays Game: DCSS 0.32 Server: crawl.dcss.io Filename: 2024-12-22.00:52:11.ttyrec Time: (1734828731) Sun Dec 22 00:52:11 2024 bgg= [?1051l[?1052l[?1060l[?1061hbggaV)0[?7h[?25l[?1cbggbggbggirWelcome, ssays. Please select your species. SimpleIntermediateAdvanced a - Mountain Dwarf  j - Humans - Coglin b - Minotaurk - Koboldt - Vine Stalker c - Merfolkl - Demonspawnu - Vampire d - Gargoylem - Djinniv - Demigod e - Draconiann - Sprigganw - Formicid f - Trollo - Ghoulx - Naga g - Deep Elfp - Tenguy - Octopode h - Armataurq - Oniz - Felid i - Gnollr - BarachiA - Mummy Mountain Dwarves are strong melee fighters and capable heavy-armoured casters. They can use scrolls to enchant even some artefacts. + - Recommended species * - Random species # - Recommended character ! - Random character % - List aptitudesSpace - Pick background first ? - Help Tab - Recommended characterbgg2 You are a Demigod Ice Elementalist. Do you want to play this combination? [Y/n/q]bggs bgg bgg GYou are a Draconian Artificer. bgg -Do you want to play this combination? [Y/n/q]bggDebgg bggI" ssays the CharlatanDraconianHealth: 16/16 ========================Magic: 1/1========================AC: 4Str: 14EV: 11Int: 11SH: 0Dex: 11XL:  1 Next:  0% Place: Dungeon:1Noise: ---------  Time: 0.0 (0.0)a) +0 clubZap: wand of flame (15)bgge' i##.##).##.##>##@##.##.##..###bgge, bgg- Welcome, ssays the Draconian Artificer.Everyone else who sought the Orb of Zot has failed. Will you be different?bgg1 bggf Press ? for a list of commands and other information.  Found a mace. Found an escape hatch in the floor.bggAj bggl [ _Found a staircase leading out of the dungeon.bggbgg   Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting1.1   1.7  +1   f - Spellcasting   0.0   1.2  -1          bgg~ b - Maces & Flails   0.0   1.0   0       c - Unarmed Combat   0.0   1.0   0   g + Evocations3.0   4.0   0  bggR    bgg bgg5_    bggR^    bggn{    d + Dodgingbgg2.1   3.6  -1      bgge + Stealth0.8   1.0   0  bgg̛a    bgg_    bgga    bgg_    bgg5a    bggN_    bggs        bggn    bgg_    bggќa    bgg_    bgga    bgg?        bgg            bgg    The relative cost of raising each skill is in cyan.  bggThe species aptitude is in white.  [?] Help[=] set a skill target  bggI[/] auto|manual mode [*] useful|all skills [!] training|cost|targetsbggVbggbggssays the CharlatanDraconianHealth: 16/16 ========================##Magic: 1/1========================.##AC: 4Str: 14).#EV: 11Int: 11#.#SH: 0bggDex: 11#>#XL:  1 Next:  0% Place: Dungeon:1#@#bggNoise: ---------  Time: 0.0 (0.0)#.#a) +0 clubbggr#.#Zap: wand of flame (15)bgg&?#..###bggKWelcome, ssays the Draconian Artificer.Everyone else who sought the Orb of Zot has failed. Will you be different?bggz Press ? for a list of commands and other information.  Found a mace. Found an escape hatch in the floor. _Found a staircase leading out of the dungeon.bggbgg?bggwbgg~(  _Sorry, you're not good enough to have a special ability.bggt4bggxbggzF _Unknown command.bggbgg;l  Skill  Level Cost  Apt Skill  Level Cost  Apt a + FightingbggJ1.1   1.7  +1   f - Spellcasting   0.0   1.2  -1           b - Maces & Flails   0.0   1.0   0       c - Unarmed Combat   0.0   1.0   0   g + Evocationsbgg3.0   4.0   0  bgg1            bggt    d + Dodging2.1   3.6  -1      bgg)e + Stealth0.8   1.0   0      bggl    bgg        bgg        bggF        bggha    bgg_    bgg        bgga    bggl    bgg<            bgg        The relative cost of raising each skill is in cyan.  The species aptitude is in white.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [!] training|cost|targetsbgg:bggE a * Fighting   1.1bggi_  d * Dodging   2.1bgg=K e * Stealth   0.8bgg= Tssays the CharlatanDraconianHealth: 16/16 ========================##Magic: 1/1========================.##AC: 4Str: 14).#EV: 11Int: 11#.#SH: 0Dex: 11#>#XL:  1 Next:  0% Place: Dungeon:1#@#Noise: ---------  Time: 0.0 (0.0)#.#a) +0 club#.#Zap: wand of flame (15)#..###Everyone else who sought the Orb of Zot has failed. Will you be different?Press ? for a list of commands and other information.  Found a mace. Found an escape hatch in the floor. _Found a staircase leading out of the dungeon. _Sorry, you're not good enough to have a special ability. _Unknown command.bgg4? M### ..#).<#.#bggOF bggG 21.0 (1 _bggsK bggCN a _There is an escape hatch in the floor here.bggM#### ...##)><#.#bggC2 _bgg"bggbggUx## ....####)....##.##.# #># #<# #.# #.# #..###bggbgg&3bggbgg3i _Found a short sword. _You see here a +0 mace.bggUbggͨ&4bggbgg# _e - a +0 macebggm bggp   Skill  Level Cost  Apt Skill  Level Cost  Apt  a * Fighting   1.1   1.7  +1   f - Spellcasting   0.0   1.2  -1          bggWq  b - Maces & Flails   0.0   1.0   0       c - Unarmed Combat   0.0   1.0   0   g + Evocations3.0   4.0   0              bggq      d * Dodging   2.1   3.6  -1       e * Stealth   0.8   1.0   0          bggs @                                                        bggus _            The relative cost of raising each skill is in cyan.  The species aptitude is in white.  [?] Help[=] set a skill target  bggs [/] auto|manual mode [*] useful|all skills [!] training|cost|targetsbgg7a = b + Maces & Flails 0.0bggi  b * Maces & Flails   0.0bgg _o a - Fighting   1.1bgg- = a + Fighting 1.1bggSl o d - Dodging   2.1bgg= d + Dodging 2.1bgg<_o e - Stealth   0.8bgg= e + Stealth 0.8bgg2bgg=9bgg[?Fssays the CharlatanDraconianHealth: 16/16 ========================Magic: 1/1========================bgg?2AC: 4Str: 14##EV: 11Int: 11....#####SH: 0Dex: 11bgg?C#)....##bgg-@XL:  1 Next:  0% Place: Dungeon:1#@.#Noise: ---------  Time: 4.0 (0.0)##.#a) +0 club#>#Zap: wand of flame (15)#<##.##.##..### bggT@_Sorry, you're not good enough to have a special ability. _Unknown command. _There is an escape hatch in the floor here. _Found a short sword. bggw@L_You see here a +0 mace. _e - a +0 macebggvEbggEbggObggۙ bgg* RWield which item (- for none)?- - Unarmed Hand Weapons (go to first with ))  a - a +0 club (weapon)e - a +0 mace[?] describe selected [*] show all[tab] equip|unequip bgg:bgg[?bggDssays the CharlatanDraconianHealth: 16/16 ========================Magic: 1/1========================AC: 4Str: 14##EV: 11Int: 11....#####SH: 0Dex: 11#)....##bggDXL:  1 Next:  0% Place: Dungeon:1#@.#Noise: ---------  Time: 4.0 (0.0)##.#a) +0 club#>#bgg/EZap: wand of flame (15)#<##.##.#bggEw#..### _Sorry, you're not good enough to have a special ability. _Unknown command. _There is an escape hatch in the floor here. _Found a short sword. _You see here a +0 mace. _e - a +0 macebggIbggIq5 (0.5e) +0 macebggKbggNM, _e - a +0 mace (weapon)bgg@\bgg\bggg]bgg_bggmabggienbggebgggbggQi,bggibggkbggm,bggLnbggobggXr,bggisbggwC  You see here a +0 short sword.bggybggz _bggzbgg|bggr~,bgg;bggbggvbggbggbgglbggۄbggbggfbggbgg`,bgg bggbgg<,bggڌbggbggڏbggbggbggbgg,bgg%bgg.bgg,bggMbggsbgg+,bggbggbgg,bggtbggBbgg)bggbggbgg;,bgg6bggbgg>bgg],bgg!bggbggzbggbggbgg@bgg4,bgg2bggbgg,bggbggxbgg},bggbgg]bggM,bggbggbggbggFbggbggbgg,bgg8bggbgg,bggbggfbgg}bgg*bgg~bggbggbgg/bggbggbggbggbggmbggbgg4bggVbggbgg2bggbggbggbggbggBbggCbgg,bggXbggbgg#.# #.....##<#bgg$#.###.....##.# .#######.........##.# .#.....####...#####.. .......bgg#....## ### .......#.....## .......bgg #......######.......#....#......#....^..bgg5##.#######..@.......#.# #..............### ##########....rbggcT ###.  bggvr   quokka (asleep) bgg@/0.5 (36.0)bggr.rbgg,1.5 (37bggbggY _A quokka comes into view.bgg G  Skill  Level Cost  Apt Skill  Level Cost  Apt bgg a + Fighting1.1   1.7  +1   f - Spellcasting   0.0   1.2  -1           b * Maces & Flails   0.0   1.0   0       c - Unarmed Combat   0.0   1.0   0   g + Evocations3.0   4.0   0                  d + Dodging2.1   3.6  -1      bgg e + Stealth0.8   1.0   0                                                                              The rbggJ elative cost of raising each skill is in cyan.  The species aptitude is in white.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [!] training|cost|targetsbgg$bgg],bggy44 #.# #.....##<#ssays the Charlatan#.###.....##.# .######Draconian#.........##.# .#.....Health: 16/16 ========================bgg4s####...#####.. .......Magic: 1/1========================#....## ### .......AC: 4bggK5Str: 14#.....## .......EV: 11Int: 11#......######.......SH: 0Dex: 11#....#......#....^..XL:  1 Next:  0% Place: Dungeon:1bgg5##.#######..@.......Noise: ---------  Time: 41.5 (0.0)#.# #..............e) +0 mace### ##########...r.bgg5Zap: wand of flame (15)###.r   quokka bgg5m_Found a short sword. _You see here a +0 mace. _e - a +0 mace bgg,6B_e - a +0 mace (weapon) _You see here a +0 short sword. bggY6D_A quokka comes into view.bgg<bgg=bggBbggDbggO#.###.....##.# .#######.........##.##.#.....  ####...#####...... #....## ####.#.....## #.#......######.#....#......#....^##.#######..........# #.......bggP### ##########...r ###.# bggRbggZEr.bggZ+2.5 (1bgg_bgg1bbggk#.###.....##.# .###### #.##.##.#.....#. ####...#####...#....## ####.#.....## #.#......######.#....#......#....^.##.#bggel0.#.# #.r.### #.####.#bggnbggpobgg"t<r..bggt&3bggwbgggybgg\ bgg 5=4.9 (1.4bgg! bgg# _You closely miss the quokka. The quokka closely misses you.bggv  You closely miss the quokka. You tail-slap the quokka.  The quokka is moderately wounded.The quokka bites you but does no damage.bggsw#3bggw7-----6.3bgg|bgg+ _The quokka bites you.bgg0  You completely miss the quokka.The quokka is moderately wounded.bgg1D2------bgg1!7.7bgg6bgg9i _The quokka barely misses you. The quokka bites you.bgg"  You closely miss the quokka. Your tail-slap misses the quokka.The quokka is moderately wounded.bggn#(9.1bgg(bgg+L _The quokka misses you.bgg&  bgg.You hit the quokka but do no damage.The quokka is moderately wounded.The quokka bites you but does no damage.bggK10----bgg"50.5bggnbgg+ _The quokka bites you.bgg  You miss the quokka.The quokka is moderately wounded.The quokka bites you but does no damage.bgg (1.9bgg bgg0 T _The quokka closely misses you.bggp  You barely miss the quokka.The quokka is moderately wounded.bggb (3.3bgg bgg S _The quokka barely misses you.bgg  You closely miss the quokka. Your tail-slap misses the quokka.The quokka is moderately wounded.bgg#1bggG=--4.7bggbggV _The quokka barely misses you. x2bggrH  You miss the quokka.The quokka is moderately wounded.The quokka barely misses you.6.1bggMbggP> _The quokka bites you but does no damage.bgg  You barely miss the quokka.The quokka is moderately wounded.bggr9/16 ---7.5bggbgg,+ _The quokka bites you.bggJ &  bgg You barely miss the quokka.The quokka is moderately wounded.8.9bgg, bggַ V _The quokka barely misses you. x2bgg 8  You hit the quokka.bgg M† bgg 10/16==-1660.3bgg bggX J _You kill the quokka!bggT bgg 1===bgg bggo ,bgg^ bgg bgg bgg bggm bgg bgg bgg'" 12===bggs" bgg!$ bggc$ bgg$ bgg& bgg& bgg+ nbgg-, :==bgg, bggQ. bgg. #3bgg. (=bgg/ bgg&1 bgg`1 bgg2 bgg3 ,bgg4 bggL6 bgg6 bgg7 bgg<9 bgg9 #4bgg9 F===bgg: bgg< ,bggM= bgg> bgg3? bggt? bgg@ ,bggMA bgg$B bgg]B $==bggB bggB bggC bgg5D bgg[D D5=bggE bggG bggFG bggH bgg&J bggJ bggK bggL bggL bggHM bgg0N bgg_N 9=bggN bggP bggPP L6==bggP bggR 1 _HP restored.bggU Ibgg^ b  You see here a quokka corpse.bggi  #.....##<# ##.....##.##.########## ........##.##.#.....#.: ##...#####..... #....## ####.. #.....## #.. #......######..........[ #....#......#....^ ##.#######.-88.3 (28.0)  #.# #.........†.  ### ##########.........#####.##...# .#bggo bggHp F-9.3 (29bgg2y Y _Found a robe.bgg bgg bgg^ bggbggGbgg,bgg'bggXbgg3==bggEbggbgg-",bgg#bgg'bgg-.,bgg0bggE3bgg5bgg6bgg7bggQ:bgg<bgg=bgg>bgg`CBbggKbggM#  #####..# ..##.# #### bggHN..##># ...# ..##<## ....# ..##.##.##########....## ..##.##.#.....## ####.....# bgg}N# ####......... ## #...............# .######..........[....# bggN......#....^..........# ####..................# .........†...........## #########...........##You pick up Great Wizards, Vol. VII and begin reading...bgg'U296.3 (7.0)bggU+7.3 (8bgg2[bggp]  You add the spells Tukima's Dance, Passage of Golubria and Yara's Violent _Unravelling to your library.bggU bgg W bggW bgg"\ bggb Xbgge ,bgg?g bggk bggn ,bggo bggr bggu ,bggw bgg8y bgge{ bgg{ bgg| bgg~ bggɀ bgg bgg bgg bgg bggņ bgg bgg bgg bgg, bgg bgg bgg bggˌ bgg bgg" bgg bgg bgg bggK bgg2 ,bgg bggk bgg ,bgg bgg bggA ,bgg0 bgg bgg ,bgg{ bggԡ bgg3 bgg bgg1 bgg bggk Bbgg! nbgg_ bgg bgg bggu bggȭ bgg bggh bgg bggS ...........#.# ......[....#.# ^..........#.# ...........#.# bgg ........##.##  .......###..###  ##.##...## ##...##   #.# ...# ###..#   ..# .#.# ##@#   ## .# #.#  bgg'  #.#   ...   #..   ....   g   goblin (asleep) ....   ...g.    bggy 1116.3 (19.0)bggӿ ,7.3 (20bgg bgg u _A goblin comes into view. It is wielding a +0 dagger.bgg [....#. ^..........#. ..##.#####..### ##.##...## ##...##  #.# ...# ###..  bggD ..# .#.# ##.  ##   ....#..##.....# .....g.......#bgg?! bgg)( }gg.==8.3 (1.0)bgg, bggo0 ( _The goblin shouts!bgg0^...... .###.#####..### ##.##...## ##...##  #.# ...# ###..  ..# .#.# ## ##  #.....###.#..##..... ..g.. ......#......####bggQbgg(g.bggP/--9bggԪbggbggǪ.##.#####..### ##.##...## ##...##  #.# ...# ###..  ..# .#.# ## ## .######  ......#.###...@.##.# #..g...#......#......#####bggE ##....bggubgg%(g.bggB--20bggebggbgg bgg e4---=1.7 (1.4bgg؊ bgg x _You closely miss the goblin. The goblin hits you with a +0 dagger.bgg  You barely miss the goblin. The goblin hits you with a +0 dagger.bgg d3-----3.1bgg bgg L _The goblin misses you.bgg.>4.5bggbgg _You hit the goblin but do no damage. The goblin misses you.bggB9  You sock the goblin!bggwJf)bggSNL--335.9bgg|TbggVJ _You kill the goblin!bggbgg| bggf&bgg)H _No target in view!bgg bggՐ bggj bggo bgg _4==bgg bgg bgg bgg bggL ,bggx bgg ,bgg bgg 5===bggB bgg bgg bgg bgg^ bgg bggZ bgg bgg bgg bggi bggݬ 9=bggŭ bggׯ bggg L6==bgg bgg ,bgg˵ bgg bggL bggN ,bggn bgg bgg} bgg bgg bgg bgg P==bgg bgg %  bgg You see here a +0 dagger.bgg bgg5  _bgg bgg bgg ##...## ##...## .# ...# ###..#bgg  .# .#.# ##.#   .########.#   ........#.##   .#####.....#   ##.#).###  #...... #. -41.9 (16.bgg: 0)#..... #......#  ###....#  #....   .....#   #....#  #...[#   bgg \-2.9 (17bgg, bgg H _Found a ring mail.bggp}IbggbggNbgg,bggчbggZbggbgg*bggqbggbgg'bggrbggbggTbggbggޘbgg0bggabggbggobggqbgg2bgglbggbggzbgg&,bgg bgg`bggbggbgg3bggbgg,bggbggbggO,bggbggbgg  .#####.....#  # ##.#).###  bggUj#. #......#  ##.## #......#  .....# #......# bggw ......# #......# bgg....... ###....## .......#####....# bgg.......@........# .......#####....# bgg....... #...[# >.....# ######bgg............  r   rat (asleep).....bgg?9r.... bgg|t 50  A rat comes into view.bgg,3.9 (11bggQ _Found a stone staircase leading down.bgg4bggbggD _A rat is nearby!bggbggR# ##.#).### #. #......####.## #......#......# #......#..###......#..####....##bgg.#####....#g..........######....#.# #...[#>.....## ######........bgg$g   goblin (asleep)r.....bgg-cr   rat (asleep).......bgg5  A goblin comes into view. It is wielding a +0 dagger.bgg"4.9 (bgg$1.0)bggbggK+ _Found 10 gold pieces.bgg& a #. #......#####.## #......#......## #......#..###......#..####....##.#####....#g..........#.#####....#.# #...[#># ######........ ..#$.#r......#........#.##bgg bgg :.ggbgg &5bgg bgg$ bgg& ####.## #......#......## #......#..###......#..####....##.#####....#g...............#.#####....#.# #...[#># ######........# .#$.#r......#..#####bgg.gr.rbgg0===6bggbgg bggR_The rat squeaks loudly.bgg #. #......# ####.### #......# ## #......#####......#.##bgg:##....#####....##....g..............##.#####....#....@...# #...[#># #######.##..........##....rbggp$.##.#..#bgg]..####......##bggubggbgg5V.gr..bgg0---7bggbggbgg ,bgg r..4---=--9.3 (1.4bgg: bggo { _You closely miss the goblin. The goblin hits you with a +0 dagger. x2bgg 8  You hit the goblin.bgg )r   rat  You kill the goblin!bgg[ ---5060.6 (1.3 _The rat closely misses you.bgg ~ _Your Stealth skill increases to level 1!bgg *  You closely miss the rat. Your tail-slap misses the rat.2.0 (1.4bgg-bgg20 _The rat closely misses you. The rat barely misses you.bgg1m5  You hit the rat.bgguF†bggN}083.4bggTbggG _You kill the rat!bgg)cJbgg0dH _No target in view!bgg% bgg& bgg+ bgg. H _No target in view!bgg bgg8 bgg bgg bgg h5= _bgg ,bggܾ bgg) bggi bgg bggR bgg bgg bgg bgg bgg L6===bgg bgg bgg@ bgg bgg bggr bgg bgg ,bgg bgg bgg; ,bgg bgg bgg bgg. $==bggX bggo bgg ,bgg bgg A _You now have 10 gold pieces.bggD bgg bgg bgg bgg0 bgg bgg bgg^ bgg` bgg bgg bgg bgg bgg bgg bggj bgg bgg bgg bgg R  There is a stone staircase leading down here.bgg/ bgg  _bgg bgg\ bgg< bgg bggU bgg# bgg*  ####.### #....... ##......## #..... #. ##........###..... #.. #..........####... #.. #..........#####.. ...#................. #.#.....)....#####..#..#............# #..lbgg+ ..>..†..## ###-#.#.###..........#  #..........# bgg%+ $#..........# #..........# #..........#bgg>+ l   frilled lizard (asleep) ##........##bggX+  ##......## #bggp+ %#######bgg*2 80.4 (17.0)  A frilled lizard comes into view.bgg9 [.llbgg: F-1.4 (18bgg> bggA 8 _The frilled lizard hisses angrily.bgg2   .. ##......##  #. ##....... #.. #........ #.. #........ ...#........ #.#.....).. bggn3v##..#............#  .l.....@..>..†..##  #.#.###..........#  #..........#  #..........#  #..........#  #..........#  ##........##  ##......##   bgg   .. ##......##  #. ##....... #.. #........ #.. #........ ...#........ #.#.....).. ##..#............#  bgg!&.l.....@..>..†..##  #.#.###..........#  #..........#  #......... #........ #..........# bgg ##....... ##...... bgg4bggbgge _A frilled lizard is nearby!bgg ####.### # ... ##......## # #.. ##.### #.. #.#### #..##.##### ...## #.#.....)....######..#.....# #.l....@...>..†..## #.#.###..........# #..........# #..........# #....# #.# ##..## ##.##  #bggxbggB.lbgg82.0) _bggbgg bggs+ ####.### # ... ##......## # #.. ##..###bgg #.. #..#### #..##..##### ...# ## #.#.....)....######..#.# #bgg a.l.>..†..## .##.#.###.#J. #..#bggF#.. #......##. #.......#bggi# #..........#J   endoplasm (wandering) ##........##bggul   frilled lizard ##......## bggL #bggbggCbgg\.lJ.bgg@&3bggbgg] _An endoplasm comes into view.bgg#  ####.### # ... ##......## # #.. ##........### #.. #....#### #..##...#...#. ##.#.#.....)....#..#.# bgg2$ g#.....l@.....>..†..## .##J#.###.# ... #...# #...# #.........# #..# #..........#bgg]$  #.. #..........#.. ##........##... ##......## bggs$ $ bgg$ (#bgg* m  The endoplasm quivers.bgg1 pJ.J=4bggg8 bgg; [ _The frilled lizard barely misses you.bggybggЂ%J.bggB-5.8 (1.4bggNbgg _You barely miss the frilled lizard. The frilled lizard barely misses you.bggm You barely miss the frilled lizard. The frilled lizard barely misses you.  You hit the endoplasm.  The endoplasm is moderately wounded.The frilled lizard bites you but does no damage.  The endoplasm freezes you.  You are frozen. You feel yourself slow down. The endoplasm barely misses you.bggBq3-----7.2Slow bggxbgg?bgg3 _The frilled lizard bites you.bggX:You completely miss the endoplasm.You feel yourself speed up.  The frilled lizard bites you but does no damage.  The endoplasm hits you but does no damage.  The frilled lizard misses you.bgg59.3 (2.1bggbgg\bggE/  --more--bgg.D> _The endoplasm hits you but does no damage.bgg You closely miss the frilled lizard.The endoplasm freezes you.bgg* 2------90.7 (1.4Slow bgg bgg y _You are frozen. You feel yourself slow down. The frilled lizard misses you.bggx8You hit the frilled lizard.bgg .  You kill the frilled lizard!You feel yourself speed up.bgg*l3=662.6 (1.9bggbggC _The endoplasm hits you but does no damage. x2bgg1` ####.### # .... ##......## # #..###........### #..##.......... #..##.... #...#. ##.#.#.....).... #####.J#.# #.....bgg^2.>..†..##.##.#.###.##...# #....# #...## #..........# #..# #.# #.. #.# ... ##bgg2.##  ... ##......##  #bgg2bgg=bgg>,30bggAEbggbGV _The endoplasm barely misses you.bgg aThe endoplasm hits you but does no damage. x2 _The endoplasm barely misses you.You hit the endoplasm but do no damage.The endoplasm is moderately wounded.    The endoplasm freezes you.bgg 2-5.0 (1.4Slow bgg bgg B _You are frozen. You feel yourself slow down.bgg You are frozen. You feel yourself slow down.  You hit the endoplasm.heavi  You feel yourself speed up.  The endoplasm completely misses you.  The endoplasm freezes you.bggQ q10----7.1 (2.1bgg bgg B _You are frozen. You feel yourself slow down.bgg2<  You sock the endoplasm!bggq:1.bggW?M---839.2bgg c _You kill the endoplasm!bggaM #. ##.. ####.### .... #### ####.##....##....### #...#............. ##.#.#.....)....########.@#............ #............>..†..#...##.#.###.... #...# #....#...## #..........##.bgg\b(....bgghbgg%im1=-200.7 (1.5bggmbggobggd bggne bgge bggNj bggj !bggm bggzn j _You feel yourself speed up.bggn bggo bggq bgg>q bgg@r bggs bggs l12===bggt bgg6v ,bggv bggx bggx bggIy bggz ,bgg{ bgg{ bgg{ k3===bggO| bgg| bgg"} bgge} bgg,~ bggU~ bgg~ bggl ,bgg5 bgg bgg- 9=bgg bggt bgg L4==bgg bgg bgg̈ bggr bggk ,bgg׊ bgg ,bgg bgg bgg3 i5===bggُ bgg. bggT bgg bgg bgg bggJ bgg bgg bgg bggt bgg #=bggӘ bgg& bgg bgg$ #6bggD )==bgg bggD bgg bggC bgg bgg bgg ,bgg bgg bggm #..###........### #..##..........## #..##..........## #...#...........##.#.#.....)....#####..#....# #............>..†..## ...##.#.###..........# bggǧ Y. #.@.# #.#- #...## #..........# #..## #....#  #....# ... ####.... ###bgg r   quokka (asleep)..... ########..r>.. bgg 8 25.2 (24.5)  bgg& CA quokka comes into view.bgg ,6.2 (25bgg bgg? ; _Found a stone staircase leading down.bgg #.. #..##... #...#... ##.#.#.....) #####..#...  #............>..†..##  ...##.#.#  . #.@.#   #...##   #..##   #..   ...   ....   .....   ..r>..bggzi #.. #..##... #...#... ##.#.#.....) #####..#...  #............>..†..##  ...##.#.#  bgg O. #.@.#   #...##   #..##   #..  ...  ....   .....  ..r>.. bggͶ4bggbgg] _A quokka is nearby!bgg>: #.... #..##. #...#..#.#.#.....)....######..#............ #............>..†..##...##.#.###..........# . ##...# #.# # #.# #..## #.# #... #.# ..... ####bggK?.... ##..... ######r>.................#bggHbgguIU==7.2 (1.0) _bggQbggSbgg{4 #..##. #...#.#.#.#.....)#####..#............ #......>..†...##.#.###.......... . ##...# #. #...## #. #@.## #. #.....##. .......##....##...#######r>.......# ...#.#bggXbggr.rbgg&8bggLbggbgg .##.#.)#####..#....................>..†..#...##.#.###.......... ##...#  #...######...#.............###...[...###.....r#######......>..........$bgg[ bgg bggp Hr.bgg &9bggq bgg Z _Found a ring mail and 9 gold pieces.bggY  You hit the quokka.  The quokka is heavily wounded.bgg#3bgg9E-----=30.6 (1.4bggbgg+ _The quokka bites you.bgg;  You miss the quokka.The quokka is heavily wounded.bggi4==---1.9 (1.3bggbggܝ _The quokka closely misses you. The quokka misses you.bgg8  You hit the quokka.bggP†bggSbgg1d#...#.......... ssays the Charlatan##.#.#.....).... Draconian#####..#............ Health: 14/16 =====================---bggw#............>..†..# Magic: 1/1========================...##.#.###.......... AC: 4Str: 14bgg. ##...# #.......... EV: 11Int: 11#...## #.......... SH: 0Dex: 11bgg#..#####.......... XL:  1 Next: 100% Place: Dungeon:1bgg#@....##.......... Noise: =--------  Time: 233.3 (1.4).......†.....##........# e) +0 mace...[..........##......## Zap: wand of flame (15)..............#########......>.......#bgg..............#..............#.$............#The quokka is heavily wounded. bgg'6_The quokka bites you.  You miss the quokka.The quokka is heavily wounded. _The quokka closely misses you. The quokka misses you.You hit the quokka.bgg _You kill the quokka!You have reached level 2!bgg/  --more--bggxk20/23-2/22 0% bggbgg4 _bgg bgg bgg bgg; bgg : _bgg a1=bgg bgg bgg. bgg[ bggݰ ,bggѱ bggX ,bgg bggm 92bgg E==bggŹ bggE bgg bgg' bggV bgg bgg- bggU ,bggX bgg> bggy 9=bgg' bgg bgg E3==bgg` bgg bgg bgg bgg bgg" b  You see here a quokka corpse.bggk #####..#.#............>..†...##.#.###. . ##...# #........... #...## #...#####..#####>......#.....###.......†.....##....[..@.......###-45.3 (12.0)........########....>.# .#..#$.#####.....#.....#bgg 7-bgg %6.3 (13bgg bgg ; _Found a stone staircase leading down.bgg&bggbggbggǣbggBbggbggqbggƬ:==bggbggybggCbggzbggbggbggbggbggbggʺbgg{bggübgggbgg,bggbggL _You now have 19 gold pieces (gained 9).bggfbggbggbggbgg,bggbgg+bgg,bggbggbggQ,bggmbggQbgge,bggwbggbggn,bggmbggbggbggNbggSbggR  There is a stone staircase leading down here.bggbgg _bgg0bggbggebggbgg{bggbgg,bggbggbggbggbggbgg .... ## #..### ##### #..## #...# #..## #### #...# #...# ...##...# ##.#.# ......# #####..# #....###...#######@..#...##.#.###..bggn.....# ##...# #..#####.....### #...## #.. #...#...#####..#####......###>......#.....##..#### ##.......†.....##. #....[..........## #...............###.......>.......#bggY63.3 (174.3 (18bggbgg\` _f - a scroll labelled OTYEHISUQObggSbggbggbgg]bgg,bggQXbgg3bggbgg bggBbgg}bgg bggu ,bggbggbggbgg;bgg(bggbgg,bggbggbggP,bggbggL!bggG#,bgg$bgg&bgg(,bgg,bggQ/bggy8bggr9bggL;bggt?bggCbggJDbggEbggIbgg \bgg\!bgg\K# #.bggs] bggZ^#.#.  #.#.  bgg^ #...####   #.....##.....# ##### ####....# #...# bgg^ #...!.@########...#  #J##.........#  #..######......# ###bgg_4 #... ###.... ...#. #######...#...# #.###. ....... # J   endoplasm (asleep)#. .. #####.....### # .# #...#...###. ....###>......#bggm-75.3 (11bggn,6.3 (12bgg7wbgg| _An endoplasm comes into view. _You see here a scroll labelled CEOTIOPN COACS.bggWt  # #. #.#. #.#. #...#### #.....# #.....# #####  ####....# #...#  #...!.@#  #J##.........##...#  #..######......#  #... ###. ...#. . #.###.   #. ..   # .#  . >bgg  # #. #.#. #.#. #...#### #.....# #.....# #####  ####....# #...#  bgg #...!.@#  #J##.........##...#  #..######......#  #... ###. ...#. . #.###.   #. ..   # .#  . >bgg 4bggs bgg<  bgg S_An endoplasm is nearby!bgg( #.#. #.#. #.#. #...#### #.....# #.....# ##### ####....# #...# #...!@?##...# #J##.........##...# #..######......#  #...# ###....### ...#.# #...#...bggd #.###.. .#  #. ... #####.....### # .## #...#... . ....###>......bgg7bgg87.0) _bgg 'bgg(bggyb #.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #...@.?##...#bgg? #J##.##...# #..######......#  #...# ###....### ...#.# #...# #.###.. .# #. ... #####.....### # .### #...#... . ....###>bggbggq<J.Jbgg&8bggnbgg bggS_The endoplasm quivers. _You see here a dark potion.bggQ #.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #.J@!.?##...# #.##.##...## #..######......#  #...# ###.... ...#.# #...# #.###.. . #. ...######.....bgg  # .### #...#... . ....###>bgg+i  The endoplasm freezes you.bggJ,2--9Slow bgg"1bgg3B _You are frozen. You feel yourself slow down.bggt~  You barely miss the endoplasm.You feel yourself speed up.bgg >=81.2 (1.9bgg o _The endoplasm barely misses you. x2bgg\ m  You hit the endoplasm.  bgg NThe endoplasm is moderately wounded.bgg$ -2.6 (1.4bgga bgg @ _The endoplasm hits you but does no damage.bgg?  You barely miss the endoplasm.The endoplasm is moderately wounded.The endoplasm freezes you.bgg1---3.9 (1.3Slow bggEbgg_B _You are frozen. You feel yourself slow down.bgg13---------You hit the endoplasm. You tail-slap the endoplasm.  The endoplasm is heavily wounded.  You feel yourself speed up.  The endoplasm freezes you.  You are frozen. You feel yourself slow down.  The endoplasm freezes you.bgg/  --more--bgg/l4 are frozen.bggl-5.9 (2.0bggrbgg4z9 _You feel as though you will be slow longer.bggm  You hit the endoplasm.  The endoplasm is severely wounded.The endoplasm barely misses you.The endoplasm hits you but does no damage.  The endoplasm freezes you.bggW9/23 ------------8.0 (2.1bggϫbggǭ% _You are frozen.bggN ;  You hit the endoplasm.bgg S.bgg^ bggW N----690.1bggc bgg- M _You kill the endoplasm!bggT #.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #.@.!.?##...#bggk #.##.##...# #. #..######......##.#...# ###....#...#.# #...# #.###..  #. ...######..... ## .### #...#... . ....###>bggU$bgg$}10/23=-1.6 (1.5bgg:-bggp0bggKg#.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #..@!.?##...# #.##.##...# #. #..######......# #.#...# ###....##...#.# #...#.#.###.. .#. ...######.....### .### #...#...#. ....###>.bggbggB-3.1bggsbgg2bgg[#.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #...@.?##...# #.##.##...# bgg"\#. #..######......# ##.#...# ###....##...#.# #...#.#.###.. .##. ...######.....### .### #...#...#. ....###>.bggbbggb(4.6bggkgbgglbggmn1==6.1 (3.0bggqbggsQ _g - a dark potionbggߩ#.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #....@?##...# #.##.bggo##...# #. #..######......# ##.#...# ###....###.#...#.# #...#.#.###.. .# #. ...######.....### ## .### #...#...#. ....###>.bggbgg-7.6 (1.5bgg<bggbggַ[ _You feel yourself speed up.bggU|bgg|bgg}bggYbgg8,bggbggbggebggvbgg#2bggˈ;==bggbgg,bggbgg{bggbgg֏bggbggLbggĒbggbgg@^3==bggjbgg ,bgg]bggК,bggCbggbgg bggbggߠbgg9=bgg'bggNbggS4=bgg)bgg@bggobggXbgg9,bgg;bggbgg(bggbggbgg[^5==bggbgg,bggbggط,bggbgg bgg4bgg-bggbggB^6==bgg>bggobggbggbggG,bggbgg,bggbggbgg_9=bggbggbggpN17=bggbgg*,bgg~bgg:,bggbgg,bggbgg~bggj8==bggbgg,bgg#bgg,bggbggy,bggbgg=bgg~h9==bggSbgg,bggbgg,bggbggr,bgg`bggbggd9=bggbgg%bggS620=bggubggbggJbggwbggbgg!,bgg1bgg$,bggbggh~1==bggbgg,bgg/bggE ,bggbgg.,bggbggbgg#2bggE==bggbgg,bgg bgg,bggbgg,bggbgg O=bgg bgg("bggw"L3==bgg#bgg%bgg',bgg(bgg0_#.#.. #.#.# #.#.# #...#### #.....# #.....# ##### ####....# #...# #.....@##...# #.##.##...# #. #..######......# ##.#...# ###....###.#...#.# #...#...#bggf1#.###.. .# ##. ...######.....### ### .### #...#...#. ....###>......#bgg61349.6 (52.0)bgg 7-50.6 (53bgg:bgg^=d _h - a scroll labelled CEOTIOPN COACSbgg(Ibggbgg6Bbgg|==bggbgg-bgg]bgg7bggbggz,bggbggbgg,bggڹ,bggbggebgg{bggbggx,bggzbggbggbgg]bggbgg-bgg*bggVbggbggbggbggbggGbggvbggvbggbggbggbgglBbggGbggbggbggbgg`bggtbgg4,bggqbggBbggYbggibggbgg;bggbggdXbggbggbgglbggbggbgg0bggbggybgg,bggRbggbggbggbgg,bggFbggbgg%bggebggbgg,bggbggRbgg ,bggbgg_bggbggbggkbggbgg^,bggbggbgg ,bgg bgg5 bgg bgg bggV bggSbgg@,bggNbgg%bgg)bggobgg bggbggbggZbggbgg bggbgg5bggbgg bgg!bgg!bgg"bgg&bgg(bggK(bgg<)bggR+bggt-bgg-bgg.bgg1bgg33bgg{3bgg4bgg}6bgg8,bgg:bgglC####...####....$ #....##..... #.....##..... #......##.... #....#...# ##.######## #.# #... #...# ### #### #.#@#  #...##  ##...#bgg"Dp #.#.# #.#.## #.#..# #.#..+ #.#.###.#.#bggJ-87.6 (37bggZK,8.6 (38bggPbgg~Ud _i - a scroll labelled PYNOWNO RYLUNKbggbgg7bggbggbggbggBbggbggXbggbggbgg  #.# #... ##K..##...## #.###... ##..........## #.......#............# ####...#.....$......# #....##............# #.....#..........# #..#......$.# #....bggw #@.####.### #...###.# # ##...#### # bggd #.#.# #...## ##...#K   kobold (missile, asleep)bgg #.#.# #.#.## #bgg#.#..#bgg 90.6 (2.0)  A kobold comes into view. It is wielding a +0 short sword.bgg+1.6 (3bggbgg* _Found 6 gold pieces.bgg[ W #.#  ##K..##...## bggR\ Q ##..........##  #............#  #.....$......#  #............#  #..........#  #......$.#  #@.##  #...## #.#  ##...# ###  #.#.#  #...##  bgg\ ##...#  #.#.#  #.#.##   bgg  #.#  ##K..##...##  ##..........##  #............#  #.....$......#  #............#  #..........#  #......$.#  #@.##  #...## #.#  ##...# ###  #.#.# #...# ##...#  #.#.#bgg l #.# bgg 4bgg6bgg]] _A kobold is nearby!bggY #.# # ##### #### #.# # ##K..## #.### ### #...... #......# ####... #.....$......# #..# #....# #....#..@...$.# #....####..#####.# #...## #.# #...####...#K   kobold (missile, asleep)#...bggx#.#.##.#.##bggbgg )2.6 (1 bggD _bgg9bggbgg;g #.# # #.# # ##### #### #.# # ##K..## #.### ### #.. #......# #### #.....$......# #..# #....# #......$.# #...bggG####..#####.# #...## .##...#### #.#.# #...###...# #.#.bgg<3bggbgg>bgg?g# ##### #### #.#  ##K..##...## #.###### #....####$#..###....###......$....####..#### #...##.##..###.#.#...###..bggbggU&4bggϸbggzbgg}: o### ##### #### #.#  ##K..##...## #.###### #....####$..###....#bgg; ##......$....####..#### #...##.##...#####.#...#bggI .KK)====5bggTO bggT ( _The kobold shouts!bgg:&....### ##### #### #.#  ##...##...## #.####..K## #....####$..###....###......$....####..#### #...#.##...#####.#bggq-bgg-[=---6bgg3bgg%6= _The kobold hits you but does no damage.bgg  You closely miss the kobold. Your tail-slap misses the kobold.1------7.9 (1.3bggbgg@ _The kobold hits you with a +0 short sword.bgg} P  You miss the kobold. The kobold barely misses you.0----9.2 _The kobold hits you with a +0 short sword.bggx`  You barely miss the kobold.bgg yC17----bgg7y(400.6 (1.4bgg\bgg@ _The kobold hits you with a +0 short sword.bgg  You hit the kobold but do no damage.The kobold hits you with a +0 short sword.bgg o13-------2.0bggS bgg = _The kobold hits you but does no damage.bgg 9  You sock the kobold!bggl C)bgg 1103.4bgg~ bgg J _You kill the kobold!bgg9"bgg"bgg_'bgg)H _No target in view!bgg3bggPbggbgg $ _bggUbggbgg`4=---bggHbgg,bggbgg,bggbggbggbggbgg95bggI;==bggRbggc,bggbgg,bggbgg,bggbggvt6==bggbgg,bggbgg ,bggr bgg ,bgg7 bgg- bgg] 9=bggbggbgg-N17=bggbgg,bggbgg,bggnbggV,bggbgg, bgg %8bgg E==bggH"bgg=$bggw$bgg/&bggL(bgg,Xbgg,bgg5/~9==bggv0bggP2,bgg_3bgg5bgg5bgg6bgg8,bgg:bgg;bgg2<9=bgg(=bgg+?bgg?E20=bggm@bggC,bgg EbggG,bggHbggJbggJbgg9Lbgg9NbggNa1==bggObggLQ,bggeRbggSbggTbggUbggVbggVbggWbggXYbggYh2==bggZbggt\bgg\bgg]bgg7_,bggB`bgga,bggbbggdbggd9=bggebggYgbgggL3==bgghbgglkbggIm,bggnbggpbggPu,bgg/vbggxbgg ybggybgg|$ bgg|(_You now have 22 gold pieces (gained 3).bgg}~bgg~$==bgg~bggbggbggbggbggbgg)bgg}bggbggxbgg,bggbgg`L _You now have 28 gold pieces (gained 6).bggՐ3bgg֑bgg bggbggΕbggbggbggBbggbggbgg4bggbggbggrbggbggbggڠbggábggբ,bggsbggbggbggbggߥbggĦbggbggXbggbggCbgg}bggbggbggbggūbgg%bggbggX####..#### ##.########...###.# #.....bggȷ:##...#### #####.#.# #...## ##...##.#.##.#.##bgg#.#.@#-#.#..'...# bgg2l#.#.##.....ß #.#.# ß.g#...########bggO##.....#bggg   goblin (asleep)#.....# #########....# #...##......########...#bggJ 61.4 (58.0)  You open the door.bggF-2.4 (59bgg@bgg7s _A goblin comes into view. It is wielding a +0 club.bggq<r ####..####  #...## #.#  ##...# ###  bgg<#.#.# #...## ##...# #.#.# #.#.## #.#.@# #.#..'...# bgg9= #.#.##.....ß  #.#.# ß.g...  #...########  bggn=C##.....#  #.....# #####  bgg=K####....# #...#   bgg ####..####  #...## #.#  ##...# ###  #.#.# #...## ##...# #.#.# #.#.## #.#.@# #.#..'...#  #.#.##.....ß  #.#.# ß.g... #...######## ##.....#  #.....#  ####....#  bggbggbggbgg] _A goblin is nearby!bggD` ; ####..####  #...## #.#  ##...# ###  #.#.# #...## ##...# #.#.# #.#.## #.#.@# #.#..'...#  #.#.##.....ß  #.#.# ß.g...  #...########  ##.....#  #.....# #####  ####....# #...#   bggF  ####..####  #...## #.#  ##...# ###  #.#.# #...## ##...# #.#.# #.#.## #.#.@# #.#..'...#  #.#.##.....ß  #.#.# ß.g... #...######## ##.....#  #.....#  ####....#  bgg  bgg bggf bgg ] _A goblin is nearby!bgg$  #...## .# #.....##...# ######## #######.#.# ß.... #...## ....##...# ...#.#.# ...##.#.##..ß#bggђ )#.#..#...##.#..@...##.#.##.....ß.#.#.# ß.g....#...###########.....#.....# #########....# #...##......########...##.##.........bgg bgg 83.4 (1.0) _bggi bgg) Q _There is an open door here.bgg\!##...# ######## ########.#.# #ß.... #...###.... ##...##...# .#.##...# bgg]#.#.##..ß# #.#..#...# #.#..'...######.#.##@....ß..#.#.##ß.g....$#...############.....#.....# #########....# #...# #......########...##.##.........#.##..######......# ####bggf9  Found 5 gold pieces.bggk@g.gbgg lE====4bggqbggt( _The goblin shouts!bggDbggb=---5.8 (1.4bggPbgg _You closely miss the goblin. The goblin barely misses you.bgg  You closely miss the goblin. The goblin completely misses you.bgg#---bgg&7.1 (1.3bggbggL _The goblin misses you.bggR 9  You sock the goblin!bgg e)bgg 078.4bgg bggQ J _You kill the goblin!bggbggbgg/bggH _No target in view!bggf _bggBbgg@bggC,bggbggFbgg,bgg9bgg bgg9bggbggbggybgg/u#.#.# #ß.... #...###.... .####...##...# J#.#.#.##...# =.##.#.##..ß# ..##.#..#...# ...+#.#..'...#####...#bgg#.#.##.)...ß.....# #.#.##ß.....@$..ß# ##..-#...############## ....##.....##..###.....# ######..######....# #...# #..###......########...# #...# J   endoplasm (asleep)#.##......# ##.#.#bgg/#.##..####### #####..#..#.#...# ###....###.........bgg} 73.4 (5.0  An endoplasm comes into view.bggm!-bgg$4.4 (6bggbgg#T _Found an ivory ring.bgg.!# #.#.# bgg!%   .#   J#   =.#  #.#.##..ß# ..#  #.#..#...# ...+  #.#..'...#####...#  #.#.##.)...ß.....# bgg" #.#.##ß.....@$..ß# ##..  #...############## ....    #####   #...#  bggM"]       bggER #.#.#    .#   J#   =.# bgg"? #.#.##..ß# ..#  #.#..#...# ...+  #.#..'...#####...#  #.#.##.)...ß.....#  #.#.##ß.....@$..ß# ##..  #...############## ....   bgg #####   #...#       bgg7  bggbgg!bggbggJa _An endoplasm is nearby!bgg% ##...# ######## ##########.....#.#.# #ß..ß# #####.#...###.... ...# ###...##...# ..J# ..#.#.##...# .=.# ##.#.##..ß# ß..# #.#..#...# ...+ #.#..'...#####...# #.#.##.)...ß.@...#  #.#.##ß......$..ß# ##.. #...##############.... ##.....##..# #.....# ##### #..##.####....# #...# #..##.#......########...# ...#.#.##.........##...# ##.#.##.##..######......# #####..#5.4 (1 _bgg>#...## #.# #.........† ##...# ###################.....#.#.# #ßb..ß# #####.##...###.... ....# #.###...##...# #..J# ..#.#.##...# #.=.# ###.#.##..ß# #ß..# #.#..#...# #...+ #.#..'...#####@..# #.#.##.)...ß.....#  bgg?[#.#.##ß......$..ß# ##.. #...##############.... ##.....##..# #.....# ##### #..##.####....# #...# #..##.. b   bat (asleep)  #......########...# ...#.#.##.........##...# ##.#.#bggI{  A bat comes into view.bggJbgg_LbggU....b=JJbbgg V&6bgggt _The endoplasm quivers.bggc#### ##.#######...... #...## #.# #.........† ##...# ###################......#.# #ß.... ...ßbggd####...###.... .###........# #b=J####..ß# #ß..##...# #@..+.'...#####.)...ß..... #.##ß......$..ß##.. ...##############bggd=.... ### # #.######....# #.....###### #..bgghbggVjbggRkbgg]u.=.Jb=7bggV~bgg: _The bat hits you but does no damage.bgg E..#### ##.#. ...## #.# #.†. #...# #############. #.#.# #ß.... ....ß# #####.# #...###.... ....# #.# ##...##...# #...# ..#  #.#.##...# #.=.# bgg ^##  #.#.##..ß# #ß.J#  #.#..#...# #.@b+  #.#..'...#####...#  #.#.##.)...ß.....#  #.#.##ß......$..ß# ##.. ##...######## .... ##.##.....# #..###.#.....# ##### #..##. ####....# #...# #..##. #......#...# #...#.bgg} bgg# bggF &b.bgg W0----8bgg bgg R _The bat hits you but does no damage. The endoplasm hits you.cggU%cgg~&cggh)  You hit the endoplasm but do no damage. The bat misses you.cgg4-b.cgg4-9.8 (1.4cgg<cgg?W _The endoplasm closely misses you.cgg;  You hit the endoplasm.cgg2 cggV You kill the endoplasm!cggjn.b.b   batcggl 19-----24cggE$81.2 _The bat hits you.cgg)cggLo _Your Maces & Flails skill increases to level 1!cggs$M...## #....#......#....^#### ##.#######...... ...## #.# #.........†..# ###################.......#.# #ß.... ....ßcgg#####.## #...###.... .# ##......# #.b####..ß# #ß@.#cgg+#...# #...+.'...#####  #.#.##.)...ß.....#..##b   batcggcgg/cgg&5=bcgg>',20cgg/cgg1: _The bat hits you but does no damage.cgg D  You closely miss the bat. The bat barely misses you.cgg6E cggcM cggM \20=3.5 (1.3cgg?U cggqW : _The bat hits you but does no damage.cgg  You barely miss the bat. Your tail-slap misses the bat.cgg Ob.4.8cgg cggj _The bat barely misses you. The bat completely misses you.cgg 6  You sock the bat!cgge=cgg076.1cggFcgg}G _You kill the bat!cgg4cgg@cggH _No target in view!cggkcggcggRcggcgg)1== _cggE,cggcgg,cggHcgg,cggcggcgg9=cgg,cggvcggK2=cgg cgg ,cggdcggq,cggcgg/,cggcgg+93cggF===cggcgg1cgg=,cggcgg!X M.##..######........## #....#......#....^#### ##.#######...... ...## #.# #.........†..# ###################.......#.# #ß.........ß#####.## #cgg ...###.... ..# ##......# #.##-##..ß# #ß..##...# #...+  #.#..'...#####...##j - a ring of protection from coldcggE 097.1 (11.0)cgg F-8.1 (12cgg cggF P _You see here a bat corpse.cggicggkPut on which piece of jewellery? Jewellery (go to first with "=) cggl j - a ring of protection from cold[?] describe selected [!] equip|wield|put on[tab] equip|unequip cgg+cgg1cgg8......## #......######......... ssays the Charlatan .....## #....#......#....^.... Draconian ..#### ##.#######............ Health: 23/23 ======================== ...###.# #.........†...... Magic: 2/2======================== #...# ###################....... AC: 4Str: 14 #.#.# #ß.........ß######.## EV: 11Int: 11 #...###.... .....##.# SH: 0Dex: 11 ##...##...# #...#cgg:I..# XL:  2 Next: 27% Place: Dungeon:1  #.#.##...# #.@.### Noise: ---------  Time: 498.1 (0.0)  #.#.##..ß# #ß..#e) +0 mace#.#..#...# #...+Zap: wand of flame (15)  #.#..'...#####...##.#.##.)...ß.....##.#.##ß......$..ß###.. ## #...##############.... ##. ##.....##..###.. #.....# ######..##...cggY:  _The bat barely misses you. The bat completely misses you.You sock the bat! _You kill the bat! _No target in view!  j - a ring of protection from cold _You see here a bat corpse.cggAcggcB+6 (0.5cgglGcggID _j - a ring of protection from cold (left hand)cggHcggaIcggIcggKcggoMcggMcgg@RBcggRcggScgg0UcggW,cggOXcggNZcgg\cggj\cggR]cgg_cgga,cgg8bcgg)e,cgg-fcggHjL _You now have 33 gold pieces (gained 5).cggkcgg%lcgglcggncggp,cggpcggircggscgg tcggtcggvcggx,cggxcggx{7 _You open the door.cgg|cgg$}cgg~cgg@  There is an open door here.cgg&cgg _cgg9cggcggcggfcggcggzcgg,cggcggcggҏ,cggcggN@  There is an open door here.cggєcgg _cggcggNcggcggcggcgg_  You see here a bat corpse.cggcgg _cggcggcgg/,cgg[cggcggJ,cggBcggcggcggcggcggócggе,cggcggcgg......# #....## ####.......# ## # #..........## #......###### ##........## #......#  ####..#### ##. cggQ #...## #.# #.........†.  ##...# ####################.. #.#.# #ß.........ß# ### #...###....@ß.....# 520.6 (22.0)  ##...##...#.###...# #.#.##...#.⌠ #.†.########## cgg#.#.##..ß#⌠∩⌠#ß..#......... #.#..#...#.⌠.#...'.######## cggB#.#..'...#####...###  #.#.##.)...ß.....#  #.#.##ß.........ß# ##cgg<Z #...############## cgg-cgg%1.6 (23cggacggm: _Found The Oracle's Delphic Readings.cggcggcggscggcggcgg#cggiXcggcgg R  There is a fountain of clear blue water here.cgg: cgg  _cgg cggcggWelcome to The Oracle's Delphic Readings! What would you like to do?  a -  242 gold a book of Airb -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] mark item for purchase [/] sort (type)[A-I] put item on shopping listcggf buy|examineexamine item[Enter] describecggm  A book of Air. A primer on the elemental magics of Air. The great minotaur hero Vuxhurn, given a copy of this book while trapped atop the tower of a wizard with a particularlyperverse sense of humor, used its pages to construct a rudimentary glider and soared to freedom. Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - ShockConjuration/Air1 no  b - SwiftnessAir3 no  c - AirstrikeAir4 nocgg< IWelcome to The Oracle's Delphic Readings! What would you like to do?  a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item [/] sort (type) [Enter] describe[A-I] put item on shopping list cggk~b $  You are short 539 gold pieces for the purchase. cgg/  a -  242 gold a book of Air  b -  c -  484 gold a book of Hexes cgg [ A book of Armaments. A book describing various magical arms and armours. It was written in the midst of a particularly bloody civil war, and the text is made substantially less helpful by its author's frequent digressions describing the crimes committed by the other side.  cgg Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - Stone ArrowConjuration/Earth 3 no  b - Animate ArmourSummoning/Earth4 no  c - Hellfire MortarFire/Earth7 no  d - Lehudib's Crystal Spear Conjuration/Earth 8 no cgg  cgg^>Welcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item  cgg^[/] sort (type) [Enter] describe[A-I] put item on shopping list cgg.$ 6 A book of Hexes. A spellbook containing an assortment of powerful Hexes, which sparkles and shimmers as the pages are flipped. Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  cgg2% e SpellsType LevelKnown  a - Sigil of BindingHexes3 no  b - AnguishHexes/Necromancy4 no  c - Cause FearHexes4 no  d - EnfeebleHexes7 nocgglWelcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)  g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) cggnmYou have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item [/] sort (type) [Enter] describe[A-I] put item on shopping listcgg  A book of the Senses. A scholarly work, describing the senses used by living creatures to perceive theworld around them. A handful of spells are included to demonstrate the principles being described. Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - Dazzling FlashHexes/Fire3 no  b - Mephitic CloudConjuration/Alchemy/Air 3 no  c - SilenceHexes/Air5 nocgg1+Welcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)  g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item cgg[/] sort (type) [Enter] describe[A-I] put item on shopping listcgg / A book of Wicked Creation. A long-forbidden tome, describing spells for various unholy (or, at least, underhanded) creations. It would be unwise to bring such a book back to the surface world - better to read it and discard it in some well-hidden location. Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - Sculpt Simulacrum Ice/Alchemycgg 6 no  b - Death ChannelNecromancy6 no  c - RimeblightIce/Necromancy7 nocggV Welcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown)  g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) cgg2You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item [/] sort (type) [Enter] describe[A-I] put item on shopping listcgg+F A book of the Senses. cgg,A scholarly work, describing the senses used by living creatures to perceive theworld around them. A handful of spells are included to demonstrate the principles being described. Stash search prefixes: {in_shop} {book} Menu/colouring prefixes: identified spellbook book  SpellsTypeLevelKnown  a - Dazzling FlashHexes/Fire3 no  b - Mephitic CloudcggQ,Conjuration/Alchemy/Air 3 no  c - SilenceHexes/Air5 nocggILWelcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f -  82 gold a scroll of blinking (unknown) cgg  g -  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. [Esc] exit[!] buy|examine items[a-i] examine item [/] sort (type) [Enter] describe[A-I] put item on shopping listcgg,}f $  You are short 49 gold pieces for the purchase.cggp   c -  484 gold a book of Hexes  e -  308 gold a book of the Senses  g $ 131 gold pieces for the purchase.cggh ? A scroll of identify. cggNi A useful magic scroll which identifies the properties of any unknown object. It is a very common scroll. Stash search prefixes: {in_shop} {scroll} Menu/colouring prefixes: identified scroll cggsi L“This, what is it in itself, and by itself, according to its proper  cggi Hconstitution? What is the substance of it? What is the matter, or  cggi proper use? What is the form or efficient cause? What is it for in  this world, and how long will it abide? Thus must thou examine all  cggi 4things, that present themselves unto thee.”cggi -Marcus Aurelius, _Marcus Aurelius Antoninus - His Meditations concerninghimselfe_, Book VIII, X. trans. Meric Casaubon, 1634.cggWelcome to The Oracle's Delphic Readings! What would you like to do?a -  242 gold a book of Air  b -  572 gold a book of Armaments  c -  484 gold a book of Hexes  d -  484 gold a book of Wicked Creation  e -  308 gold a book of the Senses  f $  82 gold a scroll of blinking (unknown)  g $  82 gold a scroll of enchant weapon (unknown)  h -  22 gold a scroll of identify (unknown)  i -  44 gold a scroll of poison (unknown) You have 33 gold pieces. You are short 131 gold pieces for the purchase. [Esc] exit[!] buy|examine items[a-i] examine item [/] sort (type) [Enter] describe[A-I] put item on shopping listcgg buy|examinemark item for purchasebuy shopping listcggC jh +  After the purchase, you will have 11 gold pieces.cgg (marked items cgg%G   c -  484 gold a book of Hexes  h +  22 gold a scroll of identify (unknown) Purchase items for 22 gold? (y/N)cgg  h -  44 gold a scroll of poison (unknown) 11 You are short 153 gold pieces for the purchase.hshopping listHcgg1Ph $ 97cggR cgg cgg {#........## #....#......#....^ ssays the Charlatan ####..#### ##.#######........ Draconian#...##cggS #.# #.........†.. Health: 23/23 ========================##...# ####################... Magic: 2/2========================#.#.# #ß.........ß##### AC: 4Str: 14#...###.....ß.....#EV: 11cgg /Int: 11##...##...#.###...#SH: 0Dex: 11#.#.##...#.⌠.#.†.########## XL:  2 Next: 27% Place: Dungeon:1#.#.##..ß#⌠@⌠#ß..#......... Noise: ---------  Time: 524.6 (3.0)cgg= B#.#..#...#.⌠.#...'.######## e) +0 mace#.#..'...#####...###Zap: wand of flame (15)cggf \#.#.##.)...ß.....##.#.##ß.........ß###..cgg Y#...##############.... ##.....#cgg l#..# #.....# ######..#cgg j ####....# #...##..#cgg   _There is an open door here. _There is an open door here. cggK _You see here a bat corpse. _Found The Oracle's Delphic Readings. _There is a fountain of clear blue water here.  There is an entrance to The Oracle's Delphic Readings here.cgg eYou see here a bat corpse. _Found The Oracle's Delphic Readings. _There is a fountain of clear blue water here.  There is an entrance to The Oracle's Delphic Readings here.  k - a scroll of identifyank you for shopping at The Oracle's Delphic Readings!cgg ~ _You can access your shopping list by pressing '$'.cggƐ cgg\ cggf cgg F _Unknown command.cggscgg>g _cgg =  You see here a bat corpse. _  There is an open door here. _cgg,cggcggcggcggcgg!Bcggcgg,cgg4 cgg!cggm#,cgg#cgg$cggG&,cgg&cgg+cgg3....#......#....^....# .#######..................#.# #.# #.........†...........##.## ##############...........###..### .....ß# #####.##...## ##... ß.....# #.# ...# ###.. ###...# ##..# .#.# ##. cgg&5&⌠.#.†.##########..###.#.. ∩⌠#ß..#.........@.......#. ⌠.#...'.########.#...##.#####.... ###...### #...#### ##.#) ß.....# K.### #. #... .....ß# ##..# ####.### #. ####### ....###......## #K   kobold (asleep) #..###........###...##### #..##..........####.#...# #..##..........#####cgg^; 43.6 (19.0)  A kobold comes into view. It is wielding a +0 dagger.cggCuK.KcggCK====4.6 (20cggGcggM( _The kobold shouts!cgg cggw Read which item? Scrolls  f - a scroll labelled OTYEHISUQO cggݒ d h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNKk - a scroll of identify [!] read|quaff|evoke[?] describe selected cggn  cggL  cggߦ ....#......#....^..........#.#ssays the Charlatan #.#######..................#.# cggߧ (Draconian #.# #.........†...........##.##Health: 23/23 ======================== ##############...........###..### Magic: 2/2======================== .....ß######.##...## ##...# AC: 4Str: 14 ß.....##.# ...# ###.. EV: 11Int: 11 ###...###..# .#.# ##. SH: 0Dex: 11  cgg: ⌠.#.†.##########..###.#.########. XL:  2 Next: 27% Place: Dungeon:1 ∩⌠#ß..#.........@..............#. Noise: ====-----  Time: 544.6 (0.0) ⌠.#...'.########.#...##.#####.... e) +0 mace ###...####K..#### ##.#) Zap: wand of flame (15) ß.....#..### #. #... .....ß###..# ####.### #... #######....###......## #... K   kobold#..###........###...######..##..........####.#...##..##..........##### _You can access your shopping list by pressing '$'. _Unknown command. _You see here a bat corpse. _There is an open cgg door here.  A kobold comes into view. It is wielding a +0 dagger. _The kobold shouts! cggH  cggi fIdentify which item? (\ to view known items) Scrolls (select first with ?)  f - a scroll labelled OTYEHISUQO  h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNK Potions (select first with !)  g - a dark potion[?] describe selected!cgg !cgg!cggX....#......#....^..........#.#ssays the Charlatan #.#######..................#.#Draconian #.# #.........†...........##.##Health: 23/23 ======================== ##############...........###..### Magic: 2/2======================== .....ß#!cggT#####.##...## ##...# AC: 4Str: 14 ß.....##.# ...# ###.. EV: 11Int: 11 ###...###..# .#.# ##. SH: 0Dex: 11 ⌠.#.†.##########..###.#.########. XL:  2 Next: 27% Place: Dungeon:1 !cggE8∩⌠#ß..#.........@..............#. Noise: ====-----  Time: 544.6 (0.0) ⌠.#...'.########.#...##.#####.... e) +0 mace ###...####K..#### ##.#) Zap: wand of flame (15) ß.....#!cgg..### #. #... .....ß###..# ####.### #... #######....###......## #... K   kobold!cgg#..###........###...######..##..........####.#...##..##..........##### !cggSb_You can access your shopping list by pressing '$'. _Unknown command. _You see here a bat corpse. _There is an open door here.  A kobold comes into view. It is wielding a +0 dagger. _The kobold shouts!!cgg]  As you read the scroll of identify, it crumbles to dust.!cgg#@K.!cgg#J----5.6 (1!cgg*!cgg,. _g - a potion of ambrosia"cgg+  You barely miss the kobold. The kobold hits you but does no damage."cgg,1---=---7.0 (1.4"cgg3"cgg5; _The kobold hits you with a +0 dagger."cggh8  You hit the kobold."cggof)"cgg8tp2=--348.3 (1.3"cgg{"cggh}J _You kill the kobold!"cgg 4"cggp "cgg H _No target in view!"cgg"cgg="cgg "cggH _No target in view!#cgg'#cgg5(#cgg(#cgg)#cgg-| _#cggr.,#cgg.#cgg/#cgg09=#cgg 1#cgg2#cgg2L3==#cgg3#cgg 8#cgg8,#cgg9#cgg;#cggm<,#cgg=#cgg=#cgg>,#cgg?#cggB>  You see here a +0 dagger.#cggC#cgg]DA== _#cggD#cggE#cggF,#cggH#cggK#cggM,#cggMN#cgg:P#cggER#cggR#cggLS#cggT#cggV,#cggW#cggX#cgg\Y,#cggY#cggZ#cggH[,#cgg[#cgg\#cgg]#cggC]#cgg]#cgg!^#cgg^#cgg^#cgg"_#cggb#cggb,#cggc#cgg(d#cggd,#cgg e#cggWf#cgg'g#cggYg#cggg#cggh#cggri#cggi#cggj#cggj#cggl#cggWl#cggm#cgguo#cggp,#cgg*q#cggr#cggr,#cgggs#cgggt#cggu#cggju#cggFv#cgglw#cggDx,#cggx#cggy#cggz,#cgg9{#cgg|#cgg|,#cggQ}#cgg~#cgg~#cgg#cgg#cgg#cggp,#cgg#cgg6#cgg,#cgg#cgg*#cgg#cgg#cgg#cgg~#cgg,#cgg#cggf#cgg,#cgg#cgg#cgg!,#cggM#cgg#cgg(,#cgg #cgg#cggנ,#cgg#cgg#cgg#cgg#cgg#cggǦ#cggw,#cgg#cgg#cgg,#cgg#cgg#cgg,#cgg#cgg#cgg}#cggŷ#cgg#cggk#cgg,#cgg#cgg#cgg,#cggD#cggs#cgg,#cgg#cgg#cgg#cggI#cgg#cgg,#cggg#cgg#cgg#cgg#cggG,#cgg;#cgg|#cgg#cgg#cgg#cgg#cgg#cggs#cgg#cgg#cgg#cgg#cgg6#cggK#cgg,#cgg#cgg#cgg#cgg#cgg#cgg-#cgg#cgg#cgg#cgg#cgg;,#cggc#cgg>  You see here a +0 dagger.#cgg #cgg\  _#cgg^ #cgg5#cgg8,#cgg1#cgg<#cgg=,#cgg>#cggA#cggC,#cggD#cggE#cggMG,#cggAH#cgg:a#ß...ß#....####..# ####.### ###cgga#######.......###......# ..# #####..###........ ..# ##### #..##......... ..# #...# #..##......... .########...# #...#....... .......##...# ##.#.#.....).. ######......# #####..#.......... # ###....###.@....>..†.-#cggb 616.3 (68.0) #########...#...##.#.###..... ..............####...# #......... .######.....### #...## #...... #####...#...#####..#####...... #cggbx......###>......#.....##...... ####### ##.......÷.....##..... #....[....##......# #.........#####cgg!c8-#cgg8h#cggqE _Done exploring.#cggX#cggsY#cgg!Z#cggo.####..............0.0)#cgg*p#cggku#cggw _No target in view! _You see here a +0 dagger. _Done exploring.#cgg I#cgg- #cgg2 #cggU5 #cgg*7 Z _You see here a +0 dagger. _Done exploring#cggi7 .#cgg3#cgg>#cgg#cgg#cggc#cgg` _You see here a +0 dagger. _Done exploring.$cgg I$cgg$cgg $cgg#$cgg&@ _Done exploring.$cggH`I$cggJ$cgg@ _Done exploring.$cgg ^$cggl`Where to? (? - help)  D - Dungeon $cggq #ß.........ß#....####..# ####.### ssays the Charlatan ################.......###......# Draconian ..######..###........ Health: 23/23 ======================== ..# ######..##......... Magic: 2/2======================== ..# #...##..##......... AC: 4Str: 14 .########...##...#......... EV: 11Int: 11 .......##...# ##.#.#.....)... SH: 0Dex: 11 ######......# #####..#........... XL:  2 Next: 34% Place: Dungeon:1 # ###....###.@..........>..†.. Noise: ---------  Time: 616.3 (0.0) #########...#...##[39;49$cgg2s m.#.###......... e) +0 mace ..............####...# #......... Zap: wand of flame (15) .######.....### #...## #......... #####...#...#####..#####......... ......###>......#.....##.........  ####### ##.......÷.....##........ #....[..........##......# #...............#########  _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring.$cggx $cggy : _$cgg} X$cgg~ $cgg. $cgǵ $cgg3 $cgg $cggƄ $cggy $cgg $cgg $cgg X$cgg $cggI $cgg $cgg $cggΓ $cgga ,$cggl $cgg˜ X _ There is a stone staircase leading down here.$cgg $cggY $cgg $ _$cgg $cgg ;2$cgg $cgg $cgg_ $cgg  #### ..# $cgg_ 4#.# #@#25.1 (8.8 ### _You climb downwards.$cgg $cgg $cgg a _There is a stone staircase leading up here.%cgg;%cgg%cggf %cgg"%cgg&%cgg)P _%cggF+%cgg+%cgg,%cgg?.%cggT0%cgg0%cggi1%cgg3%cgg5,%cggk6%cgg!> ###########.......@..#%cgg>.########.##<####k - a scroll of identify%cggB-9.1 (4.0%cgg,30.1 (5%cgg͇%cggR _You see here a +0 ring mail.%cgg9 %cgg: %cgg;; %cgg= %cgg? %cggR@ %cggD X%cggE %cggF %cggG ,%cggEH %cgg I %cgghJ %cggJ %cgg~N %cgg\P %cggRR %cggR %cggIS %cggU %cggV %cgg2W %cggW %cggDY %cgg [ %cggI[ %cgg[ %cgg^ %cgg_ %cgg<` %cgg` %cggb %cggwd %cggd %cgge %cggg %cggh %cgg )cgg? 4-10)cggC )cgg/F *cgg. ###### #....# ###.##.#### #.........# #.###.....# #@....##..#### ######.# ###.###.#  #.# #.# #.. #. ###.#.# .#.#.  #.#.#  #...#*cgg]*cgg*cgg@-2*cgg*cggP"*cggXR*cgg S3*cggkU,*cgg{\P1==*cgg7]*cgg]*cgg^^2==*cgg`^*cgg_,*cggA`*cgga,*cgg-b*cgg dB*cgget3==*cggf*cggf,*cggg*cggh,*cgg>i*cgg>j*cgg{j*cggj*cggk*cggl9=*cggYl*cggOm*cggmS4=*cggn*cggn*cgg5o*cggo*cggp*cggcq,*cggr*cggr*cgg2s*cggGt*cggt^5==*cgg u*cggv*cggWv*cggv*cggw*cgg!x*cgg_x*cggVy*cggy*cggy*cgg_{*cgg{9=*cgg&|*cgg4}*cgg}S6=*cgg}*cgg *cggM*cgg*cgg*cggH*cgg*cgg,*cgg*cggׄ17==*cgg*cgg'*cggq*cgg؆*cgg,*cgg#*cggF,*cgg*cgg*cgg'j8==*cggd*cgg,*cgg*cggώB*cgg=9=20==1==*cggB*cgg̣,*cggĤ*cgg,*cgg *cggkO=*cgg*cggȨ*cgg*K2=*cgg{*cggѪ,*cggE*cggg*cggѬ*cgg$*cggO,*cgg*cgg3=== _HP restored.*cgg3*cgg*cggܶ*cggB*cggc*cgg9*cgg*cgg*cggy*cgg(*cgg:==*cgg*cggt*cgg*cgg*cgg?*cggM*cgg,*cgg*cgg*cgg,*cgg*cgg*cgg,*cggn*cgg*cgg=*cgg ,*cgg*cgg#....####.##.#####.........##.###.....# #.....##..#### ######.......# ###.###.# #.###.# #.@.#.############*cggI###.#.#.......[..#.#.#.########.#.#.#.# #<#g#...# #########g   goblin (asleep) *cgg]735.9 (63.0)6.9 (64*cgg*cggu _A goblin comes into view. It is wielding a +0 dagger.*cggn B  #### ...# ...# #.....##..####  .......#  ###.###.#  #.###.#  #.@.#  ###.#*cggo [..#  .#  .#.#.# #<#  g#...# ###  ###### *cgg %  #### ...# ...# #.....##..####  .......#  ###.###.#  #.###.#  #.@.#  ###.#[..#  .#  .#.#.# #< *cgg g#...#  ###### *cggf 4*cggn *cgg ] _A goblin is nearby!+cgg6###.##.#####.........# #.###.....# #.....##..##########.......#  ###.###.#  #.###.# #...#.###############@#.#.......[..#  #.#.#.########.# #.#.#.# #<# .g#...# ##########+cggH+cggK87.9 (1.0) _+cggZ+cgg+cgg}.........###....##..#########....... ###.### #.####...#.###############.#.#.......[.. ######## #<.g#..######### +cgg<8+cggr+cgg~+cgg!|###....##..#########....... ###.### #.###...#.##############.#.#.......[.. ######## #<.......g#..############# +cgg¸+cgg9+cgg+cggX+cggC  gg    The helpless goblin fails to defend itself.  You hit the goblin. Your tail-slap misses the goblin.The goblin is moderately wounded.=41.2 (1.3 _The goblin barely misses you. The goblin closely misses you.+cgg6   You thump the goblin!) 512.6 (1.4 _You kill the goblin!,cgg _No target in view!,cgg,cgg,cgg,cggU,cggE,cgg: _,cggv  Things that are here:  a +0 dagger; a +0 sling; a goblin corpse,cgg,cgg _,cggz,cgg,cgg ,cgg ,cgg ,cggU ,cgg,cgg!,cgg,cggB,cgg,cggy,cggN,,cgg,cgge,cgg,,cggO,cgg ,cgg!,,cgg?",cgg#,cgg$,,cgg%,cgg',cgg',cgg',cggR(,cgg),cgg*,cggM+,,cgg,,cgg.,,cgg.,cgg/,cgg0,cgg1,,cggZ2,cgg3,,cgg94,cgg6,cgg8,cggl8,cgg8,cgg9,cgg ;,cggl;,cgg;,cgg=,cggMe,cggv,cgg  ###### #....#.. ###.##.#### ....#####..# ..K.....#.###.....# ##@#.....##..###- #..######....... #.## ###.###.##.##.###.##.##...#.####.####.#.#.. K   kobold (asleep)#.##.#.#.##.###########.#.#.##............)#...#,cggv63.6 (21.0)-4.6 (22,cgg͓,cgg%s _A kobold comes into view. It is wielding a +0 whip.,cggS     ..   ....#####  ..K.....#  ##@#  #..#  #.##   #.#   #.#  #.#  #.#  #.. #............),cggy      ..   ....#####  ..K.....#  ##@#  #..#  #.##   #.#  #.#  #.#  #.#  #.. #............),cggG 4,cgg ,cgg ] _A kobold is nearby!,cgg  ######  #....#  ###.##.####...#####.........#...K...@.#.###.....# ###+#.##.#.....##..##### #..######.......# #.## ###.###.# #.# #.###.# #.# #...#.## #.####.#.#. #.# #.#.#. #.###########.#.#.,cgg ,cgg 85.6 (1.0) _,cggh ,cggF ,cgg#+... ######... #....#.. ###.##.####.#####.#.K..@..#.###.....##+#.##.#.....##..#### #.#..######.#..#.## ###.###.#####.# #.###.# #.# #...#.,cgg #.# ###.#.# #.# #.#.# #.#.#.#,cgg,cgg&6,cgg,cgg-cgg"####.#+#...$...... ######... #....#.. ###.##.####.#####.#.K.@...#.###.....##+#.##.#.....##.. #.#..######. ..#.## ###.###. ####.# #.###. #.# #...#. #.# ###.#. #.# #.#. #.#.#.-cggl-cgg {.KK7-cgg-cgg+ _Found 17 gold pieces.-cgg  You hit the kobold. Your tail-slap misses the kobold.The kobold is severely wounded.=8.9 (1.3-cgg/-cggS _The kobold barely misses you.-cgg6  You barely miss the kobold. Your tail-slap misses the kobold.The kobold is severely wounded.-cgg7 a19-----70.3 (1.4-cggp= -cggA x _The kobold hits you with a +0 whip. The kobold closely misses you.-cgg  You closely miss the kobold.The kobold is severely wounded.-cgg q15---------1.7-cgg$ -cgg  9 _The kobold hits you with a +0 whip.-cgg4z  You completely miss the kobold.The kobold is severely wounded.-cgg{(3.1-cggσ _The kobold barely misses you. The kobold hits you but does no damage..cggc   You completely miss the kobold.The kobold is severely wounded.6=---4.5.cgg e.cggvhS _The kobold barely misses you..cgg /cgg@ /cggI N     /cggI      ##   .)  ########.##### #.....@...:...33.7 (8.0)/cggI $ #.######....#. #.....(.##..# #....##.## ... #......... . #.......# ##....###/cggJ # #.......# #.......#/cggQ /cggeR +4.7 (9/cggW /cggTZ ' _Found a hand axe.0cgg 0cgg 0cgg 0cgg8 N _There are no items here.0cggw   ssays the Charlatan  Draconian  Health: 23/23 ========================  Magic: 2/2========================  AC: 4Str: 14 ##  EV: 11Int: 11 .)  SH: 0Dex: 11 ########.#####  XL:  2 Next: 55% Place: Dungeon:2 #.....@...:...  Noise: ---------  Time: 834.7 (0.0) #.######....#.  e) +0 mace #.....(.##..#  Zap: wand of flame (15) #....##.## ... 0cggx [1K #......... .  #.......#  ##....####  #.......#  #.......#  _Found a hand axe. _There are no items here.  Aiming: Throw FlamePress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - you1cgg ssays the Charlatan  1cgg=nDraconian  Health: 23/23 ========================  Magic: 2/2========================  AC: 4Str: 14  ##EV: 11Int: 11  .)SH: 01cggDex: 11  ########.#####XL:  2 Next: 55% Place: Dungeon:2  #.....@...:...Noise: ---------  Time: 834.7 (0.0)  #.######....#.e) +0 mace  #.....(.##..#Zap: wand of flame (15)  1cgg7#....##.## ...  #......... .  1cggiA#.......#  ##....####  1cggS#.......#  #.......# _Found a hand axe. 1cggϰn_There are no items here.  Aiming: Throw Flame1cggPress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - youOkay, then.1cgg1cgg9D _2cggD42cggH2cggJN _There are no items here.2cggV32cgg2cgg_2cggO2cgg<: _2cgg2cgg2cgg2cgg_2cgg2cgg2cgg>2cgg 2cggU 2cggv,2cgg2cggF 2cggwq ######  #...)  ########.######  #....#  2cgg7#.######....#.#  #.....(.##..#  2cgg#....##.###.... #......... ..... 2cgg g#.......# ###..# ##....#### ..# #.......# ..  You pick up the Annotations on Locality and begin reading...2cgg]'+8.7 (42cgg|(+9.7 (52cgg},2cgg+/~  You add the spells Momentum Strike, Maxwell's Portable Piledriver and Dispersal_to your library.3cgg33cgg3cggk3cgg3cgg3cgg#,3cgg%3cgg&3cgg'3cgg(3cgg*,3cgg+3cgg/3cggv1,3cgg23cgg+53cggg73cgg73cgg83cgg+;3cgg=,3cgg>3cgg`A3cggD,3cggCE3cggG3cgg6J,3cggtK3cggM3cggO,3cggP3cggR3cgg4T3cggT3cggFU3cggBW3cggY3cggZ3cgg[3cgg4]3cgg_,3cgga3cggin#.######....#.# #.##.##.....(.##..#.###.....##....##.###........##...............#^##3cgg^j6#.......######..# ##....#### #..#+#### #.......# #.......# #.......#.......# #.......#.......@.....# 3cggjp#.......#.#######.....# #.......#+#...# .....# #.............# ######### ######.# #....##. ###.3cggk##.####........#####.........#)....#.###.....#######+#.##.#.....##..####3cggq051.7 (12.0)3cggMr,2.7 (133cggw3cggPzR _m - a green potion4cgg _4cgg 4cggf ,4cgg 4cgg 4cggѳ 4cgg~ 4cggǶ 4cgg ,4cggd 4cggT 4cgg ,4cgg 4cgg 4cgg| ,4cgg 4cgg 4cgg 4cgg 4cggT 4cgg 4cggA 4cgg 4cgg 4cgg 4cgg ,4cggS 4cgg 4cgg* 4cgg 4cgg 4cgg 4cgg 4cggA 4cggW 4cgg 4cgg ,4cggZ 4cggs X4cggW V       ######  #...)#   ########.###### ##.   #.............# ...   #.######....#.# #.##.#   #.##..#.###.....#4cgg 64.7 (12   #....##.###........#   #...............#^##   #.......######..#   ##....#### #..#+####   #.......# #.......#   #.......#######.......#   #.......#.....4cgg ........#   #.......#.#######.....4cggT4cggT _You see here 6 poisoned darts.5cgg5cgg15.0)5cgg"5cggy* _n - 6 poisoned darts6cgg?36cgg#A6cggC6cggE6cgg9F6cgg*J6cggJ6cggL6cggL6cggM6cggqO6cggQ6cggHR6cggR6cggU6cggK\D ########..  #...)....b #  ########@###### ##.  #.............# ...  #.######....#.# #.##.# #.......##..#.###.....# #....##.###........# 6cgg]n#...............#^## b   bat (asleep) #.......######..# ##....#### #..#+#### #.......# #..6cggd+8.7 (36cggre+9.7 (46cggj6cgglV _A bat comes into view.6cggXp ########..  6cgg#...)....b #  #@###### ##.  #.............# ...  #.######....#.#   ..##..#  .###...  ..........#^##  ..######..#  #### #..    6cgg} ########..  #...)....b #  #@###### ##.  #.............# ...  #.######....#.#   ..##..# .###... 6cgg&P..........#^##  ..######.. #### #..  6cgg[46cggs6cggfZ _A bat is nearby!6cggf /########...  #..@)....b[ #########.######.# ###.............# ... #.######....#.# #.##.##.......##..#.###.....##....##.###........# #...............#^##.......######..###....#### #..#+####6cggk 6cggjl ,70.7 (16cggr 6cggv C _Found a robe.6cggw.#.#...@....b[. # ########.######.## ##. #.............# ... #.######.#.#6cggx#....##.###.# #.......#....... 6cgg&6cgg16cggz6cggْQ _You see here a +0 hand axe.7cgg,\...#.7cggD#...)@...b[.. # ########.######.##.##. #.............# ... #.##### #....##.###.# 7cgg7cgg-2 _7cgg`7cggܪ7cgg...#.#.#...).@..b[... # ########.######.##.##. #.# ... #....##.###.# 7cgg2<37cgg7cgg7cgg .#.# #.# .#.# ..#.# ...+.#....##.#...)..@.b[...# # ########.######.##.##. #.# ..... #.######....#.# #.##.##.##..#.###.....##....##.###.## 7cgg 7cgg &47cggx 7cggT 7cgg> \#.# #.# ### #.# ...# #.# ...# #.#....+ #.#....##.#...)...@b[...# # #7cgg{? .######.##.##. #.#...... #.######....#.###  #....##.###.## 7cggmC 7cggD 7cggM 9.bb7cggM .=57cgg)U 7cggX : _The bat hits you but does no damage.7cggBf#.##.######8cgg#.#....# #.#....# #.#....+ #.#....###########........#...).....[...# #########.######@##.##.  #.............#b.......  #.######....#.####.##.##.......##..#.###.....#  #....##.###........###  #...............#^##  #.8cgg######..# ##....#### #..#+#### #.......# #.......#8cgg@ <68cgg$8cgg6 8cgg`_The bat misses you. The bat hits you but does no damage.8cgg5  You closely miss the bat. The bat closely misses you.8cgg-8.0 (1.38cgg8cggP _The bat barely misses you.8cgg]t>9.38cggy8cggI{ _You barely miss the bat. The bat barely misses you. x38cgg& 8cgg' 8cggX* 8cgg0 ".b8cgg>1 )80.68cgg7 8cgg; _You miss the bat. The bat barely misses you.8cgg0 8cgg: b.  You barely miss the bat. The bat completely misses you.8cggN; (1.98cgg@B 8cggE Q _The bat closely misses you.8cggK %  8cgg* You closely miss the bat. The bat completely misses you.3.28cgg _The bat hits you but does no damage. The bat barely misses you.9cgg9cggP9cgg`9cgg".b9cggN(4.59cgg9cggt _You closely miss the bat. The bat hits you but does no damage.9cgg@  You closely miss the bat. The bat closely misses you.9cgg(5.89cgg9cgg 9cgg%/_The bat hits you but does no damage. x29cgg 9cgg "b.9cgg -7.2 (1.49cgg 9cgg _You closely miss the bat. The bat barely misses you. x29cgg& 5  You hit the bat.9cgg. 4†9cggC2 588.5 (1.39cgg}9 9cgg< G _You kill the bat!9cgg 9cgg 9cgg9cggDH _No target in view!:cgg 4:cgg:cgg :cgg:_No target in view!:cgg3:cgg:cgg]:cgg:cggS:cgg: _:cgg,\  You see here a +0 robe.:cggt:cggݨ _:cgg:cggë:cgg:cggϭ:cgg:cgg<:cgg:cgg:cgg[:cggk:cggE:cgg6:cgg:cggA:cgg:cgg:cgg:cggD:cgg#.# #.###### :cgg2E#.#....# #.#....# #.#....+ #.#....###  ########........#  #...).....[...#.# :cggX###.######.##.##@# - ..:cggM#†........r ###....#.####.##.###.... ...##..#.###.....# .. :cgg##.###........#### ....#^## r   rat (asleep) ...######..# :cgg 94.5 (6.0  A rat comes into view.-5.5 (7:cgg:cgg{< _Found Huits's Antique Armour Boutique.:cgg  #.# #.###### #.#....# #.#....# #.#....+ .###  .....#  #...).....[...#.#.##.##@##†........r.... ####.##.###.... #.....# .. ....####..#^##..#  :cgg9  #.# #.###### #.#....# #.#....# #.#....+ .###  .....#  #...).....[...#.#.##.##@##†........r.... ####.##.###.... #.....# ......####..#^##:cgg_ Z..#  :cgg 4:cggR :cggʯ Z _A rat is nearby!;cggi2#.#######.#....# #.#....# #.#....+ #.#....### ########........# #...).....[...#.# # ;cggJ##.######.##.##.####...# ........#†......@.r....# ##....#.####.##.###....# ..##..#.###.....# ..# #.###........#### ..........#^########..# ### #..#+#### .# #.......#######;cggǶe6.5 (1 _;cgg )#.###### #.#....# #.#....# #.#....+ #.#....### ..# ;cgg ...).....[...#.# .# .######.##.##.####...# #†.r....# ....#.####.##.###....# ##..#.###.....# ...# .###........#### #..#^## ..######..# . ;cgg Nrr;cgg5 .=7;cggV ;cggV I _The rat misses you.;cgg 5  You hit the rat.;cggv G∩;cggϺ 6628.9 (1.4;cgg ;cgg G _You kill the rat!cggT>cgg>cgg4>cggzH _No target in view!>cgg~I>cgg>cgg0>cgg˂$ _>cgg,>cgg5,>cggч>cgg>cgg,>cgg>cggF>cggF:Welcome to Huits's Antique Armour Boutique! What would you like to do?  a -  190 gold a pair of crude boots  b -  14 gold a robe >cgg  c -  80 gold a scale mail  d -  80 gold a scale mail  e -  180 gold a shimmering scale mail You have 28 gold pieces. [Esc] exit[!] buy|examine items[a-e] mark item for purchase [/] sort (type)[A-E] put item on shopping list?cgga a $  You are short 162 gold pieces for the purchase.[Enter] buy shopping list@cggPe $ 34AcggnAcgg$uAcggz#.######ssays the Charlatan#.#....#Draconian#.#....#Health: 23/23 ========================#.#....+ #####Magic: 2/2========================#.#....### #...#AC: 4Str: 14 ######........# #...#EV: 11Int: 11 ..).....[...#.# #...#SH: 0Dex: 11 .######.##.##.####...#XL:  2 Next: 65% Place: Dungeon:2 ......#†........@....#Noise: ---------  Time: 907.2 (3.0) ....#.####.##.###....#e) +0 mace ##..#.###.....# #....#Zap: wand of flame (15) ###........#### cgg{m##.#....# ........#^## #.#....# ######..##.#....# # #..#+#### #......##.......# ###+#### ######.......# _The rat squeaks loudly. _The rat twitches its whiskers.You hit the rat. _You kill the rat! _No target in view!  There is an entrance to Huits's Antique Armour Boutique here.AcggAcggAcggK _The rat twitches its whiskers. Acgg% You hit the rat. _You kill the rat! _No target in view!  There is an entrance to Huits's Antique Armour Boutique here. _You can access your shopping list by pressing '$'.AcggAcggAcggAcggF _Unknown command.Bcgg4Bcgg8(Welcome to Huits's Antique Armour Boutique! What would you like to do?  a $  190 gold a pair of crude boots  b -  14 gold a robe Bcgg9 c -  80 gold a scale mail  d -  80 gold a scale mail  e $  180 gold a shimmering scale mail You have 28 gold pieces. You are short 342 gold pieces for the purchase. [Esc] exit[!] buy|examine items[a-e] mark item for purchase [/] sort (type) [Enter] buy shopping list [A-E] put item on shopping listCcgg%Ccgg3.Ccgg7#.######ssays the Charlatan#.#....#Draconian#.#....#Ccgg7=Health: 23/23 ========================#.#....+ #####Magic: 2/2========================#.#....### #...#AC: 4Str: 14 ######........# #...#EV: 11Ccgg7Int: 11 ..).....[...#.# #...#SH: 0Dex: 11 .######.##.##.####...#Ccgg*8XL:  2 Next: 65% Place: Dungeon:2 ......#†........@....#Ccggo8Noise: ---------  Time: 907.2 (0.0) ....#.####.##.###....#e) +0 mace ##..#.###.....# #....#Zap: wand of flame (15) Ccgg8A###........#### ##.#....# ........#^## #.#....# ######..#Ccgg8[#.#....# # #..#+#### #......##.......# ###+#### ######.......#Ccgg*9You hit the rat. _You kill the rat! _No target in view!  There is an entrance to Huits's Antique Armour Boutique here. _You can access your shopping list by pressing '$'. Ccgg91_Unknown command.CcggdACcggBCcggvJ~ _You can access your shopping list by pressing '$'.CcggU]4CcggFdCcggfF _Unknown command.Ccgg-/ Ccgg0 3Ccgg3 Ccgg@5 CcggK: | _Ccgg ; Ccgg; CcggP< ,Ccgg0= Ccggb> CcggB@ Ccgg@ Ccgg@ CcggC CcggE Ccgg F CcggYF CcggH CcggI ,Ccgg;J CcggK CcggL Ccgg-M CcggsM CcggP CcggQ CcggKR CcggR Ccgg&V 7 _You open the door.Ccgg8X CcggX CcggY Ccgg\ @  There is an open door here.Ccgg^ CcggL_  _CcggQ` Ccgg'b Ccggc CcggGd Ccggfe Ccggk y..#.####.##.###....# ..#.###.#....#### #........#### ##.#....# ......#^## #.#....# Ccggl 3####..# #.#....#  #..#+#### #......#  #.......# ####'#### ####.......# #.....#.....# #.@. ######.....# #.......... ...# .....# #.....####. ...# #########.....## #....####### Ccggl ....# ###.##.#### ...#####.........# ..)....#.###.....#+#.##.###..####CcggYr 018.2 (11.0)Ccggr ,9.2 (12Ccggw Ccgg{ ] _o - a bubbling silvery potionCcggyCcgg,{3Ccgg~CcggXCcggƇXCcgg,CcggfCcggCcgg,CcggCcgg#XCcgg Ccgg2,CcggCcggCcggǘ,CcggVCcgg͚CcggCcgg,CcggCcgg,CcgglCcgg&Ccgg,Ccgg"CcggCcgg%XCcggCcgg`CcggCcggCcgg,CcggCcgg4Ccgg  #.#....#  #.#....#  #......#  ####'####  #.....## #......##### #..........## ####### Ccgg #.....####..###....... ###.....# ##...@.# 32.2 (13 ..####### #####.# #.#### >.. ..# ###..###..#### ####.###.#  #.###.Ccgg"#Ccgg&Ccgg,3.2 (14CcggPCcgg+; _Found a stone staircase leading down.Dcgg.Dcgg3DcggDcgg޺,DcggDcggBDcggDcggB#.#....# #.#....# #.#....# #......# ###'#### .....## ......##### ..........## ########### .....####..###..@......K...# ##.....##......#######.# .###### ###DcggG.#>..## ..###### ..#K   kobold (missile, asleep)#####.#Dcgg 6.2 (3.0)  A kobold comes into view. It is wielding a +0 club.DcggnK.K)Dcgg~4==7.2 (4DcggDcgg( _The kobold shouts!Dcggx# ########### #..@.....K.  ##.....##......#  #####.# .######  #>..## #####DcggL  ########### #..@.....K.  ##.....##......#  #####.# .######  #>..## Dcgg%S 4DcggY Dcgg\ ] _A kobold is nearby!Dcggp .#....# .#....# .#....# ......# '#### ## ##### ## #####..###...@....K.# ##.....##......# #####.#..######  #>..### DcggY ###### .##### ###.#Dcgg Dcgg 4K.Dcgg ;--8.2 (1 _Dcggl Dcgg Dcgg̯#....# #....# #....# # '#### ## ##### ## #####..###.K.# ##.....##......# #####.#..######  Dcgg#>..## # ##### # ##### ##.#DcggDcggtK.--9DcggFDcggEcgg....# ....# ....# # Ecgg<'#### ## ##### ## #####..###.....@K.# ##.....##......###. #####.#..######    # #.#EcggEcgg KK 2 kobolds (missiles, 1 wandering)  The kobold hits you with a +0 club.Ecgg&#2Ecggw;--=40Ecgg{Ecggs _A kobold comes into view. It is wielding a +0 club.Ecgg+8  You hit the kobold.Ecgg K.K)  The kobold is moderately wounded.EcggՓC1.5 (1.3EcggEcggT _The kobold closely misses you.Ecgg=>a  You closely miss the kobold.Ecgg?EcggGt....K.KEcggH(2.8EcggNEcgg=Ra _The kobold is moderately wounded.Ecgg 8  You hit the kobold.Ecgg! Ecgg) K.)   kobold (missile)  Ecgg* 4You kill the kobold!Ecgg/ >(((((((EcggM L...@...Ecgg- _3==84.1Ecgg Ecgg? f _The kobold throws a stone. The stone misses you.Ecgg;# # # # #### ## ##### ## #.####..###.K.Ecgg!<G# ##.....##..)...###.# #####.#..###### #>..####### # .#EcggFEcggL0((Ecgg..2--50 _The kobold throws a stone. The stone hits you.FcggH# # # #  ## ##### FcggI## #. ####..###.K....# # ##.....##..)...###.# #####.#..###### #>..####### ##FcgghMFcgg*T^K.-6FcggeYFcgg(\Fcgg8y  You hit the kobold.) Fcggp:>72=7.4 (1.3Fcgg=FcggH?J _You kill the kobold!FcggqFcgg=FcggFcggH _No target in view!FcggE 4Fcgg Fcgg H _No target in view!Fcgg[{ 3Fcgg| Fcgg. Fcgg i3== _Fcgg> Fcgg ,Fcgg Fcggǎ U  Things that are here:  a +0 club; 5 stonesFcgg Fcgg  _Fcgg Fcggj Fcgg Fcgg@ Fcgg Fcggҙ Fcgg f==Fcgg FcggH Fcgg Fcgg' Fcgg Fcgg Fcgg FcggQ Fcgg Fcgg  ###+##.....# #B.........# #..........# ......#.... ......... .....##.# # ######......(#........)....@# - ....##..)...###.## ##.#..###### #...#Fcgg 0#>..## #.######## #.##.#B   giant cockroach (asleep) #.# #.. ###Fcgg Fcgg .54.4 (7.0FcggT E-5.4 (8Fcgg Fcgg b _A giant cockroach comes into view.Gcgg ###+##.....#  #B.........#  #..........#  ......#....  .........  .....##.# # #######......(# ..)....@#)...###.## #...#  #>..## #.###  ##### #.# Gcggd#.# #.# #.. ###Gcgg.  ###+##.....#  #B.........#  #..........#  ......#....  .........  .....##.#  #######......(# ..)....@#)...###.## #...#  #>..## #.  ##### #. #.# #.# #.. ###GcggGcggvf _A giant cockroach is nearby!Gcgg]4 ###+##.....#  #B.........#  #..........#  ......#....  .........  .....##.# # #######......(# Gcggc5..)....@#)...###.## #...#  #>..## #.###  ##### #.# #.# #.# #.. ###Gcgg W ###+##.....#  #B.........#  #..........#  ......#....  .........  .....##.#  Gcggu #######......(# ..)....@#)...###.## #...#  #>..## #.  ##### #. #.# #.# #.. ###Gcgg% 4Gcgg Gcgg4 f _A giant cockroach is nearby!Hcgg5Hcgg=  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting1.5   1.7  +1   i - Spellcasting   0.0   1.2  -1           b * Maces & Flails   1.3   2.0   0       c - Axes   0.6   1.0   0   j + Evocations3.1   4.0   0   d - Staves   0.6   1.0   0       e - Unarmed Combat Hcgg>[39;49m  0.0   1.0   0       f - Throwing   0.0   1.2  -1                      g + Dodging2.3   3.6  -1      h + Stealth1.3   2.0   0                          HcggN@W[m                            The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsHcggHcggÏHcggDHcggwssays the Charlatan###+##.....#Draconian#B.........#Health: 23/23 ========================#..........#Magic: 2/2========================......#....HcggAC: 4Str: 14.........EV: 11Int: 11.....##.#SH: 0Dex: 11 # ##############......(#XL:  2 Next: 72% Place: Dungeon:2 ###........)....@#Noise: ---------  Time: 955.4 (0.0) ....##..)...###.##e) +0 mace ###.#..###### #...#Zap: wand of flame (15)#>..###.#########.##.#B   giant cockroach (asleep)#.##..HcggM### _No target in view!  Things that are here: _a +0 club; 5 stones _A giant cockroach comes into view. _A giant cockroach is nearby! _A giant cockroach is nearby!HcggHcggXHcggHcggiIcgg Icgg Icgg)" IcggC% O _Char dumped successfully.Jcgg?Jcgg@Shopping list: 5 items, total cost 578 gold pieces  a - [D:1] 44 gold a scroll of poison (unknown)  b - [D:1] 82 gold a scroll of blinking (unknown) JcggA) c - [D:1] 82 gold a scroll of enchant weapon (unknown)  d - [D:2] 180 gold a shimmering scale mail  e - [D:2] 190 gold a pair of crude boots You have 28 gold pieces [!] travel|examine|delete items [a-e] choose item[Esc] exitKcggU _travel|examineKcggracexamine|deleteLcgg 4399pair of crude boots dMcggMcggWMcggWssays the Charlatan###+##.....#DraconianMcggٳ#B.........#Health: 23/23 ========================#..........#Magic: 2/2========================......#....AC: 4Str: 14.........EV: 11Int: 11.....##.#SH: 0McggGDex: 11 # ##############......(#XL:  2 Next: 72% Place: Dungeon:2 ###........)....@#Noise: ---------  Time: 955.4 (0.0) ....##..)...###.##e) +0 mace ###.#..###### #...#McggxZap: wand of flame (15)#>..###.#########.#Mcgg#.#B   giant cockroach (asleep)#.##..Mcgg###Things that are here: _a +0 club; 5 stones _A giant cockroach comes into view. _A giant cockroach is nearby! Mcgg_A giant cockroach is nearby! _Char dumped successfully.McggMcggPMcggMcgg&McggJ#  ..#.. ##+##.....B.#....##......#....#......... #.......##. ##############@.....(# ###........).....####### ....##..)...###.## ###.#..###### #...Mcgg$ y>..###########..Mcgg(. Mcgg: H6.4 (1 _McggC; McggW ..... ..#.. ###+##.....# #B.........#Mcgg\X #..........# ##.... #....# #..@....##.# ##############......(# .###........).....####### .....##..)...###.## ####.#..###### #...#McggX* #>..## #.######## #.# #.# #.#McggbMcggb&7Mcgg mNcgg? # ..... ..#.. ###+##.....# #B...# #..........# ##.... #....# #.......##.#Ncggej ##############......(####........).....####### #.....##..)...###.## #####.#..###### #...# #>..## #.######## #.#  #.#NcggiNcgg.BB8Ncgg Ncggd Ncgg #= #. ... ..#.. ##+##.B........##.... .. ## #.......##. .Ncgg### ##############......( ..###........).....####### #.....##..)...###.## #####.#..###### #...>..##########Ncgg-k  The giant cockroach barely misses you.Ncgg/.=9Ncggb5Ncgg8G _The giant cockroach bites you but does no damage.NcggH  You hit the giant cockroach but do no damage.Your tail-slap misses the giant cockroach.NcggI'60.8 (1.4NcggNNcggP] _The giant cockroach closely misses you.Ncgg=  You hit the giant cockroach.  The giant cockroach is moderately wounded.The giant cockroach bites you but does no damage.Ncgg -2.1 (1.3Ncgg Ncggd ] _The giant cockroach closely misses you.NcggBs The giant cockroach is moderately wounded.  The giant cockroach bites you but does no damage. _The giant cockroach closely misses you.You hit the giant cockroach but do no damage.Your tail-slap misses the giant cockroach.  The giant cockroach is moderately wounded.Ncgg>t (3.4Ncggay Ncggg| ] _The giant cockroach closely misses you.Ocgg~The giant cockroach is moderately wounded.barely miss the giant cockroach.  The giant cockroach is moderately wounded.The giant cockroach waves its antennae.  The giant cockroach bites you but does no damage.Ocgg-4.8 (1.4OcggOcgg\ _The giant cockroach barely misses you.Ocggl  You barely miss the giant cockroach.The giant cockroach is moderately wounded.Ocggm(6.2OcggEtOcggvJ _The giant cockroach bites you but does no damage. x2Ocgg6.  You hit the giant cockroach.  The giant cockroach is almost dead.Ocgg$/-7.5 (1.3Ocgg4Ocgg7G _The giant cockroach bites you but does no damage.OcggBA  You hit the giant cockroach.Ocgg E†Ocgg 598.9 (1.4Ocgg| Ocgg S _You kill the giant cockroach!Ocgg& Ocggr Ocggx Ocgg H _No target in view!OcggAOcggmOcggOcggUOcggOcgg$ _OcggOcggOcgg<OcggOcgg"OcggOcggCOcggOcggOcggdOcgg,Ocgg|OcggOcgg OcggjOcggOcgg-OcggI,OcggOcggNOcgg8,Ocgg#OcggOcgg+Ocgg,Ocgg .....# ...#... ###+##.....# #  #..........#.#  #.†........#.#  #......#.....  Ocgg M#..........#  #.......##.#  ##########......@#  - .....).....#######  ..)...###.## #### #...# ## #.### # #.#    #.#  Ocgg0 W  #.#    #..   Ocgg.76.9 (8.0OcggDE-7.9 (9Ocgg8Ocgg6 _n - 12 poisoned darts (gained 6)Pcgg_Pcgg`3PcggcePcgg?gPcggkBPcggl,PcggmPcggnPcggpPcggJqPcggqPcggSsPcgg,uPcgguPcggvPcgg'yPcggyz,Pcgg {Pcgg|Pcgg},Pcgg~PcggPcggu,PcggPcggpPcggQ,PcggPcggPcgg5PcggPcggŇPcggPcgg,,PcggPcggPcgg4Pcgg,PcggPcgg,PcggPcggcPcggĕ,PcggRPcggiPcgg!  #.#.   .#.   ..r   #..  Pcgg #..#   #...   #####..#####  S......@...#  ######..###.#  ........#.#.#  ....#......#  ###+##.....#.###  #..........#.# S   adder (asleep)#.†........#.# Pcgg-Hr   rat (asleep)#......#.....# #..........### Pcgg790.9 (13.0)PcggҰ%1.9 (14PcggPcgg<b _A rat and an adder come into view.Pcgg  #.#. .#. ..r #.. #..#  #...  #####..#####  S......@...#  ######..###.#  ........#.#.#  ....#......#  ###+##.....#.###  #..........#.#  #.†........#.#  Pcgg& W#......#.....#  .### Pcgg` { #.#. .#. ..r #.. #..#  Pcgg`b T#...  #####..#####  S......@...#  ######..###.#  ........#.#.#  ....#......#  ###+##.....#.###  #..........#.#  #.†........#.#  #......#.....#  .### Pcgg_i Pcggi Pcggq PcggAy d _There are monsters nearby!Qcgg&Qcgg)Fire/throw/use which item? ([*] to toss any item) Missiles (go to first with ()  n - 12 poisoned darts Wands (go to first with /)b - a wand of flame (15) (quivered)  c - a wand of charming (15)  d - a wand of iceblast (5)RcggRcgg4  ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================..r  Magic: 2/2========================#.*  AC: 4Str: 14#.*#RcggB  EV: 11Int: 11#..*  SH: 0Dex: 11#####.*#####  XL:  2 Next: 79% Place: Dungeon:2S......@...#  Noise: ---------  Time: 991.9 (0.0)######..###.#  e) +0 mace........#.#.#  Zap: wand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (asleep)Rcgg#.†........#.#  r   rat (asleep)#......#.....# #..........### _n - 12 poisoned darts (gained 6) Rcgg,_A rat and an adder come into view. _There are monsters nearby!Throw: 12 darts (poison)Press: ? - help, Shift-Dir - straight line, f - ratAim: a rat (asleep, 98% to hit)Scgg+w k r..Scgg .#..*..*Tcggs# #...  You can't see that place.Tcggh  #*****Tcgg#S*, f - adderAim: an adder (asleep, 98% to hit)Tcgg   ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================..r  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#...  SH: 0Dex: 11Tcgg #####..#####  XL:  2 Next: 79% Place: Dungeon:2S((((((@...#  Noise: ---------  Time: 991.9 (0.0)######..###.#  e) +0 mace........#.#.#  Zap: wand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.#  r   rat (asleep)#......#.....# #..........### _There are monsters nearby!Throw: 12 darts (poison)Press: ? - help, Shift-Dir - straight line, f - adderAim: an adder (asleep, 98% to hit)  You throw a poiTcgg* Jsoned dart. The poisoned dart hits the adder.  The adder is poisoned.TcggM Q  Throw: 12 darts (poison)  Press: ? - help, Shift-Dir - straight line, f - adder  Aim: an adder (asleep, 98% to hit)  You throw a poisoned dart. The poisoned dart hits the adder.  TcggN 6The adder is poisoned.  The adder hisses angrily.TcggN TcggO Tcgg.W .(.S....TcggW 5===2.9 (1Tcgg^ Tcgg_ Tcggi /  --more--VcggL. _The rat squeaks loudly.VcggVcgg%Vcgg(Vcgg'*Vcgg{X  ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================...  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#...  SH: 0Dex: 11#####..#####  XL:  2 Next: 79% Place: Dungeon:2(.S....@...#  Noise: ===------  Time: 992.9 (0.0)######..###.#Vcgg_}6  e) +0 mace........#.#.#  Zap: wand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.# #......#.....# #..........### Throw: 11 darts (poison)Press: ? - help, Shift-Dir - straight line, p - adderYou can't see that place.  [the floor.]  You can't see that place.  Okay, then.Vcgg~VcggVcgg. _WcgguWcggvWcgg|WcggF _Unknown command.Wcgg] Wcgg:e Wcgg l ;Wcgg#p Wcgg(r F _Unknown command.XcggUXcgg7XFire/throw/use which item? ([*] to toss any item) XcggX`Missiles (go to first with ()  n - 11 poisoned darts Wands (go to first with /)b - a wand of flame (15) (quivered)  c - a wand of charming (15)  d - a wand of iceblast (5)Ycgg-Ycgg  ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================...  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#...  SH: 0Dex: 11#####..#####  XL:  2 Next: 79% Place: Dungeon:2(.S****@...#  Noise: ===------  Time: 992.9 (0.0)######..###.#  e) +0 mace........#.#.# Ycggk Zap: wand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.# #......#.....# #..........### _Okay, then. _Unknown command. _Unknown command.Throw: 11 darts (poison)Press: ? - help, Shift-Dir - straight line, f - adderAim: an adder (lightly wounded, poisoned, 25% to hit)Ycgg!   ssays the CharlatanYcgg, #.#.  Draconian.#.  Health: 23/23 ========================...  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#...  SH: 0Dex: 11#####..#####  XL:  2 Next: 79% Place: Dungeon:2(((((((@...#  Noise: ===------  Time: 992.9 (0.0)######..###.#  e) +0 mace........#.#.#  Zap: wand of flame (15)....#......#Ycgg[  ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.# #......#.....# #..........### _Unknown command.Throw: 11 darts (poison)Press: ? - help, Shift-Dir - straight line, f - adderAim: an adder (lightly wounded, poisoned, 25% to hit)  You throw a poisoned dart.  The poisoned dart barely misses the adder.Ycggq Ycggr Ycgg%z 0r..S... r   rat---3.9 (1 _Ycggz Ycgg ZcggE:---Zcgg8NZcggQZcggSZcgg  ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================...  Magic: 2/2========================#..  AC: 4Str: 14#.r#  EV: 11Int: 11#...  SH: 0Dex: 11#####..#####  XL:  2 Next: 79% Place: Dungeon:2(((((((@...#  Noise: ---------  Time: 993.9 (0.0)######..###.#  e) +0 mace........#.#.#  Zap: Zcgg%W[40mwand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.#  r   rat#......#.....# #..........### _The poisoned dart barely misses the adder.Throw: 10 darts (poison)Press: ? - help, Shift-Dir - straight line, f/p - adderAim: an adder (moderately wounded, poisoned, 25% to hit)  You throw a poisoned dart.  The poisoned dart barely misses the adder.Zcgg4 Zcgg Zcgg .r...S..Zcgg 24.9 (1 _Zcgg Zcgg [cgg8%[cgg;0[cgg3[cgg5[cggw  ssays the Charlatan#.#.  Draconian.#.  Health: 23/23 ========================...  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#..r  SH: 0Dex: 11#####..#####  XL:  2 Next: 79% Place: Dungeon:2(((((((@...#  Noise: ---------  Time: 994.9 (0.0)######..###.#  e) +0 mace........#.#.#  Zap: [39[cgg ya;49mwand of flame (15)....#......# ###+##.....#.### #..........#.#  S   adder (poisoned)#.†........#.#  r   rat#......#.....# #..........### _The poisoned dart barely misses the adder.Throw: 9 darts (poison)Press: ? - help, Shift-Dir - straight line, f/p - adderAim: an adder (moderately wounded, poisoned, 25% to hit)  You throw a poisoned dart.  The poisoned dart closely misses the adder.[cgg[cgg[cgg[cgg`.r.....S[cggM25.9 (1 _[cgg [cgg2[cggm  You barely miss the adder.The adder is heavily wounded.1---=[cggp7.2 (1.3[cgg[cgg _The rat bites you. The adder barely misses you. The rat closely misses you.\cgg̞7  You hit the adder.\cgg †r   rat  You kill the adder!\cggݩ\cgg  ssays the Charlatan#.#.  Draconian.#.  Health: 22/24 ======================--...  Magic: 2/2========================#..  AC: 4Str: 14#..#  EV: 11Int: 11#...  SH: 0Dex: 11\cgg˰#####.r#####  XL:  2 Next: 124% Place: Dungeon:2(.....†@...#  Noise: =--------  Time: 998.5 (1.3)######..###.#  e) +0 mace........#.#.#  Zap: wand of flame (15)....#......# ###+##.....#.### #..........#.#  r   rat#.†........#.# #......#.....# #..........### \cgg`_The poisoned dart closely misses the adder.You barely miss the adder.The adder is heavily wounded. _The rat bites you. The adder barely misses you. The rat closely misses you.You hit the adder.  You kill the adder!\cggղ _The rat bites you but does no damage.  You have reached level 3!\cggc/  --more--\cggl  Your experience leads to an increase in your attributes!Increase (S)trength, (I)ntelligence, or (D)exterity? ]cgg -7/29=3/3563% ]cgg3]cgg6 _You feel stronger. x2; Your scales feel tougher.^cgg[(>9.8^cgg92 _You barely miss the rat. The rat barely misses you.^cgg v4---1001.1 (1.3) ^cgg&^cggt) _You closely miss the rat. The rat closely misses you. The rat bites you.^cggw 6  You sock the rat!^cgg i.^cgg j5=--42.4^cgg ^cgg@ G _You kill the rat!^cgg# 4^cggx ^cgg H _No target in view!_cgg=_cgg>_cggLC_cggEH _No target in view!_cgg4_cgg*&^ _No target in view!_cgg 3_cgg_cggI_cgg0| __cgg _cgg_cgg_cggͭ_cggh6==_cggw_cgg,_cgg_cgg,_cggP_cgg,_cgg_cgg2_cggIw7==_cgg,_cggd_cgg_cggo_cgg_cggտ,_cgg`_cggZ_cgga8==_cgga_cggE,_cgg _cgg,_cggj_cgg ,_cgg_cggU_cgg9=_cgg_cggc_cggD9=_cgg_cgg_cgg,&  #.#..  .#..  ... ###  #.. .<#  #..#..  #.... #..##### _cgg.(.....@....# -19.4 (17.0) ######..###.#  ........#.#.#  ....#......#  ###+##.....#.###  #..........#.#  #.†........#.#  #......#.....#  #..###_cggq _cgg)_cggG-20.4 (18_cgg&_cgg2 _Found a stone staircase leading up. _You see here an adder corpse._cgg _cgg_cgg_cgg_cgg(_cgg| __cgg,_cgg_cgg%9=_cgg_cgg_cgg ,_cggf",_cgg#,_cggt#_cgg#_cggs$,_cgg$_cggy&,_cgg&_cgg+(E _n - 12 poisoned darts (gained 4)_cgg(3_cgg0)_cgg)_cgg*,_cgg*_cggE+_cgg+,_cgg4,_cgg}-_cgg-,_cgg?._cggp/7 _You open the door._cgg03_cgg0_cgg1@  There is an open door here._cgg2_cgg2 __cggJ3_cgg3_cggJ4,_cgg4_cgg5_cgg[6B_cgg7_cgg7,_cgg8_cgg8_cgg:9,_cgg9_cgg:_cgg:,_cgg;_cgg;_cggj<_cgg<_cgg(=_cgg>_cgg{?,_cgg?_cgg@_cggA_cgg B_cgggB_cgg C_cggC_cggPD_cggD_cggkF_cggzG,_cgg#H_cggI_cggJ,_cggrK_cggvL_cggL,_cggHM_cggM_cgg}N,_cggN_cgg@O_cggO,_cggP_cggP_cggQ,_cgg_Q_cggQ_cggoR,_cggR_cggSS_cggS_cggjT,_cggU_cggV_cgg>W,_cgg}X_cggVY_cggY_cgg Z_cgg[_cgg[_cggY\,_cgg]_cggx^_cgg^_cgg@__cgg`_cggCa_cgga_cggb_cggc_cggd_cgg/e_cgge_cggg_cggh_cggh_cggoi_cgg"k_cggLl,_cggl_cgg6q ##  .#  ###.#   #.@.#   #.###   #.#####   #.....# #.###.#.#...#_cggq #.#...#.#.... ###.### ....### #######.# #....<# #.......# #..#..#_cggbt,58.4 (3_cggt,9.4 (39_cggv_cgg yR _p - a white potion_cgg _cgg 3_cgg _cgg _cgg n_cgg _cgg _cgg _cggi _cgg _cgg@ _cgg _cgg _cggW _cggE _cgg _cgg _cggr _cgg _cgg ,_cggs _cgg _cggV ,_cggH _cgg _cggb ,_cgg" _cgg _cgg` ,_cgg _cggU _cggw ,_cgg _cgg _cgg ,_cgg% _cggN _cgg, #######....##.##.###..#.# ...###.#.####..#)#...#.#.......#.###.@......#70.4 (11#.#####.#.....#.....#.# ...#.###.#.#...#.#.#...#.#....###.###.....##########.# ##....<##.......# #..#..##.####### #.....#_cgg B1.4 (12_cgg _cgg _ _Found a spear.2.4 (13_cgg _cgg>  _cgg$ ]_q - a scroll labelled GYNIAJ MAPLON`cggI`cgg`cgg,`cggX`cggj`cggY`cggh,`cgg`cgg`cgg `cgg`cggX`cgg`cgg,`cgga `cgg{ `cgg ,`cggg `cggj`cggy,`cgg$`cgg`cgg,`cgg`cgg`cgg,`cgg`cgg`cgg`cgg`cgg`cggO`cgg`cggz`cgg. `cgg"`cgg#,`cgg$`cgg(`cggi)`cgg)`cggq*`cggJ,`cgg-`cggN.`cgg3/`cgg1`cgg93,`cgg74`cgg6`cgg*8`cgg8`cggg9`cggQ;`cgg_=,`cggL>`cgg @`cggA,`cgg!C`cggaD`cggbF`cggG`cggRI`cgg?J`cggK,`cggvK`cggjL`cgg M,`cggrM`cgg?N`cggN`cgg6O,`cggXP`cggP`cggDQ`cggQ`cggR`cggR`cggS`cggWS`cgg(T`cggT`cggU`cgg^U`cggU`cggV`cgg1W`cggW`cggW`cggX`cggX`cgg/Y`cggY`cgg[,`cggi[`cgg2\`cgg\,`cgga]`cgg}^`cgg$_`cggv_`cgg_`cgg a`cgg^b`cggb`cgg0c`cggd`cgge`cggf,`cggg`cggnh,`cggh`cggj`cggj,`cgg,k`cggl`cggl`cggl,`cgg~m`cggm`cggzn,`cggHo`cggo`cggXp`cggp`cggvq`cggr`cggsr`cggr`cgg^t`cggzL   ###   #.#  ## ####.#  .># #....#  ... #.##.##  ##.#.#...#  #...@###.#  110.4 (38###### #.######...#  #....# #.# #.###  #.##.#`cggz# #...#  #..#.# #....# ###.#  ###.#.####..#)#####.#   #...#.#.............#   #.###........########   #.#####.#.....#   `cggp~`cgg,1.4 (39`cgg΂`cgg; _Found a stone staircase leading down.`cgg`cgg3`cgg`cgg`cgg`cgg,`cgg`cgg+`cgg`cgg`cggo`cgg`cgg `cgg`cgg`cgg`cgg`cgg`cgg `cggx`cgg9`cgg8`cgg~`cgg`cgg?`cggR  There is a stone staircase leading down here.`cggl`cgg5 _`cgg`cggm,`cgg`cggc`cgg>,`cgg`cgg`cgg,`cgg`cgg`cgg ,`cggq`cgg`cggw ,`cgg `cggG `cgg ,`cggr `cggg `cgg1 B`cgg`cgg,`cgg`cgg`cggo,`cgg `cgg`cgg,`cgg`cgg`cggX`cgg,`cgg2`cgg`cgg`cgg`cgg{`cggw`cgg`cgg`cgg3 7 _You open the door.`cggR!`cgg!`cgg!`cgg#@  There is an open door here.`cggb$`cgg$ _`cgg#%`cgg%`cgg&,`cgg&'`cgg)(`cgg)`cggT)`cgg)`cggM.- ######## #....@.# #......############### +......'.............. #......############### ########  ###### #....# #.##.#`cgg2 38.4 (27  You now have enough gold to buy a scroll of poison on D:1.  You can access your shopping list by pressing '$'.`cggy3,9.4 (28`cggD5`cgg6> _You now have 44 gold pieces (gained 16).`cggL`cggR3`cgg`cgg`cggv`cgg`,`cgg/`cgg,`cgg`cgg`cgg!`cgg`cggנ`cggF`cgg`cgg`cgg`cgg?...##... ########+..$. #......##.....#......###########.....S'@.....'................#......####### ########  `cggP####.. S   adder (asleep) #.# #.. ###.`cggز 43.4 (4.0)  You open the door.  An adder comes into view.`cgg@o.SS`cgg4==4.4 (5`cggG`cggk _The adder hisses angrily. _Found 6 gold pieces.`cggZ  . ..# #... ########  +..$. #......#  #.....#......## ......S@.....'. ......#......## ##### ######## `cgg  . ..# #... ########  +..$. #......#  `cgg_ #.....#......## ......S@.....'. ......#......## ##### ######## `cgga `cgg `cggw `cgg ] _An adder is nearby!acgg"U . ..# #... ########  +..$. #......#  #.....#......## ......S@.....'. ......#......## ##### ######## acggv=acgg/I . ..# #... ########  +..$. #......#  #.....#......## ......S@.....'. ......#......##acggxJ ##### ######## acgg*Kacgg\Jacggg _An adder is nearby! _An adder is nearby!You hit the adder.  The adder is moderately wounded. acggxh+ The adder bites you  You are poisoned.7=====---5.8 (1.4Pois acggmacgg]pT _The adder poisons you! The adder bites you but does no damage.acggmM You are poisoned. _The adder poisons you! The adder bites you but does no damage.  You barely miss the adder.  You feel sick. The adder barely misses you. The adder bites you.re more poisoned.acggn4=======------7.1 (1.3Pois acgg@sacggv, _The adder poisons you!acgg:  You closely miss the adder.The adder is moderately wounded.You feel very sick.acgg; 2----8.4Pois acgg#A acggC U _The adder barely misses you. x2acgg   You hit the adder. Your tail-slap misses the adder.The adder is moderately wounded.20---9.7acgg acgg b _You feel sick. The adder closely misses you.acgg  You miss the adder.The adder is moderately wounded.acggm18----51.0acgg^acggn _You feel sick. The adder misses you. The adder completely misses you.bcggH8  You sock the adder!bcgg2 'You kill the adder!bcggzT--39=2.3bcggIbcggɵ$ _You feel sick.bcgggbcggbcggbcggH _No target in view!bcgg4bcgg;bcggεH _No target in view!bcgg bcgg! bcgg" bcgg$ bcggf( P7bcgg) 3 _You feel sick.bcgg) j6-bcgg+ _You feel sick. _No target in view! _No target in view! _You feel sick. _You feel sick.  bcgg , h5-- bcgg`, bcgg- _You are no longer poisoned.6=bcgg. bcgg. ,bcgg / bcgg0 bcgg/1 bcgg1 bcgg2 bcggF3 bcgg3 bcgg_5 bcgg5 ^7==bcggk6 bcgg8 bcgg^8 bcgg8 bcgg{: bcgg: bcgg; bcgg; ,bcggA =8bcggA bcggjB bcggB bcgg#D bcggD bcgg!E bcggF bcggG bcggG bcggLH bcggH S9=bcggH bcggI ,bcggJ bcggJ ,bcggK bcggK bcgg L bcggTL bcgg4N u20==bcggIO bcgg;P ,bcggP bcgg3R ,bcggR bcggS ,bcggcT bcggQV bcggV k21==bcggY bcgg?[ ,bcgga\ bcgg] ,bcgg^ bcgg` ,bcgga bcggc ;2bcggc E==bcgg#d bcgge ,bcgg5f bcggg bcgg;h bcggl 3==bcggsm bcggCo bcggo bcggIp bcggq ,bcggr bcgg&t bcggt bcgg%u bcgg\v bcggv 9=bcgg{w bcggy bcggy %4bcggWz bcgg%{ bcgg{ bcgg| bcggJ} bcgg} bcgg~ bcggy bcgg bcgg[ bcgg{ bcgg K5=bcgg bcgg bcggI bcggЄ bcgg bcggs bcgg bcgg bcgg} bcgg bcgg= bcggȊ h6==bcggD bcgg bcgg bcggύ bcgg@ bcgg bcgg% bcgg ,bcgg bcgg bcgg h7==bcggԔ bcggL ,bcgg bcggf bcgg bcggJ bcgg bcgg bcgg_ bcgg bcgg h8==bcggF bcgg ,bcggo bcggϡ ,bcgg bcgg ,bcgg̤ bcgg bcggڦ h9==bcgg) bcgg bcgg ,bcggc bcggծ V  There is an open door, spattered with blood here.bcgg5 bcgg  _bcgg bcgg bcggZ ,bcgg! bcgg bcgg bcggG 9=bcgg bcgg ,bcgg bcgg- L _You now have 50 gold pieces (gained 6).bcgg` bcggɿ bcgg4 bcgg bcgg bcgg bcggI bcggA bcggT bcgg bcgg bcgg bcgg bcgg bcgg< bcggX bcgg ,bcgg bcgg bcgg bcggk ,bcgg^ bcggc bcgg ,bcgg8 bcggH ,bcgg bcgg bcgg ,bcgg bcgg   ######  #.@..# --224.3 (72.0) #'##.##  #. #..######. ##.....########.∩ +.....#......##. ##.....#......###. +......'......'.bcgg #+ #......#......## ############### _You open the door.bcgg O _Found Erey's Weapon Shop.bcgg bcggF 3bcgg| f _bcggy   There is an open door here.bcggt K _bcgg BbcggI bcgg bcggߖ bcggi ,bcgg bcgg` Welcome to Erey's Weapon Shop! What would you like to do?  a -  781 gold the +9 halberd of Wu Jian's Indignation {antimagic, rElec}  b -  906 gold the +11 hand axe of Ahamyub {venom, *Corrode rElec rF+ Dex+4}c -  594 gold 6 silver javelins  d -  44 gold a +0 scimitar  e -  16 gold a +0 sling  f -  16 gold a +0 sling  g -  121 gold a +0 vampiric spearh -  3 gold 3 stones  i -  7 gold 7 stones You have 50 gold pieces. [Esc] exit[!] buy|examine itemsbcgg. R[a-i] mark item for purchase [/] sort (type)[A-I] put item on shopping listgcgg b $  You are short 856 gold pieces for the purchase.[Enter] buy shopping listkcggkcgg\kcggssays the CharlatanDraconianHealth: 29/29 ========================######Magic: 3/3========================#....#AC: 5Str: 16#'##.##EV: 11Int: 11#.##..#####SH: 0Dex: 11kcgg`###.###.....######## XL:  3 Next: 39% Place: Dungeon:2+..@..+.....#......# Noise: ---------  Time: 1229.3 (5.0)###.###.....#......# e) +0 mace#.#+......'......' Zap: wand of flame (15)#+##......#......################ _There is an open door, spattered with blood here. _You now have 50 gold pieces (gained 6). _You open the door. _Found Erey's Weapon Shop. _There is an open door here.  There is an entrance to Erey's Weapon Shop here.kcggkcgghkcggp _You now have 50 gold pieces (gained 6).open the door. _Found Erey's Weapon Shop. _kcgg?There is an open door here.  entrance to Erey's Weapon Shop here. _You can access your shopping list by pressing '$'.kcggikcggjkcggmkcggpF _Unknown command.kcgg a  ssays the Charlatan  Draconian  Health: 29/29 ======================== ######  Magic: 3/3======================== #....#  AC: 5Str: 16 #'##.##  EV: 11Int: 11 #.##..#####  SH: 0Dex: 11 ###.###.....######## XL:  3 Next: 39% Place: Dungeon:2 kcgg 7+..@..+.....#......# Noise: ---------  Time: 1229.3 (0.0) ###.###.....#......# e) +0 mace #.#+......'......' Zap: wand of flame (15) #+##......#......# ###############         _You can access your shopping list by pressing '$'. _Unknown command.Aiming: Throw FlamePress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - youlcgg8ssays the CharlatanDraconianHealth: 29/29 ========================######Magic: 3/3========================#....#AC: 5Str: 16#'##.##EV: 11Int: 11#.##..#####SH: 0Dex: 11###.###.....######## XL:  3 Next: 39% Place: Dungeon:2lcggJ+..@..+.....#......# Noise: ---------  Time: 1229.3 (0.0)###.###.....#......# e) +0 mace#.#+......'......' Zap: wand of flame (15)#+##......#......################ _You can access your shopping list by pressing '$'. _Unknown command.Aiming: Throw FlamePress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - youOkay, then.lcgg"lcggZ. _lcggalcggzlcgglcggUF _Unknown command.lcggk X[?25h[?0c  Search for what [? for help]? ncgg% [?25l[?1cncggncgg2 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=] Results at your position ([,] to cycle)  a - [right here] the +11 hand axe of Ahamyub {venom, *Corrode rElec rF+ Dex+4} ncggResults elsewhere ([,] to cycle)  b - [D:2] a +0 hand axeocgg Level 2 of the Dungeon <<>>^∩∩(Press ? for help) #..#.# #....# ###.#  ###.#.####..#)#####.#  #...#.#.............#    #.###........######## #.#ocggB#.#####.#.....##.#######.....#.#.....##.#....##.###.#.#...#.###.#....# #.#...#.#......##.#....+  ########.###.....#####.#....### #...########.# ###....<#########........# #...##.......# #..#..##...).....[...#.# #...##.####### #.....#########.######.##.##.####...##....#########..######.............#†........∩....##....'.........†....##.######....#.####.##.###....###...#########..###.##.......##..#.###.....# #....#####...#  ........#.#.##....##.###........#### ##.#....######  ....#......##...............#^## #.#....####+##.....#.####.......######..# #.#....##..........#.#ocgg##....#### #..#+#### #......##.†........#.##.......# #.......# ####'#####......#.....##.......#######.......# #.....###..........####.......#.............# #......######.......##.#ocgg ocgg ocgg _ssays the CharlatanDraconianHealth: 29/29 ========================Magic: 3/3========================AC: 5Str: 16EV: 11Int: 11SH: 0Dex: 11ocgg HXL:  3 Next: 39% Place: Dungeon:2Time:Aiming: Throw FlamePress: ? - help, Q - select action, (/) - cycleShift-Dir - straight line, f - you _Okay, then. _Unknown command.Search for what [? for help]? axeocgg 4ocgg ocgg ocgg ocgg % _ocgg ocggg ocggD ,ocgg ocgg ocgg ocgg ,ocgg 7 _You open the door.ocggE 4ocgg ocggi @  There is an open door here.ocgg3 ocgg _ocggv ocgg\ ocgg) ,ocgg ocggA ocgg ocgg ocgg ocgg ocgg0 ,ocgg  ocgg ocgg ,ocgg ocgg] ocgg " ,ocgg" ocgg:* V  There is an open door, spattered with blood here.ocgg1, ocgg, _ocggm- ocgg3 Bocggj4 ocggM9 ocgg; ocgg; ,ocggu@ ocggA BocggD ,ocgg~E ,ocggH ocggH BocggL ocggM ocgg`N ocggN ocgg"T @  There is an open door here.ocggU ocggV _ocggV ocgg[ ocgg] ocgg] ocgg] ocggb ocggd ocggd ,ocggi ocgg&k ocggNl ,ocggq ocggr Bocggx ocgggy ,ocggz ocgg ocggR ,ocggۀ ocggI ocggc ,ocgg؆ ocgg@ ocggK ocggԌ ocggC ocggȑ ocgg ocgg ocgg> ocgg ocgg ,ocggD ocggp ocggc ocgg ,ocgg Xocggw ocggQ ocggϫ ocgg ocggװ ocggp ,ocgg) ocgg ocgg ocgg ,ocgg ocgg= ocggϿ ocggx ocgg ocgg: ocgg ocgg ocgg ocgg ocgg ,ocggS ocgg* ocgg ocgg ocgg Bocgg ocgg ocgg ,ocgg ocgg ocgg% ocgg ocgg ocgg" ocgg ocgg ocggy ocggK Xocgg_ ocgg ,ocgg` ocggA ocgg3 ocgg ocgg ocgg  ocgg ,ocgg ocgg" ocgg$ ,ocgg& ocgg, ocgg1. ,ocggn/ ocgg_4 ocgg6 ,ocggX7 ocgg; ocgg= ,ocggN> ocggB ocggOD ocggE ,ocggI ocggK ,ocgggM ocgg4Q ocggR ,ocggS ocggW ocggY ocggZ ocgg`] ocgg4` ocgga ,ocggec ocggg ocgg>j ,ocggj ocgglo ocgg2q ,ocgg\r ocggv ocggy ,ocggJ{ ocgg ocgg ,ocgg~ ocgg ocgg< ,ocgg ocgg| ocgg ,ocgg ocgg ocgg ,ocgg ocgg ocgg۟ ,ocgg ocgg; ocgg> ocggק ocgg> ocgg' ocgg: ,ocgg ocgg ocgg ,ocgg ocgg ocgg ,ocgg ocgg ocggK ,ocggx ocgg ocgg ,ocgg ocggC U  Things that are here:  a +0 club; 5 stonesocgg[ ocgg _ocgg ocgg ocgg? Bocgg ocggy ,ocggv ocgg ocggr ,ocggV ocgg ocgg ,ocgg ocgg ocgg ,ocgg ocgg/ ocggY ocgg ocgg ocgg ocgg ocgg ocggt ocgg  ocgg ocggM ocgg ocgg ocggb ocgg ocgg ocgg8 ocggB BocggM ocggy ,ocgg ocgg ocgg ocggE ocgg ocggC ocgg! Bocgg$ ocgg& ,ocgg7' ocgg) ocgg%+ ,ocgg+ ocgg. ocgg/ ocgg80 ocgg0 ocgg3 ocgge5 ,ocgg5 ocgg8 ocgg9 ocggo: ocgg: ocgg> @  There is an open door here.ocgg@ ocggWA _ocggA ocggG XocggEJ ocggK ocggL ocggcL ocggO ocggP ,ocggQ ocggaT ocgg U ocggU ,ocgg(W ocgg X ,ocggX ocggOZ ocgg[ ,ocgg\ ocgg a b  There is an entrance to Huits's Antique Armour Boutique here.ocggCc ocggc _ocggd ocggh ocggj ,ocggLl ocgg'o ocggrq ,ocggas ocggv ocgg2x ocggx ocgg~y ocgg,| ocgg~ ,ocgg ocggĂ ocgg ocggZ ocggɆ ocgg: ocgg ,ocgg< ocggǓ ocgg ,ocgg ocgg1 \  You see here a +0 robe.ocggN ocgg _ocggW ocgg ocgg ,ocggH ocgg ocggj ocgg߫ ocgg ocggR ocgg ,ocgg- ocgg ocggR ,ocgg ocgg3 ocggU ,ocggh ocgg/ 6#.##.#######.#....##.#....##.#....+ ###.#....### #.########........# #.#...@.....[...#.# #. Noise: --------- 1337.3 (108.0)ocgg ########.######.##.##.####. e) +0 mace#.............#÷........∩.. Zap: wand of flame (15)#.######....#.####.##.###..#.......##..#.###.....# #..#....##.###........#### ##. #...............#^## #. #.......######..#.#. ##....#### #..#+#### #.ocgg0 E ocgg} ocgg ocgg Q _You see here a +0 hand axe.pcggpcgg08.0) pcggpcgg' _r - a +0 hand axepcggi pcggl Wield which item (- for none)?- - Unarmed Hand Weapons (go to first with ))  e - a +0 mace (weapon)pcggl a - a +0 club  r - a +0 hand axe [*] show all[?] describe selected [!] equip|wield|put on[tab] equip|unequip qcgg qcgg qcgg  ssays the Charlatan#.#Draconian#.######Health: 29/29 ========================#.#....#Magic: 3/3========================#.#....#AC: 5Str: 16#.#....+ ## EV: 11Int: 11#.#....### #. SH: 0Dex: 11qcgg ########........# #. XL:  3 Next: 39% Place: Dungeon:2#...@.....[...#.# #. Noise: ---------  Time: 1338.3 (0.0)########.######.##.##.####. e) +0 mace#.............#÷........∩.. Zap: wand of flame (15)#.######....#.####.##.###..#.......##..#.###.....# #..#....##.###........#### ##. #...............#^## #. #.......######..#.#. ##....#### #..#+#### #.  _a +0 club; 5 stones _There is an open door here. qcgg _There is an entrance to Huits's Antique Armour Boutique here. _You see here a +0 robe. _You see here a +0 hand axe. _r - a +0 hand axeqcgg& qcggY' u8 (0.5r) +0 hand axeqcgg(. qcgg0 0 _r - a +0 hand axe (weapon)rcggE rcggF rcggtL rcggN F _Unknown command.rcgg rcgg   Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting1.7   1.7  +1   i - Spellcasting   0.0   1.2  -1  rcggk          b * Maces & Flails   1.7   2.0   0       c - Axes   0.9   1.0   0   j + Evocations3.2   4.0   0   d - Staves   0.9   1.0   0       e - Unarmed Combat   0.0   1.0   0       f - Throwing   0.0   1.2  -1             rcgg~ 4[40m         g + Dodging2.3   3.6  -1      h + Stealth1.4   2.0   0                                      rcgg 7                The relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetstcggo b - Maces & Flails   1.7ucggXV{ c + Axes   0.9ucggj9*vcggvcggvcgg&%$ssays the Charlatan#.#Draconian#.######Health: 29/29 ========================#.#....#Magic: 3/3========================#.#....#AC: 5Str: 16vcgg &B#.#....+ ## EV: 11Int: 11#.#....### #. SH: 0Dex: 11########........# #. XL:  3 Next: 39% Place: Dungeon:2#...@.....[...#.# #. Noise: ---------  Time: 1338.8 (0.0)########.######.##.##.####. r) +0 hand axe#.............#÷........∩.. Zap: wand of flame (15)#.######....#.####.##.###..#.......##..#.###.....# #..#....##.###........#### ##. #...............#^## #. #.......######..#.#. vcgg '##....#### #..#+#### #.  _There is an entrance to Huits's Antique Armour Boutique here. _You see here a +0 robe. _You see here a +0 hand axe. _r - a +0 hand axe _r - a +0 hand axe (weapon) _Unknown command.vcgg;-vcgg-vcgg?3vcgg4vcggvcgg Wield which item (- for none)?- - Unarmed vcgge!_Hand Weapons (go to first with ))  r - a +0 hand axe (weapon)a - a +0 club  e - a +0 mace [*] show all[?] describe selected [!] equip|wield|put on[tab] equip|unequip wcgg:$wcggt+wcgg 3$ssays the Charlatan#.#Draconian#.######Health: 29/29 ========================#.#....#Magic: 3/3========================#.#....#AC: 5Str: 16wcgg3j#.#....+ ## EV: 11Int: 11#.#....### #. SH: 0Dex: 11########........# #. XL:  3 Next: 39% Place: Dungeon:2#...@.....[...#.# #. Noise: ---------  Time: 1338.8 (0.0)########.######.##.##.####. r) +0 hand axe#.............#÷........∩.. Zap: wand of flame (15)#.######....#.####.##.###..#.......##..#.###.....# #..#....##.###........#### ##. wcgg4#...............#^## #. #.......######..#.#. ##....#### #..#+#### #.  _There is an entrance to Huits's Antique Armour Boutique here. _You see here a +0 robe. _You see here a +0 hand axe. _r - a +0 hand axe _r - a +0 hand axe (weapon) _Unknown command.wcgg;P  Okay, then.wcgg<wcggCwcggN. _wcgg=wcgg>wcggַwcggwcggdwcggpP _wcggwcggwcgglwcggwcgg!wcggwcggXwcggDwcggLwcggwcgg^wcggwcgg>,wcggIwcggwcgg,wcggwcgg}wcgg9wcggwcgg8wcggwcgg#>. #.# wcgg#.# #.# #.##.# #.######  #@#....# 45.8 (7 #.#....#  #.#....+ #####  #.#....### #...# ########........# #...# #.........[...#.# #...#########.######.##.##.####...#wcgg!#......#÷........∩....##.######....#.####.##.###....#wcggW6.8 (8wcgg; _Found a stone staircase leading down.wcggCwcggRead which item? Scrolls  f - a scroll labelled OTYEHISUQO  h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNKk - a scroll of identify  l - a scroll labelled XEGEPP VYMEU  q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selectedycggc ycggCssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#.#SH: 0Dex: 11#.######XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1346.8 (0.0)#.#....#r) +0 hand axeycgg#.#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....# _You see here a +0 hand axe. _r - a +0 hand axe _r - a +0 hand axe (weapon) _Unknown command. _Okay, then. _Found a stone staircase leading down.ycgg~*ycgg.Identify which item? (\ to view known items) Scrolls (select first with ?)  f - a scroll labelled OTYEHISUQO  h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNK  l - a scroll labelled XEGEPP VYMEU  q - a scroll labelled GYNIAJ MAPLON Potions (select first with !)  m - a green potion  o - a bubbling silvery potion  p - a white potion[?] describe selectedzcggE zcggK ssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#.#SH: 0Dex: 11#.######XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1346.8 (0.0)#.#....#r) +0 hand axe#.#....+ ##### Zap: wand of flame (15)#.#....### #...#zcggL ########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....# _You see here a +0 hand axe. _r - a +0 hand axe _r - a +0 hand axe (weapon) _Unknown command. _Okay, then. _Found a stone staircase leading down.zcggW ]  As you read the scroll of identify, it crumbles to dust.zcggX +7.8 (1zcgg] zcgg_ S _m - a potion of lignification{cggv{cgg"3Read which item? Scrolls  f - a scroll labelled OTYEHISUQO  h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNK  l - a scroll labelled XEGEPP VYMEU {cgg q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selected|cggu|cgg|cgg?ssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#.#SH: 0Dex: 11#.######|cgg7XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1347.8 (0.0)#.#....#r) +0 hand axe#.#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....# _r - a +0 hand axe (weapon) _Unknown command. _Okay, then. _Found a stone staircase leading down.  As you read the scroll of identify, it crumbles to dust. _m - a potion of lignification|cggU  #>.#.##.##.##.#§§§§#.##.....##..As you read the scroll labelled OTYEHISUQO, it dissolves into smoke.|cgg +8.8 (1|cgg|cgg- _It was a scroll of fog.|cgg |cgg Read which item? Scrolls  h - a scroll labelled CEOTIOPN COACS  i - a scroll labelled PYNOWNO RYLUNK  l - a scroll labelled XEGEPP VYMEU |cgg  q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selected}cgg]|}cggU}}cggփ}cggssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#§#}cggSH: 0Dex: 11#§######XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1348.8 (0.0)#§#....#r) +0 hand axe#§#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....#}cgga~#.######....#.####.##.###....# _Okay, then. _Found a stone staircase leading down.  As you read the scroll of identify, it crumbles to dust. _m - a potion of lignificationAs you read the scroll labelled OTYEHISUQO, it dissolves into smoke. _It was a scroll of fog.}cgg }cggq As you read the scroll labelled CEOTIOPN COACS, it crumbles to dust.  It is a scroll of amnesia.}cgg/  --more--~cggA ~cggq +9.8 (1~cgg} ~cgg 6 _You feel forgetful for a moment.~cgg>P ~cggJR Read which item? Scrolls  i - a scroll labelled PYNOWNO RYLUNK ~cggS C l - a scroll labelled XEGEPP VYMEU  q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selectedcgg 7ssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#§#SH: 0Dex: 11#§######XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1349.8 (0.0)#§#....#r) +0 hand axe#§#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....# _m - a potion of lignificationcggV<As you read the scroll labelled OTYEHISUQO, it dissolves into smoke. _It was a scroll of fog.  As you read the scroll labelled CEOTIOPN COACS, it crumbles to dust.  It is a scroll of amnesia. _You feel forgetful for a moment.cgg/B §§cgg.......Nothing appears to happen.  As you read the scroll labelled PYNOWNO RYLUNK, it crumbles to dust.cgg,50.8 (1cggcgg0 _It was a scroll of poison.cgg.4cgg3cgg5F _Unknown command.cggQcgg~SRead which item? Scrolls  l - a scroll labelled XEGEPP VYMEU  q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selectedcgg[cggIcgg $ssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#§#SH: 0Dex: 11#§######XL:  3 Next: 39% Place: Dungeon:2#@#....#cggMUNoise: ---------  Time: 1350.8 (0.0)#§#....#r) +0 hand axe#§#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....#It is a scroll of amnesia. _You feel forgetful for a moment.  Nothing appears to happen.  As you read the scroll labelled PYNOWNO RYLUNK, it crumbles to dust. _It was a scroll of poison. _Unknown command.cggd  As you read the scroll labelled XEGEPP VYMEU, it crumbles to dust.  It is a scroll of brand weapon.cgg/  --more--cgg cgg& 5Brand which weapon? Hand Weapons  r - a +0 hand axe (weapon)a - a +0 club  e - a +0 mace[?] describe selectedcgg cgg Wssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#cgg EV: 11Int: 11#§#SH: 0Dex: 11#§######XL:  3 Next: 39% Place: Dungeon:2#@#....#Noise: ---------  Time: 1350.8 (0.0)#§#....#r) +0 hand axe#§#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....#cgg BNothing appears to happen.  As you read the scroll labelled PYNOWNO RYLUNK, it crumbles to dust. _It was a scroll of poison. _Unknown command.As you read the scroll labelled XEGEPP VYMEU, it crumbles to dust.  It is a scroll of brand weapon.cgg   #>. #.# #.# #.# #.# #§# #§######  #@#....#  #§#....#  #§#....+ #####   #...#   #...#  [ #...#        ÷∩....#      Your +0 hand axe crackles with electricity.cggaO/ #>. #.# #.# #.# #.# #§# #§######  #@#....#  #§#....#  #§#....+ #####      [     ÷∩  cggUcggrVc1.8 (1(elec)cggZcgg0]A _r - a +0 hand axe of electrocution (weapon)cggRB cggC sRead which item? Scrolls cggD  q - a scroll labelled GYNIAJ MAPLON [!] read|quaff|evoke[?] describe selectedcggg cgg cgg  $ssays the Charlatan#>.Draconian#.#Health: 29/29 ========================#.#Magic: 3/3========================#.#AC: 5Str: 16#.#EV: 11Int: 11#§#SH: 0Dex: 11#§######XL:  3 Next: 39% Place: Dungeon:2#@#....#cggi {Noise: ---------  Time: 1351.8 (0.0)#§#....#r) +0 hand axe (elec)#§#....+ ##### Zap: wand of flame (15)#.#....### #...#########........# #...##.........[...#.# #...#########.######.##.##.####...##.............#÷........∩....##.######....#.####.##.###....# _It was a scroll of poison. _Unknown command.As you read the scroll labelled XEGEPP VYMEU, it crumbles to dust.  It is a scroll of brand weapon.  Your +0 hand axe crackles with electricity. _r - a +0 hand axe of electrocution (weapon)cggs$  As you read the scroll labelled GYNIAJ MAPLON, it crumbles to dust.2.8 (1Tele cgg'  _You feel strangely unstable. It was a scroll of teleportation.cggYx _Unknown command.cggP@ cggA 4cggD cggmH cgg(L Q _cggO cggPP cggP cggQ cggS ,cgg8T cggU cggVZ #+##....#.#######.##.#cggZ #.##>..  §# §#§######  #§#....# #§#....#cggw[  #§#....+ #### #.#....### # ########........# #cgg^ +5.8 (3cggkf 8######  #....#  #'##.## #.##..############.###.....####...+..∩..'.....#...## ..###.###.....#...#∩.#...#.#+......'...cggg *#J.@..#+##......#...#.# #.......#############.##...#######.##.#. #.#..#.#>.. .. J   endoplasm (asleep)#.# ..l   frilled lizard (asleep)#§# #l# #§#cggys  Your surroundings suddenly seem different.  An endoplasm and a frilled lizard come into view.cggy{ cgg&| 36.8 (4cggW cgg > _Found Oteadey's Antique Weapon Emporium.cgg o       cgg   ##### ...+..∩ ## ..### #∩.#...# #J.@..# #.# #.......# #.##...######  #.##.#. #.#..#. #>.. .. #.# .. #§# #l# #§#cggT7         ##### ...+..∩ ## ..### #∩.#...# #J.@..# #.# #.......# #.##...######  #.##.#. #.#..#. #>.. .. #.# .. #§# #l# #§#cggcggcggcggd _There are monsters nearby!cgg         #####cggY ...+..∩ ## ..### #∩.#...# #J.@..# #.# #.......# #.##...######  #.##.#. #.#..#. #>.. .. #.# .. #§# #l# #§#cggcgg?m         ##### ...+..∩ ## ..### #∩.#...# cggEn#J.@..# #.# #.......# #.##...######  #.##.#. #.#..#. #>.. .. #.# .. #§# #l# #§#cggrcgg{scgg{z _There are monsters nearby!cgg ###### #....# #'##.## #.##..##### #######.###.....#...+..∩..'.....# ##...###.###.....# #∩.#...#.#+......' #J@...#+##......#cgg; #.# #.# #.##...###### #.##.#.# #.#..#.# #>.....# #.#. ... #§#.#l## #§#cgg JJThe endoplasm quivers.=7.8 (1cggcggz@ _The endoplasm hits you but does no damage.cggm  You slash the endoplasm!  Lightning courses through the endoplasm!cgg\  You kill the endoplasm!cgg.l   frilled lizardl..cgg&6429.0 (1.2cggcgg8 _The frilled lizard hisses angrily.cggN ....'##.##.##..############.###.....###...+..∩..'..##...###.###∩.#...#.#+......' #.....#+####.# #.@.....############...###### #.# #.>....cggs #.#. .l.#§#.#.##§# ..cgg cggܭ :l.cgg} 5-600cggIJ cggc cggљ v'##.##.##..############.###.....###...+..∩..'..##...###.####∩.#...#.#+......' #.....#+####.###.......############..@###### #.# #..>....l#.#. ...§#.#.##cgg }#§# ..#§# ##cgg cgg8 :l.cgg @-1cgg cgg cgg;*.##..#####cgg>B#######.###.....###cgg?w...+..∩..'cgg@ ..cgghA]##...###.###cggBo#∩.#...#.#+......'cggB0 #.....#+##cggC#cggH{#.###.......###########...###### #.#@# ..#l>......#.#...#§#.#.###§# .. #######cggWr8-=2cggZcgg\3 _The frilled lizard bites you.cgg 1  You hit the frilled lizard but do no damage.The frilled lizard bites you.7--3.3 (1.3cgg"6cgg7F _The frilled lizard bites you but does no damage.cgg&v  You hit the frilled lizard.  Lightning courses through the frilled lizard!!cgg-F†cgg0^8=44.6cggu5cgg7R _You kill the frilled lizard!cgg 4cggl cgg H _No target in view!cgg cgg cgg cgg  cgg :_No target in view!cggH cggZ 3cgg{cgg: _cgg|,cggcggc,cggcggcgg=h9==cggcggcgg,cggcggm cgg|"cgg#cgg#cgga%cgg|',cgg1(cgg*cgg,cgg,9=cgg#-cgg.cgg0,cgg0cggk8cgg "Welcome to Oteadey's Antique Weapon Emporium! What would you like to do?  a -  60 gold a daggerb -  90 gold a hand axe  c -  240 gold a jewelled maced -  90 gold a mace  e -  210 gold a runed rapier cgg f -  180 gold a glowing spearg -  90 gold a spear  h - 1404 gold the +7 staff of the Meek {protect, meekguard}i -  105 gold a war axe You have 50 gold pieces. [Esc] exit[!] buy|examine items[a-i] mark item for purchase [/] sort (type)[A-I] put item on shopping listcgg c $  You are short 190 gold pieces for the purchase.[Enter] buy shopping listcgg cggssays the Charlatan######Draconian#....#cgg)Health: 29/29 ========================#'##.##Magic: 3/3========================#.##..##### AC: 5Str: 16#######.###.....# EV: 11Int: 11#...+..∩..'.....# SH: 0Dex: 11##...###.###.....# XL:  3 Next: 44% Place: Dungeon:2#@.#...#.#+......' Noise: ---------  Time: 1373.6 (9.0)##.....#+##......# r) +0 hand axe (elec)cgg#.###.......######### Zap: wand of flame (15)#.##...#######.##.#.##.#..#†##>.....##.#.#...#.#.#.##You hit the frilled lizard.  Lightning courses through the frilled lizard!! _You kill the frilled lizard! _No target in view! cggY_No target in view!  There is an entrance to Oteadey's Antique Weapon Emporium here.cggv cggu#cgg% cggf&E Lightning courses through the frilled lizard!! _You kill the frilled lizard! __No target in view!  There is an entrance to Oteadey's Antique Weapon Emporium here. _You can access your shopping list by pressing '$'.cggi cggj cggDn cggp  cggq 8_Unknown command.cgg+ _ _cgg8 ncgg> BcggA  cgg2C d You see here a frilled lizard corpse.cggF cggH 5 _cggEL cgg O cggP cggR cggU cggX cggg cggJ cgg? cgg– cggW cggM cgg cgg cgg cggȤ cgg cgg cgg[ cgg cggٯ cgg cgg% cggm cgg cgg cgg cgg. cgg cgg, G#.###.......###############cgg0 F#.##...###### cgg p#.##.#.# ####### cgg< #.#..#†# #.....# cggg #>.....####.###.# cgg i#.#.#.......#...# cgg U#.#.#.#######.#.# cggs j#§#...#######.### cgg@ w#§######..@...# cgg9 #§# ##.##### cgg A#§#######.cggC ?#§#....##.cgg ?#§#....##<cgg d#§#....+.g #####cgg gg   goblin (asleep)cgg~ A#.#....### #...# cgg7 =#######........# #...# cgg ?.........[...#.# cgg ...#cgg cgg'  cgg& cgg 400.6 (2cgg 7.0)  cgg GA goblin comes into view. It is wielding a +0 club.cgg cggd cgg+ %1.6 (28cgg cgg  cgg cgg -_Found an escape hatch in the ceiling.cggl . . .#   cgg†# #.....#  #>.....####.###.#  #.#.#.......#...#  .#.#  ######.###  #..@...#  #§# ##.#####  #. #. #< .g #####  ## #...#  #...# [ #...# cgg . . .#   †# #.....#  #>.....####.###.#  #.#.#.......#...#  .#.#  ######.###  #..@...#  cgg!#§# ##.#####  #. #. #< .g #####  ##  [ cgg\cggkcggcgg] _A goblin is nearby!cgg+2 #.##...######  #.##.#.# ####### #.#..#†# #.....# #>.....####.###.# #.#.#.......#...# #.#.#.#######.#.# #§#...#######.### #§######......#  #§# ##@#####cgg= #§#######.#  #§#....##.# #§#....##<# #§#....+.g# ##### #.#....#### #...# ########........# #...# #.........[#.# #...# ##.######.##.##.####...#cggcgg 82.6 (1.0) _cgg'cggcgg#.# #######..#†# #.....>.....####.###.#.#.......#..#######.#§#...#######.#######......#  ##.###########@# ....<+.g# #####.#....#### #... ########........# .........[...# ##.######.##.##.### ........#÷........∩.3cggcggcggK= ..#†# #.....>.....####.###.#.#.......#..#######.#§#...#######.#######......#  ##.##########.# ....<+.g# #####.#....#### #... ########........# .........[...# ##.######.##.##.### ........#÷........∩. ##....#.####.##.###cgg5F cgg:G &4cggL cggO cgg ~>.....####.###.#.#.......#..#######.#§#...#######.#######......#  ##.##########.# ....+.g# #####.#....#### #... ########........# .........[...# ##.######.##.##.### ........#÷........∩. ##....#.####.##.### ..##.....# ####cgg u ggThe goblin shouts!cgg"E====5cggcgg _The goblin barely misses you. _There is an escape hatch in the ceiling here.cggcgg:b=---6.9 (1.3cggcgg _You hit the goblin but do no damage. The goblin misses you.cgg7  You hit the goblin.  The goblin is moderately wounded.cgg8I---8.1 (1.2cgg=cgg@W _The goblin closely misses you. x2cgg  You barely miss the goblin.The goblin is moderately wounded.cgg-9.4 (1.3cgg7cggT _The goblin closely misses you.cgg!o  You closely miss the goblin.The goblin is moderately wounded.cggp )10.7cggt cgg"w = _The goblin hits you but does no damage.cgg  You closely miss the goblin.The goblin is moderately wounded.8-2.0cgg$ cgg& 9 _The goblin hits you with a +0 club.cgg  You closely miss the goblin.The goblin is moderately wounded.cggu(3.3cgghcggZ _The goblin barely misses you. The goblin misses you.cgg  You hit the goblin.  The goblin is severely wounded.cgg[9=4.5 (1.2cggcgg= _The goblin hits you but does no damage.cgg"  You closely miss the goblin.The goblin is severely wounded.cggP-5.8 (1.3cggՑcggHT _The goblin closely misses you.cggs  You barely miss the goblin.The goblin is severely wounded.7.1cgg$cgg&{ _The goblin barely misses you. The goblin hits you but does no damage.cggF `  You slash the goblin! Lightning courses through the goblin!cgg 2)cgg L=88.4cgg cgg J _You kill the goblin!cgg" cgg# cgg( cgg+ H _No target in view!cgg4cggcgg/H _No target in view!cggF3cggHcggENcggPcgg1UP _cggPW,cgg6Xcgg[7 _You open the door.cgg^3cgg/_cgg c@  There is an open door here.cgg(ecgge _cggfcggvicggk,cgg'mcggocggq,cggscggoucggwcggxcggycgg{cgg}cggd~cggcggcgg؃cggjcggbcggŇcggcgg,cggucgggcggcgg[cgg cggcgg,cggVcggcggwcggcggŸcggdcgg٢cggjcggcggycggcggScggȧcggЬcggcggcggcggcgg=cggٳcggdcggcgg,cggcggcggcgg"cggcggcggcggcggicgggcgg,cggcggcggcgg(cggcggcgg ,cggcggcgg*Bcgg7 _You open the door.cgg3cggAcgg@  There is an open door here.cggcggF _cggscgg^cggUcggcggcggcggcggcggcggHcggScggcggcggcgg ,cggcggcggBcgg  _You open the door. _There is an open door here. _You open the door. _There is an open cgg: &door here. _You open the door.cgg cggHcgg%cggRcgg%cggcggwcggcggcggcggcgg#cgg1%cgg%cgg&cgg*+cggF-cgg-cgg.cgg2cgg4cgg55cgg?6cgg9cgg*<,cgg<cgg.@cggAcgg5BcggBcggEcggGcgg]HcggHcggKcggdMcggMcgghNcgg QcggRcgg6ScggScggVcgg XcggXcgg2YcggJ[cgg\cgg]cgg]cgg_cgg`cggAacggacggccggdcggoecggbfcgg+hcggTicggicggOjcgg>lcggmcggncggzncggpcggrrcggscggscggucgg3wcggwcggsxcgg;zcgg{cggn|cgge}cgg~cggE,cggVcggcgg[,cggcgg*cgg֊,cggcggcgg,cggƐcggcgg,cggRcgg,cggcggxcggcggcgg cggcggcggʠcggacggѢcggcggcggçcgg[cggcggcggcgg!,cgg|cggԮ,cggwcggcggDZ,cggkcggcgglcgg,cggcggcggcggcggżYou open the door. _There is an open door here. _You open the door. _There is an open door here. _You open the door.  There is a stone staircase leading down here.cggcgg _cgg)cggcggcgge,cggcgg$ #'##.## #......# #.##..## ......# #######.###... .S...# #...+..∩..'... cgg....###...###.###... ...##∩.#...#.#+.... ..###.....#+##.... #.###.......###### #@##...######- #.##.#.# ####### #.#..#†# #.....# #>.....####.###.# #.#.#.......#...# cgg #.#.#.#######.#.# S   ball python (constriction, asleep) #.#...#######.### #.######......# #.# ##.#####cgg085.4 (67.0)cgg6j.SS)cggF-6.4 (68cgg+cgg^ _A ball python comes into view.cgg   #......#  ......#  .....# ∩ .S..# ...##∩ ..# #.# #@#  cggp#.##.#.#   #.#..#†#   #>.  #.#  #.#  #.#  #.#  #.#  cgg1   #......#  ......#  .....# ∩ .S..# ...##∩ ..# #.# #@#  #.##.#.#   #.#..#†#   #>. #.# #.#  #.# #.# #.# cgg4cggcggb _A ball python is nearby!cggdx   #......#  ......#  .....# ∩ .S..# ...##∩ ..# #.# #@#  #.##.#.#   #.#..#†#   #>.  #.#  #.# cggyh #.#  #.#  #.#  cggP A   #......#  ......#  .....# ∩ .S..# ...##∩ ..# #.# #@#  #.##.#.#   #.#..#†#   #>. #.# #.# cgg  #.# #.# #.# cgg cgg cgg cggR b _A ball python is nearby!cgg ....# '##.## # #.##..###.######.####......# #...+..∩..'#...S..###...###.###cgg (#......##∩.#...#.#+#.....#+##....#.......######.##...###### .##.#.# ######.#..#†# #....>.....####.###.#.#.......#...#.#..#...#######.###.######......cggE cgg/ F.Scgg# 87.4 (1.0) _cgg cggN cgg_ ##########....# '##.##  #.##..########.### #...+..∩..'..###...###.###S.##∩.#...#.#+#.....#+##....######.###.......######..###### #.#.# ######.#..#†# #....>.....####.###......#..#....#######.###cgg~   The ball python closely misses you. The ball python grabs you.  The ball python constricts you.The ball python bites you but does no damage.cgg 8- 1 =8Constr cgg cggh _ _The ball python constricts you.cgg)!=  You hit the ball python.cgg_(C.cgg,v9=11 519.7 (1.3cgg\2cgg&4O _You kill the ball python!cggAVcggWcggJ\cgg^H _No target in view!cgg=cggccggcggH _No target in view!cggcgg3cggҢcgg _cggBcgg8cgg?cgg9=cgglcggcggncgg,cggR  There is a stone staircase leading down here.cgg9cgg _cgg>cggDcggk,cggcggcgg,cgg/cgg|cgg,cgglcggcgg,cggAcggcggBcggcgg7,cggcggcgg,cggcggcgg},cggcggcggu,cggcggGcggU,cggcggGcgg5,cggKcgg\  You see here a +0 robe.cgg-cgg _cggcgg1cgg,cggcggcggcgglcggcgg` cggm,cggcggcggA,cgg9cgg5cggcggQcggcggcggtcgg cggp cggR$cgg%cgg&cggj&cgg +b  There is an entrance to Huits's Antique Armour Boutique here.cgg,cggJ- _cggt.cggg1cgg_3,cgg4cggS7cgg8,cggx9cgg<cgg<,cggs=cgg?cgg?cggu@cgg@cggrCcggD,cggEcggGcggI,cgg=JcggyN@  There is an open door here.cgg4PcggP _cgghQcggScggNU,cggUcggXcggY,cggZcgg!]cggu^cgg _cgg_cggacggBccggc,cgg fcggHgcgggcggHhcgg jcggjcggyk,cggvmcgg@ncggncggocggqcggs,cgg!ucggzwcggxcggycgg zcgg|cgg]~cgg~cggcggcgg˃,cggcggccgg,cggacggcgg,cggFcggcgg,cggcgg`cgg,cggcgg"cggcggcggcggcggD,cggcggݛcgg,cggΝcgg}U  Things that are here:  5 stones; a +0 clubcggۡcggd _cggݢcggƣcgg,cggNcggCcgg*,cggcggcgg>cggcggcgg׫cggcggcggjcgg>cgg?# ##############.......# ###........(.....####### ....##..(...###.### ###.#..###### #...# #>..## #.######## #.#<# #  #.#.#.#.#.  #.#......g  #.@...# - #####.#  ..[..# ####.#g   hcggobgoblin (asleep)#<####  550.7 (61.0)  A hobgoblin comes into view..-1.7 (62cggcggZ _Found a stone staircase leading up. The hobgoblin moves out of view.cgg cgg 3cgg cggj cgg3 Bcgg #.......# ........(.....####### ..##..(...###.#####.#..###### #...#.. #>..## #.###?# ## ##### #.#<#.# ..#.#.##.#..>#...@.# 2.7 (1cgg .0)#####.# ... ....# [..# ....#.# ....##<# .....  ### _...##cgg cgg6 gg   hobgoblin_cgg +3.7 (2cgg cgg* ^ _Found a basalt altar of Yredelemnul. Found an escape hatch in the floor.cgg ( (## #...#.. #>..## #.###?# ##  #.#<#.# ..  #.#.#.#.#.#.  #.#...g....>  #...@.# #####.# ...  ....# [..# ....#  ....#  #<# ..... cgg4H ### _...## cgg ( (## #...#..>..## #.###?# ##  #.#<#.# ..  #.#.#.#.#.#.  #.#...g....>  #...@.# #####.# ...  ....# cggX [..# ....# ....#  #<# .....  ### _...## cgg(8_cgg)cgg09_cggR3` _A hobgoblin is nearby!cggQfk.# .(.....#cggg@ ##..(...###.##### .#..###### #...#.. >..## #.###?# ###  #.#<#.#... #.#.#.#.#.#.##.#...g....>##....@# #####.# ....  ......# ..# ###....#.# .....# cggi#<# ...... ### .cgghr5_cgg^s3=4.7 (1cggy9_cggW|V _The hobgoblin barely misses you.cgg l  You hit the hobgoblin.  Lightning courses through the hobgoblin!!cgg6 Z._cgg 555.9 (1.2cgg 9_cgg M _You kill the hobgoblin!cggR 5_cgg cgg# cgg H _No target in view!cgg _cgg ,cgg& ,cgg cggv cgg%cggcggcggcgg,cggcgg> #....#cggs #......#.....# #..........### #.......##.# #############.......# ........(.....####### .##..(...###.########## .#..###### #...#. cgg>..###.###@# ###- #####.#<#.#...#.#.#.#.#.#.# #.#........># cgg>v#.....#...... #####.#....#. .....#.#......# # ..####....#cgg!-9.9 (4.0cgg."!-cgg"%60.9 (5cgg&cgg")2 _f - a scroll of brand weaponcgg cgg   There is an escape hatch in the floor here. _cgg cgg cgg cggY4 ncgg6 i#.#.#.#.#.#.#  #.#........>##  #.....#......####  #####.#....#....#   .......#.#..###   .......#.##.#  ###....#....#  cgg9< D #......#..###   .......@..#   B.._...####  .......  #.....#  ###... ####  B   giant cockroach (asleep)      cggt= 079.9 (19.0)cggC .BB80.9 (20cggG cggK b _A giant cockroach comes into view.cgg} .#  #.#........>##  #.....#......####  #####.#....#....#  .......#.#..###  .......#.##.#  ###....#....#  #......#..###  .......@..#  .B._...####  .......  #.....#  ###... ####cgg3cggA .#  #.#........>##  #.....#......####  #####.#....#....#  .......#.#..###  cgg.......#.##.#  ###....#....#  #......#..###  .......@..#  .B._...####  .......  #.....#  ###... ####cggV8_cggcggǐcggf _A giant cockroach is nearby!cgg}< #.#.#.#.#.#.#  #.#........>##  #.....#......####  #####.#....#....# .#.#..###  .......#.##.#  ###....#....# .#......#..### b.# .B._...#### #.# #.....##  ###...  ####  b   bat (asleep)  cgg2cggcgg/<B.cgg01.9 (1.0) cgg cggV _A bat comes into view.cgg  #.#.#.#.#.#.#  #.#..>##  #.....#......####  #####.#....#....# cgg  ..#.#..### # .......#.##.# # ###....#....# ##.#......#..### #.b...B.@....# ##...._...#### #.#  ##.....##  ###...#  #####    cgg cgg( :.Bcggȵ &2cgge cgg cggkcggcggcggr  You hit the giant cockroach but do no damage.cggi[....bbcgg~5=4.2 (1.3cggcggU _The giant cockroach misses you.cgg7  You hit the giant cockroach.  The giant cockroach is severely wounded.  The bat closely misses you. The giant cockroach bites you.cgg$bcgg. 8-5.5cgg9_cggG _The giant cockroach bites you but does no damage.cggT}The bat closely misses you. The giant cockroach bites you. _The giant cockroach bites you but does no damage.  You barely miss the giant cockroach.Your tail-slap misses the giant cockroach.The giant cockroach is severely wounded.  You hit the bat.cgg_ †_  You kill the bat!cggc576.7 (1.2cggk9_cgg|n\ _The giant cockroach barely misses you.cgg?A  You hit the giant cockroach.cggEq._cggIP-608.0 (1.3cggN9_cgg~QS _You kill the giant cockroach!cgg cgg cgg 9_cgg H _No target in view!cggcggRead which item? Scrolls  f - a scroll of brand weapon cgg[!] read|quaff|evoke[?] describe selectedcgg)Ocgg'ScgglYI#.#.#.#.#.#.#cggY  ssays the Charlatan#.#........>##  Draconian#.....#......####   Health: 28/29 =======================-#####.#....#....#   Magic: 3/3========================........#.#..###   AC: 5Str: 16 #cggZa.......#.##.#  EV: 11Int: 11 ####....#....#  SH: 0Dex: 11 ##.#...†..#..###  XL:  3 Next: 60% Place: Dungeon:2 #.......@....#cgg[  Noise: =--------  Time: 1588.0 (0.0) ##...._...####  r) +0 hand axe (elec)##.......#  Zap: wand of flame (15)##.....## ###...# ##### cgg[]       You hit the bat.  You kill the bat! _The giant cockroach barely misses you.cgg[You hit the giant cockroach. _You kill the giant cockroach! _No target in view!cgg̓cgg Brand which weapon? Hand Weapons  r - a +0 hand axe of electrocution (weapon)a - a +0 club  cgg \e - a +0 mace[?] describe selectedcgg*cggcgg)#.#.#.#.#.#.#  ssays the Charlatan#.#........>##  DraconiancggG#.....#......####   Health: 28/29 =======================-#####.#....#....#   Magic: 3/3========================........#.#..###   AC: 5Str: 16 #.......#.##.#  EV: 11Int: 11 ####....#....#  SH: 0cggDex: 11 ##.#...†..#..###  XL:  3 Next: 60% Place: Dungeon:2 #.......@....#  Noise: =--------  Time: 1588.0 (0.0) ##...._...####  r) +0 hand axe (elec)##.......#  Zap: wand of flame (15)##.....## ###...# #####        You hit the bat.  You kill the bat! _The giant cockroach barely misses you.You hit the giant cockroach. _You kill the giant cockroach! _No target in view!cgg    #.#........>##  #.....#...  #####.#...  ........# # .......#.##.# # ###....#....# # #.#...†..#..### # .......@....# # #...._...####  ##.......#  ##.....##  ###...#  cgg#####  As you read the scroll of brand weapon, it crumbles to dust.  Your +0 hand axe of electrocution drips with poison.cgg/   #.#........>##  #.....#...  #####.#...  ........#  .......#.##.#  ###....#....#  #.#...†..#..###  .......@....#  #...._...####  ##.......#  ##.....##  ###...#  ##### cgg<6cggF7k-9.0 (1venom)cggj9cgg;9 _r - a +0 hand axe of venom (weapon)cgg3cggHcggcgglK9=cgg,cgg,cgg cgg#_  You see here a bat corpse.cgg$cgg% _cgg%cgg['cgg(cgg)cgg)cgg+cgg,cgg[-9=cgg-cgg/cgg0,cgg1cggi2cggn3cgg3cgga4cgg4cgg5cggf6cgg6cgg8cgg9cgg :,cgg6;cgg><cgg<,cggTWk##.....##..(...###.########### #####.#..###### #...#.......# #>..## #.###.#####.# ##### #.#<#.#...#.#  #.#.#.#.#.#.#  #.#........>##  #.....#......## ########.#....#... #@..........#.#..#-9cggY0.0)######### #.##........#.##.# ......[..# #.##.###....#....# ########.# #.##.#...†..#..### ##<# #..............# #### ####...._...#### ###.......###.....#####...#cgg]cgg_E _Done exploring.cggc/ cgg0 3cgg> .....0.0)..†._cgg D [ _Done exploring.cggcgg,3cggO_cgg[ _Done exploring.cgg icggj3cgg9_cgg҈cggՎ~_ _Done exploring.cggcgg 3cgg9_cggcgg9_cggE _Done exploring.cgg" cgg$ Where to? (Tab - D:2 @ (x,y), ? - help)  D - Dungeon cgg4cggY ##.....##..(...###.###########ssays the Charlatan#####.#..###### #...#.......#Draconian#>..###.###.#####.#Health: 29/29 ========================######.#<#.#...#.#Magic: 3/3========================#.#.#.#.#.#.#AC: 5Str: 16#.#........>## EV: 11Int: 11cgg#.....#......## SH: 0Dex: 11########.#....#... XL:  3 Next: 60% Place: Dungeon:2#@..........#.#..# Noise: ---------  Time: 1599.0 (0.0) ########## #.##........#.##.# r) +0 hand axe (venom) ......[..# #.##.###....#....# Zap: wand of flame (15) ########.# #.##.#...†..#..### ##<# #..............# #### ####...._...#### ###.......###.....#####...# _You see here a bat corpse. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring.cggգcggcggԦ: _cgg۫XcggWcgg,cggcgg0cggA,cggcggcggcgg,cggcgg,cggcggcggxcggcgglcggJcgg,cggcggcgg,cggcgg*cggcggcggcggcgg,cggcgg\cgg.cggcggcggcgga,cggWcggcgg,cggcgg3cgg,cggcggcggcggcggfcggcggg,cggJcggcgg.cggcggcgg|cggcggf cgg cgg cgg cgg cgg cggcgg@cggcggcggcggcgg cggcggScggEcggcggcgg= _Done exploringcggt. _ Things that are here:  3 stones; a +0 club; a kobold skeletoncggY cgg  _cggV"cgg>$cgg-&cgg&cgg(cgg$+cgg-cgg-cgg.cgg1cgg3cgg*4cggQ5cgg)7cgg8cgg9,cgg<Y  There is a stone staircase leading down here.cgg=cgg>cgg?$ _cggo@cgg3cggNcggBcggo      ###   ...  #.#  ..#  cgg #.#  .#  #  628.7 (29.7) ###                     _You climb downwards.cggcgg cgga _There is a stone staircase leading up here.cggv cggw 3cggx cgg { cgg | _cgg cgg؁ cgg Bcgg- cgge ,cgg cggv cgg} ,cgg7 cgg cggj ,cgg cggi cgg ,cggc cggǖ cgg ,cgg$ cggs cgg+ ,cgg cgg( cggo       #  #r  #..### #.... #. #.###. #.....# ######.### #......# #.####.# r   quokka (asleep)#.# #<#cgg> a ### cggg 237.7 (9.0)cgg8 -8.7 (10.0) cggT cgg Y _A quokka comes into view.cggy  # #r #..####  #.....#  #. #@#  #.###.#  #.....#  .###  #......#  #.####.#  #.#  #<#  ### cgg # #r #..####  #.....#  #. #@#  cgg#.###.#  #.....#  .###  #......#  #.####.#  #.#  #<#  ### cgg1cggcggcgg ] _A quokka is nearby!cgg     #  #r   #..####  #...@.#  #.###.#  #.###.#  #.....#cggS  ######.###  #......# #.####.#  #.#  #<# cggcgg.rrcgg89.0) _cggcggacgg ..# #.. #.. #..  #..cggZ  #..  #.r####  #..@..#  #.###.#  #.###.#  #.....#  ######.###  #......#  #.####.#  #.#  #<# cggscggP /=40cgg cggS _The quokka barely misses you.cggcgg-1.9 (1.2cggcgg _You barely miss the quokka. The quokka misses you.cggD 8  You closely miss the quokka. You tail-slap the quokka.  The quokka is severely wounded.6---3.1cgga cggي i _The quokka barely misses you. The quokka bites you.cggH  You closely miss the quokka.The quokka is severely wounded.cggI b7=--4.3cggL cggO > _The quokka bites you but does no damage.cggЧ,  (very poisoned)You hit the quokka but do no damage. The quokka is poisoned.  The quokka is severely wounded.The quokka bites you but does no damage.cgg.-5.6 (1.3cgg^cggS _The quokka barely misses you.cgg8  You barely miss the quokka.The quokka is almost dead.cgg>@.cgg?)cggCL=46.9cggAGcggIJ _You kill the quokka!cggcggcggcggͷH _No target in view!cggtcggucggxcgg{H _No target in view!cggEB IcggC h8= _cggQG Xcgg I ncggJ cggJ e=cggK a9=cggWL cggN 1 _HP restored.cggQ cggQ cggHR cggwS cggT ,cggU cgg|V cggEX BcggX cggY cggqZ 9=cggZ cgg6\ cggn^ cgg^ cggB_ cgg` cggb ,cggc cgg/l cgg@m cgg0o cggo cgg/p cgg6q cggs cggs ,cggt cggu ,cggzv cgg/x cggBz Bcggs| cgg .  ....### .......@..######### -64.9 (18.0)......###.......... ..... #..######## .... #..#... #..#.. #..#+ #..#### #.....# #.###.#cggq F-5.9 (19cgg cgg 5 _Found a runed translucent gate.cgg1 cgg 3cgge cgg cggF cggh# ,cgg+* I _The kobold shouts! You hear a shout!cggh/ cgg2 cggu; cgg= cgg> cgg? cggM cgg[ cgg] cgga cgge cggyj cggk cggm cgg{ d _The kobold brigand shouts! The kobold shouts! You hear a shout!cgg6 cgg cgg Icgg cggY 7 _The kobold shouts!cgg cgg cgg` cgg cgg cgg ,cggI cgg cgg Xcgg cgg cgg cgg cgg, ,cgg cgg{ cggh _#..##..<..#.. #######.. #....# #.. #....# #..##....# #..@.....# 74.9 (9.0) #..$###....####### ### ##..........##### ..........###...... ...........# #..#### ...........# #..#cgg _ ...........# #..#...........# #..#..##+++##..# #..#### cgg/ cgg3 -5.9 (10.0) cggU cgg 9 _Found a stone staircase leading up.cggJ_cgg cggL,cgg,cgg,cgglcgg,cggcgg,cggcgg%M _You now have 60 gold pieces (gained 10).cgge3cgg<cggcggh,cggcggb,cggcgghcggcggcggcggCcggB%cgg(&cgg)cgg/4I _The kobold shouts! You hear a shout!cgg?cggRCcggGcggqKcgg4OcggScgg(XcggXcgg3[cggc7 _The kobold shouts!cggjcggmcgg-qcgg#tcggycggycgg|cggXcggcgghcggcggcgg-,cgg|cgg7 _The kobold shouts!cggcggucggcggrcggcggw#.#..##....# #.#........# #...###....####### ###..##..........## ###..........###... #............# #..# #............# #..# #............# #..# #.@..........# #..#cgg;86.9 (11 #...##+++##..# #..# #..##KKKW.##.# #...#..#.#KKK#.#.# #.## #..#⌠.#K#. #. #..#.#.K.# #... K   kobold brigand (missile) #..# .... ######. W   FireSight's ghost .### =[ #...... KKKKKK 6 kobolds (1 wand, 3 missiles) #.####.cggcggcggOcggcgg[cgg KKKK#K?KKKK 74cgg,7.9 (12cggS#cgg)M _Found a leather armour.cgg#3cggU)cgg4cggd;cgg<cgg>=cggBcggCcggIcggHPcggX,cgg[cgg_cgghd,cgg^hcggrcggwcggxcggzcgg}cggcgg1cgg=cggzcgg,cggӑcgg9cgg #............# #. #............# #.. #...##+++##..# #..g #..##KKKW.##.# #.... #..#.#KK.#.#.# #cgg}.... #..#⌠K#.#. #..$... #..#.#.?.# #.......##..# .... ####.......@### =[ #..........#...# #.####### ###..#  #... #### g   hobgoblin (asleep) cgg 93.9 (6.0)  A hobgoblin comes into view.Found 2 gold pieces.cggK .  The hobgoblin shouts!cgg4==4.9 (7cggcggi6 _The hobgoblin moves out of view.cgg _cgg  #.# #....... #...# #...... #...##+++##..# #.g... #..##KKKW.##.# #.... #..#.#KK.#.#.# #... #..#⌠K#.#. #cggT _.$.... #..#.#.?.# #.##..# .... .### =[ #.#...# #.#####..# #.... ####g   hobgoblincgg &0cgg L.gcgg 4--5.9 (1cgg cgg cgg    .......   ....... +++##..#  .......   ...g...   ....... #..#  ..$.... #..#.#.?.#  .......##..# ....  .......@.### =[  .......#...#  ##########..#  #....  #### cggP   .......   ....... +++##..#  .......   ...g...   ....... #..#  ..$.... #..#.#.?.#  .......##..# ....  .......@.### =[  .......#...#  ##########..#  #.... #### cggEcgg9--cgg#cgg)` _A hobgoblin is nearby!cgg   .......   ....... +++##..#  .......   ...g...   ....... #..#  ..$.... #..#.#.?.#  .......##..# ....  .......@.### =[  .......#...#  ##########..#  #....  #### cgg_3cgg4   .......   ....... +++##..#  .......   ...g...   ....... #..#cggR  ..$.... #..#.#.?.#  .......##..# ....  .......@.### =[  .......#...#  ##########..#  #.... #### cgghcggcggcgg  #.# #########.# .##............# .##...##+++##..# .....##..##KKKW.##.# g...##..#.#KK.#.#.# ......##..#⌠K#.#. $....##..#.#.?.# ##..# .... ###...### =[ #..........#.#.############..#....#### _A hobgoblin is nearby!.g6 _cggj #.#. #.##.#########.#.##............#.##...##+++##..#.##..##KKKW.##.#....##..#.#KK.#.#.#...g..##..#⌠K#.#.$..@.##..#.#.?.# ##..# .... ##...### =[ #..........#...##.############..#....cggl5####cggocggy ll   frilled lizard (wandering)The hobgoblin hits you.cggz\8-=7cggcggƇa _A frilled lizard comes into view.cggu g  The frilled lizard hisses angrily.  You slash the hobgoblin!cggZy cgg .l.l   frilled lizardcgg O-79.1 (1.2cgg cggg M _You kill the hobgoblin!cggB k ###. #.... #.##l#########.#.##............#.##...##+++##..#.##..##KKKW.##.#.##..#.#KK.#.#.#......@..##..#⌠K#.#.#....$....##..#.#.?.# ###..# .... ##...### =[ #.........#...###############..# ....cgg !####cggˤ cggd J.lcgg 6-7000cgg cgg cgg ###..## ### # ... # ##.######### #..l......##......... #.##...##+++ #.##..##KKKW.## #.##..#.#KK.#.# #.........##..#⌠K#.#. #....$....##..#.#.?.#  ###..# .... #...### =[ #.........#...#############..#....####cgg,cggJ.lcggL@-1cgg%cgg(cggQ #...###. ###..## ### # ... # ##.######### #.........##......... #...l.....##...##+++ #.##..##KKKW #.##..#.#KK.#. #.........##..#⌠K#.#. #....$....##..#.#.?.# ###..# .... #...### =[ #.........#.#############..#....cgg}cgg\9==2cggDcgg[ _The frilled lizard barely misses you.cggB  You slash the frilled lizard!cggE†cggS593.3 (1.2cggcggR _You kill the frilled lizard!cggj cgg cggb cgg H _No target in view!cgg 4cggI cggT H _No target in view!cgg9i4cggt^ _No target in view!cggcggcggcggcggucgg($ _cgg',cgg,cgg~cggcgggO=cggcggo,cgg#cggL _You now have 62 gold pieces (gained 2).cggi3cgg)cggtcgg,cggcggcgg,cggcgg4cgg6cgg,cggcggcggOr #.#..## .... #.#.cggK S... #...### ... ###..## ...# ### ...## # ...# # ##.#########....... #...##.......- #...†.....##...##++ #.........##..##KKK #.........##..#.#KK #.........##..#⌠K#. #.........##..#.#.? S   adder (wandering) #...##..# ..cgg #...........### =#.........#...#cgg+s11.3 (8.0-2.3 (9cggcggY _An adder comes into view.cgg[R ] ....  S...  ...  ...#  ...##  ...#  ##.####### #.@....... #...†.....++ #......... cggS #......... #......... #.........? #.........##..#  #...........### =  cgg7  ....  S...  ...  ...#  ...##  ...#  ##.####### #.@....... #...†.....++ #......... #......... #......... #.........? #.........##..#  #...........### = cgg cgg cgg cggi  cggL O_An adder is nearby!cgg/ ....  S...  ...  ...#  ...##  ...# cgg02 ##.####### #.@....... #...†.....++ #......... #......... #......... #.........? #.........##..#  #...........### =  cgg ....  S...  ...  ...#  ...##  ...#  ##.####### #.@....... #...†.....++ #......... #......... cgg#......... #.........? #.........##..#  #...........### = cgg‘4cggcgg] _An adder is nearby!cggR.##..... #......S...#...... ##......# ##cgg.......#........# ##@#######.........†..##++...#K...#KK.⌠K#..#.?##..# ....### =cgg#cggY*?S.cggE+23.3 (1 _cgg03cgg5cgg1 #.#..##.. #.#..##..... #.#..##S... #.#.... #...###. ###..## #### #.......@.# #########.######### #.........##...... #...†.....##...##+ #..##..# #..##..#.#K #..##..#⌠K# #..##..#.# #cggx3E##..# .cgg5cgg7cggL@<4cggIcgg2McggzS #.#..#####.# #.#...# #.#.......# #.#..#S...# #.#....# #.. ###..# #### #..........# ##########.######### #.........##..... #...†.....##...## #...##..#cgg]| #.........##..#. #.........##..#⌠K #.##..#.#cgg0cggU.Scgg&5cggcgg cgg  #.<.. .# #.#..#..#####.# #.#...# #.#...# #.#.....# #.#..S...# #.. ### #### #...........# #cggn %##########.######### #.........##.... #...†.....##...# #.........##..# #.........##..#. #.##..#⌠cgg cgg( U.ScggH &6cggV cgg cggcgg5 #.<cggR ..# .#cgg+ #.#cgg [#..#####.#cgg!+ #.#cgg2").#cgg#+ #.#cgg1$).#cggT% #.#.# #.#.# #....S....# ###.##cgg * ###.## #.# ##.## #.........## #...†.....##... #.........##.. #.........##..# #.##..#cgg,cgg0cgg=cgg[?.cgg@ScggAcggLCcggC7cggLcggPcggm #.< ..# .# #.##..#####.# #.#.# #.##.# #.##.# #.##.# ##.# ####.##cggl ####...S.## ##.# ##.## #.........## #...†.....## #.........##.. #.##.. #.##..cgggcgg&W.Scggn&8cggcggcgg..# .# #..###..#####.# #.............# #. #.# #. #.# #. #.# #. #.# ## #.##  #..## #. #...S..# # ############.######### #.........##cgg4 #...†.....## #.........## #.## #.## #.##cggcgg8S..cgg&9cgg9cggOcggr  ..# .# # .###..#####.# # ..# # #.# # #.# # #.# # #.#  #.##  #...S.## # #.# # cgg#.# #.## #...†.....## #.## #.## #.## #.##cggGcgg5S.cgg'20cgghcggcgg H SS  very poisoned)The adder hisses angrily.  You hit the adder. The adder is poisoned.  The adder is moderately wounded.cgg  f7--===1.6 (1.3cgg"" cgg-& ` _The adder bites you. The adder misses you.cgg;  You barely miss the adder.The adder is moderately wounded.cgg]=o8=---2.8 (1.2cggBcggFz _The adder bites you but does no damage. The adder barely misses you.cggV  extremely poisoned)You hit the adder. The adder looks as sick as possible!  The adder is severely wounded.cggH--4.1 (1.3cggcggR _The adder barely misses you.cgglThe adder is severely wounded. _The adder barely misses you.  You barely miss the adder.  The adder is almost dead.  The adder bites you.  You are poisoned.cgg6=====--5.4Pois cggcggT _The adder poisons you! The adder bites you but does no damage.cgg]&  cgg^You closely miss the adder. Your tail-slap misses the adder.The adder is almost dead.You feel sick.cggd8.cgge1cggiq4----946.6 (1.2cggncggqI _You kill the adder!cgg cgg 9--cgg3 cggn H _No target in view!cgg cgg 4cgg cgg ,cgg 3 _You feel sick.cgg &3cgg cgg 3 _You feel sick.cgg8 L2-cgg cgg. 3 _You feel sick.cgg W1--cgg cgg _No target in view! _You feel sick. _You feel sick.  cgg U=-cgg cgg j _You are no longer poisoned.cgg cgg! cggj# ,cggG$ cgg& cggJ' cgg( cggG* cgg* K2=cgg+ cgg. ,cgg. cgg(1 ,cggq2 cgg 4 ,cgg4 cggU7 cgg7 h3==cgg8 cgg0; ,cgg; cggN =4cggLR 5=cggS cgg?T ,cgglZ ncgg[ cgg\ ~6==cgg] cgg_ ,cgg` cggc Bcgg3e ,cgge cgg]g cggg h7==cggh cggj cggYk ,cggm ,cggr ncggas h8==cggt cgg"u cggu cggnv cggw cggx cggJy cggz cgg,{ cgg | cgg5~ cgg~ h9==cgg cgg cgg ,cgg cggT cggM cggщ cggM cggԋ cgg ,cggƎ cgg cggM cgg 9=cggk cgg cgg M.  #.##  ....# ###  g..... ..## .# ......###..#####.# .$.cgg ....#  #...# - #...#  #..........# #........##..........###...........## g   hobgoblin (asleep)#............#############.##### #.......cggP ~ 68.6 (42.0)  A hobgoblin comes into view.cgg F-9.6 (43cgg? cgg + _Found 11 gold pieces.cgg> . #.## ....# ###  g..... ..## .#  ......###..#####.#  .$...............#  #@.........#  #..........#  #..........#  #..........#  #..........## cggV@r #...........##  #............#  #########cggV . #.## ....# ###  g..... ..## .#  ......###..#####.#  .$...............#  #@.........#  #..........#  cgg 1#..........#  #........ #........ #...........##  #........ #########cggcggcgg8cgg2` _A hobgoblin is nearby!cgg+xx##.... ..##.###. .....#. ### g..... ..## .#......###..#####.#..$.....#.....###.#... #..#. #.....# #....cggy  #.... ### #............#############.####cgg{cgg܁d.ggcggȂ970.6 (1.0) _cggcggcggdM ### ..## .. ...####.###..# #.....#.. ### g....# ..## .#.....@###..#####.#cggfD$.....##.....###.##..... #....##.### #.....#! #.. #.. #..## #............#cgglcgg4sH.gcgg%t&1cgg{cgg~W _Found a silvery potion.cggG 6.... ### ..# ..## ... ...# ###.###..###.....#...####.# ..## .##....g.@.###..#####.##...$.##.....###.# #..... #......# #.#### #.......#.! #....#. #.........## #...........##  #.#.g2cgg  You barely miss the hobgoblin. Your tail-slap misses the hobgoblin.=3.8 (1.2cggψcgg _The hobgoblin misses you. The hobgoblin closely misses you.cgg \ cgg]] You closely miss the hobgoblin. Your tail-slap misses the hobgoblin.5.1 (1.3cggodcgggW _The hobgoblin closely misses you.cggb>6.4cgghcggl _You barely miss the hobgoblin. The hobgoblin closely misses you.cgg/s6---7.6 (1.2cggH4cggR6m _You closely miss the hobgoblin. The hobgoblin hits you.cggR  You hit the hobgoblin. The hobgoblin is poisoned.  The hobgoblin is almost dead.cgg E†cggT 088.8cgg cgg M _You kill the hobgoblin!cgg cgg cggq cgg] H _No target in view!cggH4cggNMcgg2PH _No target in view!cgg3cggcggucgg5$ _cggXcggm7=--cggcgg,cggAcgg,cggEcgg cggcggfcggcggh8==cggcgggcggcggcggcggcgg:cggcggcgg'cggQ ~9==cgg cgg cggd,cggcggcgg,cggWcggncgg,cggcgge=cggsM _You now have 73 gold pieces (gained 11).cgg 3cggZ!cgg"cgg'^..#.# ..## .... ...# ###.###..## ##.....#...### #........# ..## #.....†..###..##### #.................. ##.....###......... #@....# #.........-cgg((94.8 (16.0) #.##### #......... .!.. #......... #...(. #......... ........ #......... ...####.# #......... .... .# ##########..... # cgg-cgg.F-5.8 (17cggr1cgg3% _Found 6 stones.cggi3cgg?kcgglcggrXcggu,cgg+vcgg/xcggcz,cgg{cggR ###.###..####.....#...####........# ..## #.....†..###..#### #........... ##.....###........cgg? #.....# #########.##### #.......@...# #######...(.# #.........# #......####.# #....... .# #########....... #....#.#....#cgg18.8 (3.0)cgg9+9.8 (4cggcgg(T _f - a silvery potioncgg Icgg cgg@ cgg% Bcgg/' ,cgg ( cgg+ cgg:. ,cgga/ cgg1 cggf4 cggE5 cgg6 cgg7 cgg~: ,cgg; cgg2< cggW> ,cgg? cggA cgg E ,cggzI cggK cggWM cggM cggN cggO cgg T BcggT cgg6W ,cgg;X cgg[ cggC_ Xcgg` ,cgga cgg e cggZg ,cggh cggj cgg\l ,cggm cgggn cggqp ,cgg0q cggr cggt ,cggu cgg2w cggzy ,cgg:z cggz cggO| ,cgg| cgg~ cgg cggh cgg cgg cgg ,cggÆ cggM cgg ,cgg cggd cgg ,cggp cgg cggT ,cgg cgg cgg4 ,cgg cgg cgg ,cggݠ cgg cgg ,cggܥ cggC cggX ,cgg cgg cggW ,cgg' cggC cggo ,cgg' cgg cgg ,cgg cggU cgg ,cggD cgg cgg cgg[ ,cgg cgg ,cgg cgg cgg ,cgg cgg cgg ,cgg cgg cgg ,cgg` cgg6 cggo ,cgg cgg cgg ,cggk cggV cgg ,cgg4 cgg cgg cgg ,cgg cgg ,cgg> cggp cggj ,cgg cgg? cgg2 ,cggn cgg9 cgg ,cgg cgg cgg ,cgg cgg? cgg4 ,cgg cggX cggO ,cgg cggb cggS ,cgg cggd cggV ,cgg( cgg cgg cggb ,cgg cgg cgg ,cggJ cgg  ,cgg cgg1 cgg? ,cgg cggw cgg ,cgg cgg" cgg ,cgg? cggh cgg[ ,cgg cgg cggS ,cgg cggu cgg" cgg ,cgg7 cggU ,cgg cgg cgg1 ,cgg cggH cgg- ,cgg cggs cgg ,cgg cggH cgg ,cggm cgg cgg ,cgg) cgg cgg ,cggX! cgg! cgg# ,cgge$ cgg % cgg% ,cggq& cgg' cgg( ,cgg( cgg]) cgg* ,cgg*+ cgg+ cggl, cgg- ,cgg- cgg. cgg-/ ,cgg0 cgg3 Bcgg4 cgg36 Bcgg7 cgg8 ,cggX9 cgg}: cgg< ,cgg*= cgg=> cgg@ ,cggA cggNT cggY #.# #.......# #.# #.#####.# #.###.# #...# #...#.# #.### #.#.#.###.# ###.#.#...# #.....###  #####.# #@# #......K.  #########  K   kobold (asleep) cggI` ]883.8 (84.0)4.8 (85cggd cggg _A kobold comes into view. It is wielding a +1 short sword of draining.cggE[ #.# ..#  #.# .# cgg #.###.# #...#  #...#.# #.###  #.#.#.###.#  ###.#.#...#  #.....###  #####.# #@# #......K.  ######### cggPI: #.# ..#  #.# .#  #.###.# #...#  #...#.# #.###  #.#.#.###.#  ###.#.#...#  #.....###  #####.# #@# #......K.  #########  cggQ4cgg@ScggV] _A kobold is nearby!cggد #.# ..#  #.# .#  #.###.# #...#  #...#.# #.###  #.#.#.###.#  ###.#.#...#  #.....###  #####.# #@# #......K.  ######### cggN: #.# ..#  #.# .#  #.###.# #...#  #...#.# #.###  #.#.#.###.#  ###.#.#...#  #.....###  #####.# #@# #......K.  #########  cgg^Jcggg #.# #.#####.# #.###.# #...# #...#.# #.### #.#.#.###.# ###.#.#...#  #.....### #####.#  #.#########.@....K..########## _A kobold is nearby!cgglcgg=ttK.KcggCu:===5.8 (1.0) cggycgg%~( _The kobold shouts!cgg'o#.# #.#####.# #.###.# #...# #...#.# #.### #.#.#.###.# ###.#.#...# cgg6#.....### #####.# #.##..@..K.#cggcgg!3K.cgg'#0---6cgg1(cggO+cgg( x#.# #.#####.# #.###.# #...# #...#.# #.### #.#.#.###.# ###.#.#...# #.....### #####.# #.##...@K.#cgg7 cgg8 P=--7cgg= cgg@ T _The kobold closely misses you.cgge cggg &9.0 (1.2cggj cggm _You barely miss the kobold. The kobold misses you.cgg (very poisoned)You hit the kobold but do no damage. The kobold is poisoned.90.2cggcgg2L _The kobold misses you.cgg48  You hit the kobold.cggZe)cggcggn#.# #.#####.#ssays the Charlatan#.###.# #...#cgg{%Draconian#...#.# #.###Health: 29/29 ========================#.#.#.###.#Magic: 3/3========================###.#.#...#AC: 5Str: 16#.....###EV: 11Int: 11#####.#SH: 0Dex: 11#.##########XL:  3 Next: 100% Place: Dungeon:3#...@)......Noise: =--------  Time: 1891.5 (1.3)############r) +0 hand axe (venom)Zap: wand of flame (15) cgg~    _The kobold shouts! _The kobold closely misses you. _You barely miss the kobold. The kobold misses you.You hit the kobold but do no damage. The kobold is poisoned. _The kobold misses you.You hit the kobold.cgg: _You kill the kobold!You have reached level 4!cgg/ /  --more--cggM36/364/424 0% cggdcgglO _You feel agile.cggIcggcggAo#.# #.#####.# #.###.# #...# #...#.# #.### #.#.#.###.# ###.#.#...# #.....### #####.# #.##....@.#cgge(0.0cggz-2.5 (1 _ _You see here a +1 short sword of draining.cgg cggp cggc cggK cgg cggw P _cggN cgg cgg cggA cgg cggs cgg cgg cgg" cgg# cggp$ cgg% cgg' cggT( cgg) cggs* cgg, cgg- cggc/ cgg)0 cgg1 cgg2 cgg\3 cgg4 cgg6 cgg7 ,cggP9 cgg8; cgg; ,cgg= cgg'? cgg? ,cgg@ cggB ,cggC cggsD cgg\F cggF ,cgg@I cggcggJA,cgg>BcggEcggTHcggIcggIcggLcggO,cggQcggScggKV,cggUWcggYcggT\,cggl]cgg_cggb,cggccggwfcggJicggicgg|jcggumcggEp,cgg]qcggscggv,cggwcggycgg}cgg~cggvcggȁcgg,cgg,cgg,cggcggcgg;cggʐcggwcgg cggk_ You see here a hobgoblin corpse.cggGa _cggQ ##   .. #.   ...#.#.## ...#.#...## .... ...# ###.###..## ##.....#@..### #........#g..## .# #.....†..###..#####.# #...................# ##.....###..........# #.....# #..........#g   goblin (asleep) ##########.##### #..........# .............# #..........# ########...(.## #..........##cggdY65.5 (556.5 (56cggcggs _A goblin comes into view. It is wielding a +0 club.cgg4|<## .. #. ...#.#.### ...#.#...## ........# ###.###..## ##.....#.@.### #..#g..## .# #.....†..###..#####.# #................cgg}5...###.....###..........##.....# #..........# .##### #..........#...cgg†cgg+07.5 (1.0) cgg1cggڍcgg * gg  very poisoned)The helpless goblin fails to defend itself.  You hit the goblin. The goblin is poisoned.  The goblin is moderately wounded.cgg " 5=8.7 (1.2cggh& cggM* @ _The goblin hits you but does no damage. x2cggj/:  You slash the goblin!cggA8D)cgg<t 29.9 _You kill the goblin!cggBcggEi _Your Fighting skill increases to level 2!cggcggcggHcggH _No target in view!cggFcggG3cggJcgg McggP: _cggTBcggUcggWcggZ,cgg\cgg^cgg `,cgg`cggubcggd,cggNecgg#fcggg,cggohcggicggkcggKlcggmcgg^ocggtBcggvcggx,cggycggc{cgg~,cgg~cggcgg?,cggcggcgg5,cgg܆cggcgg3,cggcggWcggԍ,cgg}cggcgg%,cggːcggfcggΒcggr,cgg=cggdcggcggcgg@.. #.#### .....# (....# .....## ##....... #####........ #....@.......-86.9 (17.0) #.###........  #.# #...##...  #.# #...# . #.# #...######.# #...#  .. #.....# #...#  ...#.#.##### #####  ...#.#...##-7.9 (18 _Found 6 stones.cgg cggI cgg cgg׆ cggҊ cgg BcggǑ ,cgg cggt cggN ,cgg cgg cggz ,cgg; cgg cgg cgg cgg cggJ cggA ,cgg cgg Xcggб cgg1 ,cgg= cgg cgg cgg ,cgg: cgg. ,cgg cgg cgg ,cgg" cgg cgg ,cgg cgg cgg' ,cgg' cggG cgg cgg. cgg cgg cgg ,cggB cgg cgg{ cggL cgg cgg cgg) ,cgg cgg cggo ##### #...# #...# ####...#####. #............ ### ########.##...#####?...# ............. ########.########.##.....# ... cgg #(....# ....##.....### ....###......... ..bg..g   goblin (asleep)#####.......... ....###b   bat (asleep)#.............. ....##.###..........cggD [2004.9 (175.9 (18cggN cgg< b _A bat and a goblin come into view.cgggM ##### #...# #...# ###  #.... ### .##...#####?...# ..........@....... .########.#.....  #.....# ... ...  #(....# ....# .  #.. ....#  ##. ..bg..  . ....###  #..... ....#  cggoD ##### #...# #...# ###  #.... ### .##...#####?...# ..........@....... .########.#.....  #.....# ... ...  #(....# ....# . #.. ....# ##. ..bg..  . ....###  #..... ....#  cggM4cgg)Wcgg*[d _There are monsters nearby!cgg######...# ##...# .#####...#####..##.............### #######.##...#####?... ........................ #######.########@#.....  #.....# #...g#(....# .....##.....####.....###............bg.. #####...............###ghobgoblin (asleep) #...................# g   goblin (asleep) cgg#.###...............# b   bat (asleep) #.# #...##.....cggcggcggcgg[b..bcgg06.0) cggicgg\ _A hobgoblin comes into view.cggBcggcggcggعc5-=8.1 (1.2cggcgg _You barely miss the bat. The bat hits you. The bat barely misses you.cgg  You barely miss the bat.The hobgoblin shouts! The goblin shouts!cggy,cgg....b.g.g   goblinb   batcggu6=====9.3cgg=cggpu _The bat hits you but does no damage. The bat barely misses you.cgg5 #####...#.####...#####..............### #######.##...#####?...## ........................ #######.########.#g #.....# #@.......(#.b...#.....####...g.# #........... #####..###..... ghobgoblin###..g   goblin #...##...b   bat .#cggٹ cgg׺ cgg cgg cgg^ cgg  cggX cgg Scgg .cgg gcgg gcggr .cggs S   adder (wandering)g   hobgoblincgg g   goblinb   batThe bat closely misses you.cgg [=---100cgg o _An adder comes into view.cgg  You closely miss the bat.The adder hisses angrily.  You hit the hobgoblin. The hobgoblin is poisoned.cgg_cgg#cgg&  cggBYou hit the goblin but do no damage. The bat hits you but does no damage.  The hobgoblin hits you but does no damage.cggcgg; Srb.Sr   quokka (wandering)g   hobgoblin (very poisoned)g   goblincgg(…)The goblin hits you but does no damage.---1.5 (1.2cggMcgg1cgg/  --more--cggB cgg8D K_A quokka comes into view.cggH You closely miss the hobgoblin.The hobgoblin is severely wounded.You hit the goblin. The goblin is poisoned.cggI cggJ CYou kill the goblin!cggL cggiN cgggO cggP cgg] :r.S.).brb   batcgg^ {The bat hits you but does no damage. The hobgoblin barely misses you.cgga _4--42.7cggIj cggHn - _The hobgoblin hits you.cggɮ  You barely miss the hobgoblin.The hobgoblin is severely wounded.cggcggcgg,cgg%  cgg7You kill the hobgoblin!cgg%.cgg.rbS.b   batcgg 063.9cggcggP _The bat barely misses you.cggϦ5  You hit the bat.cgghcggvcggjcgg.S.rcggzP--75.2 (1.3cggcgg' cggA_You kill the bat!cgga  You hit the adder but do no damage. The adder is poisoned.cggcggLx.r(very poisoned)cggOV5=6.5cggpcgg{ _The adder closely misses you. The adder bites you but does no damage.cgg   extremely poisoned) (very poisoned)You hit the adder. The adder looks as sick as possible!  The adder is heavily wounded.You hit the quokka. The quokka is poisoned. The adder bites you.cggc W2--7.8cgg cgg  _The quokka completely misses you. The adder bites you but does no damage.cgg 9  You slash the adder!cgg s  You kill the adder!You hit the quokka.cgg S†)cgg cgg@ X --23cgg  F9.1 _You kill the quokka!cgg cgg  cgg7 __Your Axes skill increases to level 1!cggёcggcggcggH _No target in view!cggcggPcggܖcggęH _No target in view!cggjx3cggzcggG~cggPR3= _cgg+cgg|,cggMcgg,cgg.cggqcgg>cggcgg̔cggU4=cggcggcggcgg:5=cggcgg,cggcgg,cggcggcgga6==cggcggcggcggcggcggScgg< #.# ##### ..#  #...# ..#  #...# ..#  ####...#####..#  #....### .##...#####?...## ................@......>-33.1 (14.cgg0) ######.########.#....#.....# #.†.......(....# #..).#....  ####.....# ...  ##......... ..###.........### . ...................# .###...............#cggcggF-4.1 (15cggAcggM; _Found a stone staircase leading down.cgg cgg cgg cggD cgg cgg ,cgg ].#  ##.# ##### ...# #...# #..# cgg  #...# #..# ####...#####..#  #.............### #####.##...#####@...##. ......................># #####.########.#.#.....# #.†....#(....# #..)..#.......####.....#...  ..........# ###cggJ .......####.#..cgg 15.0)cgg G=6.1 (2cgg cgg L _h - a scroll of poisoncgg<-cgg.cgg/cggV4cgg6cgg:Bcgg>cgg?cggd@cgg&cgg,cgg'cggcggP cgg cgg cggcgg,cggcgggcgg,cggecggcggs!,cgg"cggx%cggm(,cgg)cgg*,cgg.,cgg/cgg+1cgg2,cgg3cgg5cggA8,cggA9cgg=cgg?cggk@cgg@cggBcggvEcggFcggFcggHcggK,cggMcggNcggYQ,cggRcgg`UcggY,cggZcggr]cggw_,cggu`cgg!ccggsfcgggcgghcggGkcggn,cggocggvcggycggszcgga{cgg}cggȀcggdcggcggcggBcggȏ.................#...... ............####.#...... ............##......^### ............##.#.##..... ##.............#..#..... ##.#....########........ cgg^# .#.... #..###### # #.... #..#  .. #@.# ##..#  #..#  #..# ### #.<cggzB.# #.#..#######.# #.#..##....## #.#..##....#cgg058.1 (22.0)cggї,9.1 (23cggÛcgg}] _i - a scroll of teleportationcggBcggdD3cgg2HcggLcggQncgg3Tcggjcggl,cggocggp,cgg scggv,cgg*wcgg~ycggvBcggcggi,cggPcggcgg,cggcggcggގcgg,cgg4BcggL _You now have 81 gold pieces (gained 8).cggcggښcggcggicggcggcggIcggcgg,cgg"cgg٫cggncggIcggcggRcgg,cggBcgg?cggcggR,cggcgge,cggcgg( .#  ##.# #### ...# ...# #..# ...# #..# ############# ...#####..# #...........# cggE..........####...........# ...#####....##..@........# ..............>#........# ######.#................# .# ##.†................# .# #..)..#.............### .####.....#...............# ...............#..........# ..........####.#..........#.......##......^########cgg(-78.1 (19cgg&,9.1 (20cggcgg\ _k - a viscous coppery potioncggcggcggecggcggcggϩcgg0cggcgg,cggjcggGcgge,cgg6cggϽcggncggYcggcggcgg`,cggcggcgg,cgg?cggR  There is a stone staircase leading down here.cggcgg _cggtcggcggcggJcggcggcgg,cggNcggcgg ,cgg{cggqcggM,cggFcggcggv,cggMcggXcgg,cggcggucgg cggD ,cgg cggcgg,cggcgg,cggcggmcggBcggcgg!,cgg:"cggo%cgg',cgg)cggH-cgg/cgg0cgg'1cggb4cgg}7,cgg8cggBcggG,cgguIcggdLcggUXcggX,cggYcgg[cggC_,cgg`cgg=fcggi,cggkcggncggr,cggYscggvcgg7z,cgg{cggQ~cggQBcggycggS,cggԋcgg6cgg,cggZcggpcggIcggcggcggwcggס,cggcggcggj,cggcggNcgg-,cggcggUcgg,cggܼcggcgg0,cggcggcggcgg,cggcgg,cggcggcgg,cggcgg!cgg1cggcggcggcgg,cgg?cggcgg,cgg(cggcggV,cggcggcgg,cggcggcggx,cgg cgg cgg5,cggwcggcgg,cggcggKcgg,cggcggcgg#,cgg$cgg3&cgg(cgg)cgg9*cgg+cgg'/,cgg0cgg?2cgg5,cgg6cgg9cgg5<,cggw=cgg?cggC,cggVDcggGcggI,cggKcggMcggOcggPcggQcggVcgg_Y,cgg2Zcgg[cgg^cgg^cgg\_cgg|`cggh ### #.. #.. ####.. cggPi#..... ##############.##.. #.@................138.1 (59 #.############.#### #.. #.....# ...# #(....# ..## #.....# #..# ##......  #.# #####.......  #> #...........  #.###....... cggSpcggPq,9.1 (60cggucgg}J _Found a stone staircase leading down.cgg~-40.1 (61cgg^cggO` _l - a sedimented amethyst potioncgg& cgg 3cgg cgg= cgg/ Bcgg cgg ,cgg cgg ,cgg cggl cgg ,cggu cgg cgg ,cgg cgg cgg cggs ,cgg cgg+ ,cgg cgg cggt ,cgg& cgg cgg ,cggo cgg cgg ,cggw cgg cgg ,cgg2 cgg cgg& ,cgg cgg cggc v##############............##.#################..# ##.....#...## ##...### ##..## ## #.## ##### #@# ##J..........# #.###.cgg V#####.....#.# #.# #. #.....# #.# #. #.....# #.# #. #.....# #####.# #. J   endoplasm (asleep) ......# #.....# #. #.....#.#.##### ##...#.#...##cgg% Y52.1 (123.1 (13cgg+ cggX0 _An endoplasm comes into view. _There is a stone staircase leading down here.cgg n #.. ##. #########..#  #.....#...##  #...###  #..##  #.##  #@#  #J..........#  #####.....#.# #.#  #.....# #.# cgg;  #.....# #.#  #.....#   ......#   #.....#   cgg #.. ##. #########..#  #.....#...##  #...###  #..##  #.## cggY #@#  #J..........#  #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....#   ......#   #.....#  cggW4cggfcgga _An endoplasm is nearby!cgg  #.. ##. #########..#  #.....#...##  #...###  #..##  #.##  #@#  #J..........#  #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....#   ......#   #.....#   cggr #.. ##. #########..#  #.....#...##  #...###  #..##  #.##  #@#  #J..........#  #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....#   ......#   #.....#  cggt4cggycggI~a _An endoplasm is nearby!cggw   #...........  #.##########  #########..#   #.....#...##   #...#   #..##   #.####  #.###>###### #...  #J..@.......# #.###   #####.....#.# #.# #   #.....# #.# #   #.....# #.# #   #.....# #####.# #   ......# #.....# #   #.....#.#.##### #gg! ;39;49m b   bat (asleep)   #b...#.#...##  ........#cgg94cgg  .0) cgg cgg$V _A bat comes into view.cgg  #   ##.   #########..#   #.....#...##   #...###   #..##  # #.##   #.###>###### #   #J.# #.   #####.....#.# #.#   #.....# #.#  cggh #.....# #.#  #.....# #####.#  ......# #.....#   #.....#.#.#####  #b...#.#...##   .#cggcgg&5cggcggcgg  #  ##.  ###..#  #.....#...## #. #...### #. #..## cggk #. #.##   #.###>###### #  #J.# #.  #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....# #####.#  ......# #.....#  #.....#.#.#####   #b...#.#...##   .#cggbcggڶ&6cggcggcggS JJThe helpless endoplasm fails to defend itself.  You hit the endoplasm.  The endoplasm is lightly wounded.cggÌ 5=7.3 (1.2cgg cgg @ _The endoplasm hits you but does no damage.cgg0u  You hit the endoplasm.  The endoplasm is moderately wounded.The endoplasm freezes you.cggv(8.5cggzcgg|1 _You are frozen. You resist.cgg;  You hit the endoplasm.cgg$1.cgg(059.7cggt.cgg0M _You kill the endoplasm!cggcgg:cggcggܲH _No target in view!cggcggcggcggH _No target in view!cggH_cggnf _cgg ,cgg cggK cgg cggc ,cgg< cgg ,cgg cgg cgg cgg ,cgg cggu cgg cgg cgga cgg ,cgg cgg cgg Bcgg cgg ,cggA! cgg" cgg# ,cgg$ cggU% cgg' ,cgg' cggq( cggE* ,cgg* cgg, cgg3 8 #..  cgg4  ##.##   #########..#  #.....#...##  #.###...###  #.# #..## #   #.# #.## ##   #.###>###### #..  cgg5  #...# #.##- #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....# #####.#  ......# #.....# # b   bat (asleep)   #.....#.#.#####  #b...#cgg6 , cgg@ 071.7 (12.0)cggA F-2.7 (13cgguJ cggM cgg s ##. #########..#  #.....#...## cgg  #.###...###  #.# #..##  #.# #.##  #.###>######  #...@.......#  #####.....#.# #.#  #.....# #.#  #.....# #.#  #.....#   ......#   #.....#  #b...#   cgg ##. #########..#  #.....#...##  #.###...###  #.# #..##  #.# #.##  #.###>######  #...@.......#  #####.....#.# #.# #.....# #.# #.....# #.# cggO #.....#  ......#  #.....# #b...#cggs cgg cgg߮ cgg Z _A bat is nearby!cgg ##.########### #########..#  #.....#...## # #.###...### # #.# #..## ## #.# #.## #####. #.###>####### #..... cggC -#...........# #.### #####@....#.# #.# #. #.....# #.# #. #.....# #.# #. #.....# #####.# #. ......# #.....# #. #.....#.#.##### # >#b...#.#...## . ...........# .####.###..#cggI%cgg&cgg(cggj1`bb.cgg203.0) cggK8cggT<; _Found a stone staircase leading down.cgg#########..# .....#...####...###  #..## ### #####.##>####### #....#...........########.....#.#   b...# ####.......#.#.##### ##>#cgg..## . ...........####.###..## ##.....#...###cgg cgg"cgg*cgg,.=4cggB1cgg4P _The bat barely misses you.cgg.....#...####...###  #..## ### #####.##>####### #..............#######.....#.#   b...# ####.......##.#.##### ##>#..##. ...........cgg_####.###..##.. .##.....#...###........#)..##cggcggqcgg"b.cgg&5cggcggRQ _The bat closely misses you.cgglcggmcggtcggu-6.9 (1.2cggcggqt _You closely miss the bat. The bat hits you but does no damage.cggMD cggE cggXG cgg?N &b.cgg?O (8.1cgg(V cggX[ t _You closely miss the bat. The bat hits you but does no damage.cggq t  You barely miss the bat. You tail-slap the bat.cggBi.cgg069.3cggcgg!G _You kill the bat!cgg{b _No target in view!cgg 4cggcgglH _No target in view!cggcgg=3cggcggcgg$ _cggbcggtcggn# #..## # #.## #####.##>####### #...............# #.####.....#.# #.# # #.....#   #.....# ####.#####...#....-#.#.#.##### ### >#....#.#...## S. ...........#.#. .####.###..##.S.. .##.....#...### S   adder (asleep)cgg.# #. ##........#)..## S   ball python (constriction, asleep).. .. #.....†..###..#......cggM 800  A ball python and an adder come into view.cggcggTcgg^  The ball python hisses angrily. The adder hisses angrily.cgg8KSKS.SS)K   koboldcgg4==1.3 (2cggcgg z _A kobold comes into view. It is wielding a +0 short sword.cgg` 9 #.# #..##  #.# #.##  #.###>#######  #...........#  #####.....#.# #.#  #.....# #.#  #.....# #.#  ####.....#   #...@....#   cgg G#.##S....#  # >#....#  K. ...........#  S#. .####.#  .... .##....  .# #. ##) .. .. †cgg5  #.# #..##  #.# #.##  #.###>#######  #...........#  #####.....#.# #.#  #.....# #.#  #.....# #.#  ####.....# cggt8   #...@....#   #.##S....#  # >#....#  K. ....... S#. .####.# .... .##....  .# #. ##) .. .. †cgghA cggB cggK cggO d _There are monsters nearby!cgg,cggEcgg'OKS...cgg(5-2.5 (1.2cgg1cggx6x _You barely miss the adder. The adder bites you but does no damage.cgg8  You hit the adder. Your tail-slap misses the adder.The adder is moderately wounded.cgg[.S cggB-3.7cggcggťU _The adder barely misses you. x2cgg  You slash the adder! The adder is poisoned.  The adder is almost dead.K>#S.S   ball python (constriction)K   kobold40=4.9cgg_ _You kill the adder!cggњcggϢnS.-6.1cgg_cgg _You closely miss the kobold. The kobold closely misses you.cgg  You closely miss the kobold. You closely miss the ball python.The ball python misses you. x2cgg i4---7.3cggŸ cgg @ _The kobold hits you with a +0 short sword.cgg~8  You hit the kobold.cgg͎y  You kill the kobold!You hit the ball python.cggQs)†cgg!P--48.6 (1.3cggןcggO _You kill the ball python!cggYcggcggcgg!H _No target in view!cggucggcggcggNH _No target in view!cgg4cggcgg_H _No target in view!cgg> 3cgg@ cgg9D cgg9E #5cgg0J q= _cggL cggM ,cggN cggR cggS cggAT cgg1W cggW h6==cgg Y cgg\\ cgg^ cgg|_ cgg"` cggc g  You see here a ball python corpse.cggf cggf  _cgg^h cgggk cggn ,cggo cgg1q cggt cggKu 9=cggv cggx cggz cgg{{ cgg2| cgg~ cggҁ cgg cggɃ cgg cgg cgge cgg. cgg cgg ,cgg cgg: cgg8 ,cgg} cgg cgg ,cgg˟ cggT cgg cgg cgg cgg cgg ,cgg cgg cggx cgg cgg cgg cgg cgg< cgg cgg cgg ,cggJ cgg cgg cgg cgg^ cggI cggs ,cgg cgg cgg cggw cggL cgg cgg ,cgg cgg cgg' ,cgg cgg cgg cggu cgga cgg cgg ,cgg cgg0 cgg ,cgg cgg cggd ,cgg cgg cggX cgg cgg cgg cgg" cggs# cgg$ cgg& cgg) cgg* cgg8+ cgg- cgg/ cgg0 cgg@1 cgg2 cgg5 cgg5 cggM6 cgg8 cgg6: cgg: cgg; cggD= cggi? cgg@ ,cggB cggD cggE cgg?F cggG cggI cgguJ cggK cgghL cggN ,cggO cgg'Q cggES cggS cggT cggU cggX ,cggtY cggy] l  You see here a frilled lizard skeleton.cgg_ cggu`  _cgga cggc cgge ,cggtf cggh cggJj cggj cggk cggl cggn ,cggn cggo cgg q ,cggq cgg{r cggs ,cggt cggtv cggx ,cgg} cgg cgg: cggЂ cggu cgg' cggʋ ,cggN cgg͐ cggV cgg cgg cggܖ cggț cgg cggٞ cggu cgg cgg cggN cgg cgg cgg] cgg cgg cggE cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg4 cgg ........##..##KKKW.##.# #.....# ........##..#.#KK.#.#.# #.###.# ........##..#⌠K#.#. #.###.# ........##..#.#.?.# #.....# cggf ........##..# .... ######.### ..........### =[ #......# ........#...## ###.#.####.# ###########..#### #.# ##....@..# #<# -######..# ###  ### cggX 1245.6 (57.0)cgg F-6.6 (58cgg| cgg Z _q - a lumpy emerald potioncgg]3cgg_cggGbcgg}fcggj,cgglcggjp,cggrcggvcgg{cgg{cgg}cggȁcgg,cggycggLcgg,cggCcggМcgg,cggcggcggL,cggcgg>######............# #..# ##............# #..# ##...##+++##..# #..#### ##..##KKKW.##.# #.....# ##..#.#KK.#.#.# #.###.# ##..#⌠K#.#. #.###.# ##..#.#.?.# #.....# ....##..# ....########.### ......### =[ #@#......# cggi....#...## ####.#.####.# #######..####....# #.###.......### #<#######..########cgg253.6 (7.0)cgg+4.6 (8cggcgg. _s - a scroll of identifycgg̉ 3cgg؋ cggɑ cgg cgg̔ cgg? Xcggd cgg cgg ,cgg cggڢ cgg cgge cgg cggѧ cgg cgge cgg cggX cggW ,cgg] cgg cgg cgg cgg cgg cgg ,cgg cgg6 cgg" cgg cggZ cgg] cggq `cggH ,cgg ,cgg Bcgg cgg cgg cggT cggW cgg ,cgg0 cgg cgg  The kobold shouts! The kobold brigand shouts! The kobold shouts! x2  FireSight's ghost turns its malevolent gaze towards you.cggT cgg cgg cgg8 cgg cgg" cgg* cgg+ cgg. cgg; L _You hear a shout! The kobold shouts! x2cggE cgg K cgg/P cgg3l _cggџ _The kobold shouts!cggE cggP cgg 3cggg cgg cggp cgg cgg+ cgg cgg# 7 _The kobold shouts!cggn cggR 3cgg cgg= cgg cgg cggK cgg} cgg! cgg) ,cgg, cggi9 cggQE cggL cggR cggX cgg_ ,cggx cggԆ cggV cgg cggQ cgg cgg ,cgg cgg cggG cgg_ cgg5 cggc cgg cgg cgg cgg cgg cgg cgg cgg cggb cgg cgg@' cgg, cgg2 cgg`4 cggL7 cgg4B cggK cggO cggT cggZ cgg] cggc cggQd cggh cggv cgg cgg cggW cgg: cgg cgg cgg cggC cggB cgg cggl cggN cggK ,cgg5 cggb cgg cgg cggm cgg cggS cgg cgg cgg cggj cgg< cgg cgg/cggcggDcggcggcggcgg,cgg cgg ,cggd cggj cggcgg,cggcggcggE,cgg{cggUBcggjcggocgg.,cggcggcgg ,cggcgg? cgg!,cgg"cggS#cggW$,cgg0%cgg&cgg',cgg3)cgg+cgg+cggV,cgg2ncgg3,cgg4cgg~5cggJ7,cgg8cggQ9cgg:cgg;,cgg%=cgg>,cgg?cgg@cgg+B,cggBcggDcggrEcggF,cggGcggMcggNcggNcggUPcggQ,cgg;RcggScggT,cggUcggWcggKX,cggYcgg*[cgg\,cgg\cgg^cgg_,cgg`cggKbcgg%c,cggdcggfcggkg,cggjcggkBcggr...# #..# #.#  .# #..# #.#  ...# #..# #.#  #..# #..#########.#  cgg>t;##.# #.....##.....#  K#.# #.###.##.#####  K### #.###.##.####  .# #.....##....#  ########.#######@#  317.6 (63.0) #.#......# #.#  #.#.####.# #.#  ..# #.# #.#  ### #<# #.#  #### #.#    ##.#   ...     cgg\ucgg zcgg|}T _Key pressed, stopping explore.cgg_cggƛf _cggBcggݠXcggBcggcgg,cgg_cggcgg_,cggcgg'cgg,cggcggcggF,cggcgg;cgg,cggHcggöBcggcggcgg,cggcgg8cgg,cgg1cggſ,cggjcggcggcgg,cggVcggcgg,cggcggcggcgg3cgg5cggOcgg cggcggcggcggcggcgg;cgg,cgghcggcggN,cggcggcggcggcggLcgg,cggcggn _m - 2 potions of lignification (gained 1)cggcgg3cgg.cggcgg,cggcggRcgg,cggcgg_cgg,cggdcggBcggcgg\ cgg ,cgg cgg!cggcggcggcgg,cggcgg~cggcgg,cggcggcgg!Bcgg#cgg&cgg'cgg(cgg7+cgg.cggw/cgg0cggrcgg ,cgg cggcgg,cggcggh cggs#,cggl$cgg&cggO(,cgg )cgg-Bcggm.cgg22cggn4,cgg\5cgg8cgg9cggr:,cggA>cgg/@cgg@cggmAcgg Ecgg=GcggGcggHcgg2LcggNcggiOcgg7PcggKScggU,cggVcgg"Zcgg2\cgg ]cgg]cgg`cggb,cggbcggdcgglfBcgghcgg}k,cgglcggocggvp,cggqcggrcggs,cggytcggucgg2w,cgg xcggzcgg|,cgg}cggcggWcgg߅cggd,cggcgg$ cggk_FireSight's ghost turns its malevolent gaze towards you.cggcggcggcgg4cgg? _The kobold brigand shouts!cggdcggcggWcggycggEcggƿcggcggcggcgg$cggcggcggcggcgg>cgg7 _The kobold shouts!cggcggcggQcggcgg`cgg#/cggVK,cggNcggbe #.#..##....#  cggd#.#........#  #...###....#######  ###..##..........######## ###..........###......... # #............# #..####### # #............# #..# #########............# #..# .......##.......@....# #..# 75.6 (58 .÷.....##...##+++##..# #..####### .......##..##KKKWK##.# #.....##.. .......##..#.#.KK#K#.# #.ggze;m###.##.# .......##..#⌠.#K#.⌠### #.###.##.# .......##..#.#.?.#.# #.....##.. K   kobold brigand (missile) .......##..##.....########.###### W   FireSight's ghost .........#####.=[##.#......# KKKKKK 7 kobolds (1 wand, 4 missiles) .......#...########.#.####.#cgg[rcggxcggKBcggCcggHcggu6....###...# #....# #....cggrw0.0)...........cggcgg] _Could not explore, unopened runed door.cgg3cggcgg 4cgg((cgg- cgg.O_Could not explore, unopened runed door.cggscggcggcgg=4cgg@cgg_] _Could not explore, unopened runed door.cgg cggB cgg: cgg 4cgg; cgg? ] _Could not explore, unopened runed door.cgg03cgg5cgg[4cggWjcggn] _Could not explore, unopened runed door.cggcgg_cggcggVcggcggPcggU _Could not explore, unopened runed door.cgg\cggJWhere to? (Tab - D:3, ? - help)  D - Dungeon cggr.cggL#.#..##....#ssays the Charlatan#.#........#Draconian#...###....#######Health: 36/36 ========================###..##..........######## Magic: 4/4cgg N========================###..........###......... AC: 5Str: 16 ##............# #..####### EV: 11Int: 11 ##............# #..#SH: 0Dex: 12 #########............# #..#XL:  4 Next: 44% Place: Dungeon:3 .......##.......@....# #..#Noise: ---------  Time: 2375.6 (0.0) .÷.....##...##+++##..# #..####### r) +0 hand axe (venom) .......##..##KKKWK##.# #.....##.. Zap: wand of flame (15) .......##..#.#.KK#K#.# #.###.##.# .......##..#⌠ggpO"m.#K#.⌠### #.###.##.# .......##..#.#.?.#.# #.....##.. K   kobold brigand (missile) .......##..##.....########.###### W   FireSight's ghost .........#####.=[##.#......#KKKKKK 7 kobolds (1 wand, 4 missiles) .......#...########.#.####.# _Could not explore, unopened runed door. _Could not explore, unopened runed door. _Could not explore, unopened runed door. _Could not explore, unopened runed door. _Could not explore, unopened runed door. _Could not explore, unopened runed door.cggTcgg^gcggFmcgg scggt$ _cgg5ycggkcggcgg0cggcggcgg,cggcggcggA,cggcggcgg,cgg.cgglcgg,cgg1cggucgg9cggV,cgg cggcgg9,cggcggzcgg`,cgg]cgg3,cgg cggcggcggg ,cgg cgg ,cggWcggcggcggm,cggecgg@,cggcgg[cgg,cggcgg cgg)",cgg"cgg%cgg&,cggg'cgg )cgg*,cggN+cgg-cggm.cgg1/,cgg1cgg34cgg4cgg5cgg]7cggn9cgg(:cgg:cgg<cgg>cggn?cgg'@cggcggD,cggEcggcgg,cggC cgg cggcggKcggcgg`cgg cggcggcggcggcggUcggcggxcgg",cggc#cgg%cgg;(,cgg)cgg+cgg.cggM/cgg*0cgg1X _ There is a stone staircase leading down here.cgg[3cgg6cgg6$ _cgg!8cgg p4cggqcggtcggtcggCwcgg __There is a stone staircase leading down here. _You climb downwards.  Found a scroll of fog and 9 gold pieces.  Found a staircase to the Ecumenical Temple.  upcggOEcgg~M # # ####  #h#. .... #...§ §..# #....§§..# #.#.$§§..#  #  ?@.# 407.3 (31.7) cggVO...####..# #....  #..### #..# ...#h   jackal (asleep) #..# #..# cgg^s _A jackal is nearby!cgg # # #### #h#. .... #...§ §..# #....§§..# #.#.$§§..# .........# ......?@.# ...####..# #....  #..###  #..# ...# #..# cggi2#..#cggn # # #### #h#. .... #...§ §..# #....§§..# #.#.$§§..# .........# ......?@.# ...####..# #....  #..### cggb5#..# ...# #..# #..# cggVcggcggcgg  # # ##### #h#. .... #...§ §..# #....§§..###.#.$§§..##......@..#cgg....?<.##...####..###. #.... #..### #..# ...# #..##..# _A jackal is nearby!cggƶW##..§§cggt 88.3 (1.0) _cgg*cggcggC  # ########## #h#........ #.....§..# #...§§§..# ##.#.$@§..# #.........#........?<.#..####..###.# #....#. #..#### #..# ...#  #..#cgg8 #§§>.§@.cgg &9cgg cgg cgg # # ########## #h#......... #...§§§..#cgg  #...@>...# ##.#.§....# #.........# ........?<.#..####..##.# #.... #. #..####. #..# ...#cggܖ |...§$§§cgg '10cgg] cgg cgg}o+         # ##########   #h#.........   #..@.....#   #....>§..#   ##.#.$§§..#   #.........#   ........?<.#  ###...####..#  #.# #....  cgg'q #. #..###  #. #..#cggyj§§.§...cggz&1cggfcggcggy    ## h. #h  #.##   #h#.   #.@.§....# cgg# #..§.§...#  ##.#.$....#  #.......#  ........?<.#  ###...####..#hh 3 jackals (asleep)   ##.# #....   #. #..##   #. #..#cgg h  2 jackals come into view.cggcgg .hhh...>§hhhThe jackal barks! x2; You hear a shout! The jackal barks!cggE====2cggcggT _The jackal closely misses you.cgg@:  You slash the jackal!cggcggcggz.§$§§. 2cggj6=---3.5 (1.2cgg,cggRJ _You kill the jackal!cggb L §>§....  You barely miss the jackal. The jackal barely misses you.---4.7cgg cgg L _The jackal misses you.cgg  You hit the jackal but do no damage. The jackal is poisoned.cgg †h@..§.§$.§(1 poisoned)5.9cgg cggG L _The jackal misses you.cgg,cgg2 g.h.§>§g   hobgoblinYou closely miss the jackal.A hobgoblin comes into view.cggM(7.1cggcggM _The jackal closely misses you. The jackal misses you.cgg  You closely miss the jackal.The jackal is moderately wounded.You hit the jackal. The jackal is poisoned.cggY  You kill the jackal!cggcggV.g†§..   jackal (cgg088.3cgg`cgggA _The jackal bites you but does no damage. x2cgg:  You slash the jackal!cggcgg5.g.@...§.§g   hobgoblincggg1509.5cggcggJ _You kill the jackal!cgg s  You hit the hobgoblin. The hobgoblin is poisoned. You tail-slap the hobgoblin.cgg 4†§cgg< +§cgg9 6220.8 (1.3cgg$ cggw' M _You kill the hobgoblin!cgg cgg cgg cggj H _No target in view!cgg;,cgg-cgg7^ _No target in view!cgg#    ##   ..  #.  #.##########   #†#.........  #....§...#  cgg$ g#..@.§§..#  ##.#.$§...#  #.........#  ........?<.# ###...####..#  ##.# #.... . #..###   #. #..#  ...#cgg- .>...#§.cgg. ;-10 _cgg:6 cgg`8 cggr ## ..  #.  #.########## #†#.........  #........#  #....>...#  ##.#.@....#  #.........# cgg .........?<.#  ###...####..# ##.# #.... #. #..### #. #..# ...# #..#cggq6§cgg`@-2cggcgg  §>You now have enough gold to buy a scroll of blinking on D:1, or buy a scroll ofenchant weapon on D:1.  You can access your shopping list by pressing '$'.cggv +3.8 (2cggdcgg?= _You now have 90 gold pieces (gained 9).cggm*w## .. #. #.###########†#..........#...§....# #....@...# ##.##  #..# .........?<.####...####..###.# #....#. #..####. #..#...#cgg2/§cgg5+4.8 (1cgg8cgg<i _There is a staircase to the Ecumenical Temple here.cggcggcggcggI..§cgg-5 _cggcggA: ♣♣...#_..._#...♣♣♣..##.....##..♣♣ß.#...⌠...#.ß♣♣..##.....##..♣♣♣...#_..._#...♣♣♣♣....###.###....♣♣♣♣..♣♣...###....♣..♣♣♣♣..♣♣♣♣........♣♣♣..♣♣Temple♣..♣♣ ♣♣...@...♣♣ ♣♣..♣♣_♣♣ ♣♣..♣♣♣♣♣..♣♣ ♣♣_♣♣♣♣ ♣♣..♣♣ ♣♣..♣♣ ♣♣♣♣♣..♣♣ ♣♣..♣♣♣_.♣♣ ♣♣._♣♣♣♣♣ ♣♣♣♣ cgg< You climb downwards. Welcome to the Ecumenical Temple!cgg@Q___cgg-6.6 (1.8cggH__cgg _Found a staircase back to the Dungeon. _There is a staircase back to the Dungeon here.cgg4cgg3cgg_}_0.0_cgg7cggl_ _Done exploring.cggo Icggv k__cgg-z }_ _Done exploring.cggH ♣♣....###.###.♣♣...#_..._#...♣♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ..##.....##..♣ ..#_..._#...♣♣ ...###.###....♣♣ ♣...###....♣..♣♣ ♣♣..♣♣♣♣.♣..♣♣ ♣..♣♣ ♣♣...<...♣♣ ♣♣..♣ ♣_.♣♣♣♣♣..♣♣ ♣♣_♣ ♣♣♣ ♣♣..♣♣ ♣♣..♣♣ ♣♣♣♣♣.♣♣..♣♣♣_.♣♣._♣♣♣♣♣♣♣♣♣_7.6 (1 __cggy ♣♣..♣....#+#...♣♣♣♣....###.###.♣♣...#_..._#...♣♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ..##.....##..♣ ..#_..._#...♣♣ cgg )..###.###....♣♣ ...###@...♣..♣♣ ♣♣..♣♣♣♣........♣♣♣..♣♣ ♣..♣♣ ♣♣...<...♣♣ ♣♣..♣ ♣_♣♣♣♣♣..♣♣ ♣♣_♣♣♣♣ ♣♣..♣♣ ♣♣..♣♣ ♣♣♣♣♣.♣♣..♣♣♣_.♣♣._♣♣♣♣♣♣♣♣♣cgg T__cgg &8cgg$ :_cgg\& cgg___cggCA__cgg=cgg♣♣..♣....#+#...♣♣..♣♣ ♣♣....###.###....♣♣ ♣♣...#_..._#...♣♣ ♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ♣..##.....##..♣ ♣♣...#_..._#...♣♣ ♣♣....###.###....♣♣ ♣♣..♣♣...###.@..♣..♣♣ ♣♣..♣♣♣♣.♣♣♣..♣♣ ♣..♣♣ ♣♣...<...♣♣ ♣♣..♣ ♣_♣♣ ♣♣..♣♣♣♣♣..♣♣ ♣♣_♣♣♣♣ ♣♣..♣♣ ♣♣..♣♣..♣♣ ♣♣..♣♣♣_.♣♣ ♣♣._♣ggx16;6H♣♣♣♣ ♣♣♣♣cgg`_9cggH:_cggcgg B♣♣..♣♣♣........♣♣♣♣..♣....#+#...♣♣♣♣....###.###....♣♣♣...#_..._#...♣♣♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ..##.....##..♣ #_..._#...♣♣ ..###.###@...♣♣ ...###....♣..♣♣  cgg♣♣..♣♣♣♣........♣♣♣..♣♣  ♣...<...♣♣ ♣♣..♣  ♣_♣♣♣♣♣..♣♣ ♣♣_♣  ♣♣♣♣♣..♣♣ ♣♣♣♣♣.♣♣..♣♣♣_.♣♣._♣♣♣♣♣♣♣♣♣cggL\__cggn'30cgg;_cggpcgg~ u♣..♣♣ ♣♣...ß...♣♣ ♣♣..♣ ♣♣..♣♣♣........♣♣♣♣..♣♣..♣....#+#...♣♣..cgg T♣♣....###.###....♣♣♣...#_..._#...♣♣♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ..##.....##..♣ #_..._#.@.♣♣ ..###.###....♣♣ ...###....♣..♣♣ ♣♣..♣♣♣♣........♣♣♣..♣♣ ♣...<...♣♣ ♣♣..♣ ♣_♣♣♣♣♣..♣♣ ♣♣_♣ ♣♣♣♣♣..♣♣ ♣♣♣♣♣.♣♣..♣♣♣_.♣♣._♣cgg R__cgg. &1cgg ;_cgg cgg@_♣♣ ♣♣..♣♣♣♣♣_♣ ..♣♣ ♣♣...ß...♣♣ ♣♣..♣ ♣..♣♣♣........♣♣♣♣. ♣♣..♣....#+#...♣♣..♣♣....###.###....♣♣♣...#_..._#...♣♣♣..##.....##..♣ ♣ß.#...⌠...#.ß♣ ..##.....##.@♣ #_..._#...♣♣ cgge..###.###....♣♣ ...###....♣..♣♣♣♣........♣♣♣..♣♣ ...<...♣♣ ♣♣..♣ _♣♣♣♣..♣♣ ♣♣_♣ ♣♣♣♣..♣♣ ♣♣♣♣♣.♣♣..♣♣cgg37_cggE&2cggh}____cgg/cgg3 d__cgg[___cgg'cgg____cgg}cgg}'_cggcgg9HX_cgg;K{____cggLcgg) s♣ ♣♣..♣♣ ♣♣♣ ♣_♣♣♣♣♣..♣♣ ♣♣_♣ ♣♣...ß...♣♣ ♣♣..♣♣♣........♣♣♣♣..♣♣♣....#+#...♣♣..♣♣.###.###....♣♣♣...#_..._#...♣♣ ♣..##.....##..♣ ♣ß.#...⌠...#@ß♣ ♣..##.....##..♣ ♣♣...#_..._#...♣  ♣♣....###.###..  ♣♣..♣♣...###.... ♣♣..♣♣♣♣........♣♣♣♣ ♣..♣♣ ♣♣...<...♣♣ ♣♣..♣_♣♣ ♣♣..♣♣♣♣♣._♣ ♣♣♣ ♣♣..♣♣♣♣ ♣♣♣cgg [___cgg &3cgg ]__cggǐ cggC_♣♣♣..♣♣ ♣♣_♣ ...ß...♣♣ ♣♣..♣ ♣........♣♣♣♣..♣♣ ....#+#...♣♣..♣♣ cggE..###.###....♣♣ #_..._#...♣♣ ..##.....##..♣ ♣ß.#...⌠...#.ß♣ ♣..##.....##.@♣ ♣♣...#_..._#...♣♣♣♣....###.###....♣ ♣♣..♣♣...###....♣ ♣..♣♣♣♣........♣♣ ..♣♣ ♣♣...<...♣♣ ♣♣ _♣♣ ♣♣..♣♣♣♣♣..♣♣ ♣♣_♣♣ ♣♣..♣♣ ♣♣.♣  ♣♣..♣♣ ♣♣cggL>__cggM&4cggIR{____cggETcgg #♣ ♣♣..♣♣ ♣♣♣ ♣_♣♣♣♣♣..♣♣ ♣♣_♣ ♣♣...ß...♣♣ ♣♣..♣♣♣........♣♣♣♣..♣♣cgg P♣....#+#...♣♣..♣♣.###.###....♣♣♣...#_..._#...♣♣ ♣..##.....##..♣ ♣ß.#...⌠...#@ß♣ ♣..##.....##..♣ ♣♣...#_..._#...♣  ♣♣....###.###..  ♣♣..♣♣...###.... ♣♣..♣♣♣♣........♣♣♣♣ ♣..♣♣ ♣♣...<...♣♣ ♣♣..♣_♣♣ ♣♣..♣♣♣♣♣._♣ ♣♣♣ ♣♣..♣♣♣♣ ♣♣♣cgg B_cggt &5cgg[ J__cggF cggz'M ♣♣..♣♣ ♣♣..♣♣ ♣♣ ♣♣..♣♣ ♣♣..♣♣ ♣♣_♣♣ ♣♣..♣♣♣♣♣..♣♣ ♣♣_♣..♣♣ ♣♣...ß...♣♣ ♣♣..♣ ♣♣..♣♣♣........♣♣♣♣..♣♣cggz|?♣♣..♣....#+#...♣♣..♣♣♣♣....###.###....♣♣♣♣...#_..._#...♣♣..##.....##@.ß.#...⌠...#.ß ♣..##.....##..♣ ♣♣...#_..._#...♣♣#...♣♣..♣♣ ♣♣_♣cggR__cggq&6cggԥ9_cggcggHHM_.♣♣ ♣♣._  ♣♣..♣♣ ♣♣..♣♣ ♣♣ ♣♣..♣♣ ♣♣..♣♣ ♣♣_♣♣ ♣♣..♣♣♣♣♣..♣♣ ♣♣_..♣♣ ♣♣...ß...♣♣ ♣♣..♣ ♣♣..♣♣♣........♣♣♣♣..♣♣♣♣..♣....#+#...♣♣..♣♣♣♣....###.###....♣♣♣♣...#_..._#.@.♣♣..##.....##..ß.#...⌠...#.ß♣..##.....##..♣...♣....♣♣ ♣♣.cggMR__cggcgg ?cgg3?cggo?cggAcggBcggCcggCcggPEcggFcggFcggVGcgg9Icgg`JcggJcgg~KcggNZ  There is a staircase back to the Dungeon here.cggNcggOcgg8P$ _cggPcgg~&Dungeon:4cggIcgg$cgg* ##..#.  #.##########. #†#.......... cgg+Z#....§...# #...§@§..# 87.1 (16.5)##.#.§§§..# #.........# .........?<.####...####..###.# #....#. #..###cgg+#. #..# cgg+e...# _You climb upwards. Welcome back to the Dungeon!cgg,cgg2cgg 6i _There is a staircase to the Ecumenical Temple here.cgg cggh cgg% cggX cgg& cgg P _cggA$ ,cggU% cgg' cgg, ,cgg- cgg5 ..#.#.##########.#†#..........cgg66 M#...§....##...§§...# ##.#..§...# #.........# .........@<.# ###...####..# ##.# #.....cggg6 #. #..#### #. #cgg6 ..# ...#cgg6 T #..#cgg6  cgg@ |#..§.90.1 (3.0)cggH +1.1 (4cgg cggӦ S _t - a scroll of fogcgg3cgg4cgg:cgg=H _No target in view!cggdcggcggcggcgg#. #.##########.#†#.......... #.....§..# #....§...# ##.#..§...# #.........# ..........<.# ###...####@.# cgg ##.# #.......s#. #..#######. #..# ...##..# cggs   scorpion (asleep)#..##cggD..#cgg[&0cggcgg.>.§s..scgg+2.1 (1cggcgg>[ _A scorpion comes into view.cggط. #. #.##########.  #†#..........  #........# #....>...# ##.#...§..# #.........# ..........<.# #@.# ##.# #.....s..  #. #..######  #. #..# ...# #..# #..# #..#cggcE #. #.##########.  #†#..........  #........# #....>...# ##.#...§..# #.........# ..........<.# #@.# cggE##.# #.....s..  #. #..######  #. #..# ...# #..# cgg F#..# #..# cggNcggOcggfWcgg[_ _A scorpion is nearby!cggx #. #.###. #†#.... #.# #....>...# ##.#...§..# #.# .<.# ###...####.@# ##.# #.....s..##. #..# ##..# cggN cgg* #.§§§.s.cgg -3 _cgg> cgg cggU"#.##########.#†#.......... #........# #...§§...# ##.#..§...# #.........# ..........<.# ###...####..#####.#cggOW ##.# #..@.s...#. #..####### #. #..#  ....####..#..# #..##..cgg[cggc#..§>§.§s.cggc&4cggqcgg  ..§§... (very poisoned)You hit the scorpion but do no damage. The scorpion is poisoned.cggi2-------=5.3 (1.2cgg'cgg1 _The scorpion stings you. x2cggۦ §>.  You barely miss the scorpion.You tail-slap the scorpion, but do no damage.The scorpion is moderately wounded.cggU(6.5cggcgg V _The scorpion closely misses you.cggCE .§.§§ You hit the scorpion but do no damage. The scorpion looks even sicker.  The scorpion is moderately wounded.cgg21----------7.7 _The scorpion barely misses you. The scorpion stings you.cggy  You hit the scorpion. The scorpion looks as sick as possible!  The scorpion is almost dead.cgg .§.§>$cggԧ cggN g#.##########.ssays the Charlatan#†#..........Draconian of Gozag  Gold: 52 #...§.§..#Health: 22/37 ==============----------cgg k#....>...#Magic: 4/4========================##.#...§..#AC: 5Str: 16#.........#EV: 11Int: 11..........<.#SH: 0Dex: 12###...####..#####.#XL:  4 Next: 140% Place: Dungeon:4##.# #..@$....#Noise: =--------  Time: 2498.9 (1.2)#. #..#######r) +0 hand axe (venom)#. #..#Zap: wand of flame (15)....####..#cggɮ #..##..##..  The scorpion is moderately wounded. cgg _The scorpion barely misses you. The scorpion stings you.  You hit the scorpion. The scorpion looks as sick as possible!  The scorpion is almost dead. cgg( _You kill the scorpion!Your Axes skill increases to level 2!cggR You hit the scorpion. The scorpion looks as sick as possible!  The scorpion is almost dead. _You kill the scorpion!  cgg Your Axes skill increases to level 2!  Your Stealth skill increases to level 2! have reached level 5!cgg /  --more--cgg.X5/425/5521% cggh1cgg:34 _cgg IcggU P _cggX ,cgg cgg ,cgg} cgg O6cgg cggp ncgg. cggS cgg S7=cgg cgg cgg cgg/ cggJ cgg cgg cgg cgg cggY cgg9 cgg E528cgg ;==cgg cggD ,cgg cgg ,cgg" cgg cgg cgg cggb cgg K9=cgg' cgg cgg cggZ cgg? cgg cgg cgg cgg cgg cgg! cgg#" N30=cgg" cgg% ,cggD& cgg3( cggZ( cgg( cgg* cgg@+ W1=cgg+ cgg- ,cgg'. cgg=2 ,cgg2 cgg5 ,cgg6 cgg7 a2=cggn8 cgg: ,cgg: cgg< ,cgg= cggA ,cggA cggD 93cgg6E 2=cggZE cggWG ,cggG cggI ,cgg/J cggS '4=cggGT cggU cggV h5==cggW cggX cggY cggY cgg[ ,cgg\ cgg] ,cggk^ cgga` cgg` #6cgg` 2=cgga cggd ,cggd cgg g cgg\g cggg cggj cggo59 -----37.3cggCcggJG _You kill the orc!cggV#. #.# #.# #.# #.# #.# #.#..@...J..#######.#.##.# ## #.#.. #.##. #.#.# #.#.#†#.. cgg/cggۛ"J.cgghb5=-80cggdcggĪ  Things that are here: _5 gold pieces; a +2 falchion of freezing; a +0 leather armourcgg&<\#. #.# #.# #.# #.# #.# #.# ..$@.J...# ######.#.# cgg<#.#  #. #.#.# cggNAcggQHJ.cgggIG-9 _cggNcgg7Qcgg JJ(unaware)You hit the endoplasm.  The endoplasm is lightly wounded.cgg6=90.5 (1.2cggdcgg^O _The endoplasm is distracted by your dazzling golden aura.cgg #JJThe endoplasm is distracted by your dazzling golden aura.  You barely miss the endoplasm.  The endoplasm is no longer distracted by gold.  The endoplasm quivers.You tail-slap the endoplasm, but do no damage.  lightly wounded.6=1.7cgg] cggH O _The endoplasm misses you.cggq ;  You hit the endoplasm.cgg E$cgg͗ 542.8 (1.1cggQ cgg M _You kill the endoplasm!cggcggcgg*cgg"H _No target in view!cgg>cggcggcggVH _No target in view!cgg\cgg]cgg4^cgg`cggJf _7=cgggBcggs598=cggta9=cggucggv,cggOwcgg y,cggycgg|,cgg|cgg)cggV40=cggcggȂcgg cgg׃cggK,cgg1=cgg,cggcgg,cggcgg,cgg:cgg5cggh2==cggcggcgg8cggecggcggTcggȞ&66cgg@cggwL _You now have 66 gold pieces (gained 7).cgg53cggcggcggZcgg9=cgg'cggi  You now have 71 gold pieces (gained 5).  Things that are here:cgg &71cgg#cggh _a +2 falchion of freezing; a +0 leather armourcgg3cggͼcggccggcggcggncggMcggcggcggcgg/cggdcggcgg\cgg+cgg/cggcggqcggUcggcgg4cggcggcggcgg>cggcggcggCcggncgg,cggcgg,cggcggcggxcggcggcggecggcggOcgg@cggcggY,cggcgg  Things that are here:  a +2 falchion of freezing; a +0 leather armourcggcgg _cggcggcgg',cggAcgg?cgg ,cggy cgg" cggT,cggqcggxcgg,cgg:cggcggcggcggcgg2cgg!,cgg"cgg)cgg,cgg,cgg-cgg0cgg^2cgg73cgg3cggP6cggp9,cgg,:cgg<<cgg\?cgg?cggW@cggAcggD,cggEcggBGcggAJ,cggKcgg^McgglT . .. ... _... cggTT..... #########..#... #......@.-643.8 (51.0) #.#####.#  #.cggT# #.# #.cggUp#  .#########  cgg;Uz ..)......#  #######.###cgg[U$####.#cgg\cgg]F-4.8 (52cggbcgge5 _Found an iron altar of Okawaru.cgg$cggcgg͈cggcgg,cgg,cgg\##.#.#...#.# ##.#...# #......####.._..g.......###..#..#......# #.## #.# #.##.##.# g   goblin (asleep)#######.cggy  ..)......# cgg15.8 (1.0)cgg+6.8 (2cgg˭cggs _A goblin comes into view. It is wielding a +0 club.cggUW  ##.#.#  ...#.#  ##.#...#  #......##  ##.._.....  g.......#  #########..#.....  #........@...#  #.############  #.# #.# #.# #.#    )  cggi \ ##.#.#  ...#.#  ##.#...#  #......##  ##.._.....  g.......#  #########..#.....  #........@...#  #.############  #.# #.# cggW #.# #.#    )  cgg 4cgg. cgg ] _A goblin is nearby!cgg{]  .# ## ...##.#...#  #......###.###.._..... #...g.......#########@.#................#..############# #.cgg(^ #  #######.########.........).....cggo t ggThe goblin shouts!cggRp J====7.8 (1cggWt cggmv S _The goblin barely misses you.cggJcggJb=---9.0 (1.2cggQcggSz _You closely miss the goblin. The goblin hits you but does no damage.cgg>6cggp7J---50.1 (1.1cggv=cgg2@ _You barely miss the goblin. The goblin closely misses you. x2cgg8  You hit the goblin.cgg'C$cgg/V71 51.3 (1.2cggicggJ _You kill the goblin!cggS cggJT cggZ cggV] H _No target in view!cgg- cgg. cgg3 cgg6 H _No target in view!cgg cgg cgg cggD cgg+ cggK : _cgg L  You now have 75 gold pieces (gained 4).cgg 95cgg@ cggM < _You see here a +0 club.cgg 3cgg# cggW cgg$ ,cgg cgg cgg ,cgg cggu cgg3 ,cgg cgg cgg ,cggcggcggUBcggWcgg! Bcgg cgg ,cggcggcgg*cgg)75cggcggQcgg,cggcgg!cgg?$cgg$cgg%cgg&cgg4),cgg)cggr*cggt-,cgg-cgg0cgg1:# ##S ...  .. # #.########.# # #..@......# ##.#.#- #########.# ...#.# #.# ##.#...# cgg ;I#.# #......# #.###.._.... #...)....... S   adder (asleep) #########..#.... #............#.. #.############cgg C{ 66.3 (15.0)  An adder comes into view.cggKi.SScggKF-7.3 (16cgg&QcggT/ _The adder hisses angrily.cgg[1K # ##. ..S ..#  #.######### .#  #..@......#  #########.#  #.#  #.#  #.###.._ #...) .  cgg,r # ##. ..S ..#  #.######### .#  #..@......#  #########.#  #.#  #.#  #.###.._ #...) cgg>Q. cggcggjcggcgg] _An adder is nearby!cgg{###. ##.# ##...# ..S.. ... # #.# .#  #.@.......# ##.#. #.# ...#. #.# ##.#... #.# #...... #.###.._ #...) cgg#..# #.#  #.#cggcggZcggT.ScggE88.0) _cggcggcgg UThe adder hisses angrily. _An adder is nearby!  You miss the adder. You tail-slap the adder.  The adder is lightly wounded.  bites you.  You are poisoned.cgg* 1====-=9.5 (1.2Pois cgg0 cgg , _The adder poisons you!cggh o  You closely miss the adder. You feel sick.cggi c39--70.7cggpn cggq @ _The adder bites you but does no damage. x2cgg   (very poisoned)  You hit the adder. The adder is poisoned.  You tail-slap the adder, but do no damage.The adder is moderately wounded.cgg a7--1.9cgg7b _You feel sick. The adder bites you but does no damage.cggThe adder is moderately wounded. _You feel sick. The adder bites you but does no damage.  You barely miss the adder.  The adder is moderately wounded.  You feel sick. The adder barely misses you. The adder bites you.  You are more poisoned.cggh5====--3.1cgg(cgg{, _The adder poisons you!cggk cggpl You hit the adder. The adder looks even sicker.  The adder is heavily wounded.cggmb3---4.3cggrcgguL _You feel sick. The adder bites you but does no damage.cgg The adder is heavily wounded. _You feel sick. The adder bites you but does no damage.  You closely miss the adder.The adder is almost dead.  cgg4 mYou feel sick. The adder bites you.  You are more poisoned.cgg/ q29=====----5.5cgg& cggK+ T _The adder poisons you! The adder bites you but does no damage.cggA 7  You hit the adder.cggH $  You kill the adder!cggE 75 7---326.7cgg cgg# S _You feel very sick.cgg^}cgg}8-cggJcgg2H _No target in view!cggr6- _You feel sick.4--cgg _You feel sick.3-cgg:3 _You feel sick.cggcgg@cgg _You feel sick.2-cgg3 _You feel sick.cggjT1-cggcgg= _You feel sick.  cgg"B=cggcgg@j _You are no longer poisoned.cggcggcggcggccggcgg cgg cgg cggcgg92cggcggcggcggwcggpcgg^,cgg-cggmcggcgg%cggu753=cggcggcgg ,cggA#cgg#cgg#cgg%cgg%cgg&cggu(cgg(K4=cgg)cgg+cgg+cgg,cgg&/cggg/cgg30cgg2cgg@3S5=cgg$4cgg}6cggU7cgg7cgg:cgg\;cgg;cgg{>cgg>cgg}?cggBcggrB56=cggBcgg@CcggJEcggEcggAFcggIcggK,cggbE7=cggcp8==cggpcggr,cgg^ucggucgg?vcggycggycggzcggw9=cggcgg‚cggcgg,cggcgga,cggcggxcggN30=cggdcgg,cggcggƓ,cggucgg1cggW1=cggucggocggcggcgg,cggϞcgg#cgg`cggcgg92cgg(=cggTcgg,cggcggocggcgg_cgg,cggNcgg3=cggȶcggcggcggcggcggcggIcgg*cggfcggcggK4=cggcggocggcggcggcggcggcggcggD#5cggE==cgg'cggcggcggcgg,cggcggr,cggcggY6=cggrcggcggZcgg#cggrcgg!cggJ,cggcggcggK7=cggRcggcggcggcggBcggcggcgg N8=cgg cgg$ cggY cgg cggcggcgg{cgg,cggacggcgg$cggXcggyD9=cggcggcggcggcgg*cggscgg cgg"cgg"cggh#cgg%cgg3&V40=cgg&cggu)cgg)cgg*cgg-,cgg-cgg80cgg0cgg0cgg3cgg351=cgg4cgg4cgg7cggX7cgg 8cgg;cggB;cgg<cgg>cgg>h2==cgg?cgg2AcggC,cggDcggFcggM ## #. ######...##cgg?N.>......# #....## #@######### .#-762.7 (86.0)cggjN #.........# ##.##########.# ...# #.# ##.#cggN #.# #.. #.###.._ cggN~ #...)..... cggN #########..#..  #............# cggOcggUcgg[VF-3.7 (87cggZcggRbJ _Found a stone staircase leading down.cgg!c5814.7 (88cggGgcgg2j= _You now have 81 gold pieces (gained 6).cggcgg[ cgg4 cgg cggcggE^=cgg ## #. #######...##..>......# #..@.###.#.######### .#.#.........# ##...#########.# ..#. #.# ##.#§§§# #.# #..g   hobgoblin (asleep).# # #.###.._.g #...).... #########..#.cgg(15.7 (1.0)cgg(+6.7 (2cgg1/cgg]3\ _A hobgoblin comes into view.cgg{ ## #. ##.## #####...## ..>......# #..@.# ##.#.#  #.#...  ..#####  .#. #.#  §§§# #.#  .# # _ .g #...)cggl  ## #. ##.## #####...## ..>......# #..@.# ##.#.#  #.#...  ..#####  .#. #.#  cgg P§§§# #.#  .# # _ .g #...)cgg cggb cggd cgg| ` _A hobgoblin is nearby!cggR' ## #. ##.## #####...## ..>......# #..@.# ##.#.#  #.#...  ..##### cggAS .#. #.#  §§§# #.#  .# # _ .g #...)cgg6 ## #. ##.## #####...## ..>......# #..@.# ##.#.#  #.#...  ..#####  cgg|.#. #.#  §§§# #.#  .# # _ .g #...)cggcgg0cgg϶cggN` _A hobgoblin is nearby!cgg0W### #..#.#######...## ..>......# #....# ##@#.######### #.#.........# ## ..#########.# .#.. #.# ##.#§§§#. #.# #...# # #. #.###.._g . #...)..### #########..# #..........cgg 9cgg}927.7 (1 _cggJ>cgg;?cggg+###..##.#######...##..>......# #....###.#.######### #@#.........# ###...#########.# ..#.#.. #.# ##.##§§§#.....#.# # #.###.._..g .#..)...cggW,..# ## #########..#.#  #...........##########cgg5cgg68cggq;cggq=cgg### #..##.#######...## ..>......# #....# ##.#.############.#.........# ##.@.#########.# . #.#..# #.# ##cgg$§§§#..# #.# #...#§# #.# #.###..g .# #...)..# ## ##########.# #........... #.######### #.#cgg'cgg&9cggcggXcgg  #..#.#######...## ..>......# #....# ##.#.############.#.........#cggj 5 #...#########.#  #@#..# #.# ##§§§#..# #.# .#§#.#.# #.###..g §..# #...)# ### ##########.# #.......... #.########## #.#  #.#cgg .§..#§._§#.#.§.# #70cgg 9_cgg Y _Found a shadowy altar of Dithmenos.cgg  #.##  #####...##   ..>......#   #....#   ##.#.#########  ##.#.........#   #...#########.#  #.#..# #.# #  §.#..# #.#  #.#§#.# #.###  cggg ..g._§§..# #...)  #..#.#.#.### #########  #.###.§.## #.......  ... #.# #.#######  ### .# #.#   .# #.#   #.#cgg cgg #..#§#g#§..§.#.#.##.#g.#.#cgg E====1cggW cgg# + _The hobgoblin shouts!cgg]#..#.§#cggb=---2.9 (1.2cggYcgg" _You barely miss the hobgoblin. The hobgoblin closely misses you.cgg; #..#§§#§.§.#.### (very poisoned)You hit the hobgoblin. The hobgoblin is poisoned.  cggq|The hobgoblin is heavily wounded.The hobgoblin hits you but does no damage.cggl39-----4.1cggcgg- _The hobgoblin hits you.cggɥ=  You slash the hobgoblin!cggѫ#§#..#.#cggb§#.#.#.§§._#..#.#.#.###.§.... #.#cgg{### .#.#cgg7Q81 35.3cggճ6_cggM _You kill the hobgoblin!cgg p cggp cggv cggy H _No target in view!cggj cgg cgg8 cgg cgg j40-- _cgg cggԥ cgg cgg* ,cgg֩ cgg ,cgg cgg~ cggư K1=cggr cggس ,cggɴ cgg" ,cgg cgg( ,cgg cgg cgg= h2==cggk cgg% cgg( cggz )81cggJ cgg cgg %8cggC cggI L _You now have 88 gold pieces (gained 7).cgg( 3cggl cgg cgg cggB 9=cgg cgg@ cgg> ,cgg cgg cgg3 ,cgg cgg cgg ,cggp cggD cgg ,cgg cggg cgg ,cgg& cgg cgg~ cgg cgg cgg cggx ,cgg cggWcgg%Bcggcgg`cggcggcggcgg cgg cgg cgg cgg:cggcgg,cggcggcgg cggU cgg cggQ"cggc%,cgg%cgg'cgg),cgg/*cgg,cgg-cgg-cgg].cgg/cgg5Xcgg7cgg7cgg>8cgg9cgghWcggb  There is a stone staircase leading down here. _cggPd,cggincggjcggem,cggncgg/ocggqcgg%rcggcrcggtcggvcggvcgguwcggxcgg-{cggj{cgg{cgg}cgg,cgg^cggcgg؃cggcggpcggfcggҐ ###############  #......@......W - ##.############[ #########...## #.....>......cgg?%# #.#######....## #.# ##.#.######### .# # W   phantom (dormant) #.# ###.#.........#cgge| ##.#.# #.# #...#########.#cgg ...#.# #.# ##.#..## #.# ##cgg$.#...#cgg} 824.3 (49.0)  A phantom comes into view.cggDF-5.3 (50cgg7cggC _Found a robe.cgg7( ###############  #......@......W  ##.############[ ...## #.....>......# #.cggʼn# #.#  .# # #.#   #.#   #.#  #.#  cgg! ###############  #......@......W  ##.############[ ...##.....>....#  .# # .#  .#  .#  #.# cgg0)4cgg60cgg3^ _A phantom is nearby!cgg ###############  #......@......W  ##.############[ ...## #.....>......# #.# #.#  .# # #.#   #.#   #.#  #.#  cgge ###############  #......@......W  ##.############[ ...##.....>....#  .# # .#  .#  .#  #.# cggQ4cggcgg9^ _A phantom is nearby!cggT##.......W###.#[#...## .....>......# ..# ##.#.# .# # ...cggtcgg/86.3 (1.0) _cggAcgghcggy # #.W# ##.#[# ...## # ##.#.# .# # cgg} cgg ~W.Wcgg &7cggB cggˌ cgge # #.W.# ##.#[# ...##  ##.#.# .# # cggh cggp 3W.cggq &8cggw cggbz cggo# #.W..# ##.#[# ...## ##.#.# .# # cggvcggv$39cgg|w:--=9cgg~cggI+ _The phantom hits you.cggacgg8b'30.5 (1.2cgggcgguk _You miss the phantom. The phantom barely misses you.cgge  You closely miss the phantom. Your tail-slap misses the phantom.1.7cggkcggo> _The phantom hits you but does no damage.cggVf   You hit the phantom but do no damage. Your tail-slap misses the phantom.40--2.8 (1.1cggj cggRm U _The phantom closely misses you.cggg C4.0 (1.2cggm cggp _You miss the phantom. The phantom closely misses you.cgg5  You closely miss the phantom. Your tail-slap misses the phantom.5.2cgg\9cgg;A _The phantom hits you but does no damage. x2cgg  You closely miss the phantom. Your tail-slap misses the phantom.cggW38-6.4cggcggT+ _The phantom hits you.cgg  You hit the phantom but do no damage.7.6cgg_cgg> _The phantom hits you but does no damage.cgg>8.8cgg _You barely miss the phantom. The phantom misses you.cggҭ  You closely miss the phantom.9=40.0cgg cgg > _The phantom hits you but does no damage.cggi  You hit the phantom.  The phantom is lightly damaged.1.2cggcgg7 _The phantom barely misses you. The phantom closely misses you.cgg$UA  You hit the phantom.  cggULThe phantom is moderately damaged.cggZ## #...§@.# ##.##W# cgg[...## .# >......# .#....# .. ###.#.## ## .# #  cgg\ck#####.....§#####cggd65--cggd!2.4cgghcggmJ _The phantom hits you. The phantom blinks! You blink.cgggT #####.......#####You barely miss the phantom.The phantom is moderately damaged.cgg[r6--3.5 (1.1cgg]U _The phantom closely misses you.cggd cggf You hit the phantom but do no damage.The phantom is moderately damaged.cggXg&4.7 (1.2cggvlcggGp cggpcggp1_The phantom closely misses you.cgg qcggR  You closely miss the phantom.The phantom is moderately damaged.1---5.9cgg cgg2 + _The phantom hits you.cggg  You hit the phantom.  The phantom is moderately damaged.The phantom hits you.cggK29----cgg0!7.1cggcggӬ cgg0_The phantom hits you but does no damage.cgg>  You slash the phantom! You tail-slap the phantom.  The phantom is severely damaged.cgg?(8.3cggyEcggLU _The phantom closely misses you.cgg)  You barely miss the phantom.You tail-slap the phantom, but do no damage.The phantom is severely damaged.cgg4*k3----9.5cggZ-cgg)0+ _The phantom hits you.cggTY  You barely miss the phantom.The phantom is severely damaged.cgg_#################..............###.############§# ##...## #@# ......# #W# ....# #.. # cgg`m ##.#.############# .# ##.........# ##.#.# #...###.# ...#.# #.#..## #.# ##.#...# ..§#..# #.# #......# #.#§#.# #.###.._.....cgggH§[cgghm0-----50.7cggancggqJ _The phantom hits you. The phantom blinks! You blink.cggMG cggG cgg~N cggsS ^ _You are too injured to fight recklessly!cggtQ4cggTcgg#X^ _You are too injured to fight recklessly!cggcggcggcggP^ _You are too injured to fight recklessly!cggLcggcgg|cgg^ _You are too injured to fight recklessly!cggl4cgg~cggI^ _You are too injured to fight recklessly!cgg cgg( cgg cggW Y _You are too injured to fight recklessly!cggX  You hit the phantom.  The phantom is severely damaged.cggY]16----1.8 (1.1cgg%_cggb+ _The phantom hits you.cgg, .You barely miss the phantom. Your tail-slap misses the phantom.The phantom is severely damaged.cgg-3.0 (1.2cgg^cgg cgg0_The phantom hits you but does no damage.cgg  You hit the phantom but do no damage.The phantom is severely damaged.cgg 47--cgg( !4.2cggŰ cgg _The phantom closely misses you. The phantom barely misses you.cgg6r  You hit the phantom.  The phantom is severely damaged.cgg| % ############## .............# ############[# .## #.# ..# #§#### ..# #...W..##############@# # #.........# ##.#.########.# ...#.# .## #.# ##.#...# ..# #.# #......### #.###.._..... ..# #...).......# ### #########..#.... #............#..#cggЅ cggֆ M3--5.3 (1.1cgg< cgg+ J _The phantom hits you. The phantom blinks! You blink.cgg ############## ............. ############[ .## #. ..§######...W. #.##############.# #........# ##@#. #########.# #.. .## #.# ##.#...#......## ###.._..... ...).......# ### #########..#..... #............#..##  #.############cgg1cggz.W-60cggcggcgg?############## ............. ############[ .## #. ..§#####..... #.##############W# #cggvN........# ###.#. #########.# #.. .## #.# ##.#...#.#......## ###.._..... ...).......## ### #########..#..... #............#..## cggi #.############...cgg?cggF.Wcgg@-7cgg cggcgg^  You closely miss the phantom.The phantom is severely damaged.cgg^l4=-=8.5 (1.2cggvecggi> _The phantom hits you but does no damage.cgg 9  You hit the phantom.cgg' E$cggg- 88 5/44=88cgg- J9.7 _You destroy the phantom!cgg3 cgg7 h _Your Dodging skill increases to level 3!cgg%M ############# ............. ############[#.# §#### ..# #.....# ##############.# .........# ### #########.# #...#.# .###.#...# ..# #.# #......##..#########...cggB,cgg,<-600 _cggY3cgg9cgg9b96-1.7 (2cgg[=cgg)?= _You now have 96 gold pieces (gained 8).cggM ############# ............. ############[#.# #.#### ..# #.....# ##############@# .........# ### #########.# #...# .## #.# ##.#...##........#......#..##62.7 (1cggkcggcggJ cgg cgg, cgg cgg cgg Xcgg cgg3 )96cgg cggN cgg 37=cgg cgg8 cgg cgg cgg cgg cgg cgg cggL cgg cgg cgg cggo S8=cgg. cgg cgg cgg cggJ ,cgg2 cgg cgg T19=cgg cgg ,cgg cgg cggH cggQ cgg ,cgg| cgg< cggw L20=cgg cgg5 cgg cggc cgg cgg cgg? cgg cgg* cgg= cggI cgg #1cgg 0=cgg9 cgg cggj cggj cggZ cgg cgg cgg cgg cgg% cgg& cggn #2cgg ;==cgg cgg*# cggx# cgg$ cggS' ,cgg( cgg* cgg* K3=cgg+ cgg. cggI. cggb/ cggy1 cgg1 cgg>2 cgg`4 ,cgg4 cggF6 i4=cgg6 cgg8 cgg9 cgg : cgg< cgg< cgg= cgg@ cggG@ cgg@ cggB cggC K5=cggG XcggRH cggH cggNI cggVK cggK S6=cgg?L cgg N cggJN cggN cggP ,cggQ cggFS ,cggT cggU cggU K7=cggV cggPX ,cggY cgg#^ Bcgg2_ ,cggH` cggHb cggb S8=cggOc cgge cggne cggwf cggi cggj cggzk cggm cggm cgg{n cggCp cggp K9=cgg-q cgg"s cgghs cggot cgg2w cggw cggDy cgg} j30=cgg~ cgg4 ,cgg߀ cgg ,cggE cgg ,cgg cggC 91cgg (=cgg cgg cggċ cggY cgg? cggu cgg cggؐ ,cgg cgg cgg3 N32=cggē cgg cgg cggn cgg cgg\ cgg cggܜ cgg 3==cgge ,cgg cgg cggš cggO cgg ,cggf cgg/ cggg U4=cgg4 cggͩ ,cgg cgg> ,cgg cgg cgg0 cggү cgg a5=cgg cggd cgg cgg cgg) ,cgg9 cgg 96cggf 2=cgg cgg~ ,cgg. cgg cgg cgg cggi cgg cgg cggg cgg K7=cgg cgg ,cgg cgg ,cgg cgg ,cgg cgg 8=cgg ,cgg# cgg ,cgg cgg ,cgg cggE K9=cgg cgg cgg{ cgg cggZ cgg O40=cgg cggG cgg cgg cgg ,cggA cgg( ,cgg cgg cgg K1=cgg cgg ,cgg cggN ,cgg cgg ,cgg cgg* cggl U2=cgg cgg ,cggx cggk ,cgg, cgg cgg K3=cgg  cgg ,cgg cgg ,cggV cgg ,cgg cggx cgg a4==cgg3 cgg~ cgg Bcgg1 cgg  cgge cgg  cgg9 cgg#& ............# ###########[# .. #.# .## #.#####S# .# #.....#.#############.#.#.......# ###.#.# ########.# #...#.## #.# ##.#.@.# .# #.# #......# .# #.###.._..... #...).......## ## #########..#.....  #............#..##S   ball python (constriction, asleep)  #.############...  #.# #.##  #.#cgg( 296806.0)cgg) cgg4 k.SS)cggY5 ,97cgg= cggI@ ^ _A ball python comes into view.cggEo[# .. #.# .# #.#####.#cggrF2 #.....#.##.#S# ###.#.# #...#.# #.# ##.#.@.# #.# #......##  #.###.._.....  #...).......##  ###..#..... cggFK ......#..##  ########... cggFO #.# #.##  #.#cgg[# .. #.# .# #.#####.# #.....#.##.#S# ###.#.# #...#.# #.# ##.#.@.# #.# #......##  #.###.._.....  #...).......## ###..#.....  cggL2......#..##  ########...  #.# #.##  cggcggYcgg*cggXb _A ball python is nearby!cgg[# .. #.# .# #.#####.# #.....#.##.#S# ###.#.# #...#.#cgga #.# ##.#.@.# #.# #......##  #.###.._.....  #...).......##  ###..#.....  ......#..##  ########...  #.# #.##  #.#cgg6[# .. #.# .# #.#####.# #.....#.##.#S# ###.#.# #...#.# #.# ##.#.@.#cggB7 #.# #......##  #.###.._.....  #...).......## ###..#.....  ......#..##  ########...  #.# #.##  cgg<cggo=cggnGx _A ball python is nearby!cgg{############ ...........# ### ########[# #.. # #.# #.# # cgg{{)#.#####.# # #.....#.# ##############.#S# ........# ###.#.# #####.# #...#@# cgg{r# #.# ##.#...# # #.# #......## cgg{# #.###.._..... #...).......## cgg{# #########..#..... #............#..##cgg|#.############...#.# #.##cggcgg F.ScggIU=70.0) _cgg(cggcgg =  You hit the ball python.cgg E$cgg ^96 9=1.8 (1.1cgg cgg O _You kill the ball python!cgg 4cggi cggv" H _No target in view!cgge4cggcgg0H _No target in view!cggIOIcggQcggUcgg Y: _cgg ]g102cgg`M _You now have 102 gold pieces (gained 6).cggfdcggdcggecgggcggjcgg5kcgg"lcggmcggqcggqcggrcggtcgg(v,cggwcggwcgg(ycgglycgg7zcgg{cgg'~,cgg~cggcgg,cggBcggYcggЉcgg7*102cggcgg9cgg,cggcggcgg=cggcggcgg̘cggcggcggkcgg%cgg%cggťcggucgģcggcggcggLcggcggTcggcggcggDcggcggRcggcggcggmcgg cggcggcggcggcggHcggcggcggcggncggcggcgg^cggcggicgg#cggcgggcggcggcgg3cgg0cggcggcgg}cgg,cggcgg}cggcggcgg)cggcggcggcgg<cgg4cggcggcggcggcggcggcggcgg!cggcggcggYcggjcggfcgg9cggcggcggcggcgg@cgg~cggA cgg cgg cggcggucggcggcggcggcggacggLcggcggcggYcggcgg!cgg!cgg{"cgg#cggM%cgg%cggW&cggW'cgg(cggK)cgg)cggV+cgg,,cgg-cgg/cgg1cgg%2cgg2cgg3cgg5cgg5cgg5cgg?7cgg8cggz9cgg:cggy;cgg=cgg>cgg?cgg@cggBcggCcggBDcggUEcggeGcggGcgg`HcggIcggKcgg*LcggLcggNcggPcgg=QcggQcgg^Tcgg[cggX\ cgg\(#.#cgg\ cgg]#.cgg1^ cgg^(#.#cgg_ cgg_#.cgg ` cgg`#.cgg` cggb#.cggc cggc#. cggc-#cgg@d#.cggd cggdcggQe-cgge9 #............cgg f cggfV....∩...######gcgggr ###..#### cggPh.... cggh2.### cggifg   goblin (asleep) cgg_icggicggj cggm{ cgg"| cgge| 3018.8 (47.cgg| 0)  cgg.IA goblin comes into view. It is wielding a +0 dagger.cggcgg>cgg-cgg %9.8 (48cggScgg^ cggcgga._Found Adwic's Antique Weapon Boutique.cgg #.# #.# #.# #.# #.# #.#cgg:3 #.# ##.# #@# # #............  ....∩...######g # ###..#### .... .###cggX  #.# #.# #.# cgg!Y &#.# #.# #.# #.#cggAY #.# #@#cgg\Y L #............  cggY ....∩...######g  ###..#### .... .### cgg5Z cgg_ cggi` cggf cggLj ] _A goblin is nearby!cgg0 i #.# #.# #.# #.#cgg ~ #.# #.# #.# ##.# #@# #cggӤ  #............  ....∩...######g # ###..####cgg = .... .###cggL !cggC s #.# #.# #.# #.# #.# #.# #.##.# #@# #............  ....∩...######g  ###..#### .... .### cggF ] _A goblin is nearby!cgg" f#.# #.# #.# #.# #.# cgg# #.# #.#  #..##.#########.....@......# ....∩...######g####..####  .....###cgg - cgg@. 920.8 (1.0) _cggq2 cgg5 cggz#.# #.# #.# #.# #.# #.# #.# #..##.# #.# ....∩...######g# cgg0###..#### .....###cggcggs]g.gcgg0===1cggcggV( _The goblin shouts!cgg}:#.# cgg#.# #.# #.# #.# #.# #.# #..##.# #.g.# cgg2 ....∩...######.# ###..#### ..cggi,.. cggcgg!g.cgg?'---cggȷ 2cggѽcggZcgg#.# #.# #.# #.# #.# #.# #.# #..##.# #.cggz4g..# ....∩...######.# ###..#### cggcggP=--3cggjcggS _The goblin barely misses you.cggB z  You barely miss the goblin. You tail-slap the goblin.cgg A$ cgg? G102 90cgg 5.0 (1.2cggH cgg J _You kill the goblin!cgg cgg cggN cggS H _No target in view!cggMcggcggFcgg4cggcgg0: _cggM  You now have 110 gold pieces (gained 8).cggh:10cggcgg> _You see here a +0 dagger.cgggcggcggcggIcgg%,cgg>,cggcggcggcgg2cgg.cggccggmcggcgg #.# #.# #.#cgg' #.#### #.# #.<.. #.##..##.######## #cggW ###.........)..# ....∩..@######.#-cgg31.0 (6.0 # ###..#### # #....cggN .### cgg'cgg}E-2.0 (7cggicgg; _Found an escape hatch in the ceiling.cggO3cgg3cgg4cggu7cgg:cgg?,cggr?cggOB,cggtCcggEcgg2H,cggHcggMcggIRWelcome to Adwic's Antique Weapon Boutique! What would you like to do?  a -  156 gold a longbow  b -  216 gold a crude morningstar  c -  108 gold a glowing slingd -  84 gold a trident  e -  84 gold a trident  f -  924 gold the +5 woodcutter's axe You have 110 gold pieces. cggR*[Esc] exit[!] buy|examine items[a-f] mark item for purchase [/] sort (type)[A-F] put item on shopping listcgg%f $  You are short 814 gold pieces for the purchase.[Enter] buy shopping listcggpb $ 1030 gold pieces for the purchase.cgggycggcgg?f.##.#ssays the Charlatan .##.##.#Draconian of Gozag  Gold: 110 .####.##.#Health: 44/44 ======================== .##...##.#cggMagic: 5/5======================== ...###..##.#AC: 5Str: 16 ..##.<...##.#EV: 11Int: 11 ...cgg9#..##.########SH: 0Dex: 12 ..## ######.........)..#cgg XL:  5 Next: 90% Place: Dungeon:4 ..........@...######.#cgg86Noise: ---------  Time: 3035.0 (3.0) #.## ######..#####r) +0 hand axe (venom)cgga#....#Zap: wand of flame (15)#.###.#cgg.. ##.#..#cgg2... _You kill the goblin! _No target in view!  You now have 110 gold pieces (gained 8). _You see here a +0 dagger. _Found an escape hatch in the ceiling.  There is an entrance to Adwic's Antique Weapon Boutique here.cggcggocgg& _No target in view! cgg+ You now have 110 gold pieces (gained 8). _You see here a +0 dagger. _Found an escape hatch in the ceiling.  There is an entrance to Adwic's Antique Weapon Boutique here. cggbZ_You can access your shopping list by pressing '$'.cggp 4cgg3r cgg7u F _Unknown command.cgger cgg s cggs cggv cggy cgg~} P _cgg cgg cggK cgg cgg ,cgg cgg@ cgg cgg7 cgg cggҍ cgg cggА cgg cgg. cgg ,cgg4 cgg cgg cggT *110cggM cgg cgg cgg cgge cgg cgg4 ,cgg cggT cgg. cggm cgg cgg! cggܧ ,cgg* cggF cgg cgg4 cgg` cgg cggY cgg cgg: cgg˰ cggѲ ,cgg cggγ cggѴ cgg cgg. cgg cgg$ cggW cgg cggF cggz cgg cgg͹ cgg cggȻ ,cgg cgg cgg cgg߾ cgg cgg cgg! cggS cgg cgg cgg ,###[# #...# #....#  #.# #.### ####.#  #.#####.# #.#  #.....#.# ###########.# #######.#.# #........##.# .cggy # ###.#.# #.######.##.# .# #...#.# #.# #.##.# .# ##.#...# ####.######.##.# .# #......## #$@.#.......##.#55.0 (20.0) .###.._..........###.###..##.# ...).......####...#...<...##.# ####..#..... ...##.#####..##.#### ........#..####. ######......... #########... .. ........∩...#####.####. #######..#####[ #....##.###.#cgg? cgg ,6.0 (21cgg_ cgg H _Found a ring mail.cggv.cgg/cgg1cgg-6cggu8cgg8cggo<cgg-@cgg@%6cggAcggEM _You now have 116 gold pieces (gained 6).cggHcggIcggIcggMcggPcgg QcggQcgg)TcggVcggWcggiWcgg;Ycgg [cggF[cgg[cgg]cgg_cgg`cggdacggccggMfcggfcggxgcgggicgg"o,cggppcggrcggucggkvcggvcggxcggz,cggT{cgg}cgg~cgg~cgg cgg)cgg)cggcgg~cgg͊a  You see here a +0 ring mail.cggcgg _cggPcggWcgg˗cggJcggcgg~cgg]cggcgg+cggcggcggȥcggcgg3cgg#.........#..####.########........ ##########................∩...### ##.####.########..#### cgg]#.####[######....#  #.....#....#.###.#  ######.###..# ##. cggz####### #.# #. # . .....# #.# # .. #####.# #@# ..  #.# #........ cgg #.# ###.J...#  #.# .##..# #####.# # .. cgg......#J   endoplasm (asleep) ####### cggGV##cgg-73.0 (17cgg,4.0 (18cggWcgg] _An endoplasm comes into view.cggz6..∩ cgg{N.  #.####[#  #.....#.  ######.###..# ##.  #.# #. # .  #.# # ..  #@# ..  #.# #........  #.# ###.J...# cgg{S #.# .##..#  # .. cgg{8 #cggt ..∩ .  #.####[#  #.....#.  ######.###..# ##. cgg  #.# #. # .  #.# # ..  #@# ..  #.# #........  #.# ###.J...#  #.# .##..# # ..cggJ cgg cgg! cgg & a _An endoplasm is nearby!cggi #########................∩...#### ##.####.########..#### .####[######....# #.....#....#.###.# ######.###..# ##. ###### #.# #. # . .....# #.# # . ####.# #.###.#.## ..  #.# #.@....... #.# cgg ###.J...###.#  .##..# ####.# .# ... .....# .# ###### ..o   orc .#J   endoplasm (asleep) o# cggs! cgg.4  An orc comes into view. It is wielding a +0 mace.cgg4 cggB6 cggA .Jo   orc wizard (wandering)Jwandering)cggB poThe orc shouts!==5.0) cggTK cggX _The orc moves out of view. _An orc wizard comes into view. It is wielding a +0 dagger.cggo ##.####.########..#### .####[######....# #.....#....#.###.# ######.###..# ##. ##### #.# #..# . ....# cgg#.# #..## . ###.# #.###.#.### ..  #.# #.......... #.# ###@....## #.#  #J##..# ###.# #.# ...# ....# cgg[#.# . ##### #.. #.# cgg#o# oo 2 orcs (1 oro J   endoplasm (wandering)r   quokka (wandering)cggJcggicggۼ.Jo   orc (.cgg/--6cggScggc _A quokka and an orc come into view.cggHk [....# ....#....#.########.###..# ##. ##### #.# #..# .....# #..## .. ###cggI1#.###.#.###  #.......... ###.....##  #@##..# ##J# ...# ....# .. ####. #.#oor.#.#cggRcggScgg8Vcgg(c.Jor.cgg-dA--7cggXncggrcgg6....#....#.########.###..# ##. ##### #.# #..# ....### .. ####.###.#.###  .......... ##.....##  #.##..# ## ...# ...J# .. ####..  #o#ocggv7Ir#..o.. .##.# ##oo 2 orcs (1 wandering)cgg ?cgg?cgg@cggAcgg{CcggN.Jor#...oo   orc (cgg*OcggVO8cggrXcggt\cggD#####.###..# ##. ##### #.# #..# .....## .. ######.#.###  ......... ##.....##  #.##..# ## ...# ...cggu .. ####Joo..... #r#..##?..#.....o. .####.# # oo 2 orcs (1 wandering).cggkcggcggcggcggro.o.o   orc (cgg&9cggcggAg _Found a scroll labelled SIGHAUT NAGAOL.cgg y  You catch the helpless endoplasm completely off-guard!  You hit the endoplasm.cgg z  You kill the endoplasm!The orc wizard shouts!cgg7 cgg P  You hit the quokka. The quokka is poisoned.cgg cgg  cggA"  An orc priest comes into view. It is wielding a +0 club.cgg. 116   --more--cgg oro.ocgg -opriestoo 2 orcsr   quokka (very poisoned)  The quokka bites you but does no damage.cggck1====80.2 (1.2cggcgg0"K _The quokka barely misses you.cgg-EYou closely miss the quokka.  The quokka is moderately wounded.The orc priest shouts!  You hit the orc. The orc is poisoned.  You hear a shout!  The quokka barely misses you.cgg cggcggcgg/  --more--cggV  The orc is distracted by your dazzling golden aura.cgg#ocgg#oo.oo   orc wizardoo 2 orcs (cggS1 very poisoned)r   quokka (very poisoned)An orc comes into view. It is wielding a +0 flail.cgg<===-cgg!1.4cggcgg _The orc shouts!dgg)9  You closely miss the quokka.The quokka is moderately wounded.You barely miss the orc.The orc is no longer distracted by gold.dgg<dggDI oo. The quokka bites you. The orc closely misses you.dggIu3-====2.6dggpQdgg~VT _The quokka closely misses you.dggG8  You hit the quokka.dgg+c$extremely poisoned)  You hit the quokka.  You kill the quokka!  You hit the orc but do no damage. The orc looks as sick as possible!  The orc  The orc priest calls down the wrath of Beogh upon you.dggc*Beogh smites you!dggdg27----------dggr/  --more--dgg *The orc wizard gestures at you while chanting.dggHdggaVoo 3 orcs (1 extremely poisoned)dggVY1------------2==--3.8dgg&6dggCdggvFS _Something hits you.dgg #.# #..# . # #.# #..## .. .# dggM#.###.#.### .. .# #.......... .# ###.....## .# #.##..### .# #.#.....###.# dgg#.#...#. #$$.P.#.#..##?..._#.#..... .P......#### .##.#####.dggm##.. dggo8_dgg&7dggdgg  _Found a basalt altar of Yredelemnul. Something hits you but does no damage.dgg # #.# #..# . ..# #.# #..## .. #.# #.###.#.### .. #.# #.......... #.# ###.....## #.# #.##..### #.# #.#.....###. ..# #.#...#.....# #$$.P. #.#..##?..._ #.#..... .P. .....#### . ##.#### #.# #..  #.dgg  #.# #..# .  #.# #..## ..  #.### ..  .....  ..##  #.##..###  #.#.....###.  #.#...#..... dgg V #$$@......P.  #.#..##?..._  #.#..... .P.  .....#### .  ##.#### #.#  #..  #.   dggҋ  #.# #..# .  #.# #..## ..  #.### ..  .....  ..##  #.##..### dgg  #.#.....###.  #.#...#.....  #$$@......P.  #.#..##?..._  #.#..... .P.  .....####  ##.#### #.# dgg 3#.. dggB 5#. dgg v _Something hits you.dgg *3--dggF 8dgg 9_dgg V _* * * LOW HITPOINT WARNING * * *dggP # #.# #..# ..# #.# #..## .. ##.# #.###.#.### ..  #.#dgg  #..........  #.# ###.....##  #.# #.##..####.# #.#.....###..# #.#...#.....# #.P. #.#..##?..._ #.#..... .P. .....#### . ##.#### #.# #..dggl = #.dgg: dgg !4dgg 2--9dggF dggȱ _Something hits you but does no damage. _Items here: $ )) [. dgg7# #.# #..# ..# #.# #..## ..#.# #.###.#.### .. #.# #.......... #.# ###.....## dgg7 #.# #.##..####.# #.#.....###..# #.#...#.....# #@$.P. #.#..##?..._ #.#..... .P. .....#### . dgg7= ##.#### #.# #.. #.# dgg|: dggA8_ dggB7-100 _ dggH dgg0Oj _Items here: $ )) [[. dgg M ######.#### ####..# . ...# #..## #####.#.### ............###.....##  #..### ###.#.....### ....#...#.... #####$$.......P...##?..._#.#..... .P..#######.# dgg"  dgg .=1 dgg$  dgg& f _Something hits you but does no damage. dgg5 ,M.....#....#.###.# ######.###..# ## ####.# . ...# #..## #####.#.### ............###.....##  #..### ###..### .....#...#.... #####$$.......P.#.#..##?..._..###.. dggM6  dggL:    .# ##.  #.# #..# .  #.# #..## ..  #.###.#.### ..  #.# #..........  #.# ###.....##  #.# #.#  #@# dgg: $  #.#  #$$  #.#..##?..._  #.#..... .P.  .....#### .   ##.####   #.#  dgg: T#..  dggU    .# ##.  #.# #..# .  #.# #..## ..  #.###.#.### ..  #.# #..........  #.# ###.....##  #.# #.#  #@#  #.#  #$$  #.#..##?..._ #.#.....  .....####  dgg^ ##.#### #.# #.. dgg` ._Something hits you. dgg@32 dgg dgg# V _* * * LOW HITPOINT WARNING * * * dgg` dggaG43.3 (1.1 dggf dggFi _You closely miss something. Something hits you but does no damage. dgg  dgg` -4.5 (1.2 dggۧ  dgg z _You miss something. Something hits you but does no damage. dgg8_ dgg:1165.6 (1.1 dgg9{ dgg! _You closely miss something. Something hits you but does no damage. dggt dgguT5=6.7 dggy9_ dgg| _You barely miss something. Something hits you but does no damage. dggNd  You completely miss something. Your tail-slap misses something. dggO-7.9 (1.2 dgg%T dggWf _Something hits you but does no damage. dgg ~   .# ##.  #.# #..# .  #.# #..## ..  #.###.#.### ..  #.# #..........  #.# ###.....##  #.# #.#  #@#  #{#  #$$  #.#..##?..._  #.#..... .P.  .....#### .   ##.#### dggm   #.#  #..  dgg̓    .# ##.  #.# #..# .  #.# #..## ..  dgg7  #.###.#.### ..  #.# #..........  #.# ###.....##  #.# #.#  #@#  #{#  #$$  #.#..##? #.#.....  .....####  ##.#### #.# #.. dgg  You hit something. Your tail-slap misses something. Something hits you. dgg J3-9.1 dggk l _* * * LOW HITPOINT WARNING * * * dgg"k4-10.3 dgg dgg3| _You hit something. Something hits you but does no damage. x2 dgg?_ dgg}!1.5 dggC9_ dgg _You closely miss something. Something hits you but does no damage. dgg?  You barely miss something. dgg $_Reactivating autopickup. dggH 116 5/51=22.7 _You feel a bit more experienced. dgg9_ dgg?i _Your Fighting skill increases to level 3! dgg  #####.###..# ##. ##### #.# #..# .....## .. ######.#.###  .........  dgg6 \##.....##  #.##..### ##.#.....###. ...#.... ####$.......P #.#..##?..._..###..#.# dgg  dgg 2-30  dgg _ dggM 6_ dgg j  You now have 123 gold pieces (gained 7).  Things that are here: dgg: b23-4.7 (2 dggf 6_ dgg L _a +0 dagger; a +0 robe dggz 3 dgg{  dgg , dgg  dgg#  dgg S6= dgg)  dgg , dggō  dgg , dgg~ 7= dgg  dggҙ  dgg  dgg)  dggJ  dgg  dgg , dgg  dggܭ 8= dgg  dgg  dgg|  dggH ~1239 dggں , dgg  dgg , dgg9  dgg , dgg6  dgg  dgg. J20= dggx  dggN , dgg  dgg , dgg  dgg , dgg  dgg  dgg $21 dgg (= dgg]  dgg , dgg  dggR , dgg  dgg  dggC =2= dggg  dgg  dgg , dggv  dgg  dgg  dgg2  dgg  dgg  dgg  dggF  dgg} 53= dgg  dgg  dgg  dgg  dggn  dggM , dgg  dgg S4= dgg  dgg B dgg  dgg , dggd  dgg% , dgge  dgg  dgg K5= dgg  dgg , dgg1  dgg  dgg  dgg!  dgge) 6= dgg1*  dgg(: =7= dgg< , dgg">  dggB , dggYC  dggD  dggE S8= dggCF  dggI , dggK  dggAM  dggyM  dggO  dgg$S  dggS K9= dggdU  dggmY , dggM[  dgg] , dgg^  dggka  dgga  dggb  dgge  dggOf T30= dggg  dgg|j , dggk  dggn  dgg0n  dggXo  dggr  dgger K1= dggs  dggiv , dggz  dgg} , dgg  dgg  dgg  dgga  dgg  dgg S2= dgg  dgg , dgg  dggs  dgg  dgg  dgg  dggԑ K3= dgg  dggQ  dgg  dgg  dgg , dgg  dgg , dgg#  dggϡ  dgg S4= dggf  dgg , dgg  dgg , dgg  dgg=  dggo  dgg԰  dgg: a5= dgg  dgg  dgg;  dgg  dggx  dgg  dggʾ  dgg  dgg 96 dggC  dggT , dgg}  dgg , dgg0  dgg , dgg  dgg  dggg N37= dgg  dgg , dgg  dgg  dgg  dgg*  dggk  dgg W8= dgg  dgg , dgg  dgg , dgg>  dgg  dgg  dgg  dggX  dgg #9 dgg (= dgg  dgg? , dggt  dgg{  dgg  dgg&  dgg  dgg` V40= dgg  dgg , dgg  dggG  dggs  dgg  dggm , dgg  dgg)  dggr K1= dgg  dgg: , dgg  dgg , dggM  dgg , dgg  dgg! 92 dgg&" 2= dggZ#  dgg%  dgg.&  dggM'  dgg*  dgg*  dgg+  dgg.  dgg. K3= dgg"0  dgge3 , dgg4  dgg7  dgg7  dgg8  dgg<; , dggV?  dggA  dgg=B U4= dggC  dggfF , dggpG  dggI , dggJ  dggM  dggM K5= dggO  dggQ , dgg{S  dggU  dggV  dggtW  dggZ , dgg[  dgga^  dgg^ N6= dgg_  dggc , dggdd  dggf , dggNh  dgglj  dggj K7= dgg[l  dggn , dggo  dggr , dggt  dggDx , dggy  dgg0} k8= dgg~  dgg% , dgg{  dgg  dgg8  dgg|  dgg  dgg$  dggf  dggd  dggŽ K9= dgg  dggV , dgg  dgg , dggq  dgg  dggr V50= dggݟ  dgg , dgg  dgg , dgg_  dgg< , dggB  dgg  dgg1 K1= dgg\  dgg  dgg , dgg  dgg N  You now have 139 gold pieces (gained 16). dgg{ &39 dgg  dggO W _Items here: )) [[. dgg 3 dgg  dgg k  You now have 154 gold pieces (gained 15).  Things that are here: dgg" X54= dgg  dgg j _a +0 flail; a +0 mace; a +0 ring mail dgg 3 dgg  dgg  dgg  dgg  dgg  dgg  dgg , dgg  dgg)  dgg , dgg  dgg  dggH , dgg  dgg #.# #..## ..  #.###.#.### ..  #..........  ###.....## #  #.##..### #.. #.#.....###...# dgg ~#)#...#.......# #)).......P.P.#  #.#..##@..._...  #.#.....#.P.P..  dgg ........#### ..... ####.#### .#.# dgg. #.# # ##.. dggO ?#.#  dgg8 x_250.7 (136.0)17 dggZ  dgg" d _u - a scroll labelled SIGHAUT NAGAOLdgg%dgg<&dgg(dgg].dgg9v#.# #..## .. #.###.#.### .. #. ###.....## # ##.##..### .#.#.#.....###...# #)#...#.# #)).P.P.##.#..##.@.._.0.0)dgg9s#.#.....#.P.P..####(.####.#### ##.#.##.# .# ##.. # dggDFdggF+2.7 (1dggNdgg8Q% _Found 4 stones.dggdggdggdggdggh#.###.#.### .. #.......... )####.....## .##### #.##..### .#... #.#.....###...# #)#...#.......# #)).......P.P.##.#.#..##...._.....#.#.....#@P.P0........####(....####.#### ###.#.##dgg` #.# .# ##..  ##.# dggdgg6+3.7 (1dggdgg# _Found a mace.dggl; Idggl? dgg8C dggC dggG ,dggM d#.......... )# dggRN S###.....## #.#####.##..### #.#... #.#.....###...# #)#...#.......# #dggN #)).......P.P.##.###.#..##...._......##.#.....#.P.P.dggN ........####(.@......#####.#### ###.#.##.## #.# #.# # #.. #.dggMO ##.# #.# ..#S   adder (asleep)S.#.#.dggY &4dgg2Z +5.7 (2dgg^` dggd Y _An adder comes into view.dgg"b   )#  ..## #.#####  #.##..### #.#...  #.#.....###...#  #)#...#.......# #  #)).......P.P.##.##  #...._......#  #.P.P......  #(.@......#   ###.#.##.##  #.# #.# #  #.. #.# #.# #.# ..# dggb lS.# .#.dgg5   )#  ..## #.#####  #.##..### #.#...  #.#.....###...#  #)#...#.......# #  #)).......P.P.##.##  #...._......#  #.P.P......  #(.@......#   ###.#.##.##  #.# #.# #  #.. #.# #.# #.# ..# S.#dgg! P .#. dggi4dggp dgg ] _An adder is nearby!dgg.  )#  ..## #.#####  #.##..### #.#...  #.#.....###...#  #)#...#.......# #  #)).......P.P.##.##  #...._......#  #.P.P......  #(.@......#   ###.#.##.##  #.# #.# #  #.. #.# #.# #.# ..# dgg /lS.# .#.dggE  )#  ..## #.#####  #.##..### #.#...  #.#.....###...#  #)#...#.......# #  #)).......P.P.##.##  #...._......#  #.P.P......  #(.@......#  dgg  ###.#.##.##  #.# #.# #  #.. #.# #.# #.# ..# S.# .#. dgg2_dggsdggdgg] _An adder is nearby!dggs'##.....## #.##### #.##..### #.#... .....###...# )#...#....#)).......P.P.##.##.#..##...._.........#.P.P..............####(........#####.#### ###@#.##.## #.# #.# # . # .S.#..# #dggkdggC26.7 (1 _dggdggbdgge~ #.##..### #.#... .....###...# )#...#....#)).......P.P.##.##.#..##...._......#...#.P.P..............####(........#####.#### ###.#.##.## #.# #@# # . # .Sdggze#.#..# ##dgg'r<7dggzdgg}dgge=.....###...# )#...#....#)).......P.P.##.##.#..##...._.........#.P.P..............####(........#dgg=Z####.#### ###.#.##.# #.# #.# # . # ..S##.#..# ## dggLF,dgg,G>  The adder hisses angrily.dggP4_Sr.Sr   quokkadggQ/==8dggwYdgg\Y _A quokka comes into view.dgg< dgg r.  You barely miss the adder. Your tail-slap misses the adder.dgg 5-9.9 (1.2dgg" dgg&& = _The adder bites you but does no damage.dgg P  You slash the adder! The adder is poisoned.dgg .r (very poisoned)  The adder is severely wounded.dgg C-61.1dggr dgg { _The adder bites you but does no damage. The adder closely misses you.dgg;q  You miss the adder. You tail-slap the adder.dgg?dggGr.r   quokkadggJQ154 32.3dggLQ8_dggqoI _You kill the adder!dgg:  You slash the quokka!dggF$dgg543.4 (1.1dgg8_dggGJ _You kill the quokka!dggdggdggdggĢH _No target in view!dggo< dgg< dggRD dgg=F H _No target in view!dgg _dgg& : _dgg |65dgg N _You now have 165 gold pieces (gained 11).dggN 3dgg dgg dgg?  #)).......P.P.##.## #.#..##...._......# #.#.....#.P.P......dgg ........####(..#####.#### ###.#.##.## #.# #.# #  #.. #.# dgg #.# #####.#  #...@.#-6.4 (3.0 .........#dgg (###.##.#.## .###..dgg V ## #.. dggx 6.## .dgg .dgg 8_dgga E-7.4 (4dgg" 8_dggx% % _Found 5 stones.dggd3dgg-dggOdgg,dggd,dggcdggdggdggdgg8dggfdggdggdggdggͪ*165dgg`dgg"dgg###.#### ###.#.##.## #.# #.# # #.. #.# #.# #####.#  ###.....# .........## >(###.##.#.######... # #.###......^..## #.#@......#71 #.##.####.## #. ... + ............+......###......#########dgg 2.4 (5 _Found a stone staircase leading down.dggBdgguBdggCdggeHdggLdggQ,dggRdggTdggUdggVdggTXdggx[,dgg\dgghaBdggyd _u - 2 scrolls labelled SIGHAUT NAGAOL (gained 1)dggi_dggDldggrldggmdggOndggp,dggHqdggFsdgg_udggudggFvdggGxdggz,dgg{dggj|dgg~dgg~dggdggdgg,dggdgghdgg{dggdgg^dggjdgg:dggodggdgg>dgg\.####(........#  ## ###.#.##.##...# f#  #.# ##. #...# ..dggޙ  #.# .##...##. #####.# ....... ###.....# .....  ........## #..># dgg  ###.##.#.######...#  dgg71# #.###......^@.#  ####.#.......##  dggm#.##.####.## #......##.#  +......##.#  +.........#   f   sleepcap (dormant)+......#### dgg` #......#  ########dgg dgg85.4 (13.0)6.4 (14 _A sleepcap comes into view.dggRB( #.##...# f#  #.# ##. #...# ..  dggBP#.# .##...##.   .......  .....  #..># ######...#  # #.###......^@.#  ####.#.......##  #.##.####.## #......##.# .##.#dgg C  ....# dgg)C### dgg>C dggSC*dgg( #.##...# f#  #.# ##. #...# ..  #.# .##...##.   .......  .....  #..># ######...#  # #.###......^@.# dgg ####.#.......##  #.##.####.## #......##.# .##.# ....# ###  dggdgg2dggdgg_ _A sleepcap is nearby!dggC ( #.##...# f#  #.# ##. #...# ..  #.# .##...##.   .......  .....  #..># dgg######...#  # #.###......^@.#  ####.#.......##  #.##.####.## #......##.# .##.# ....#dgg/B ###  dggb"dggb p( #.##...# f#  #.# ##. #...# ..  #.# .##...##.   .......  .....  #..># ######...#  # #.###......^@.#  ####.#.......##  #.##.####.## #......##.# .##.# ....# ###  dgg 4dgg dgg _ _A sleepcap is nearby!dggj ( #.##...# f#  #.# ##. #...# ..  dgg9 #.# .##...##.   .......  .....  #..># ######...#  # #.###......^@.#  ####.#.......##  #.##.####.## #......##.# .##.# ....# ###dgg H  dggn ( #.##...# f#  #.# ##. #...# ..  dggN #.# .##...##.   .......  .....  #..># ######...#  # #.###......^@.#  ####.#.......##  #.##.####.## #......##.# .##.# dgg ....# ###dgg 2  dgg~ dgg dgg dggҬ  ..#.P.P  ##(........#...# #  dgg # ###.#.##.##...# f# #.# ##. #...# .  #.# #.##...##  #####.# #... ##.....# .......  .......## #..>#  ##.##.#.######..@# dggѭ D # #.###......^..#  ####.#....... #.##.####.#dgg  #......##.#  +......##.#  +.dggG ..#  +......#### #......# dgg~ X _A sleepcap is nearby!dgg= dgg t.ffdgg 87.0) _dgg dgg dggh: ##...._......# ...#.P.P...... ###(........ # ###.#.##.# .#dgg!;##. #...# f.# ##...##..#  #####.# ##...# ## ...........# .......## ##.##.#.######.  # #.###......^..####.#.......####.####.#####....+###dgg?dgg0Gd_.fdggG&8dggNdggQ dgg!RU_There is a stone staircase leading down here.dggY`....P.P.##.##  #...._......###.  ..#.P.P.........# #  ###(........#...# .#  ###.#.##.##...# .#  dggm#.# ##. #...# ..#   #.# #.##...##f.#  ###.# ## #.....# ........@..# ......## ####..>#### #.##.#.######...# dgg # #.###......^..#  dgg}W####.#...... #.##.####.# #......##.#  +......##.#  dggQ+...#  dggdggJd_.fdgg -9 _dgg7_dggۿdggm (very poisoned)You hit the sleepcap. The sleepcap is poisoned.  The sleepcap is lightly damaged.dggn6=90.6 (1.2dggu7_dggyM _The sleepcap releases spores at you but does no damage.dgg\ _You hit the sleepcap but do no damage.The sleepcap is lightly damaged.dggm]dgg]&1.7 (1.1dggec _The sleepcap releases spores at you but does no damage.dgg:E m0-looks as sick as possible!  dggE You tail-slap the sleepcap, but do no damage.  is lightly damaged.  The sleepcap releases spores at you.  You are engulfed in a cloud of soporific spores!  You fall asleep.dgg~K /  --more--dgg&no.###.....# # (#...# .#  #...# .#  #.# ##. #...# ..#  #.# #.##...##..#  ##.......f..#  ........@..#  ####..>#### #...# # ..^..#  ......##  #.##.####.## extremely poisoned)  #.#  #.#  dgg!rdggr2  2 dggs5-2.9 (1.2 _dggsdggys.###.....# # (#...# .#  #...# .#  #.# ##. #...# ..# dggBzu #.# #.##...##..#  ##.......f..#  ........@..#  ####..>#### #...#  ..^..#  ......##  #.##.####.##  #.#  #.# dgguz dgg~dggRx42-----11 ==3.9 (2dgg7_dggTG _The sleepcap releases spores at you! You wake up.dgg1 {  You hit the sleepcap but do no damage. You tail-slap the sleepcap.  The sleepcap is heavily damaged.The sleepcap releases spores at you but does no damage.1-----5.1 (1dgg dggܡ : _The sleepcap releases spores at you.dggJP _verdgg";You hit the sleepcap but do no damage.You tail-slap the sleepcap, but do no damage.The sleepcap is heavily damaged.36----6.3dgg^dgg: _The sleepcap releases spores at you.dggu _ extremely poisoned)You hit the sleepcap. The sleepcap looks as sick as possible!  The sleepcap is severely damaged.dggz-7.4 (1.1dgg7_dggN _The sleepcap misses you.dggq  _ You hit the sleepcap but do no damage. The sleepcap looks as sick as possible!  The sleepcap is severely damaged.dggEe37=--8.5dgg.7_dggVU _The sleepcap barely misses you.dgg  You hit the sleepcap.  The sleepcap is almost destroyed.9.6dggdggmV _The sleepcap closely misses you.dggd :  You hit the sleepcap.dgg[l o$dggmr 165 =36300.8 (1.2 dggr B_You destroy the sleepcap!dgg4x dggz e _Your Axes skill increases to level 3!dgg 6_dggA dgg# dgg% H _No target in view!dgg dggdggdggKdggļX8 _dggXdggHdgg,dggdggdggbK9=dggdgg,dggdgg,dggdggdgg(V40=dgg dgg,dggdgg[,dgg1dgg,dgg dggUdggK1=dggedggdgg@165dgg ,dggdgg,dggVdggdggHN2=dggdgg,dggEdgg,dggdggdggZK3=dggdgg,dggdgg,dggdggN,dgg5dggdggU4=dggdgg#,dggdgg,dgg dggX dgg K5=dgg dggdggdggdgg'dggedggdggC,dggdggdggU6=dggdgg,dgg/dggq,dggdggGdggK7=dggdggodggdgg dgg!dgg!dggN"dgg9$dggy$dggE%dggD(k8=dgg(dgg*,dgg+dgg-,dgg.dgg1dgg[1dgg2dggN4dgg4K9=dgg5dgg-8,dgg8dgg:,dggZ;dggQ=dgg=V50=dgg >dgg@,dggAdggC,dggCdggE,dggFdgg0Idgg@JZ1=dgg|KdggM,dggzNdggQdgg4R&74dggSdggUM _You now have 174 gold pieces (gained 9).dggXdgg.YdggZdgg[dgg]dgg^9=dgg_dgg_dgg*bdggibdggbdgg8ddgghXdgg$i,dggidggdjdggk,dggkdggldggn,dggndggv  ..  # ..  86 )#  #.##### ####  # #.#... ..##  ###...# ...#  ......# # #..#  ..P.P.##.## #..#  ..._......###. #@.#  - #.P.P.........##..#  #(........#...##..# ###.#.##.##...##..# .# ##. #...##..# #.# #.##...##..# ###.# ##..........# ....# ...........## dggv....## ####..>#### You now have 186 gold pieces (gained 12).dggj{_57.8 (57.0)-8.8 (58dgg,~dgg. _v - a wand of roots (10)dggV3dgg'dggdggdggzdgg,dggx##.  .  .. # .. . )# # dgg_) #.#######.###### # #.#... ........# ###...# .<........# # 9.8 (1.0) ..P.P.##.## ..._##. #.P.P.........##..# #(........#...##..# . . dggJ....#dgg2_dgg,60.8 (2dgg2_dgg|9 _Found a stone staircase leading up.dggUdggdgg/dggdgg[wM.# ##.  # .. . )# #  #.#######.######  #.#... ..# ###.<.....0....# ##[###P.P.##.## #. ..._......###. #..# dgg"#..#dgg"dgg+1.8 (1dgg 8_dggC _Found a robe.dgg{ 3dgg dggv dgg dgg Bdgg ,dgg dggs dgg dgg] dgg/ dggé dgg| ,dgg dgg dgg dggG dgg dgg dggθ dgg dgg dgg \  You see here a +0 robe.dgg dggN  _dgg dgg dgg dgg dgg dgg dgg ,dgg dgg dgg ,dgg dgg dgg dggT dggX dgg dggm ,dgg dgg dggr dgg dgg dgg dgg# dggv dgg dgg dgg7 dggc dgg dgg* dgg ,dgg` dgg dgg dgg- dgg dggh dgg dgg dgg dgg" dgg& dggK& dgg' dgg* dgg- dgg. dgg/ dgg4 dgg6 ,dgg58 dgg: dggz< dgg< dgg= dgg@ dggB dggB dggC dggcE dggG dggG dggH dggkJ dggL dggM dggM dggO dggR dggR dggT dgg/V dggX dgg7Y dggTZ dggib dgg'd ,dgge dggg dggyi ,dgg(k dgg{m dggo ,dggp dgg&s dggu dggv dggw dggy dgg!{ dggF{ dggf~ dgg dgg0 dggT dggf dgg dgg* dggX dgg dggS dggӊ Bdgg   Things that are here:  a +0 dagger; a +0 robe _  Items here: )) [[. _dgg XdggF ,dggU dgg dggϾ ,dgg dgg0 dgg ,dgg dgg+ dgg@ dgg dgg> dgg dggF ,dgg: dgg dgg dggx dgg< dgg dgg? ,dgg> dgg6 dgg ,dgg dgg dgga ,dggs dgg dgg ,dggK dgg dgg ,dgg dgg dgg dgg dgga dgg dgg ,dggd dgg! dgg/$ ,dgg% dgg ' dgg) dggK* dgg+ dgg6- dggg0 ,dggz1 dgg4 ;  You see here 5 stones.dggL7 dggE8  _dgg8 dgg]: dgg; ,dgg3< dggt= dggF@ ,dgg@ dgg1C dggiE ,dggHF dggeK dggM dggN dggN dggeP dggnR ,dgg)S dggT dggV dgg:W dggW dggY dgg] BdggL_ dgga ,dggb dggd dggf ,dggg dggSj dggl ,dggm dggu   #.# #.#.###..... ..######.# ######.#.... ........## #.##.### .#######.# #......#dggv  #.# +......# #.# +....... #.# +......# .########.# #......# dggsv ....# ######## ###########  dggv ? You pick up a book of Air and begin reading...dggz| 1427.8 (66.0)dgg} ,8.8 (67dgg dgg7 X _You add the spells Shock, Swiftness and Airstrike to your library.dgg IdggΝ dgg$ dgg dggX Xdgg dggF dgg ,dgg dgg0 dggR dgg dgg dgg0 dgg^ Bdgg̯ dggޱ dgg" dggp dgg dgg ,dgg dgg dgg ,dgg dgg^ dggk ,dgg dgg dgg5 ,dgg dgg dgg& dggU dgg dgg% dgg9 G...# ###(### #..##.# # #..# ..######.# #..# ........## #.. .#######.#  #.# ####.# ....######## #.# >..########.# dgg 39.8 (11#..........#############dggJ dgg -40.8 (12dgg dgg ; _Found a stone staircase leading down.dggudggv3dggydgg|,dgg U ....# ###(##..#.. #.  #..##. ..######.  #..##. ..##  #..#. .#######.##< #.#.#####. #.#..## #.##.>....########.#1.0)##..........# #####dgg~dgg+2.8 (2dggdgg9 _Found a stone staircase leading up.dgg 63dgg6dgg8dgg>Xdgg@dgg@dgguAdggBdgg%EdggiEdggEdggGdggI,dggJdggpMP  There is a stone staircase leading up here.dggZ _dgg\,dgg\dgg]dgga`BdggZadgg_bdggc,dggcddggfdgg)l:.#.§§...# #.##....... ........# #.# #.#####. ......<.# #.## #. ..####..#####. #. .# #........#> #. . #..#######. #. . #..#  #.....# ####.####  #dggl###..# ## 52.8 (10.0)#..# #.#####.# ..#####..##.#######.......#..#.........#######<########..#####.#dggm........##########.>...........####### dggup#############........ dggw,3.8 (11dggzdgg|9 _Found an escape hatch in the floor.dggAxdggky3dggj{dgg5~dgg~dggP,dgg5,dgg׃dggdgg;,dggdggdggdgg4dggčdgg6dggޑ,dggdggPdggޖdgg2dggdggdgg8dggdgg:dggdggdggdggdggdgg^,dggwdggdggf,dggAdgg]dggq,dgg9dggָdggdgg<dgg$dggdgg,dggdgg2dgg,dgg>dggdggdggdggdgg #. #..#######.#  #. ##..#  ....# ####.####  ###..# #.......#  #..# #.#####.#  dgg#..####.# #.### ########.......# #... ............##.# #<# ####@.......#####.# #.............. #.....###.> #.....# ########### dgg 68.8 (15  You now have enough gold to buy a pair of crude boots on D:2.  You can access your shopping list by pressing '$'.  You now have 199 gold pieces (gained 13).dgg5999.8 (16dggdgg` _f - 2 silvery potions (gained 1)dgg dgg dgg dggF dgg dgg Bdgg dgg dgg dgg dgg  ,dgg dggq dgg ,dgg dgg9! dggP# dgg# dgg$ dgg' dggL) ,dgg<* dgg+ dggD- ,dgg- dgg. dgg0 ,dggY3 dgg 8   ##.# #........  #. #..######  #. ##..#   ....# ###  ###..# #..  #..# #. #..####.#dggS8 X  #.###########....... #...@............##.# ############........  #.. dgg8  #.....###.  #.....# ## #######dgg8 "dggz< 277.8 (8.0)dgg< +8.8 (9dgg> dgg@ - _w - a scroll of amnesiadgg dgg 3dgg dgg Bdgg} dgg0 dgg dgg dgg dgg dgg dgg dggK dgg dgg dgg dgg dgg dgg dggc dgg4 dgg dggM dgg dgg` dgg ,dgg dgg ,dgg" dgg I _g - 2 potions of ambrosia (gained 1)dgg dgg dgg: dgg\ dgg ,dggP dgg dgg Xdgg' dgg ( dgg{* dgg* dgg+ dgg, dgg. dgg$/ dgg/ dgg2 dgg55 ,dgg5 dgg7 dgg: dgg: dggp; dgg= dgg? ,dgg@ dggoB dggD ,dggE dggE dggG ,dgg=H dggVI dggJ ,dggK dggO Xdgg P dggQ dgg R dggwR dggS dggYU dggyU dggU dgg W dggX dggX dggY dggwZ dgg[ ,dggN\ dggO] dgg^ ,dgg_ dgga dggd dggd dggwe dggg dggYj dggj dggdgg@dgg2@dgg@dggeP  There is an escape hatch in the floor here.dgg dgg _dggdggdgg,dgggdgg dgg ,dgg" dgg dgg,dgg-dggYdggdggdggjdggdgg,dggPdgg6dgg,dggdggdggA,dggdggdggzdggdggdgg#dgg%dgg%dgg@&dgg(dgg*,dgg,dgga/dgg92dggz2dgg4dgg9dgg=Bdgg>dgg A,dggAdggFNdggQ,dggSdggVdgg>Y,dggiZdgg]dgg`dgg`dggadggddggjBdggldggndgg,odgg`pdggsdggxBdggzdgg},dgg~dggہdgg,dgg(dgg:dgg,dggdggdggdgg/dggdggdggҟ,dggdggڤdggOdggdggdgg,dgg,dggdggdggdggͽdggsdggBdgg],dggndggdggdggdggYdgg7dgg,dggdggEdgg,dggdgg1dggdgg<dgg3dggdgg,dggBdggdgg,dggdggJdggYdggdgg dggdggdggDdggdgg>dgg!,dggm#dgg<&dgg0*,dgg,dgg).dgg1dgg<1dggy2dgg4dgg7,dgg8dgg*;dggv=,dgg>dgg7@dggCdggUCdggtDdgg$FdggH,dggJdggLdggCNdggNdggTOdggPdggSdggSdggTdggUdgg\dgg@]dgg_,dgg `dgg]adggcdggBcdggcdgg'edgggg,dgg!hdggkdggcu..# #.#.# #####.#.##..........# ..# #.#.###.....#............## ..# #...........#######..>### ..# ###(###.##.#.######...# ..# #.# #.#.###......^..# dggu..######.########.#.......## ........##.... #.##.####.## .#######.#.≈≈≈.#......##.# ## #.#...≈.'@.....##.#  dggv#.#._.≈.'.........# # #.#...≈.'......#### ########.#5≈≈≈.#......# dgg:v.........#...5.######## ###############dggivd55 2 ufetubi (asleep) dgg  97.8 (80  You open the gate.  2 ufetubi come into view.dggdggdgg5.5..551 wandering)dgg6===8.8 (81dggӓdggM _The ufetubus shouts! _Found a glowing golden altar of the Shining One.dggx..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.#  #.#...≈.'@.....##.#  #.#._.≈.'.........# #dggx #.#...≈.5......#### #.≈≈≈.#......# #.5...######## ######dgg!..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.#  #.#...≈.'@.....##.#  dggB"X#.#._.≈.'.........#  #.#...≈.5......#### #.≈≈≈.#......##.5...############## dgg6,4dgg4dgg7d _There are monsters nearby!dgg1^..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.# dgg^f #.#...≈.'@.....##.#  #.#._.≈.'.........# # #.#...≈.5......#### #.≈≈≈.#......# #.5...######## ######dgg..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.#  #.#...≈.'@.....##.#  #.#._.≈.'.........#  #.#...≈.5......#### #.≈≈≈.#......##.5...############## dggRdggdggdgg) d _There are monsters nearby!dggSG..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.#  #.#...≈.'@.....##.#  #.#._.≈.'.........# # #.#...≈.5......#### #.≈≈≈.#......# #.5...######## ######dgg3dggð \..# #.#.# #####. ..# .  .>####  ###(.######...#  #.# #......^..# ########.#... #.... #.##.####.## #.≈≈≈.#......##.#  #.#...≈.'@.....##.#  #.#._.≈.'.........# dgg  #.#...≈.5......#### #.≈≈≈.#......##.5...############## dggd dgg dgg dgg d _There are monsters nearby!dgge .##.....#...# ...........#######..>#### ##(###.##.#.######...# dggf  #.# #.#.###......^#####.########.#.......#......##.....#.##.####.## #######.#.≈≈≈.#......##.# ## #.#...≈.'.# #.#._dgg[f .. #..≈.5### ########.#.≈≈≈.# dggf .........#.5...####### ###############dggMj dggn r  The ufetubus slips past you!  The ufetubus hits you but does no damage.dggjv x5'..5dggKw 9--9.8 (1.0) dgg} dggT V _The ufetubus closely misses you.dggp7  The ufetubus shouts!  You hit the ufetubus but do no damage. The ufetubus is poisoned.dgg^[ 5.5very poisoned)  The ufetubus barely misses you. The ufetubus closely misses you.The ufetubus hits you but does no damage.dggN====601.0 (1.2dggdgg V _The ufetubus closely misses you.dggdgg[05.  You closely miss the ufetubus.The ufetubus hits you but does no damage.closely misses you. x2  bardgg<=---dgg&2.1 (1.1dggdgg? _The ufetubus hits you but does no damage.dgg  _The ufetubus hits you but does no damage.  You hit the ufetubus.  The ufetubus is heavily wounded.  You hit the ufetubus. The ufetubus closely misses you. The ufetubus hits you.  The ufetubus hits you but does no damage.  The ufetubus barely misses you. The ufetubus closely misses you.dggH l47-----3.2dgg-dggU _The ufetubus barely misses you.dgg+  _The ufetubus barely misses you.You miss the ufetubus. You tail-slap the ufetubus.  The ufetubus is severely wounded.  You barely miss the ufetubus. The ufetubus misses you.  The ufetubus hits you but does no damage. x2dgg, c4----4.3dggV4 dggn7 m _The ufetubus closely misses you. The ufetubus hits you.dggA  You hit the ufetubus but do no damage.The ufetubus is severely wounded.You hit the ufetubus. The ufetubus is poisoned.dgg}M  '   ufetubus (  You kill the ufetubus!The ufetubus slips past you! The ufetubus hits you.  The ufetubus hits you but does no damage.dggQ 199 0----85.5 (1.2dggX dggY dgg` /  --more--dggU j _The ufetubus barely misses you. The ufetubus hits you.dggj You hit the ufetubus. The ufetubus looks as sick as possible!  The ufetubus is almost dead.dggJ C$ dgg Q--406.6 (1.1dgg dgg D _You kill the ufetubus!dgg>dgg;?dggEdggNH@ _No target in view!dgg,dgg-dgg4dgg7@ _No target in view!dggo4dggvdggyH _No target in view!dgg+3dggL,dgg 1: _dggn6Xdgg9dgg :D1=dgg;dggk>,dggCXdggFdggGU2=dggHdggVK,dggTLdgg#O,dggOdggR,dgg Tdgg{VdggWX1993=dggYdgg\,dggD^dgg#a,dggcdggedgg^edggeN4=dggfdggYj,dggkdggRndggndggmodgg9r,dgg)sdggudgguK5=dggLwdggydggydggzdgg4}dggy}dgg/~dggdgg΀U6=dggҁdggdggԃdggdgg>,dggdgg,dggdggdgg#7dgg+(=dgg%dggzdggȟdggdggdgg>dgg!dgg,dggdggldggU8=dggdgg"dggmdgg5dgg;dgg~dggDzdggĴdgg059=dggdggHdggdggdggιdggMdggdggFdgg0BdggFdggV50=dggpdggdggfdggGXdgg<dggK1=dggdggdggdgg(dgg*dggdgg<20dggR _You now have 209 gold pieces (gained 10).=  There is an open gate here.dgg5 _dgg%dgg[ #..# ###(###.##.#.######...# dgg #..# #.# #.#.###......^..#  #..######.########.#.......## ##........##.....#.##.####.##.#######.#.≈≈≈.#......##. #### #.#...≈.'......##.# dgg#.#._.≈.'.........## #.#...≈.'......#### ..########.#.≈≈≈@#......# -49.6 (43.0)dgg%..........#.....######## ########## dgg8-dgg"[ _Done exploring.dggb dgg5c dggd dgg A..'0.0) dgg_ dgg dggG E _Done exploring.dggeb dggc 3dggZ 4dgg dgg E _Done exploring.dgg dggC dgg dgg(dgg,dgg2dgg4E _Done exploring.dggIdggdggdgghdggE _Done exploring.dggdgg3dggI&4dgg,dgg\.@ _Done exploring.dgg dgg Where to? (Tab - D:4, ? - help)  D - Dungeon  T - Temple dgg dgg  #..# ###(###.##.#.######...#ssays the Charlatan#..# #.# #.#.###......^..#Draconian of Gozag  Gold: 209  #..######.########.#.......##Health: 51/51 ======================== ##........##.....#.##.####.##Magic: 6/6======================== ...#######.#.≈≈≈.#......##.#AC: 6Str: 16 #### #.#...≈.'......##.#EV: 11Int: 11#.#._.≈.'.........#SH: 0Dex: 12 ####.#...≈.'......####XL:  6 Next: 40% Place: Dungeon:4 ..########.#.≈≈≈@#......#Noise: ---------dgg   Time: 3649.6 (0.0) #..........#.....########r) +0 hand axe (venom) ##################Zap: wand of flame (15) _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring. _Done exploring.dgg dggdggdgg`: _dgg6? _ There is an open gate here.dgg* _dgg-Bdgg6ndgg6dggJ7dgg7dgg9dggq;dgg;dgg&<dgg=dgg?dgg?dgg@dggBdggDdggDdgg{EdggGGdgg^HdggHdggHdgg+JdggLdgg Mdgg?MdggNdggPdggPdggQdggSY  There is a stone staircase leading down here.dggTdgg.W: _dggWdgg`;5dggbdggbdggbdggYkO  .  ..  ...  ...  ..#  ###...#  #@$...# 63.3 (13.7) #.##..#  ..# #.####.>## _You climb downwards.  Found 12 gold pieces. Found a stone staircase leading down.dggkdggepdggsa _There is a stone staircase leading up here.dgg dggl dgg dgg dgg #..#............ #..# ###...# #<@...# #.##..# ...# .# #.### ..#. ..> B#dggi B   bombardier beetle (asleep)## .dgg }0.0)BBdggP +4.3 (1dggCT dggX _A bombardier beetle comes into view. _You see here 12 gold pieces.dggD  #..#  ....  .....  .....  dgg ....  #..#  ###...#  #<@...#  #.##..#  ...# .#  dgg #.### ..  #. ..  > B#  ## . dgg*} #..#  ....  .....  .....  ....  #..#  ###...#  #<@...#  #.##..#  ...# .#  #.### .. #. .. dgg> B#  ## . dggdggdggdggh _A bombardier beetle is nearby!dgg4 #..#  ....  .....  .....  ....  #..#  ###...#  #<@...#  #.##..# dgg4 ...# .#  #.### ..  #. ..  > B#  ## . dgg3} #..#  ....  .....  .....  ....  #..#  ###...#  #<@...#  #.##..#  ...# .#  #.### .. #. .. dggW4> B#  ## . dgg94dgg|=dggAh _A bombardier beetle is nearby!dggf#..##....##....... .... ##..# ###...# #<$@..# #.##..# ...# ..# dgg##.### ....#. ..#..> #.##B# ## .# ...# #.dggdgg@B.dgg$5 dggC _dgg{dggdgg#..###....# ##...... ....... ..... ##..# ###...# #<$...# #.##@.# ...##..# #.####....#. ...#B.#> ##.##.### .# ... .# #.<.. .dgg^<6dggdgg9 _Found a stone staircase leading up.dggem#....# .##...... ....... ..... ##..# ###...# #<$...# #.##..# ...##.@# #.####.....##. ....#B.#> ####.##.### #.# ... #.# #.<... ...... ##dggdgg *The bombardier beetle sprays incendiary fluid at you.The burning spray hits you.dggqy .===7Fire dggW dgg _ _You are covered in liquid fire!dgg .##...... ...... ..... ##..# ###...# ##<$...# ..#.##..# #.#...##..##...##.####..@..##.......#B.# >.#####.##.# ## #.# ... #.# #.<... ....... ###..dgg  You shake off some of the fire as you move.  The liquid fire burns you!dgg) `46-----8dgg dgg I _The bombardier beetle bites you but does no damage.dggo  You completely miss the bombardier beetle.dggq3------9.5 (1.2dggdggZ _The liquid fire burns you!dggpe   (very poisoned)You hit the bombardier beetle. The bombardier beetle is poisoned.  The bombardier beetle is moderately wounded.The liquid fire burns you!38----70.6 (1.1 _The bombardier beetle bites you but does no damage.dggzjoThe liquid fire burns you! _The bombardier beetle bites you but does no damage.  The bombardier beetle looks as sick as possible!bombardier beetle is severely wounded.  The liquid fire burns you!dggqF$dggv209 34----541.7dgg{dgg~U _You kill the bombardier beetle!dgg}'dgg(dgg.dgg 1H _No target in view!dgg dgg dggd dgg H _No target in view!dggdggz  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting3.2   3.4  +1   j - Spellcasting   0.0   1.2  -1           b - Maces & Flails   2.7   2.0   0      dggq c * Axes   3.4   4.0   0   k + Evocations3.9   4.0   0   d - Polearms   1.8   1.0   0       e - Staves   0.9   1.0   0       f - Unarmed Combat   0.0   1.0   0       g - Throwing   0.0   1.2  -1                  dgg    h + Dodging3.2   4.8  -1      i + Stealth2.6   3.0   0          dgg                dggr                dgg    The relative cost of raising each skill is in cyan.  dggSkills enhanced by cross-training are in green.  [?] Help[=] set a skill target  dgg}[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsdggr dgg dgg1 .##......ssays the Charlatan.......Draconian of Gozag  Gold: 209 .....Health: 34/51 ================--------##..#Magic: 6/6========================###...##AC: 6dgg Str: 16#<$...# ..EV: 11Int: 11#.##..# #.#SH: 0Dex: 12...##..##...#XL:  6 Next: 54% Place: Dungeon:5#.####..@..#Noise: =--------  Time: 3671.7 (0.0)#.......#$.#dgg r) +0 hand axe (venom)>.#####.##.#Zap: wand of flame (15)## #.# ...Fire dgg k#.# #.<... ....... ###..  The bombardier beetle looks as sick as possible!  The bombardier beetle is severely wounded.The liquid fire burns you! _You kill the bombardier beetle! _No target in view! _No target in view!dgg dgg dggv dgg dggddggedggjdgg nZ _You are on fire! dggP dgg  dggO dggZ _You are on fire! dgg dgg: dggҰ dggZ _You are on fire! dgg!  dggN"  dgg/(  dgg* _No target in view!You are on fire!No target in view!!dggM .##...... ....... ..... ##..# ###...# # #<$...# .. #.##..# #.# ...##..##...# #.####.@...# #.#$.# >.#####.##.# ## #.# ... #.# #.< ... ....J   jelly (asleep) ... ### ..J!dggHYou are on fire!No target in view!  A jelly comes into view.!dggX;-2.7 (1!dgg!dgg;^ _You shake off the liquid fire.!dgg  .##...... ....... ..... ##..# ###...# # #<$...# .. #.##..# #.# ...##..##...# #.####@....# #.#$.#.>.#####.##.# ## #.# ... #.# #.< ... .... ... ### ..J.!dggW !dgg \5-3!dgg| !dgg !dgg    .......  .....  ##..# ###...# #  #<$...# ..  #.##..# #.#  ...##..##...#  #.####@....#  #.......#$.#  .>.#####.##.#  ## #.# ...  #.# #.< !dgg  ... ....  ... ###  ..J. !dgg>   .......  .....  ##..# ###...# #  #<$...# ..  #.##..# #.#  ...##..##...#  #.####@....#  #.......#$.#  .>.#####.##.#  ## #.#  !dggi?}#.# #.< ... ....  ...  ..J. !dggF4!dgg M!dggO\ _A jelly is nearby!"dggZi.##...... ....... ..... ##..# ###...# # "dgg[[q#<$...# .. #.##..# #.# ...##..##...# #.####.@...# #.#$.# .>.#####.##.# "dgg[## #.# ...#.# #.<... .... ... ###..J."dgg`"dgg3fhJJ."dggf&4"dggAm"dggbqZ _The jelly quivers."dggڵ! .......  ##..# ###.#<$.. .##..# #.# ..#..#.####.....# #......@#$.#.>.#####.##.### #.# ... #.# #.<... ....J. ###........"dgg׷"dgg <J."dgg׿&5"dgg"dgg<"dgg  ##..# ###.#<$.. .##..# #.# ..#...##.####.....# ......#$.#.>.#####@#### #.# ... #.# #.<.J. ...... ###..... ............"dgg| "dggI <J."dggٞ B66"dgg@ "dgg Z _The jelly jiggles."dggu* ##..# ###.#<$.. .##..# #.# ..#..#.####.....# #.......#$"dgg* .>.#####.#### #@# ... #J# #.<... ......... ###.......#........#.........######..#.."dggV5 ;="dgg5 7"dggy: "dgg= S _The jelly closely misses you."dgg  You hit the jelly. Your hands burn!  The jelly is heavily wounded."dggI48.8 (1.1"dgg."dggR _The jelly barely misses you.#dgg1  You barely miss the jelly.The jelly is heavily wounded.#dgg2(9.9#dggT6#dgg8R _The jelly barely misses you.#dgg  You completely miss the jelly. You tail-slap the jelly.  The jelly is severely wounded.#dgg*E581.0#dgg#dggR _The jelly barely misses you.#dggq  You hit the jelly. Your hands burn!  You tail-slap the jelly, but do no damage.The jelly is almost dead.#dggVr2093-2.1#dggPz#dgg|S _The jelly closely misses you.#dgg 7  You hit the jelly.#dgg F$#dggG 209 -65#dgg J3.3 (1.2 _You kill the jelly!#dgg #dggX k _Your Evocations skill increases to level 4!#dgg ###.#<$.. .##..# #.# ..#..#.####.....# ......#$.>.#####.#### #.# ...#dgg{  #@# #.<#............#.........####........###.....######.#... ..#..##dgg #dgg8 q4=-40 _#dgg #dgg #dgg $13#dgg >-5.3 (2#dgg #dggE > _You now have 213 gold pieces (gained 4).#dgg) <$.. .##..# #.# ...##..##..#.####.....# ......#$.>.#####.#### #.# ... ####.####.<##...@........####dgg## #### #.#dggE#dgg+6.3 (1#dgg#dgg$dgg$dggInventory: 24/52 slots Hand Weapons (go to first with ))  r - a +0 hand axe of venom (weapon)a - a +0 club  e - a +0 mace Missiles (go to first with ()$dgg}n - 12 poisoned darts Jewellery (go to first with "=)  j - a ring of protection from cold (left hand) Wands (go to first with /)b - a wand of flame (15) (quivered)  c - a wand of charming (15)  $dggd - a wand of iceblast (5)  v - a wand of roots (10) Scrolls (go to first with ?)  h - a scroll of poison  i - a scroll of teleportation$dgg s - a scroll of identify  t - a scroll of fog  u - 2 scrolls labelled SIGHAUT NAGAOLw - a scroll of amnesia  x - a scroll labelled CUYTIR FAOSE $dggiPotions (go to first with !) $dggK[Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]$dgge @ o - a bubbling silvery potion. An unlabelled flask containing a single dose of unknown liquid. Stash search prefixes: {inventory} {potion} Menu/colouring prefixes: unidentified potion “Then gave I her, — so tutor'd by my art, — $dgge A sleeping potion; which so took effect  As I intended, for it wrought on her  The form of death: meantime I writ to Romeo  That he should hither come as this dire night,  To help to take her from her borrow'd grave, $dgg f Being the time the potion's force should cease.”  -William Shakespeare, _Romeo and Juliet_ (q)uaff, qui(v)er, (d)rop, (=)adjust, or (i)nscribe.%dgg$Inventory: 24/52 slots Jewellery (go to first with "=)  j - a ring of protection from cold (left hand) Wands (go to first with /)b - a wand of flame (15) (quivered)  c - a wand of charming (15)  d - a wand of iceblast (5)  v - a wand of roots (10) Scrolls (go to first with ?)  h - a scroll of poison  i - a scroll of teleportation  s - a scroll of identify  t - a scroll of fog  u - 2 scrolls labelled SIGHAUT NAGAOL  w - a scroll of amnesia %dgg$  x - a scroll labelled CUYTIR FAOSE Potions (go to first with !)  f - 2 silvery potions  g - 2 potions of ambrosia %dgg4% k - a viscous coppery potion  l - a sedimented amethyst potion  m - 2 potions of lignification  o - a bubbling silvery potion %dggq%[Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[75%]%dgg(s%dggz%dgg#<$...# ..ssays the Charlatan#.##..# #.#Draconian of Gozag  Gold: 213 ...##..##...#%dggԀ!Health: 34/51 ================--------#.####.....#Magic: 6/6========================%dggX#.......#$.#AC: 6Str: 16.>.#####.##.#EV: 11Int: 11## #.# ...SH: 0Dex: 12####.####.<#XL:  6 Next: 65% Place: Dungeon:5#...@........%dgg Noise: ---------  Time: 3686.3 (0.0)#.........###r) +0 hand axe (venom)%dgg#........##Zap: wand of flame (15)#..........##..........#%dgg؁B######..#.....#..#%dgg### #.  The jelly is almost dead. %dggs_The jelly closely misses you.You hit the jelly. %dgg@_You kill the jelly! _Your Evocations skill increases to level 4! _You now have 213 gold pieces (gained 4).%dggև%dggn%dggÍ%dgg %dgg<4%dgg%dggrI _The jelly closely misses you.  You hit the jelly. _You kill the jelly!Your Evocations skill increases to level 4!You now have 213 gold pieces (gained 4). _Unknown command.%dgg[%dgg.\%dgg1]%dgg`%dggdV5 _%dgg9f%dggpf%dggEg%dggk,%dgg8m%dgg+q%dggeq%dggXr%dggt%dggYu96%dggv%dgg4y%dgg|y%dggz%dggj},%dgg&~%dgg,%dgg-%dgg%dgg"837=%dggF%dgg%dgg,%dgg%dgg%dggdž*213%dgg%dggi%dggW8=%dgg%dgg,%dggx%dggݐ,%dggB%dgg,%dgg%dgg%dgg^#9%dgg(=%dgg%dgg:%dgge%dggϜ%dggQ,%dgg%dgg.%dgg[V40=%dgg%dgg %dggN%dgg%dgg˦,%dgg%dgg:,%dggʪ%dggj1=%dgg,%dggj%dgg޲%dgg#2%dgg02=%dgg%dgg]%dgg%dgg%dggi,%dgg%dggj,%dggv%dgg%dggK3=%dgg%dgg/7130.0) %dgg%dgg%dggj _Key pressed, stopping explore.%dggJ%dgg\ _Unknown command.%dgg  _%dgg B%dggž %dgg2 %dgg %dgg %dggZ U4=%dgg %dgg' %dggb %dgg\ %dgg ,%dgg %dggT %dggİ %dgg D5=%dgg %dggi %dgg %dgg %dgg %dgg %dgg. %dgg %dgg' %dgg %dggt %dgg %dgg N6=%dgg %dgg %dgg %dgg %dgg %dgg? %dgg1 %dgg %dggJ %dggr D7=%dgg\ %dgg %dggI %dgg7 %dgg" ,%dgg1 %dgg ,%dgg %dgg %dgg U8=%dgg %dgg %dgg %dgg %dgg ,%dggF %dgg %dgg 59=%dgg %dgg %dgg ,%dgg %dggs ,%dgg %dgg| %dgg %dgg %dgg %dgg V50=%dgga %dgg ,%dgg{ %dgg ,%dgg %dgg& ,%dgg %dggO %dgg K1=%dgg %dgg 1 _HP restored.%dgg %dgg( %dgg %dgg %dgg ,%dgg7 %dgg %dgg %dgg %dgg %dgg %dgg %dggB 9=%dgg %dgg %dgg/ %dggU %dgg %dgg %dgg %dgg %dgg_ %dgg  .......  .....  ##..# ##...# ###<$...# ... #.##..# ##.#...##..##...# #.####.....# %dggS #.......#@.# .>.#####.##.# ## #.# ... ####.####.<##........#.........#####........##%dgg k#..........##..........#%dggO 51.3 (35  You now have enough gold to buy a crude morningstar on D:4.  You can access your shopping list by pressing '$'.%dgg 482.3 (36%dggi %dggb! > _You now have 218 gold pieces (gained 5).%dgg%dgg %dgg%dgg,%dgg%dgg%dggJ,%dgg%dgg%dgg/%dgg%dggx%dgg%dgg%dgg%dgg%dgg%dgg%dgg%dgg%dgg%dgg%dgg%dgg%&30%dgg%dggN _You now have 230 gold pieces (gained 12).%dgg%dgg%dgg%dgg%dgg%dgg,%dgg5%dggS%dgg%dgg%dgg%dgg,%dgg%dgg9%dgg%dgg%dggG%dgg %dgg %dgg %dggZ %dggI%dgg%dgg,%dgg%dgg,%dgg%dgg%dgg,%dggI%dggg%dggk,%dgg n%dggo"%dggZ$%dgg$%dgg%%dgg'%dggL1W #...##..##...# #.####.....# ####.......#..# #..>.#####.##.# #.##.# #.# ...%dgg 2 .. ##.#####.####.<# #.. ##..##............ .. ##..###.........### . #.@## #........## .S.....## #..........# .....## #..........#≈≈≈≈. ######..#......≈ ..#..#≈≈.### #. S   adder (asleep)... %dgg;-70.3 (18%dggj<,1.3 (19&dgg&dggqY _An adder comes into view.&dgg #...##..  #.####.....#  ####....#  #..>.#  &dgg#.##.# #.# ...  .. ##.#<#  #.. ##..# .. ##..# . #.@##   &dggY.S.....##   .....## &dggϜ0  ≈≈≈≈.  &dgg% ...≈  &dgg$< ≈≈.### #.  ...&dggN*&dgg5 #...##..  #.####.....#  ####..&dggd6..#  #..>.#  #.##.# #.# ...  .. ##.#<# &dgg6Z #.. ##..# .. ##..# . #.@## &dgg6k  .S.....## &dgg6H  .....##  &dggU7S ≈≈≈≈.  ...≈  ≈≈.### #.  ... &dggx7&dggn>&dgg)?&dgg E&dgg.#  #.##.# #.# ...  .. ##.#<#  #.. ##..# &dggR.. ##..# . #.@##   .S.....##   .....##   ≈≈≈≈.   ...≈  &dggqf ≈≈.### #.  ...&dgg #...##..  #.####.....#  ####....#  #..>.#  #.##.# #.# ...  .. ##.#&dgg;F<#  #.. ##..# .. ##..# . #.@##   .S.....##   .....##   &dggb≈≈≈≈.  ...≈ &dgg ≈≈.### #.  &dgg>... &dgg%&dgg&dgg&dgg&] _An adder is nearby!&dggef #...##..##...# #.####.....# ####.......#..# #..>.#####.##.# #.##.# #.# ... .. ##.#####.####.<# #.. ##..## .. ##..###.&dgg f . #@.## #.##.S.....## #.#.### #.#≈. ######..#....§ ..#..#≈.≈ ### #....&dggfW_.≈.&dgg nR  Found an ornate altar of the Wu Jian Council.&dggn&dggWtA.§§§&dggt§§..._.≈.&dggu02.0) &dggy;_&dggL} &dgg{}!_The adder hisses angrily.&dgg< 4&dgg1> C_&dggB H _No target in view!&dggC:_&dgg&dggC_&dgg H _No target in view!'dggEZ'dggZ'dgg['dgg^'dggTdN ####.....# ####.......#..>.#####.####.# #.# ...'dggd}.. ##.#####.####.<##.. ##..##...........#.. ##..#######.S##..## ## .......@## 'dggdA..#### 'dggd≈≈≈§§. ######..#....S   adder_'dgge'dggh&0'dggp.S§.§≈..'dgg7q;_'dgg?u23.3 (1 _'dggx;_'dggR|'dggsg #.####.....# ####.#..# #..>.#####.##.# #.##.# #.# ... .. ##.#####.####.<##.. ##..## #.. ##..###.#..##..## #.##.S@.## #'dggLtM..§.§### #.≈§≈. ######..#...§≈§ ..#..≈§§ ### #......_.≈.'dggW...§.§....≈§_.≈.≈...≈ ≈'dggk.=4'dgg'dggS _The adder closely misses you.'dggת;≈.≈.≈._.≈.≈..≈.'dgg[0-5.4 (1.1'dggԱC_'dggK _You closely miss the adder. The adder bites you. The adder closely misses you.'dggA §_You closely miss the adder. Your tail-slap misses the adder.'dggB V1=6.5'dggeH 'dgg}L K _The adder misses you.'dggu _You barely miss the adder. The adder bites you.'dgg; X48--7.6'dgg 'dgg = _The adder bites you but does no damage.'dgg8  'dgg(very poisoned)  You hit the adder. The adder is poisoned.  The adder is moderately wounded.'dggV-8.8 (1.2'dggT'dgg(S _The adder closely misses you.(dggq  You hit the adder. The adder looks as sick as possible!  Your tail-slap misses the adder.The adder is almost dead.(dgg`wJ$§§(dggw\_(dggq230 --99.9 (1.1(dggˁ(dgg3_(dggI _You kill the adder!(dgg,0X_(dgg4;_(dgg<8H _No target in view!(dgg9 9= _(dgg ,(dggb B(dggG (dgg (dggI V50=(dgg  (dgg B(dggc (dgg (dgg (dgg (dgg (dgg (dgg! (dgg3" K1=(dgg" (dgg% (dggI,  #.####.....## ####.#..#J# #..>.#####.##.#.. #.##.# #.# ...#... ##.#####.####. ##.. ##..## #.. ##..###.#..##..## #..@..## #-.### #≈≈§§§≈≈.# ######..#.≈.. ..#≈.≈.. #≈.....≈...J   jelly (asleep)≈._.≈.≈...≈...≈.≈....(dgg6 87.9 (8.0§§≈≈≈≈§§§§..._.≈..(dggl7 E-8.9 (9(dggm= (dgg;D _A jelly comes into view. _You see here 3 gold pieces.(dgg] (dgga l  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting(dgg,b 3.3   3.4  +1   j - Spellcasting   0.0   1.2  -1           b - Maces & Flails   2.7   2.0   0  (dgg^b p     c * Axes   3.5   4.0   0   k + Evocations(dgg"c 4.0   5.0   0   d - Polearms   1.9   1.0   0       e - Staves   0.9   1.0   0       f - Unarmed Combat   0.0   1.0   0       g - Throwing   0.0   1.2  -1      (dggpc                 h + Dodging(dggc 3.2   4.8  -1      i + Stealth2.7   3.0   0              (dgg'd             (dggnd         (dggd             (dggd GThe relative cost of raising each skill is in cyan.  Skills enhanced by cross-training are in green.  [?] Help[=] set a skill target  (dgg'e }[/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targets)dggn k * Evocations   4.0*dgg*p k - Evocations   4.0*dgg *dggR 6#.####.....# ssays the Charlatan# ####.......#..# Draconian of Gozag  Gold: 230 J# #..>.#####.##.# Health: 51/51 ========================.. #.##.# #.# ... Magic: 6/6*dgg 4========================#... ##.#####.####. AC: 6Str: 16##.. ##..##......... EV: 11Int: 11*dgg #.. ##..###......... SH: 0Dex: 12*dgg 5#####..##..## #........# XL:  6 Next: 69% Place: Dungeon:5.......@..## #......... Noise: ---------  Time: 3788.9 (0.0)*dgg.....§§.### #......... r) +0 hand axe (venom)≈≈≈≈≈≈§§# ######..#. Zap: wand of flame (15)*dggH.....§§....#.≈≈≈≈≈.≈..###≈.....≈...*dggFJ   jelly (asleep)≈._.≈.≈...≈...≈.≈....  Your tail-slap misses the adder.The adder is almost dead. _You kill the adder! _No target in view! *dggw_A jelly comes into view. _You see here 3 gold pieces.*dgg;_*dggm*dgg*dgg!*dgg #...##..##.. #.####.....# # ####.......#..# J###..>.#####.##.# ..##.##.# #.# . #... ##.#####.#### ##..###..## #...##..###. #####.@##..## #...$..## #§.....§§.### #.......≈≈≈≈≈≈≈§§# ######..#§.....§§.. ..#§≈≈≈≈≈.≈...*dggD>###.≈.....≈....≈._.≈.≈....≈...≈.≈....*dgg§§§.§≈≈≈§≈.............*dgg29.9 (1 _*dggR*dgg˽*dgg ## ##....##..##... #.####....# ####.......#.J###..>.#####.##.#..##.##.# #.# .. #....##.#####.#####..###..*dgg k #.@.##..## #####..##..##.....§§§$..##......§§.### #........≈§≈≈≈§≈§§# ######.....§§.. ..≈≈≈≈.≈...###....≈._*dgg* *dgg@ .J.≈≈≈≈≈§§J*dgg '90*dgg` *dgg Z _The jelly quivers.*dgg{q #<....# .... ## ##.....##..##..... #.####.....# ####.......#...###..>.#####.##.#.J##.##.# #.# .. #....##.#####.######@.###.. #...##..## #####..##..##...§§§$..##.......§.### #........≈≈≈≈≈§§§§# ######......§§.. ...≈≈≈≈≈.≈...###....≈...*dgg*dggc.J...§§§§≈...§*dgg&1*dgg̵*dgg:+dgg9z ....≈≈≈≈....≈.≈You hit the jelly. Your hands burn!  The jelly is lightly wounded.+dggzf46---=3.0 (1.1+dggH+dggS _The jelly closely misses you.+dgg~e  §§§You slash the jelly! Your hands burn! You tail-slap the jelly.  The jelly is severely wounded.2304----4.1+dgg&+dgg R _The jelly barely misses you.+dgg*  You hit the jelly but do no damage. Your hands burn!  You tail-slap the jelly, but do no damage.The jelly is severely wounded.+dgg^B-5.2+dgg+dggdS _The jelly closely misses you.+dgg^z  You hit the jelly. Your hands burn!  The jelly is almost dead.+dgg  f§.§§§f   sleepcap (wandering)§§§J   jelly.≈.  The jelly hits you but does no damage. x2+dgg 036.3+dggʈ +dgg [ _A sleepcap comes into view.+dgg  You completely miss the jelly.The jelly is almost dead.+dgg .§§≈J   jelly....§§≈§+dgg  +dgg 29------- 2 7.4-4 hand axe (venom)Corr (-4) +dgg +dgg _The jelly hits you. The acid corrodes you! You are splashed with acid!,dgg9  You slash the jelly!,dgg$≈≈.≈≈≈.,dgg230 30=------818.6 (1.2 _You kill the jelly!,dggߩ _No target in view!,dgg,dggR,dggT,dggH _No target in view!,dgg 4,dggp ,dgga ,dgg ; _,dgg ,dgg ,dgg ,dgg ,dgg L1=,dgg ,dgg ,dgg ,dgg ,dgg ,,dgg ,dgg ,dgg ,dgg ,dgg< ,dgg #2,dgg 1=,dgg ,dgg ,dgg> +230,dgg, ,dgg ,dgg* ,dgg ,dgg ,dgg< ,dgg ,dgg ,dggW L3=,dgg ,dgg ,dgg ,dgg ,dggE ,dggs ,dgg? ,dgg ,dggW #4,dgg L= 6 ,dggi ,dgg  j _You are no longer corroded.,dggS ,dggx ,dgg" ,dgg/# ,dgg# ,dgg& ,dgg& ,dggk( ,dgg+ ,dggd+ #5,dgg+ (=,dgg, ,dgg2/ ,dggd/ ,dggY0 ,dgg2 ,dgg2 ,dgg3 ,dgg6 ,dgg7 #6,dgg7 ,dggx8 ,dgg; ,dgg&< ,dgg5= ,dgg@ ,dgg@ ,dggA ,dggD ,dggD ,dggE ,dggH ,dggH N37=,dggI ,dggKL ,dggL ,dggM ,dggP ,dggQP ,dggQ ,dggT ,dggjT W8=,dggTU ,dgg2X ,dgg|X ,dgghY ,dggf\ ,dgg\ ,dgg~] ,dgga ,,dgg$b ,dggle ,dgge K9=,dggf ,dggi ,,dggj ,dgg n ,dggn ,dggo ,dggzr ,,dggs ,dgg!w ,dggx V40=,dggy ,dgg`| ,,dgg} ,dgg ,,dggā ,dgg ,dggX K1=,dggR ,dgg ,dgg4 ,dgg ,dgg. ,dggˍ ,dgg ,dgg ,,dgg ,dgg ,dgg U2=,dggϖ ,dggk ,dgg ,dgg ,dggX ,dgg ,dgg{ ,dggm ,dgg #3,dgg٣ (=,dgg ,dgg ,,dgg ,dggQ ,dgg ,dgg ,dggį ,dgg ,,dgg ,dgg ,dggI ,dggBR f-847.6 (49.0)+0 hand axe (venom),dgg ..##.##.# #.#  #$...# ,dgg,X ##@.# #...# #####..##..##  ........$..##  .........###  ≈≈≈≈≈≈≈≈.#  .......≈..  ,dgg^X S.§...   ,dgg #<....#  ..f.   .... ,dgg ... #.# ..# ####.. ..###..> ,dgg(..##.##.# #.#  #$...#,dggOf ##@.#,dggym #...# ,dggJ#####..##..##  ........$..##  .........###  ≈≈≈≈≈≈≈≈.#  .......≈..  .§...  ,dgg,dgg],dgg ,dgg,_ _A sleepcap is nearby!-dggUT###... #<....# #..f. ## ##....##..##...... #.####...#..# ####.......#.#..###..>.#####.##.##..##.##.# #.# .. #@...##.#####.######..###.. #...##..## #####..##..##....$..##.........### #........≈≈≈≈≈≈≈≈.# ######......≈.. ..≈≈≈≈.§###-dgg;-dgg$s.ff-dgg%#4-dgg%D=8.6 (1.0) -dgg & _-dgg,-dgg0Q _You see here 5 gold pieces.-dgg'7 ##..# #..... ###...# #..... #<....# #..... ###.##..# #f.. #...##..##..... #.####..... ####.......#..#..>.#####.####.##.# #.# . ##$...##.#####.### ##..###..## #...##..### #####..##..## # ........$..## # .........### #....... ≈≈≈≈≈≈≈≈.# ######.. .......≈ ..-dgg:-dggDK.f-dggE-9 _-dggyK-dggN-dgg ..... #......)# ##..# #.......# ###...# #.......# #<....# ##.......# ###.##..# ........ #...##..##.f... #.####.. ####.......#..>.#####.##..##.##.# #.# -dgg(j ##$...##.#####.## ##..###..## #...##..### #####..##..## # ..$..## # .........### #....-dgg ≈≈≈≈≈≈≈≈.# ######-dgg  Found a battleaxe.  A malevolent force fills the Dungeon...  --more--.dgg  Found a battleaxe.  A malevolent force fills the Dungeon...  With a horrendous wail, an alarm goes off!  A sentinel's mark forms upon you..dggYou hear a shout! x4; You hear a loud squeak. x3; You hear a bark!  You hear a shout! You hear a loud squeak. x7; You hear a howl!.dggpp  You hear a loud squeak. x5; You hear an angry hiss. You hear a loud squeak..dgg 5.f5   ufetubus  An ufetubus comes into view..dggYL==========50.dgg7Mark .dggu.dgg.dggn/  --more--/dgg1 _You hear a loud squeak. x5/dgg You hit the sleepcap.  You tail-slap the sleepcap, but do no damage.The sleepcap is lightly damaged./dgg /dgg You hear a loud squeak. x2  An ufetubus comes into view./dggC 55 2 ufetubi5==-------- 1.7 (1.1/dgg /dgg ? _The sleepcap barely misses you./dgg 0dgg  You hit the sleepcap.  You tail-slap the sleepcap, but do no damage.0dgg40dggr  The sleepcap is moderately damaged.0dgggp.5 0dggI--------2.80dgg0dggN _The sleepcap misses you.0dgg\f  You completely miss the sleepcap.0dgg]0dgge\  The sleepcap is moderately damaged.0dgge0dggnV.50dggQo(3.90dgg@v0dggyV _The sleepcap closely misses you.0dgg'  You hit the sleepcap but do no damage. You tail-slap the sleepcap.0dggA-0dggW6r  The sleepcap is moderately damaged.0dggYD .5The sleepcap barely misses you. The ufetubus closely misses you.0dggE(5.00dggL0dgg*P? _The ufetubus hits you but does no damage.0dgg  You hit the sleepcap.  The sleepcap is heavily damaged.0dgg0dgg 0dggg `6=6.10dgg  0dgg k _You hit the ufetubus. The sleepcap barely misses you.0dgg  You closely miss the ufetubus. You hit the sleepcap.  The sleepcap releases spores at you.  The ufetubus hits you but does no damage.0dggV3-7.20dgg0dggJU _The ufetubus barely misses you.1dgg/  You hit the ufetubus. The ufetubus is poisoned.  The ufetubus is moderately wounded.1dgg=) .5(1 very poisoned)  You completely miss the sleepcap.The sleepcap releases spores at you but does no damage.  The ufetubus hits you but does no damage. x21dgg.a1--8.31dggc1dgge _The ufetubus closely misses you. x2; The sleepcap releases spores at you.1dggd3-You barely miss the ufetubus.hit the sleepcap but do no damage. The sleepcap is poisoned.  You barely miss the ufetubus.  The ufetubus hits you.1dggd/  --more--1dgg R (very poisoned)The ufetubus hits you but does no damage.  The ufetubus hits you. x2; The ufetubus barely misses you.35---9.41dgg 1dgg E _The sleepcap releases spores at you but does no damage.2dgg You barely miss the ufetubus.The ufetubus is moderately wounded.You hit the ufetubus.2dgg. $ extremely poisoned)   ufetubus  You kill the ufetubus!You hit the sleepcap. The sleepcap looks as sick as possible!  The ufetubus closely misses you. x3; The ufetubus misses you.2dgg#n230 ---360.52dgg*2dgg+2dgg5/  --more--2dggZ > _The sleepcap closely misses you.2dgg 2dgg 26----  You miss the ufetubus.  The ufetubus is moderately wounded.You hit the sleepcap but do no damage. The sleepcap looks as sick as possible!  The ufetubus hits you. The ufetubus closely misses you.The sleepcap releases spores at you.  2dgg 7You are engulfed in a cloud of soporific spores!2dgg /  --more--3dgg+=  You fall asleep.3dgg1/  --more--4dgg #......)# ##..#  #.......#   #.......# #<....#  ##.......#   4dgg ........  .....  #f5##  #@$###..> ##..# #.#  ##$... ##..###4dggX #...# 4dgg0##..##  $..## 4dggǸ2    4dgg4dgg #......)# ##..#  #.......#   #.......# #<....#  4dgg5##.......#   ........  .....  #f5##  #@$###..> ##..# #.#  ##$... ##..### #...# ##..##  4dgg$..##     4dgg #......)# ##..#  #.......#   #.......# #<....#  ##.......# 4dggi  ........  .....  #f5##  #@$###..> ##..# #.#  ##$... ##..###4dgg #...# ##..##  $..##   4dgg0  4dgg #......)# ##..#  #.......#   #.......# #<....#  ##.......#   ........  .....  #f5## 4dgg|Q #@$###..> ##..# #.#  ##$... ##..### #...# ##..##  4dggܤ}$..##     4dggn  The ufetubus hits you! You wake up.  * * * LOW HITPOINT WARNING * * *4dgg-f14----------=1.64dgg4dgg7 _The ufetubus hits you but does no damage.4dgg  You closely miss the ufetubus.The ufetubus is moderately wounded.4dgg +You hit the sleepcap.4dgg@( $5   ufetubus  You destroy the sleepcap!4dgg, y5=-----94-2.8 (1.24dgg4 4dgg7  4dgg8 _The ufetubus closely misses you. The ufetubus barely misses you.5dgg2<  You slash the ufetubus!5dgg?o$5dggDy=6-3.9 (1.15dggO5dggRL _You kill the ufetubus!5dggx1M. .....) ####  #<..#### ###5dgg2 #.........# #...##..###.........# #.####...#$@## ####.......#.##.$###..>.#####.####..##.##.# #.# ##$...##.#####.## Mark #. 5dgg@5dggOA4-405dggE5dggTN5dggNs66-5.9 (25dggR5dgg;T> _You now have 236 gold pieces (gained 6).6dggڀ46dgg6dggGB6dggC,6dgg6dggF6dggy6dgg)6dgg6dggJ7=6dgg6dggZ6dggrr   quokka6dgg+9.9 (46dggT^.r6dgg*,70.9 (56dgg6dggY _A quokka comes into view.6dgg} #.......#  #r.....)# ##..#  #.......#  6dgg}  #.......# #<....#  ###.......#   #.........#  #.........#  #$@##  ##.$###..> ##..# #.#  ##$.. ##..## #...# 6dgg9~]##..##  $..##   6dgg  #.......#  #r.....)# ##..#  #.......#   #.......# #<....#  ###.......#   #.........# 6dgg y #.........#  #$@##  ##.$###..> ##..# #.#  ##$.. ##..## #...# ##..##  $..##   6dgg;" 46dggT* 6dggZ. ] _A quokka is nearby!6dgg| 6dggt} 6dgg 6dggW ^ _You are too injured to fight recklessly!7dgg*R7dggS7dgg[7dgg^^ _You are too injured to fight recklessly!7dgg)47dgg)17dggb4^ _You are too injured to fight recklessly!7dggg #.......#  #r.....)# ##..#  #.......#   #.......# #<....#  7dggyD###.......#   #.........#  #.........#  #$@##  ##.$###..> ##..# #.#  ##$.. ##..## #...# ##..##  $..##   7dgg3U #.......#  #r.....)# ##..#  #.......#   #.......# #<....#  ###.......#   #.........#  7dgg,Vt#.........#  #$@##  ##.$###..> ##..# #.#  ##$.. ##..## #...# ##..##  $..##   7dggD_7dgg `7dggGf7dggj] _A quokka is nearby!8dggR## #.#  #.......# .... #r.....)# ##..# #.# ###...# #.# #<....# ###.# ###.##.. #.# #...##..##.....@...# #.####..######$.#######........$###..>.#####.#..##.##.# #. ##$...##.#####.# ##..###..## #...##..### #####..##..## # $..## #8dggK!8dgg)].r8dgg*21.9 (1 _8dgg18dgg358dgg # #Y......#8dgg## #.#  #.......# ... #)# ##.. #r......# ###... #.# #<.... ###8dggO.# ###.##.. #.# #...## #.........# #.####..8dggE######$.#######........$###..>.#####...##.##.# #.8dggm\ ##$...##.#####. Y   ice beast ##..###..##8dggAr   quokka #...##..### #####..##..## #8dggm 8dgg 8dgg.Y.r8dgg&28dgg!8dgg% _is nearby!You are too injured to fight recklessly! _A quokka is nearby!n ice beast comes into view.8dgg5g #.#######  #.......### #.Y.....# 8dggK #.......#  #)# ## #.......# ### #.r.....# #<. ###.# ###.## #.# #...## #.........# #.##########$.#######......$###..>.#####8dgg2..##.##.# # ##$...##.##### ##..###..##8dggDM #...##..###8dggg8dggP.Y8dggd8==38dgg8dggT _The quokka closely misses you.8dgg v  You barely miss the quokka.8dggE r.Yr8dgg r   river ratr   quokka (unaware)The quokka is distracted by your dazzling golden aura.8dgg -5.0 (1.18dgg+( 8dgg+ \ _A river rat comes into view.9dgg  You strike the helpless quokka from behind!  You hit the quokka. The quokka is poisoned.  The quokka is no longer distracted by gold.9dgg99dggx( .r.Yrr  very poisoned)The quokka is heavily wounded.9dgg(6.19dgg9dggȱ> _The quokka bites you but does no damage.9dggO,##.#########.r.....# .##.#.......# ..9dgg,#.# .#......)# ###.Y.....# ###..#.r.....# #<..###.......# ###.###...9dgg, # #...##.#.# #.####.######$.#######......9dgg- ##.$###..>.#####..##.##.# #.9dgg>-$...##.#####.##..###..##....9dggd-#...##..###.#####..##..## #.9dgg69dgg89dgg:9dggG.r.$Y9dggKN9-709dggU9dggYJ _You kill the quokka!9dgg #.......# .##..#.r.....# ..#.......# .#......)# ##..##.# ###...##.$Y....# #<....#9dgg3 ,###.......# ###.##..##...# #...##..##.# #.####.######$.#######.......# ##.$###..>.#####.#..##.##.# #.#$...##.#####.###..###..##....#...##..###.#####..##..## #.........$..## #.9dgg, 9dgg 9dggb) .r.Y9dgg* !-9dgg* 89dgg#2 9dggb5 9dgg X#.# ..#.r.....# .#......)# ##..# #.# ###...# #.$.....# #<....# ###...Y...# ###.##..# #.........# #...##..##.# #.####....######$@#######.......# ##.$###..>.#####.#..##.##.# #.# $...##.#####.###..###..##......#...##..###.#####..##..## #.........$..## #..### #.9dggH 9dgg 9dggN .r.Y9dggB &99dggz 9dgg> :dggjr....)##..# ......###.$<.###..###.###......Y..# #..:dgg,-##.........# #.####....######$.#######.......# ##@$###..>.#####.## ##..##.##.# #.#  ##$...##.#####.###..###..##.........##..######..##..## ........$..## .### ≈≈≈≈≈≈≈≈.# ######:dggU:dgg:dggk.r.Y:dggUR20=80:dgg( :dggl _The river rat twitches its whiskers.:dggA#......)# ##..# #..r....# ###...# #.$.....# #<....# ###.......# ###.##..# ##.........# #...##..##.#......Y..# #.####.....######$.#######.......#:dgg ##.$###..>.#####.#.##.##.# #.# .$...##.#####.#####..###..##.......#...##..###.#####..##..## #.........$..## #....### #.≈≈≈≈≈≈≈≈.# ######.......≈.. .:dgg:dgg$:dgg.r.Y:dgg8&1:dgg@:dgg<:dgg #.# ###...# #.$r....# #<....# ###.......# ###.##..# ###.........# #...##..##..#...# #.####.....#######$Y#######.......#..#:dgg^ t ##.$###..>.#####.##.#..##.##.# #.# ...##.#####.######..###..##........#...##..###.#####..##..## #.........$..## #..........### #.≈≈≈≈≈≈≈≈.# ######..#.......≈.. ..#.≈≈≈≈≈.§.###:dgg :dgg# [r.Y:dgg §§r(unaware)§§:dgg &2:dgg :dggk# _The river rat is distracted by your dazzling golden aura. _You see here 5 gold pieces.:dgg$r<.###...###.##..# ##.........#....####.....######$.#######.......# ##.Y###..>.#####.## ##..##.##.# #.# .. ##$...##.#####.#######..##........#...##..######..##..## ........$..## §....### ≈≈≈≈§≈≈≈.# ######..#..§§§..≈.. ≈≈≈≈≈.≈...##.....≈...:dgg :dgg:dgg3Y.r$Y§.r   river rat (wandering)§§3:dgg:dgg  :dgga Z_The sentinel's mark upon you fades away.;dgg`###..r###.##..# ##.........#.....####.....######$.#######.......# ##.$###..>.#####.##;dggag ##.Y##.##.# #.# .. ##$...##.#####.######..###..##........#.@.##..######..##..## ........$..## §.§....### ≈§§§§≈≈≈.# ######..#..§§...≈.. .≈≈§§≈.≈...###.....≈..._.≈.≈....;dgge;dggjj;dggk;dgg u.r.Y§≈§≈;dggou'§.§§≈≈r   river rat (wandering).≈..§§_;dgg|vR21=4;dgg|~;_;dgg0;dggP|.....r..#....####.....######$.#######.......# ##.$###..>.#####.## ##..##.##.# #.# .. ##$...##.#####.######Y.###..##...........##..######.@##..## ........$..## §.§.§....### §≈§≈§≈≈≈.# ######..#.§.§§..≈.. ≈≈≈≈≈.≈...##..§§.≈....≈._.≈.... ≈..;dggj@.Y...§§..§.≈≈≈.......5;dggm;dgg.####.....######$.#######.......# ##.$###..>.#####.## ##..##.##.# #.# .. ##$...##.#####.######..###..##.........Y.##..######..##..## ...§§..@$..## ...§.....### ≈≈≈≈≈≈≈.# ######..#.......≈.. ≈≈≈≈≈.≈...##;dgg/.....≈.... _.≈.≈....#.# ;dgg;dgg0!.######.Y.........;dgg!&6;dgg<(;_;dggz+;dgg `######$.#######.......#..#  ##.$###..>.#####.##.# ..##.##.# #.# ...#$...##.#####.######..###..##.........#...##..###.######.Y##..## #.#........$..## #..### #.§≈≈≈≈≈≈≈.# ######..#.......≈.. ..#..≈≈≈≈≈.≈.###.≈.....≈.....≈._.≈.≈....#.≈..≈≈≈≈;dggm :_;dgg &7;dgg} ;_;dgg dgg>dggl>dggM)######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 21/51 =========---------------##$...##.#####.####. Magic: 6/6========================##..###..##......... AC: 6Str: 16>dgg#...##..###......... EV: 11Int: 11######.Y##..## #........# SH: 0Dex: 12........$..## #......... XL:  6 Next: 96% Place: Dungeon:5........@### #......... Noise: ---------  Time: 3887.1 (0.0)§≈≈≈≈≈≈≈.# ######..#. r) +0 hand axe (venom).......≈....#. Zap: wand of flame (15).≈≈≈≈≈.≈...###.≈.....≈.....≈._.≈.≈....#Y   ice beast.≈..>dggy.≈.≈....#≈≈≈≈≈.≈....# _The quokka bites you but does no damage. _You kill the quokka! _The river rat twitches its whiskers. _The river rat is distracted by your dazzling golden aura. _You see here 5 gold pieces. _The sentinel's mark upon you fades away.>dgg>dggReally quaff the potion of lignification? Y - Yes  N - No>dgg/~ >dggc )######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 21/51 =========---------------##$...##.#####.####. Magic: 6/6========================##..###..##......... AC: 6Str: 16>dgg V#...##..###......... EV: 11Int: 11######.Y##..## #........# SH: 0Dex: 12........$..## #......... XL:  6 Next: 96% Place: Dungeon:5........@### #......... Noise: ---------  Time: 3887.1 (0.0)>dgg> X§≈≈≈≈≈≈≈.# ######..#. r) +0 hand axe (venom).......≈....#. Zap: wand of flame (15).≈≈≈≈≈.≈...###.≈.....≈....>dgg .≈._.≈.≈....#Y   ice beast.≈...≈.≈....#≈≈≈≈≈.≈....# >dgg _The quokka bites you but does no damage. _You kill the quokka! _The river rat twitches its whiskers. _The river rat is distracted by your dazzling golden aura. _You see here 5 gold pieces. _The sentinel's mark upon you fades away.>dggٞ .Y♣§>dgg r23633/76=>dgg8 23 2 8.1 (1Tree >dgg$ ;_>dgg L _You turn into a tree. Your roots penetrate the ground.?dgg g  You completely miss the ice beast.?dgg v o§o   orc§.  The ice beast hits you but does no damage.  An orc comes into view. It is wielding a +0 hand axe.?dggB 5=9.2 (1.1?dgg| ;_?dggX @ _The ice beast hits you but does no damage.?dgg% ;  You hit the ice beast.?dgg# F  The ice beast is lightly wounded.?dggK m.§§§§§§§.≈....≈.?dgg _.≈.≈....≈.≈.§.?dgg )90.3?dggB ;_?dgg @ _The ice beast hits you but does no damage.?dggA  You closely miss the ice beast.The ice beast is lightly wounded.@dggo≈.≈...≈_.≈.≈...≈.≈o   orc.≈@dggT4=1.4@dgg_ ;_@dgg@ _The ice beast hits you but does no damage.@dggm  You hit the ice beast. The ice beast is poisoned.  The ice beast is lightly wounded.@dgg{{.o§.....≈..(very poisoned)...≈.≈..@dgg-J26--2.5@dgg}@dggT _The ice beast hits you. The ice beast freezes you. You resist.@dgg  You completely miss the ice beast.The ice beast is lightly wounded.@dgg?.o.§§≈..§§.≈.§§§_@dgg,(3.6@dgg@dgg\@ _The ice beast hits you but does no damage.@dgg=..§§≈≈≈≈.§§§.§..≈.._ .  The ice beast is lightly wounded. _hits you but does no damage.  You hit the ice beast.  The ice beast is moderately wounded.You closely miss the orc.  @dggS7--4.7@dgg&;_@dgg: _The orc hits you but does no damage.@dggT M#§.§....§≈§§...§§§_§  _The orc hits you but does no damage.  @dgg׈ TYou barely miss the ice beast.bar@dgge (5.8@dgg ;_@dgg! : _The orc hits you but does no damage.@dggO?#...≈≈≈.≈≈≈_  The ice beast hits you but does no damage. _The orc hits you but does no damage.  You hit the ice beast.  @dgg6PThe ice beast is heavily wounded.You hit the orc.  The ice beast hits you but does no damage.@dggP(6.9@dggY@dgg]: _The orc hits you but does no damage.AdggM_.≈.§   orc (very poisoned)The ice beast hits you but does no damage.  The ice beast is severely wounded.The orc is poisoned.AdggB88.0Adggv;_Adgg: _The orc hits you but does no damage.Adgg§§§_.≈§≈§ very poisoned)§§..§.slash the ice beast! The ice beast looks even sicker.almost dead.  You hit the orc but do no damage.  The orc barely misses you.Adgg~-9.2 (1.2Adgg;_Adggŏ@ _The ice beast hits you but does no damage.AdggBH  You hit the ice beast but do no damage.The ice beast is almost dead.You hit the orc but do no damage. The orc looks as sick as possible!AdgglOAdggaq$$§§§§...§§§.§....§§.§....≈§§§Adgg_cAdggj######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Draconian of Gozag  Gold: 236 Adggj##..##.##.# #.# ... Health: 29/78 ========----------------##$...##.#####.####. Magic: 6/6========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11Adgg&k ######..##..## #........# SH: 0Dex: 12AdggMkC.......$$..## #......... XL:  6 Next: 135% Place: Dungeon:5AdggqkI......§.♣### #......... Noise: =--------  Time: 3900.4 (1.2)Adggk§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom).....§§§....#. Zap: wand of flame (15)Adggk.≈≈≈≈≈.§.§.### Tree .≈....§§.§...≈._.≈§≈§...#AdgglX.≈...≈§§§...#≈≈≈≈≈.§....#The orc barely misses you. _The ice beast hits you but does no damage.  You hit the ice beast but do no damage.Adgg@lThe ice beast is almost dead.You hit the orc but do no damage. The orc looks as sick as possible! Adggjlj_You kill the orc! You kill the ice beast!Adggm  You hit the ice beast but do no damage.The ice beast is almost dead. Adggm5 You hit the orc but do no damage. The orc looks as sick as possible! _You kill the orc! You kill the ice beast!Your Stealth skill increases to level 3!You have reached level 7!Adggx/  --more--Bdgg 78%  Your scales start taking on a rich purple colour.Bdgg/  --more--CdggnCdgg######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Purple Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 33/87 =========---------------##$...##.#####.####. Magic: 7/7========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11######..##..## #........# SH: 0Dex: 12.......$$..## #......... XL: dgg m 7 Next: 18% Place: Dungeon:5......§.♣### #......... Noise: =--------  Time: 3900.4 (1.2)§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom).....§§§....#. Zap: wand of flame (15).≈≈≈≈≈.§.§.### Tree Breath+ .≈....§§.§...≈._.≈§≈§...#.≈...≈§§§...#≈≈≈≈≈.§....#You hit the orc but do no damage. The orc looks as sick as possible! _You kill the orc! You kill the ice beast!Your Stealth skill increases to level 3!You have reached level 7!Cdgg8Your scales start taking on a rich purple colour.You learn Spellcasting much quicker. You learn Hexes much quicker.Cdgg? _You kill the orc! You kill the ice beast!r Stealth skill increases to level 3! have reached level 7!r scales start taking on a rich purple colour.  CdggyYou learn Spellcasting much quicker. You learn Hexes much quicker.You learn Evocations quicker. You can breathe blasts of antimagic.Cdgg&;_Cdgg<a _You feel strong-willed.Edgg&`_Edgg ,;_Edgge/F _Unknown command.Fdgg Spells (Memorise)TypeFailure Level  a - ShockConjuration/Air34% 1b - Momentum StrikeConjuration/Translocation 47% 2  c - Maxwell's Portable Piledriver Translocation71% 3  d - SwiftnessAir71% 3  e - Tukima's DanceHexes71% 3  f - AirstrikeAir98% 4  g - Passage of GolubriaTranslocation98% 4  h - Yara's Violent Unravelling Hexes/Alchemy100% 5  i - DispersalTranslocation100% 6 6 spell levels left [!] Memorise|Describe|Hide|Show [Ctrl-F] search [?] help[Esc] exitIdgg Idgg IdggI ######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Purple Draconian of Gozag  Gold: 236 Idgg ##..##.##.# #.# ... Health: 33/87 =========---------------##$...##.#####.####. Magic: 7/7========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11Idgg N######..##..## #........# SH: 0Dex: 12.......$$..## #......... XL:  7 Next: 18% Place: Dungeon:5Idgg3 I......§.♣### #......... Noise: =--------  Time: 3900.4 (0.0)IdggQ :§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom).....§§§..Idgg ..#. Zap: wand of flame (15).≈≈≈≈≈.§.§.### Tree Breath+ .≈....§§.§..Idgg̲ .≈._.≈§≈§...#.≈...≈§§§...#Idgg r≈≈≈≈≈.§....#You have reached level 7!Idgg 8Your scales start taking on a rich purple colour.Idgg* You learn Spellcasting much quicker. You learn Hexes much quicker.You learn Evocations quicker. You can breathe blasts of antimagic. _You feel strong-willed. IdggC 9_Unknown command.Idggۺ v _Okay, then.Idgg߻ Idgg ;_Idgg . _Ldgg'Ldgg+  Skill  Level Cost  Apt Skill  Level Cost  Apt a + Fighting3.6   3.4  +1   j - Spellcasting   0.0   0.8  +1          Ldgg, b - Maces & Flails   3.0   2.0   0       c * Axes   4.1   4.0   0   k - Evocations   4.4   4.2  +1   d - Polearms   2.2   1.0   0       e - Staves   0.9   1.0   0       f - Unarmed Combat   0.0   1.0   0       g - Throwing   0.0   1.2  -1      dgg-0m                h + Dodging3.5   4.8  -1      i + Stealth3.0   4.0   0                                              The relative cost of raising each skill is in cyan.  Skills enhanced by cross-trLdgg-.9aining are in green.  [?] Help[=] set a skill target  [/] auto|manual mode [*] useful|all skills [_] enhanced|base level  [!] training|cost|targetsOdggW Odgg2b ######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Purple Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 33/87 =========---------------##$...##.#####.####. Magic: 7/7========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11######..##..## #........# SH: 0Dex: 12.......$$..## #......... XL: dgg_c m 7 Next: 18% Place: Dungeon:5......§.♣### #......... Noise: =--------  Time: 3900.4 (0.0)§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom).....§§§....#. Zap: wand of flame (15).≈≈≈≈≈.§.§.### Tree Breath+ .≈....§§.§...≈._.≈§≈§...#.≈...≈§§§...#≈≈≈≈≈.§....#Your scales start taking on a rich purple colour.You learn Spellcasting much quicker. You learn Hexes much quicker.You learn Evocations quicker. You can breathe blasts of antimagic. _You feel strong-willed. _Unknown command. _Okay, then._Odggc Odggh ;_Odggj Odgg :_OdggY Odgg Odgg5 F _Unknown command.PdggvPdggny Spells (Memorise)TypeFailure Level  a - ShockConjuration/Air34% 1b - Momentum StrikePdggyConjuration/Translocation 47% 2  c - Maxwell's Portable Piledriver Translocation71% 3  d - SwiftnessAir71% 3  e - Tukima's DanceHexes71% 3  f - AirstrikeAirPdgg z98% 4  g - Passage of GolubriaTranslocation98% 4  Pdgg[zh - Yara's Violent Unravelling Hexes/Alchemy100% 5  i - DispersalTranslocation100% 6 Pdggz6 spell levels left [!] Memorise|Describe|Hide|Show [Ctrl-F] search [?] help[Esc] exitQdgg\ Qdgg B######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Purple Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 33/87 =========---------------Qdgg+ ##$...##.#####.####. Magic: 7/7========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11######..##..## #........# SH: 0Qdggl pDex: 12.......$$..## #......... XL:  7 Next: 18% Place: Dungeon:5Qdgg &......§.♣### #......... Noise: =--------  Time: 3900.4 (0.0)§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom)Qdgg X.....§§§....#. Zap: wand of flame (15).≈≈≈≈≈.§.§.### Tree Breath+ .≈....§§.§...≈._.≈§≈§...#.≈...≈§§§...#≈≈≈≈≈.§....#Qdgg^ @You learn Spellcasting much quicker. You learn Hexes much quicker.You learn Evocations quicker. You can breathe blasts of antimagic. _You feel strong-willed. _Unknown command. Qdgg M_Okay, then. _Unknown command.Qdgg P  Okay, then.Qdgg Qdgg C_Qdgg . _Rdggp l[?25h[?0c  Search for what [Enter for "axe", or ? for help]? Sdgg [?25l[?1cSdgg0 Sdgg1 5 matches: travel [toggle: !], by dist [/], hide useless & duplicates [=]  a - [D:4] a +0 dagger (6 further duplicates)b - [D:3] a +0 short sword (2 further duplicates)  c - [D:3] a +1 short sword of drainingd - [D:2] a dagger (60 gold) Sdggu N e - [D:2] a runed rapier (210 gold)VdggVdgg@Vdgg"######$.#######.......#..# ssays the Charlatan##.$###..>.#####.##.# Purple Draconian of Gozag  Gold: 236 ##..##.##.# #.# ... Health: 33/87 =========---------------##$...##.#####.####. Magic: 7/7========================##..###..##......... AC: 23Str: 16#...##..###......... EV:  2 Int: 11######..##..## #........# SH: 0Dex: 12Vdgg, .......$$..## #......... XL:  7 Next: 18% Place: Dungeon:5......§.♣### #......... Noise: =--------  Time: 3900.4 (0.0)§≈≈≈≈§§§.# ######..#. r) +0 hand axe (venom).....§§§....#. Zap: wand of flame (15).≈≈≈≈≈.§.§.### Tree Breath+ .≈....§§.§...≈._.≈§≈§...#.≈...≈§§§...#≈≈≈≈≈.§....# _You feel strong-willed. _Unknown command. _Okay, then. _Unknown command. _Okay, then.Search for what [Enter for "axe", or ? for help]? shortVdgg&Vdggp'Vdgg-C_Vdgg0. _VdggVVdggVdgg2;_VdggF _Unknown command.VdggB Vdgg Vdgg Vdgg Vdgg % _Vdgg Vdgg Vdgg VdggS Vdgg Vdgg 84Vdgg Vdgg ,Vdgg Vdggh ,Vdgg Vdgg2 Vdgg 85Vdgg Vdgg( Vdgg 2 @r.-≈≈.....≈≈§.....§≈..._.≈§§.r   river rat (wandering)...≈.§..≈.Vdgg; 6.4 (6§§§..§§.§...≈.Vdggg< E-7.4 (7VdggD VdggG \ _A river rat comes into view.Wdgg>@ $  ##.$###..>.#  ##r.##.##.# #.#  ##$...##.# ##..###..# #...##..# ######..##..##  .......$$..##  ........♣###  Wdgg3/§≈≈≈≈≈≈§.#  .......≈§§  .§... ###  .≈.....§§...  .≈._.≈.§....#  .≈...≈.§....#  ...# Wdggs $  ##.$###..>.#  ##r.##.##.# #.#  ##$...##.# ##..###..# #...##..# ######..##..##  Wdggtm.......$$..##  ........♣###  §≈≈≈≈≈≈§.#  .......≈§§  .§... ###  .≈.....§§... .≈._.≈.§....#  .≈...≈.§....# ...# Wdgg||:_Wdgg}Wdgg;_Wdgg ` _A river rat is nearby!Wdgg+4WdggC_Wdgg^ _You are too injured to fight recklessly!Wdgg Wdggǭ .r..≈≈._.≈.≈.§≈§§≈§.≈.Wdgg 28.4 (1 _Wdgg Wdgg Xdgg,Xdgg u$§§§_.≈.≈§.≈.§≈≈≈369Xdgg(Xdgg*Xdgg.._.≈.≈..§§Xdgg'10Xdgg@XdggXdgg$Xdgg0r.≈_r   river rat (wandering)..Xdgg132361Xdgg49;_Xdgg <Xdgg1 Xdgg? r  Your transformation is almost over.XdggE Yh.r≈§h   hound (wandering)r   river rat (wandering)XdggbH 7=2Tree Xdgg{Q ;_XdggU X _A hound comes into view.Xdggk Xdgg Xdgg  $hr_hr§The river rat squeaks loudly. The hound barks!Xdgg/ h33-====3Xdgg6$ ;_Xdggd' . _The river rat bites you.Xdgg B_Xdggg XdggI ;_Xdggt ^ _You are too injured to fight recklessly!YdgglX_Ydgg_ _You are too injured to fight recklessly!Ydggd4YdgglYdgg3p^ _You are too injured to fight recklessly!YdggX_YdggYdgg^ _You are too injured to fight recklessly!Ydgg#$ Ydgg$ Ydgg- Ydgg1 F _Unknown command.Ydgg X_Ydgg[ Ydgg ^ _You are too injured to fight recklessly!ZdggX_ZdggjZdggr!^ _You are too injured to fight recklessly!Zdgg ZdggW ' $h§_(poisoned)≈≈≈≈§You hit the river rat but do no damage. The river rat is poisoned.Zdgg| b=---4.5 (1.1Zdgg Zdgg A _The river rat bites you but does no damage.Zdgg. Zdggg Zdgg} .h.§§You barely miss the river rat.ZdggD ^4----5.6Zdgg ;_Zdgg1 A _The river rat bites you but does no damage.Zdggl6Zdgg=  You hit the river rat but do no damage. The river rat looks even sicker.[dggK r.h.§§§§§§§_§r 2 river rats (1 wandering, 1 very poi…)§≈≈≈≈.≈.  The river rat bites you but does no damage.[dgg(6.7[dgg[dggs= _The hound bites you but does no damage.[dgg!  squeaks loudly.hit the river rat but do no damage.  looks as sick as possible!closely miss the hound.  You hear a loud squeak. x2  [dggR$r§_.≈.≈§rextremely poisoned)≈§≈≈≈§[dggJ5=7.8[dggC_[dgg[dgg/  --more--[dgg99 _bites you but does no damage.\dggYou hit the hound. The hound is poisoned.  The hound is heavily wounded.You barely miss the river rat. The hound bites you but does no damage.\dggm.r§§≈§.§≈§_ (very poisoned)≈.§§§\dggѝR1--8.9\dgg}\dgg N _The river rat bites you. The hound bites you but does no damage.\dgg?C  You hit the hound. The hound looks as sick as possible!  The hound is almost dead.You hit the river rat but do no damage.The river rat looks as sick as possible!\dgg IX  You kill the hound!\dggeJ\dggTX` S$$..§§§≈§..§.≈≈≈.§§._S   water moccasin (wandering)   river rat (≈≈≈≈≈.  The river rat bites you but does no damage.\dggWZ236 -23-20.0\dgg|e/  --more--\dggKy _A water moccasin comes into view.\dggT;_\dggY] _Your Axes skill increases to level 4!]dggF  The water moccasin hisses angrily.  You hit the river rat.  The river rat looks as sick as possible!  The river rat is moderately wounded.You feel less wooden.]dgg]dgg&E.Sr@§§.Sr 2 river rats (1 extremely poisoned)§]dgg@a21/58 612 1.1]dgg]dggZ _The river rat completely misses you.]dggk  You hit the river rat.  The river rat looks as sick as possible!]dggq  The river rat is severely wounded.]dgg]dgg?...##Sr§......≈≈≈≈≈≈.....≈..≈≈≈≈.≈.§._]dgg!(2.2]dggK;_]dgg W _The river rat closely misses you.]dggM;  You hit the river rat.]dgg]dggP]dggQ..##S$r.§.§§   river rat§≈§]dgg+`2=530]dgg]dggOM _You kill the river rat!^dgg, #.........# #.####.....#######$.#######.......#..#.$###..>.#####.##.##..##.##.# #.# . ##$...##.#####.#### ##..###..## #...##..###. ######..##S.## # §.r..## # §.§......### #....... ≈§≈≈≈≈≈≈.# ######..# §§.....≈ ..# .≈≈≈≈≈.≈### .≈.....≈.... .≈._.≈.≈....#[16;^dggU-10H.≈...≈.§§...#≈≈≈≈≈§≈§...#^dgg/^dggQ;   $.###### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...##..# ######..##..##  ^dgg</§......@rS.##  §.§......###  ≈§.#  §§.....≈..  .≈≈≈≈≈.≈...  .≈.....≈....  .≈._.≈.≈....#  .≈...≈.§§...#   ^dggK   $.###### ##.$###..> ^dgg##..##.##.# #.#  ##$.. ##..# #...##..# ######..##..##  §......@rS.##  §.§......###  ≈§.#  §§.....≈..  .≈≈≈≈≈.≈...  .≈.....≈....  .≈._.≈.≈....#  .≈...≈.§§...# ^dggY=  The river rat bites you.^dgg}..§.........S§≈.^dgg5H16---4^dgg'^dgg/- _* * * LOW HITPOINT WARNING * * *Things that are here: _44 gold pieces; a +0 hand axe_dgg_dgg|Drink which item? Potions  f - 2 silvery potionsg - 2 potions of ambrosia  k - a viscous coppery potion  l - a sedimented amethyst potion  m - a potion of lignification  o - a bubbling silvery potion  p - a white potion  q - a lumpy emerald potion _dgg[!] read|quaff|evoke[?] describe selected`dgg`-`dgg/`dgg3`dgg9#.........# #.####.....# ssays the Charlatan######$.#######.......#..# Purple Draconian of Gozag  Gold: 236 ##.$###..>.#####.##.# Health: 16/58 ======------------------##..##.##.# #.# .. Magic: 7/7========================##$...##.#####.#### AC: 6Str: 16##..###..##........ EV: 12Int: 11#...##..###........ SH: 0Dex: 12######..##..## #........ XL:  7 Next: 25% Place: Dungeon:5`dggR:.§.....@r..## #........ Noise: =--------  Time: 3924.2 (0.0)........S### #........ r) +0 hand axe (venom)§≈≈≈≈≈≈≈.# ######..# Zap: wand of flame (15)§......≈....# Breath+ .≈≈≈≈≈.≈...###.≈.....≈....S   water moccasin.≈._.≈.≈....#r   river rat.≈...≈.§§...#≈≈≈≈≈§≈§...#You hit the river rat. _You kill the river rat!The river rat bites you. _* * * LOW HITPOINT WARNING * * *Things that are here: _44 gold pieces; a +0 hand axe`dggDQ    $.###### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...##..# ######..##..##  .§.....@r..##  ........S###  `dgghE§.#  §......≈..  .≈≈≈≈≈.≈...  .≈.....≈....  .≈._.≈.≈....#  .≈...≈.§§...#   You are confused.`dgg   $.###### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...##..# ######..##..##  `dgg<.§.....@r..##  ........S###  §.#  §......≈..  .≈≈≈≈≈.≈...  .≈.....≈....  .≈._.≈.≈....#  `dgg.≈...≈.§§...# `dggy'# .≈≈≈≈≈§.§§§You feel invigorated. The river rat bites you.  * * * LOW HITPOINT WARNING * * *`dgg-+4-5.2 (1wand of flame (15)Conf Ambros Breath+ `dgg.`dgg2T _The water moccasin misses you.adggm   $.###### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...##..# ######..##..##  .......@r..##  ........S###  ≈≈≈≈≈§≈≈.#  .......≈..  §≈≈≈≈≈.≈...  adggn.≈.....≈....  .≈._.≈.≈....# (very poisoned) .≈...§§§§...#   You hit the river rat. The river rat is poisoned.  You tail-slap the river rat, but do no damage.The river rat is lightly wounded.  You barely miss the water moccasin. The water moccasin bites you.  You are poisoned.  The water moccasin poisons you! The river rat closely misses you.adggC3   $.###### ##.$###..> ##..##.##.# #.#  ##$..adggD ##..# #...##..# ######..##..##  .......@r..##  ........S###  ≈≈≈≈≈§≈≈.#  .......≈..  §≈≈≈≈≈.≈...  .≈.....≈....  .≈._.≈.≈....#  .≈...§§§§...#adggE adgg+FC6======adggQFbPois Ambros Breath+ adggP/  --more--adggT 6 §§§≈.≈.  The water moccasin bites you.  * * * LOW HITPOINT WARNING * * *  You are lethally poisoned!adggqU S6Pois adgg\ adgg_ - _The water moccasin poisons you!bdgg r..##..##...........# #.####...######$.#######.......#.bdggi##.$###..>.#####.##.###..##.##.# #.# ..##$...##.#####.#####..###.. #...##..########.@##..##$r..##........S### #........≈≈≈≈§§≈≈.# ######.......≈.. ..§≈≈≈≈≈.≈... ###....≈.... _.§#.≈..§≈.≈.bdgg     $.####### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...# ######.@##..##  .......$r..##  ........S###  ≈≈≈≈§§≈≈.#  .......≈..  §≈≈≈≈≈.≈...  .≈.....≈....  .≈._.§.≈....#   bdgg)     $.####### ##.$###..> ##..##.##.# #.#  ##$.. ##..# #...# ######.@##..##  .......$r..##  ........S###  ≈≈≈≈§§≈≈.#  .......≈..  §≈≈≈≈≈.≈...  .≈.....≈....  bdgg!.≈._.§.≈.... bdgg9}* * * LOW HITPOINT WARNING * * *You feel very sick.bdgg' S.§§≈≈≈.≈The river rat bites you but does no damage.  The water moccasin attacks as it pursues you!bdgg@57bdgg bdgg _ _The water moccasin completely misses you.bdggk  #.....r...# #...##..## #.# #.####..... ######$.#######.......#.. ##.$###..>.#####.##. ##..##.##.# #.#  ##$...##.#####. ##..###..## #...##..### ######@.##..## #.Sr..## #.### #≈§§≈§.# ######..§.§.. ..§≈≈≈≈≈.≈... bdgg$ §.≈.....≈....≈.≈._.≈.≈....#  .≈..§≈.≈....#bdgg      $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #...# ######@.##..##  bdgg ........Sr..##  ..........###  ≈≈≈≈≈§§≈§.#  §.......§..  §§≈≈≈≈≈.≈...  §.≈.....≈....  ≈.≈._.≈.≈....#   bdggq      $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #...# ######@.##..##  ........Sr..##  ..........###  ≈≈≈≈≈§§≈§.#  §.......§.. bdggP  §§≈≈≈≈≈.≈...  §.≈.....≈....  ≈.≈._.≈.≈....# bdgg       $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #...# ######@.##..##  ........Sr..##  ..........###  ≈≈≈≈≈§§≈§.#  §.......§..  §§≈≈≈≈≈.≈...  bdgg §.≈.....≈....  ≈.≈._.≈.≈....#   * * * LOW HITPOINT WARNING * * *You feel very sick.bdggi ]     $##. ##.$###..> ##..##.##.# #.#  ##$... ##..#bdggz  #...# ######@.##..##  ........Sr..##  ..........###  ≈≈≈≈≈§§≈§.#  §.......§..  §§≈≈≈≈≈.≈...  §.≈.....≈....  ≈.≈._.≈.≈....# bdgg# B  The water moccasin bites you.bdgg 3r$§§≈≈.....§§.§≈.≈._bdggV H3-8bdggk bdgg6 V _* * * LOW HITPOINT WARNING * * *cdgg4:_cdgg8-cdgg;_cdgguF _Unknown command.cdgg       $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #...# ######@r##..##  ........S$..##  .....§§...###  ≈≈≈≈≈§≈≈§.#  ≈.....§§§..  cdgg L.§≈≈≈≈≈.§...  ≈.≈.....≈....  ≈.≈._.≈.≈....#   You hit the water moccasin.  The water moccasin is lightly wounded.cdggt '     $##. ##.$###..> ##..##.##.# #.#  ##$... cdgg8v ##..# #...# ######@r##..##  ........S$..##  .....§§...###  ≈≈≈≈≈§≈≈§.#  ≈.....§§§..  .§≈≈≈≈≈.§...  ≈.≈.....≈....  ≈.≈._.≈.≈....# cdgg X2-You hit the water moccasin.is lightly wounded.  You miss the river rat.  * * * LOW HITPOINT WARNING * * *You feel very sick.bites you but does no damage.cdgg܌ /  --more--ddggѝ ....._The river rat barely misses you.ddggҞ G-9.3 (1.1ddgg ;_ddggƩ > _The water moccasin bites you but does no damage.ddggd ddgg3# Drink which item? Potions  f - 2 silvery potionsg - a potion of ambrosia ddggv#  k - a viscous coppery potion  l - a sedimented amethyst potion  m - a potion of lignification  o - a bubbling silvery potion  p - a white potion ddgg# q - a lumpy emerald potion [!] read|quaff|evokeddgg# G[?] describe selectedgdgg?gdgg3gdgg #.....r...# #...##..##. ssays the Charlatan#.........# #.####..... Purple Draconian of Gozag  Gold: 236 ######$.#######.......#.. Health: 12/58 ====--------------------##.$###..>.#####.##. Magic: 7/7========================##..##.##.# #.# . AC: 6Str: 16gdgg ##$...##.#####.### EV: 12Int: 11##..###..##....... SH: 0Dex: 12#...##..###....... XL:  7 Next: 25% Place: Dungeon:5######@r##..## #....... Noise: =--------  Time: 3929.3 (0.0)........S$..## #....... r) +0 hand axe (venom)..........### #....... Zap: wand of flame (15)≈≈≈≈≈§≈≈§.# ######.. Conf Pois Ambros Breath+ ≈......§§......≈≈≈≈≈.§...## S   water moccasingdgg ≈.≈.....≈....r   river rat (very poisoned)≈.≈._.≈.≈....#.≈..§≈.≈....#gdgg mThe river rat barely misses you. _The water moccasin bites you but does no damage.gdgggdgg'$gdgg^Really quaff the potion of lignification? Y - Yes  N - Nogdgg gdgg #.....r...# #...##..##. ssays the Charlatan#.........# #.####..... Purple Draconian of Gozag  Gold: 236 ######$.#######.......#.. Health: 12/58 ====--------------------gdgg ##.$###..>.#####.##. Magic: 7/7========================##..##.##.# #.# . AC: 6Str: 16##$...##.#####.### EV: 12Int: 11##..###..##....... SH: 0Dex: 12#...##..###....... XL:  7 Next: 25% Place: Dungeon:5######♣r##..## #....... Noise: =--------  Time: 3929.3 (0.0)........S$..## #....... r) +0 hand axe (venom)..........### #....... Zap: wand of flame (15)≈≈≈§≈≈≈≈§.# ######.. dgg @0mConf Pois Ambros Breath+ ≈.......≈......≈≈≈≈≈§≈...## S   water moccasin≈.≈.....≈....r   river rat (very poisoned)≈.≈._.≈.≈....#.≈..§≈.≈....# _The water moccasin bites you but does no damage.  You turn into a tree. Your roots penetrate the ground.  You feel less invigorated.  gdggD You feel less confused.You feel very sick.The river rat bites you but does no damage.gdgg 20/87 =====23 2 30.3 (1wand of flame (15)gdggN JPois Tree gdgg] gdgg  You turn into a tree. Your roots penetrate the ground.feel less invigorated.  You feel less confused.  You feel very sick.  gdgg The river rat bites you but does no damage. _The water moccasin barely misses you.hdggeshdggGvdDrink which item? Potions  f - 2 silvery potionsg - a potion of ambrosia  k - a viscous coppery potion  l - a sedimented amethyst potion  o - a bubbling silvery potion  p - a white potion hdggv q - a lumpy emerald potion [!] read|quaff|evoke[?] describe selectedidgg idgg idgg #.....r...# #...##..##. ssays the Charlatan#.........# #.####..... Purple Draconian of Gozag  Gold: 236 ######$.#######.......#.. Health: 20/87 =====-------------------##.$###..>.#####.##. Magic: 7/7========================##..##.##.# #.# . AC: 23Str: 16##$...##.#####.### EV:  2 Int: 11idgg ##..###..##....... SH: 0Dex: 12#...##..###....... XL:  7 Next: 25% Place: Dungeon:5######♣r##..## #....... Noise: =--------  Time: 3930.3 (0.0)........S$..## #....... r) +0 hand axe (venom)..........### #....... Zap: wand of flame (15)≈≈≈§≈≈≈≈§.# ######.. Pois Tree Breath+ ≈.......≈......≈≈≈≈≈§≈...## S   water moccasin≈.≈.....≈....r   river rat (very poisoned)idgg[ N≈.≈._.≈.≈....#.≈..§≈.≈....#You turn into a tree. Your roots penetrate the ground.  You feel less invigorated.  You feel less confused.You feel very sick.The river rat bites you but does no damage. _The water moccasin barely misses you.idgg"  It was a potion of magic. Magic courses through your body.  You feel very sick.The water moccasin bites you but does no damage.idgg-3 w r§§. r   quokka (wandering)The river rat bites you but does no damage.  idgg3 CA quokka comes into view.idgg!4 N18-1.3 (1idgg< idgg@ [ _The water moccasin barely misses you.jdggB_jdgg8-jdgg;_jdggF _Unknown command.kdgg  You slash the river rat!  The river rat is almost dead.kdgg      $##. ##.$###..> ##..##.##.# #.#  ##r... ##..# #...# ######♣r##..##  ........S$..##  ...§......###  ≈≈≈§≈≈≈≈§.#  kdgg2;≈...§...≈..  ..≈≈≈≈≈.≈...  ≈.≈.....≈....   ≈.≈._.≈.≈....#  r  You hit the water moccasin. You feel sick. The river rat barely misses you.The water moccasin bites you but does no damage.kdgg`      $##. ##.$###..> ##..##.##.# #.#  ##r... ##..# #...# ######♣r##..##  ........S$..##  ...§......###  ≈≈≈§≈≈≈≈§.#  ≈...§...≈..  ..≈≈≈≈≈.≈...  ≈.≈.....≈....  ≈.≈._.≈.≈....#  kdggM .r≈§._The river rat bites you.kdggB~4=-=2.4 (1.1kdggH;_kdgg V _* * * LOW HITPOINT WARNING * * *kdgg  You completely miss the river rat.The river rat is almost dead.You hit the water moccasin. The water moccasin is poisoned. You feel sick.kdggݓ\  You kill the river rat!kdgg u      $##. ##.$###..> ##..##.##.# #.#  ##$... ##r.# #...# ######♣$##..##  ........S$..##  ...§......###  ≈≈≈≈§≈≈≈§.# kdgg+ ≈.......≈..  ..≈≈≈≈≈.≈... (poisoned) ≈.≈.....≈....  r   quokka ≈.≈._.≈.≈....#  The water moccasin bites you but does no damage.kdggrT     $##. ##.$###..> ##..##.##.# #.#  ##$... ##r.# #...# ######♣$##..##  kdgg"t........S$..##  ...§......###  ≈≈≈≈§≈≈≈§.#  ≈.......≈..  ..≈≈≈≈≈.≈...  ≈.≈.....≈....  ≈.≈._.≈.≈....# kdggxB  The water moccasin bites you.kdggh.r§.§§≈≈≈_kdgg-9/87 =--7-3.5Pois kdgg`;_kdgg@--kdgg/  --more--ldgg-W _* * * LOW HITPOINT WARNING * * *ldggPYou hit the water moccasin.  The water moccasin is moderately wounded.You hit the quokka. The quokka is poisoned. You feel sick.ldggO[$..§.§...§≈≈≈§§≈≈≈§   You kill the quokka!ldgg084.6ldggC_ldgg> _The water moccasin bites you but does no damage.ldggS      $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #$..# ######♣$##..##  .....§..S$..##  ldggT .....§...§###  ≈≈≈≈≈§§≈≈.#  ≈......§≈..  ..≈≈≈≈≈.≈...  ≈.≈.....≈....  ≈.≈._.≈.≈....#    You kill the quokka! _The water moccasin bites you but does no damage.  You barely miss the water moccasin.  The water moccasin is moderately wounded.  You feel sick.  ldgg* R     $##. ##.$###..> ##..##.##.# #.#  ##$... ##..# #$..# ######♣$##..##  .....§..S$..##  .....§...§###  ≈≈≈≈≈§§≈≈.#  ≈......§≈..  ldgg, ..≈≈≈≈≈.≈...  ≈.≈.....≈.... ≈.≈._.≈.≈....# ldgg5 ......§§§......§§The water moccasin bites you!ldggA6 K1--5.7ldggn6 -Pois ldggT< ldgg? V _* * * LOW HITPOINT WARNING * * *mdgg׿mdgg?@Drink which item? Potions  f - 2 silvery potionsg - a potion of ambrosia  l - a sedimented amethyst potion  o - a bubbling silvery potion  p - a white potion  q - a lumpy emerald potion [!] read|quaff|evoke[?] describe selectedndgg0 ndggY ndgg S#.....r...# #...##..##. ssays the Charlatan#.........# #.####..... Purple Draconian of Gozag  Gold: 236 ######$.#######.......#.. Health: 1/87------------------------##.$###..>.#####.##. Magic: 7/7========================##..##.##.# #.# . AC: 23Str: 16##$...##.#####.### EV:  2 Int: 11##..###..##....... SH: 0Dex: 12#$..##..###....... XL:  7 Next: 28% Place: Dungeon:5ndgg ######♣$##..## #....... Noise: =--------  Time: 3935.7 (0.0)........S$..## #....... r) +0 hand axe (venom)..........### #....... Zap: wand of flame (15)§§≈≈≈§§≈≈.# ######.. Pois Tree Breath+ ≈§......≈....§§≈≈≈≈≈.≈...## S   water moccasin (poisoned)≈.≈.....≈....≈.≈._.≈.≈....#.≈..§≈.≈....#You barely miss the water moccasin.The water moccasin is moderately wounded.You feel sick.  The water moccasin bites you but does no damage.  The water moccasin bites you! _* * * LOW HITPOINT WARNING * * *ndgg{ _The water moccasin bites you! _* * * LOW HITPOINT WARNING * * *  It was a potion of might.  You feel very mighty all of a sudden.  You die...  Your body crumbles into a pile of gold.ndggO0Might Pois Tree Breath+ ndggp`/  --more--odgg( odggj Inventory: 21/52 slots Hand Weapons (go to first with ))  r - a +0 hand axe of venom (weapon)a - a +0 club  e - a +0 mace Missiles (go to first with ()n - 12 poisoned darts odgg ?Jewellery (go to first with "=)  j - a ring of protection from cold (left branch) Wands (go to first with /)b - a wand of flame (15) (quivered)  c - a wand of charming (15)  d - a wand of iceblast (5)  v - a wand of roots (10) Scrolls (go to first with ?)  h - a scroll of poison odggO  i - a scroll of teleportations - a scroll of identify  t - a scroll of fog  u - 2 scrolls of fear {unknown}w - a scroll of amnesia  x - a scroll of enchant weapon {unknown} Potions (go to first with !) odgg [Up|Down] select [PgDn|>] page down [PgUp|<] page up [Esc] exit[top]pdgg pdgg^ ,pdgg pdggGoodbye, ssays.649 ssays the Charlatan (level 7, 0/87 HPs)Began as a Purple Draconian Artificer on Dec 22, 2024.Was an Initiate of Gozag.Succumbed to a water moccasin's poison... on level 5 of the Dungeon.The game lasted 00:07:02 (3854 turns). Best Crawlers -1.59874334 freshwater VSCj-27 escaped with the Orb2.53115580 tswnHuSh-27 escaped with the Orbpdgg23.32457476 tswnTrRe-27 escaped with the Orb4.26687813 tswnSpSh-27 escaped with the Orb5.26460741 tswnMDHs-27 escaped with the Orb6.26319591 MollyMollu OpFi-27 escaped with the Orb7.25873036 tswnMDRe-27 escaped with the Orb8.25355277 MollyMollu OpFi-27 escaped with the Orb9.24699432 MollyMollu OpFi-27 escaped with the Orb  pdgg]10.23823169 MollyMollu OpFi-27 escaped with the Orb  11.23737872 oddsox OpCA-27 escaped with the Orb  12.23156942 tswnpdggVMDSh-26 escaped with the Orb  13.22614997 MollyMollu OpFi-27 escaped with the Orbpdgg6(pdgg/pdgg3? [?25h[?0c [?1051l[?1052l[?1060l[?1061l